JP2003511077A - Methods and compositions for cell targeting - Google Patents

Abstract

(57) [Summary] Oligomeric ligands such as cysteine knot growth factor can be displayed on the surface of virus particles as recombinant fusion proteins. Recombinant fusion proteins can be screened to obtain agents that inhibit the binding of oligomeric ligands to their receptors, and target transposable labels containing therapeutic gene products to cells with receptors specific for oligomeric ligands Can be used to

Description

Detailed Description of the Invention

TECHNICAL FIELD The present invention relates to the display of oligomeric ligands, especially growth factors, as recombinant fusion proteins on the surface of viruses.

BACKGROUND OF THE INVENTION Retroviruses and retroviral vectors can efficiently transfer genes into eukaryotic cells. Gene delivery is initiated by the retroviral envelope glycoprotein (Env), which mediates binding to cell surface receptors and subsequent virus-cell membrane fusion. The Env protein is a homo-oligomer containing 2-4 heterodimeric subunits (Doms et al., 1993).
). In the case of murine leukemia virus (MLV), the envelope protein is a homotrimer (Kamps et al., 1991). Each Env subunit has a large glycoprotein (SU) that mediates binding to cellular receptors and a small transmembrane component (TM) that results in fusion of the virus with the cell membrane. The C-terminus of SU is non-covalently linked to TM. 4070A (amphotropic) murine leukemia virus (MLV) Env
Interacts with PiT-2 cell receptors present on mouse and human cells (
Miller et al., 1994; Van Zeijl et al., 1994). On the other hand, Env of Moloney (ecotropic) MLV interacts with a CAT-1 cell receptor which is present in mouse cells but not in human cells (Albritto).
n et al., 1989). Therefore, a vector incorporating an amphotropic envelope protein can infect human cells but not an ecotropic virus.

Delivery of retroviral genes can be controlled by engineering retroviral envelope proteins. WO94 / 06920 discloses a method of fusing a non-viral polypeptide to the N-terminus of Env and thereby displaying it on the surface of viral particles. By using this method, the hapten (Ru
ssell et al., 1993), CD3 and four colon cancer cell antigens (Ager et al.,
Single-chain antibody fragments against 1996) have been displayed and are known to bind specifically to their antigen targets. However, gene delivery does not necessarily result from this interaction. Epidermal growth factor (EGF), stem cell factor (SCF) and insulin-like growth factor I (I) which are cell growth factors.
GF-I) is also well displayed (Cosset et al., 1995;
Fielding et al., 1998; Chadwick et al., 1999). Display of these ligands suppresses envelope receptor-mediated gene delivery when the ligand receptor is present on target cells. Gene delivery is impeded by binding the chimeric envelope to a ligand receptor that does not support viral entry and sequesters the virus from the viral receptor.

Gene delivery is also a “oligomer cap” on trimeric viral glycoproteins.
Can also be interfered with by the display of polypeptides that are capable of forming (WO960456; Morling et al., 1997). Oligomeric caps are formed by intermolecular association between heterologous polypeptides displayed on different Env subunits within the trimeric envelope glycoprotein (FIG. 1). CD40
The c-terminal extracellular domain of the ligand has been shown to form such oligomeric caps when displayed on a trimeric viral glycoprotein. CD
The 40 ligand is a homotrimer and therefore exhibits the same stoichiometric association with the envelope glycoprotein itself. The CD40 ligand binds to target cells by inhibiting the binding of Env to its receptor, and also by inhibiting subsequent fusion triggers that require dissociation of the trimeric Env into its subunits. Reduce envelope protein-mediated gene transfer. Display of the trimeric "leucine zipper" polypeptide shows a similar phenotype through the formation of "oligomer caps" (Morling et al., 1997). This study shows that the displayed oligomeric proteins can be detrimental to the incorporation of Env into vector particles. The effect is probably due to the rapid oligomerization of the displayed protein prior to Env folding within the endoplasmic reticulum.

Thus, gene delivery is hampered by two mechanisms: receptor-mediated sequestration and “envelope protein” blocking. This phenotypic reversal allows one of skill in the art to control the ability of the viral vector to infect a particular cell type. Such reversal can be done in two ways. First, in the case of viral display ligands, any reduction in available ligand-receptor binding sites will increase gene delivery as more chimeric Env will be able to bind to viral receptors. Typically, this can be achieved by adding an agonist such as the free ligand (Cosset et al., 1995; Fie.
Lding et al., 1998; Chadwick et al., 1999). Such a system can be used as a basis for tests to obtain substances that interact with ligand receptors (WO97 / 03357).

Second, gene delivery can be restored by removal of any displayed heterologous polypeptide. The displayed domain can be removed by protease degradation of a substrate sequence located between the displayed domain and Env. By utilizing this mechanism, a vector activated in the presence of a specific protease can be obtained (WO97 / 122048). Such vectors can be used in gene therapy protocols to target specific cell types, such as cancer cells, that express high levels of matrix methanolloproteinase.

A particular ligand that is conveniently used in display systems is an oligomer. For example, cysteine knot growth factor is biologically active as a dimer cross-linked by disulfide bonds (Sun & Davies, 1995). However, the display of oligomeric ligands presents problems not associated with the display of monomeric ligands, including reduced incorporation of chimeric envelope proteins into vector particles. Furthermore, since the displayed proteins are both ligands and oligomers, gene delivery can be undesirably impaired by both receptor-mediated sequestration and envelope protein blocking.

Thus, there is a need in the art for methods to display functional oligomeric ligands that allow these ligands to bind to specific cell surface receptors.

DISCLOSURE OF THE INVENTION It is an object of the present invention to provide a composition for displaying functional homo-oligomer ligands, and a screening test for a new drug, and a method for specifically delivering a desired substance to a target cell. In, a method of using the displayed homo-oligomeric ligand is provided. These and other objects of the invention will be made apparent by one or more of the embodiments described below.

In a first aspect, the present invention relates to a first aspect of the invention fused to one another via a peptide bond.
A recombinant fusion protein comprising a polypeptide of claim 1 and a second polypeptide, wherein the first polypeptide is self-assembled to form a homo-oligomeric ligand capable of binding to a receptor within a continuous polypeptide chain. Recombinant fusion protein comprising the first and second domains of. Preferably the second polypeptide is a dimer or trimer.

In a second aspect, the invention relates to a first aspect of the invention fused to one another via a peptide bond.
A recombinant fusion protein comprising a polypeptide of claim 1 and a second polypeptide, wherein the first polypeptide comprises first and second domains within a continuous polypeptide chain that self-associate to form an oligomeric ligand. And the domain comprises a disulfide-bonded growth factor, and the oligomeric ligand provides the recombinant fusion protein with the ability to bind to the receptor.

In a preferred embodiment of the first and second aspects of the invention, the second polypeptide has at least two subunits of cysteine knot growth factor. The second polypeptide typically has a substantially intact viral envelope protein that binds to cell surface receptors and mediates the fusion between the cell membrane and the viral membrane, ie, is substantially intact. The fusion is enhanced to be higher than the level of fusion that occurs in the absence of the viral envelope protein of. At least two subunits of the cysteine knot growth factor spontaneously associate to form a cysteine knot growth factor that binds to the cysteine knot growth factor receptor.

In another aspect, the invention provides a viral display package having a recombinant fusion protein comprising a first polypeptide and a second polypeptide fused to each other via a peptide bond. The first polypeptide comprises first and second domains within a contiguous polypeptide chain that self-associates to form a homo-oligomeric ligand capable of binding the receptor. Alternatively, the first and / or second domain comprises a disulfide-linked growth factor, and the first and second
Domains are continuous polypeptide chains, but they self-associate as oligomeric ligands.

In yet another aspect, the invention provides a library of viral display packages, each of the plurality of viral display packages having a recombinant fusion protein. The recombinant fusion protein has a first polypeptide and a second polypeptide fused to each other via a peptide bond. The first polypeptide is
A second polypeptide containing the first and second domains within a continuous polypeptide chain that self-associates to form a homo-oligomeric ligand capable of binding to the receptor is anchored to the retroviral membrane.

In another aspect, the invention provides an isolated polynucleotide encoding a recombinant fusion protein comprising a first polypeptide and a second polypeptide fused to each other via a peptide bond. . The first polypeptide is PDGF and V
It has at least two subunits of a cysteine knot growth factor with a characteristic PDGF-like family signature selected from the group consisting of EGF. The second polypeptide has a substantially intact viral envelope protein that enhances the fusion between the cell membrane and the viral membrane. The viral envelope protein is a mammalian type C retroviral envelope protein and can be selected from the group consisting of the 4070A envelope protein, the Moloney MLV envelope protein and the gibbons monkey leukemia virus envelope protein (GALV).

In another aspect, the invention provides a method of screening a test substance capable of modulating the binding of a homo-oligomeric ligand to a receptor, such as by preventing or reducing ligand-receptor interaction. To do. The lipid envelope particles and target cells are contacted with the test substance. The lipid envelope particle has (a) a transferable label and (b) a recombinant fusion protein present on the outer surface of the lipid envelope particle and comprising a first and a second polypeptide. The first polypeptide comprises first and second domains within a continuous polypeptide chain that self-assemble to form an oligomeric ligand capable of binding to a receptor present on the outer surface of a target cell. The amount of transferable label in the target cells is measured in the presence of the test substance. An increase in the amount of transferable label in the target cells as compared to the amount of transferable label in the target cells in the absence of the test substance indicates a decrease or inhibition of homooligomeric ligand binding to the receptor.

In yet another aspect, the invention is a method of targeting a label that is capable of transferring to a target cell, the method comprising contacting the target cell with a lipid envelope particle, wherein the lipid envelope particle is (a) transferred. A possible label, and (b) a recombinant fusion protein present on the outer surface of the lipid envelope particle, the recombinant fusion protein comprising a first and a second polypeptide, and the first polypeptide self-associates. Comprises a first and a second domain within a continuous polypeptide chain forming an oligomeric ligand capable of binding to a receptor present on the outer surface of the target cell, whereby a lipid envelope particle-target cell complex is formed. Provided is a method of targeting a label capable of transfer to a target cell, the method comprising the step of being formed.

In yet another aspect, the invention provides a method of delivering a label transferable to a target cell, the method comprising contacting the target cell with the lipid envelope particle, the lipid envelope particle comprising: ) A transposable label, and (b) a recombinant fusion protein comprising the first and second polypeptides present on the outer surface of the lipid envelope particle and separated by a protein recognition site, provided that the first polypeptide is , Including first and second domains within a continuous polypeptide chain that self-assemble to form an oligomeric ligand capable of binding to a receptor present on the outer surface of a target cell, thereby providing a lipid envelope particle-target The step of containing a protein that forms a cell complex, and the protease that recognizes the protease recognition site Contacting the envelope particle-target cell complex, thereby cleaving the first polypeptide from the second polypeptide and transferring the transposable label to the target cell. Provide a way to deliver.

Yet another embodiment of the invention is a method of screening a test compound that has the ability to prevent the binding of an oligomeric ligand to a receptor. The target cells are contacted with the viral particles. The viral particle has (a) a transferable label, and (b) a recombinant fusion protein present on the outer surface of the viral particle and comprising a first and a second polypeptide. The first polypeptide comprises first and second domains within a continuous polypeptide chain that self-assemble to form an oligomeric ligand capable of binding to a receptor present on the outer surface of a target cell. The amount of transferable label in the target cells is measured in the presence of the test substance. An increase in the amount of transferable label in the target cells as compared to the amount of transferable label in the target cells in the absence of the test substance indicates inhibition of binding of the oligomeric ligand to the receptor.

Yet another embodiment of the present invention is a method of screening a test substance that has the ability to dissociate an oligomeric ligand into its component subunits, thereby reducing its ability to bind to a receptor. Contacting the target cells with the viral particles, the viral particles comprising (a
A) a transferable label, and (b) a recombinant fusion protein present on the outer surface of the viral particle and comprising a first and a second polypeptide, and the first polypeptide is self-associating. And comprising a first and a second domain within a continuous polypeptide chain forming an oligomeric ligand capable of binding to a receptor present on the outer surface of the target cell in a target cell in the presence of a test substance. Of the transferable label in the target cell in the absence of the test substance as compared with the amount of the transferable label in the target cell in the absence of the test substance. The ability to dissociate an oligomeric ligand into its constituent subunits, which includes the step of dissociating the ligand into its constituent subunits, which reduces its ability to bind to the receptor. A method of screening a test substance with a cell).

Thus, the present invention provides a new method for effective retroviral display of functional oligomeric ligands, especially cysteine knot growth factor.

DETAILED DESCRIPTION The present invention allows the display of oligomeric ligands, such as dimers or trimers, as recombinant fusion proteins in a conformation that allows them to bind to their receptors for oligomeric ligands. To do. The displayed oligomeric ligands can be used, for example, to target a label that can be transferred to a target cell bearing a receptor for the oligomeric ligand on its surface.
Such targeting can be used for a variety of purposes such as drug screening and delivery of transposable labels including genes.

Oligomeric Ligands Useful in the Invention As used herein, the term “homo-oligomeric ligand” means at least two copies that are substantially identical. What is "substantially the same"? At least 80%, preferably 90%, more preferably at least 95-98% in the amino acid sequence over the entire length of two ligands that are identical, ie, have the same amino acid sequence, when the two molecules are juxtaposed. It is identical and means that the two ligands self-associate to form a homo-oligomeric ligand with the ability to bind to the receptor.

Self-association involves the interaction between two or more substantially identical ligands via covalent and / or non-covalent binding. Typically, the self-association homo-oligomer ligand complex has a dissociation constant (Kd) of 100 M or less, preferably 10 M or less,
It is more preferably 1 M or less.

There are three types of homo-oligomer ligands, namely, natural homo-dimer or trimer ligands whose subunits are disulfide-bonded, and natural di- or trimer ligands. Yes, it does not contain disulfide bonds and can be freely dissociated (for example, stem cell factor), and natural monomeric ligands whose binding properties are enhanced by driving the ligand to assume a multimeric form. There is something (eg EGF). For the latter, ie, the natural monomeric ligand, the fusion of the monomers into a dimer, trimer, etc. results in a receptor binding affinity of, for example, at least 10, 50, 100 or It is considered to increase more than the above. Osteoprotegerin (OPG-1) functions, for example, as a homodimer, circulating as a monomer and, after binding to its receptor, as a dimer.

As used herein, the term “hetero-oligomeric ligand” refers to at least two oligomers that are substantially non-identical in sequence and binding specificity.
That is, the hetero-oligomer has less than 79% sequence identity, preferably less than 70%, more preferably less than 60%, most preferably 50% or 4 over the entire length of the molecule.
It is less than 0% and has a different binding specificity in the hetero-oligomer form compared to another hetero-oligomer with a different set of ligands.

The oligomeric ligands that can be displayed according to the invention are typically dimers or trimers, but may have 4 or more subunits. Growth factors, especially cysteine knot growth factor (CKGF), are particularly suitable for such displays. CKGF polypeptides are characterized by a common three-dimensional "cysteine knot" configuration. Cysteine knots result from an unusual string of 6 cysteine residues, three cysteine residues on each polypeptide subunit of the dimer. The knot consists of bonds 1-4, 2-5 and an intervening sequence that forms a ring, through which the disulfide bond 3-6 communicates (FIG. 2). In the PDGF-like family, the native protein is a dimer of two domains in nonparallel orientation. The subunits may be the same (form a homodimer) or non-identical (form a heterodimer).

CKGF, a protein that includes PDGF, VEGF, NGF and TGF-β2
Family members are extremely interesting candidates for retroviral display. In particular, PDGF and VEGF are involved in the process of angiogenesis in which new blood vessels are formed from existing blood vessels. This process has been implicated in tumor growth because metastatic tumors must acquire new blood flow before they grow beyond a few millimeters in diameter (Ausprunk and Folkman,
1977). Therefore, the receptors for PDGF and VEGf are interesting targets for anti-cancer agents. Retroviral display of functional PDGF and VEGF is W
As described in O97 / 03357, to promote intracellular drug screening tests and creation of vectors capable of delivering genes to vascular endothelial cells after proteolytic activation for use in gene therapy protocols. Conceivable.

The dimeric ligands that can be displayed according to the present invention include PDGF family (
For example, PDGF, PDGF-related transform protein P28-SIS, V
EGF, VEGF B, VEGF C, VEGF homolog, PLGF, PLGF-
1, PLGF-2, VEGF D and VEGF E), TGF-β family, glycoprotein hormone / gonadotropin, trefoil polypeptide family, NGF family, insulin family, HBGF / FGF
Family, intercrine α / small cytokine CXC / chemokine CXC family, small cytokine CC / intercrine β family, and interleukin family and OPEL (osteoprotegerin, Kong, etc.,
1999) is included. Trimeric ligands that can be displayed include members of the tumor necrosis factor family and macrophage migration inhibitory factor (MIG) family. Amino acid sequences and nucleotide sequences encoding these proteins are listed in GenBank, SWISS-PROT, EMBL DNA sequence database, PIR protein database, Vecbase or GenPept.
Can be obtained from various databases such as. Particularly preferred are ligands with a PDGF-like family signature. Such a ligand has a common sequence P- [PS] -C-V-X-X-X-R-C- [GSTA] -G-C-C (
SEQ ID NO: 15) is included, of which 4 cysteine residues are involved in the disulfide bond.

The oligomeric ligand is displayed as a single chain polypeptide within the recombinant fusion protein. Although the recombinant fusion protein of the present invention is not naturally occurring, recombinant DN
It can be generated using Method A or can be synthesized using standard protein synthesis methods. The recombinant fusion protein has first and second polypeptides fused to each other via a peptide bond. The first polypeptide comprises first and second domains within a continuous polypeptide chain that self-assemble to form an oligomeric ligand. 1
The inclusion of one or more additional domains can form trimeric or other oligomeric ligands. Preferably, the nucleic acid sequence encoding the first polypeptide is linked to the nucleic acid sequence encoding the second polypeptide without compromising the translation reading frame.

Cell Surface Receptor-Binding Polypeptides Useful in the Invention The second polypeptide preferably binds to cell surface viral receptors, such as cell membranes and synthetic lipid envelopes or viral, particularly retroviral membranes. Is a polypeptide that mediates fusion between various lipid envelopes. Viral glycoproteins including mammalian c-type retroviral envelope proteins such as the gimbal leukemia virus (GALV) envelope protein, 4070A envelope protein and Moloney MLV envelope protein are particularly useful as the second polypeptide. It is important that the viral glycoprotein be substantially intact, ie possess all of its domains for preserving post-translational processing, oligomerization, viral uptake and fusogenic activity. However, specific mutations such as mutations, deletions or additions that do not significantly affect the above functions may occur in the glycoprotein, and the glycoprotein having such a modification is said to be substantially intact. Take a look.

Preferably, the polypeptide at position 1 is fused near the end of the mature envelope glycoprotein so that the folding of the domain of the first polypeptide into the functional oligomeric ligand is not largely perturbed. Although the fusion closest to the N-terminus is generally optimal for preserving the infectivity of the recombinant fusion protein,
Fusions within 20 or 10 amino acids can be used. For example, the fusion at amino acid 1 is preferred over the fusion between amino acids 6 and 7. 1, 2 if desired
A linker sequence capable of functioning as a "hinge" having 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 or more contiguous amino acids 2 of any of the domains of the first polypeptide. The inclusion between the two facilitates folding of the first polypeptide into a conformation similar to the native oligomeric ligand. Amino acid sequences suitable for use as linkers between any two domains can be empirically determined by routine screening methods, or alternatively, specific amino acids that allow folding of two adjacent polypeptide domains. Predictions can be made based on the known capabilities of the sequences (see, eg, Alfthan et al., 1995). A suitable linker sequence for joining the two VEGF subunits is eg Ala-Ala-Gly-Gly-.
Gly-Gly-Gly-Ser (SEQ ID NO: 7).

Optionally, the protease recognition site is between the first and second polypeptides. Such protease recognition sites are used to control the fusion of lipid envelopes, such as viral particles, to the target cell membrane, thereby controlling the delivery of the transposable label or gene from the particle to the target cell. A variety of protease recognition sites can be used in the recombinant fusion protein. For example, a Factor Xa site or an elastase recognition site, such as N-Ac-Ala-Ala-DOPE.
, Ala-Ala-Pro-Val (SEQ ID NO: 10) and MeO-Suc-A.
la-Ala-Pro-Val-pNa (SEQ ID NO: 11) can be incorporated into the recombinant fusion protein (Zimmerman and Ashe, 1977; Na
Kajima et al., 1979). MeO-Suc-Ala-Ala-ProMet
-PNa (SEQ ID NO: 12) (Zimmerman and Ashe, 1977)
, Suc-Ala-Ala-Pro-Phe-pNa (SEQ ID NO: 13) and S.
uc-Ala-Ala-Pro-Lys-pNa (SEQ ID NO: 14) (Polan
Cathepsin G recognition sites such as owska et al., 1998) can also be used.

The second polypeptide of the recombinant fusion protein can be anchored to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microplate wells, test tubes or beads such as latex, polystyrene or glass beads.
In a preferred embodiment, the solid support is a lipid envelope particle, biological membrane or viral capsid. Lipid envelope particles can be used to encapsulate transferable labels, including synthetic lipid bilayers, native or recombinant modified envelope virus particles, and prokaryotic and eukaryotic cells. . Biological membranes include viral envelopes, including retroviruses, and prokaryotic and eukaryotic cell membranes. Useful viruses include members of the adenovirus, togavirus, rhabdovirus and retrovirus families and enveloped viruses such as paramyxovirus and orthomyxovirus. Amphoteric viruses that can infect eukaryotic cells are particularly useful. Polynucleotide encoding the recombinant fusion protein of the present invention The present invention also provides a polynucleotide encoding the recombinant fusion protein of the present invention. The polynucleotide of the present invention includes less than the entire chromosome and can be single-stranded or double-stranded. Preferably, the polynucleotide is DNA (genome D
NA or cDNA), but also RNA, and optionally synthetic (non-natural) bases. Preferably the polynucleotide is isolated free of other cellular components such as membrane components, proteins and lipids. These can be produced by the cells, isolated or synthesized in the laboratory using amplification methods such as PCR or using automated synthesizers. Methods for purifying and isolating DNA are conventional and known in the art.

[0035] In one embodiment, the polynucleotide is such that the first polypeptide is PDG.
A recombinant fusion protein comprising a subunit of either F or VEGF and wherein the second polypeptide comprises a mammalian C-type retroviral envelope protein, such as the Moloney MLV envelope protein, the 4070A envelope protein or the GALV envelope protein. To do. The amino acid sequences of these proteins are known in the art. Nucleotide sequences encoding such recombinant fusion proteins are included within the scope of this invention.

<Viral Display Package> A viral display package is a virus that has been genetically engineered to display the recombinant fusion protein of the present invention on its surface. The viral display package comprises the recombinant fusion protein of the invention and is formed when the second polypeptide is anchored in the viral membrane. The viral display package can include multiple recombinant fusion proteins, optionally having multiple target specificities by incorporating recombinant fusion proteins, each containing a different oligomeric ligand domain, into the viral display package. A virus display package can be obtained. The viral display package is preferably a virus capable of infecting eukaryotic cells, eg MLV or other type C retroviruses, vesicular stomatitis virus, influenza virus, Semilik F.
orest virus, Sindbis virus, Sendai virus or adenovirus. Library A library of virus display packages can also be constructed.
Such a library contains at least two viral display packages, which may or may not have the same target specificity. Unique restriction sites can be inserted between the codons for the second polypeptide for the construction of a vector to obtain a replication competent viral library displaying the fusion protein of the invention. For example, insert the unique restriction sites SfiI and NotI between the codons of amino acids 6 and 7 of the mature envelope protein in the full-length infectious molecular clone of MoMLV (Shoemaker et al., 1980) without compromising the translational reading frame. can do. Ga of MoMLV
After removal of the SfiI site in the g coding region (Shinnick et al., 19
81), a vector can be used to obtain a replication-competent viral library displaying the fusion protein of the present invention. For example, a library obtained by PCR of a DNA fragment encoding the fusion protein can be cloned into this site. Of course, for any given second polypeptide, there may be alternative combinations of non-complementary restriction sites that function as well, and a single restriction site may be sufficient.

Generation of an extensive library of recombinant retroviruses was previously demonstrated by transient transfection of retroviral plasmids into retroviral packaged cells (Murphy and Efstradiadis, 1987).
). The size of the library was first determined by E. coli for growth and purification of plasmid ligation products. Limited by the efficiency of plasmid transfection into E. coli and secondly into retroviral package cells for the generation of retroviral gene display libraries. By using a highly efficient method of gene delivery to mammalian cells (Curie et al., 1992), which was recently developed,
It can be assumed that a library size of 10 ⁸ virus display packages should be possible.

<Screening Method> Recombinant fusion proteins, including those present on the surface of lipid envelope particles and virus particles, are screened for test substances that have the ability to prevent oligomeric ligands from binding to their receptors. Can be used in the method. In the screening methods of the invention, the test substance may be in free form and / or pre-bound to a receptor on the surface of the target cell. The test substance that can be screened can be a pharmacological substance already known in the art, or can be a compound for which it is unknown if it has any pharmacological activity. The test substance can be natural or designed in the laboratory. They can be isolated from microorganisms, animals or plants, recombinantly produced or synthesized by chemical methods known in the art.

The screening method can be performed in vivo or in vitro. In one embodiment, lipid envelope particles such as viral particles and target cells are contacted with a test substance. The virus or other lipid envelope particle contains both a transposable label and the recombinant fusion protein of the invention.
The recombinant fusion protein specifically binds lipid envelope particles to target cells by the displayed oligomeric ligand present in the first polypeptide of the fusion protein to form a lipid envelope particle-target cell complex. Used for.

Transferable Labels and Cell Targeting Transferable labels are targeted by fusion of lipid envelope particles with the target cell membrane, such as radiolabels, non-isotopic labels such as chemiluminescent, fluorescent or enzymatic labels. It can be any label whose presence can be detected intracellularly. The transposable label can be a selectable marker such as an antibiotic resistance gene that facilitates identification and selection of target cells infected by the lipid envelope particles. Transferable labels also include β-galactosidase, luciferase, β-glucuronidase, green fluorescent protein (GFP), autofluorescent proteins such as blue fluorescent protein (BFP), glutathione-S-transferase (GST).
), Luciferase, horseradish peroxidase (HRP) or chloramphenicol acetyl transferase (CAT). Many such genes are known in the art.

The transposable label may also be such as alpha-1 antitrypsin, globin protein, factor VIII or factor IV protein, growth factor, cytokine or LDL receptor,
It can be any protein product whose delivery to target cells is desired for gene therapy purposes. Such a transferable label can be detected using, for example, an immunochemical method using an antibody that specifically binds to a protein product. Other transferable labels include antisense transcripts or ribozymes that can be detected with specific oligonucleotide probes. Other pharmacologically active substances can also be used as transferable labels.

Receptors for specific oligomeric ligands displayed by the lipid envelope particle are present on the outer surface of the target cell, which allows specific targeting of the lipid envelope particle to the target cell. Receptors that can be targeted include receptors for oligomeric growth factors such as CKGFs. Such receptors include the PDGF family (eg, PDGF
, PDGF-related transform proteins P28-SIS, VEGF, VEGF
B, VEGF C, VEGF homolog, PLGF, PLGF-1, PLGF-2,
VEGF D and VEGF E), TGF-β family, glycoprotein hormone / gonadotropin, trefoil polypeptide family, NGF family, insulin family, HBGF / FGF family, intercrine α / small cytokine CXC / chemokine CXC family, small cytokine CC / Receptors for members of the intercrine β family and the interleukin family, and for members of the tumor necrosis factor family and macrophage migration inhibitory factor (MIG) family. The target cell naturally contains the receptor, or the receptor can be introduced into the target cell using, for example, a recombinant nucleic acid construct encoding the receptor. Methods for transfecting nucleic acid constructs into cells are well known and include, but are not limited to, transfection with uncoated or coated nucleic acids, cell fusion, protoplast fusion, viral infection and electroporation. Not done.

Target cells can be isolated from eukaryotic cells, preferably mammals, more preferably humans, and subjected to tissue culture. Established cell lines can also be used to obtain target cells. Alternatively, the target cells can be inside a mammalian body such as a rat, mouse, guinea pig, hamster, rabbit, goat, sheep or human body.

The amount of transferable label in the target cells is determined in the presence of the test substance. The measurement can be performed by any method suitable for detecting the particular transposable label used, including biochemical, immunological or viral detection methods. Expression of the gene can also be for example Northern or dot blot or in situ.
It can also be measured by detecting the mRNA using hybridization. A test substance that increases the amount of transferable label in the target cell as compared to the amount of transferable label in the target cell in the absence of the test substance shows inhibition of binding of the oligomeric ligand to the receptor. ing. The increase in the amount of transferable label can be measured qualitatively or quantitatively, for example by referring to a standard curve. Preferably, the test substance is at least 25%, 50% of the amount of the label capable of being transferred in the target cells.
, 100% or 2 fold, 5 fold, 10 fold or even 1000 fold. In general, a test substance that inhibits the binding of oligomeric ligands to the receptor is considered to have an inhibitory effect if it increases the amount of label transferred to at least 25%.

The recombinant fusion protein comprising a single chain polypeptide, when present on the surface of a lipid envelope particle, such as a viral particle, targets a marker that is transferable to target cells, as described above, or , Can also be used to provide a transferable label to target cells. Delivery of the transposable label may be for therapeutic purposes or may be used after labeling a particular population of target cells, eg for isolating that population from non-target cells.

For delivery of the transposable label, the recombinant fusion protein may contain the first and second recombinant proteins.
A protease recognition site located between the polypeptides can be included. After the lipid envelope particle-target cell complex is formed, the complex is contacted with a protease that recognizes the protease recognition site. The protease can be normally present at the location of the target cell or can be introduced, for example, by injection at the site of the target cell within the mammalian body or by adding the protease to the medium of tissue culture. . The protease recognition site is then cleaved, thereby releasing the first polypeptide that contains the oligomeric ligand already bound to its receptor. The second polypeptide is then capable of causing a fusion between the lipid envelope particle and the target cell membrane, which enables delivery of the transposable label to the target cell.

The present invention also provides a method for screening a test substance that has the ability to dissociate an oligomeric ligand into its component subunits, thereby reducing its ability to bind to its receptor. The target cells are contacted with the viral particles. Virus particles
(A) a transposable label and (b) a recombinant fusion protein present on the outer surface of the viral particle and comprising the first and second polypeptides. The first polypeptide comprises first and second domains within a continuous polypeptide chain that self-assemble to form an oligomeric ligand capable of binding to a receptor present on the outer surface of a target cell. In the presence of the test substance, the amount of the label capable of transfer in the target cell is measured. An increase in the amount of transferable label in the target cells as compared to the amount of transferable label in the target cells in the absence of test substance indicates dissociation of the oligomeric ligand into its component subunits.

The above disclosure generally describes the present invention, a more complete understanding being obtained by reference to the specific examples provided below, which are for illustration purposes only. There is no intention to limit the scope of the invention. All references cited in this disclosure are expressly incorporated herein.

Example 1 Methods Used in the Following Examples Construction of PDGF Plasmids The constructs PDGFNG4SMo, PDGFNXMo, PDGFNG4SA and PDGFNXA were made as follows. Primer Sal PDGFBF5 '(
5'-CCAGCTGTCGACTAGCCTGGGTTCCCTGACCAT
TGC-3 '; SEQ ID NO: 1) and PDGF Not IR3'(5'-ATCGA
TGCGGGCCGCGTGCACAGGTCGGTGCAGCGTCACTGT
PPDGFB plasmid (ATCC570) using CTC-3 '; SEQ ID NO: 2).
PDGF was amplified from 50) and introduced Sal I and Not I restriction sites at the 5 ′ and 3 ′ ends of the coding region, respectively. Then the PCR product was digested with SalI and NotI restriction endonuclease, Sal I / N ot I digestion IGFNG4SMo, IGFNXMo, IGFNG4SA and IG
PDGFNG4SMo linked to FNXA (Chadwick et al., 1999)
, PDGFNXMo, PDGFNG4SA and PDGFNXA were prepared respectively. Constructs ScPDGFNG4SMo, ScPDGFNXMo, ScPDGF
To obtain NG4SA and ScPDGFNXA, the PCR product of PDGF was prepared using the primers PDGFB Not IR and Eag IPDGFBF5 ': (5'CGA
TATGCGGCCGGA-GGTGGAGGCGGGTTCAAGCCTGGG
TTCCCTGACCATTGC-3; SEQ ID NO: 3), which amplifies PDGF from pPDGFB, 5'end and 3'of the coding region.
Eag I and Not I sites were introduced in-frame at the ends. This PC
The R product was cleaved with Eag I and digested with Not I PDGFNG4SMo, PDGFNX
Ligated into Mo, PDGFNG4SA and PDGFNXA. The orientation of the plasmid was confirmed by Sal I / Not I digestion. ScPDGFNG4S by ligation
Mo, ScPDGFNXMo, ScPDGFNG4SA and ScPDGFNX
A was obtained. All constructs had the correct sequence according to the DNA sequence.

Construction of VEGF Plasmid VEGF. NG4SMo, VEGF. NXMo, VEGF. NG4SA and VEGF. NXA converts VEGF to IGF. NG4SMo, IGF. NXMo, IG
F. NG4SA and IGF. NXA (Chadwick et al., 1999) skeleton D
Each was obtained by PCR cloning in NA. Primer Sal I-
VEGF-For (5'-CCAGCTGTCGACTGGGGCAGAATCA
TCACGAAGTGGG-3 ′; SEQ ID NO: 4) and VEGF- Not I-Re
v (5'-ATCGATGCGGCCGCTG-TTGTTTGGTCTGCAT
Using TCACATTTGTTTGT-3 '; SEQ ID NO: 5), an amplification product was derived from pVEGF (a plasmid clone of VEGF121 cDNA) encoding a subunit of the VEGF receptor binding domain having introduced in-frame Sal I and Not I restriction sites. Obtained. The amplification product was digested with Sal I and Not I restriction endonucleases to allow ligation. Construct IGF. NG4SMo, IGF
． NXMo, IGF. NG4SA and IGF. NXA DNA was double digested with Sal I and Not I restriction endonucleases and approximately 10 Kb of Sal I-backbone- Not I DNA was approximately 220 bp of Sal I-IGF- Not I insert D.
Separated from NA by agarose gel electrophoresis. Sal I-skeleton- Not I
The DNA was gel purified and the Sal I-IGF- Not I insert DNA was added to 4
Directionally cloned into one scaffold DNA to obtain VEGF. NG4SMo
, VEGF. NXMo, VEGF. NG4SA and VEGF. NXA was obtained.

The construct ScVEGF. NG4SMo, ScVEGF. NXMo, ScVEGF
． NG4SA and ScVEGF. NXA is VEGF. NG4SMo
, VEGF. NXMo, VEGF. NG4SA and VEGF. VEG on NXA
It was obtained by PCR cloning F. Primer Eag I-VEGF-
For: (5'-CGATATGCGCGCCGGAGGTGGAGGCGGGTT
C-AGGGCAGAATCATCACGAAGTGG-3 ′; SEQ ID NO: 6) and VEGF-NotI-Rev are used to encode the same subunit of the VEGF receptor binding domain, but with introduced in-frame Eag I and Not I.
Amplification products were obtained from pVEGF with restriction sites. This results in Ala-Ala-Gly-Gly-Gly-Gly-Gly- between the two VEGF subunits.
The Ser (SEQ ID NO: 7) hinge was also introduced. The amplification product was digested with Ega I restriction endonuclease to allow ligation. Construct VEGF. NG4SMo, VEGF
． NXMo, VEGF. NG4SA and VEGF. NXA was digested with Not I restriction endonuclease and the linearized plasmid DNA was purified. And cloned into non directional in Ea g I-VEGF- Eag I insert DNA a NotI- digested backbone DNA. After screening the resulting colonies based on the Sal I / Not I restriction pattern, clones with the insert VEGF DNA in the same coding direction as the VEGF sequences in the backbone DNA were selected.

Nucleotide sequencing of both strands of DNA between the Sal I and Not I restriction sites was followed for all constructs and confirmed by PCR that no polymerase error was introduced in the nucleotide sequences.

Generation of virus The chimeric envelope expression construct was TEKCeB6 by superfection.
The cells were transfected. Stably transfected cells at 50 μg /
Transferred to medium containing mL furoemicin and 6 μg / mL blasticidin.
The combined cell colonies are cultured on the whole surface, and serum-free DMEM (for infection) or D
Viral supernatants were collected after overnight incubation in MEM / 2% fetal bovine serum (for immunoblotting). All supernatants were used after filtration (0.45 μm).

Immunoblot 30,000 rp in SW4O Ti rotor (Beckman) for 1 hour at 4 ° C.
filtered pelleted virus by ultracentrifugation (0.45 μm)
Obtained from the subsequent virus supernatant. Discard the supernatant and discard 100 pellets of virus.
Resuspended in μL ice-cold PBS. A small amount (10 μL) of sample was mixed with SDS-containing loading buffer, the sample was boiled and subjected to SDS-PAGE on a 10% (w / v) polyacrylamide gel. The protein was then transferred to nitrocellulose and the envelope protein was detected using a specific goat antibody raised against the Rauscher leukemia virus gp70-SU envelope protein. Blots were developed with horseradish peroxidase-conjugated rabbit anti-goat antibody and enhanced chemiluminescence kit. In Factor Xa cleavage experiments, a small amount of sample was used in the presence or absence of 4 μg / mL Factor Xa protease to produce 3
After incubating at 7 ° C. for 90 minutes, it was subjected to SDS-PAGE. In non-reducing gel, DTT (200 mM) was removed from SDS-loading gel and then added to a small amount of specimen.

Infected NIH 3T3 cells were seeded at 5 × 10 ⁴ cells / well in 24-well plates and incubated overnight at 37 ° C. In the ligand competition experiment, the cells to be infected were allowed to stand in the absence of ligand or in the presence of various concentrations of ligand for 3 minutes.
Further incubation at 7 ° C. followed by virus infection. After these incubation steps, 10 μL of filtered (0.45 μm) viral supernatant was diluted with serum-free medium to a total volume of 500 μL. The infection was then allowed to proceed for 6 hours at 37 ° C. The cells were then washed once with PBS and fed with fresh DMEM / 10% fetal bovine serum. After 24-48 hours, when the cells were grown to full-scale culture, X-ga
I (5-bromo-4-chloro-3-indolyl β-D-galactosidase) staining was performed, and the number of cases of infection was measured by detecting the activity of β-galactosidase.

Example 2 PDGF Display An array of envelope proteins displaying PDGF was constructed. Such a construct can be the envelope protein itself (Moroni or 4070A), the linker peptide (Ala-Ala-Ala-Gly-Gly-Gly-Ser (SEQ ID NO: 8) or the factor Xa site Ala-Ala-Ala-Ile-Glu-Gly).
-Arg (SEQ ID NO: 9) and the displayed domain (PDGF-B single domain or single chain dimer) (see Figure 4). TE with chimeric and unmodified Moloney and 4070A envelope expression plasmids
LCeB6 virus was transfected into acidic cells.

It was confirmed by immunoblotting of the pelleted virus whether the chimeric envelope protein was incorporated into the vector particles. Figure 5 shows immunoblots of chimeric constructs PDGFNG4SA, PDGFNXA, ScPDGFNG4SA and ScPDGFNXA. Lane 5 contains a distinct band at the predicted molecular weight of approximately 70 kDa, which corresponded to the unmodified 4070A envelope protein. All chimeric constructs were incorporated into retroviral particles with a slightly lower efficiency compared to unmodified 4070 Env. PDGFNG4SA
And PDGFNXA (lanes 1 and 2 respectively) are the PDs displayed
Approximately 15 kDa than unmodified 4070A Env due to the presence of GF-B domain
It was great. ScPDGFNG4SA and ScPDGFNXA (lanes 3 and 4, respectively) were approximately 30 kDa larger than the 4070A Env due to the display of two PDGF-B domains per Env subunit. A lower molecular weight non-specific band was observed at approximately 60 kDa in all immunoblots. The Moloney envelope construct had a low uptake but 407
It gave similar results as the 0A envelope construct.

The purpose of the work described in this disclosure was to obtain single chain forms of PDGF and VEGF displayed on a retroviral envelope capable of binding to its corresponding receptor. Single-chain forms of these cytokines were constructed in an attempt to display a biologically active dimer as a functional unit, one per Env subunit (see Figure 3). To investigate whether our construct formed such a dimer, we needed to show that no intermolecular disulfide bonds were formed between the proteins displayed on the adjacent Env subunits. It was Single domain forms of PDGF and VEGF were displayed as controls to reveal that such cross-linking occurs. The formation of intermolecular disulfide bonds was investigated using a non-reducing gel (see Figure 6). Lane 5 (4
070A unmodified envelope protein) has a clear band at about 70 k corresponding to SU.
It had at 85 kDa corresponding to a portion of Su disulfide bonded to Da and TM. On the other hand, lane 1 corresponding to PDGFNG4SA and PDGFNXA
And 2 only showed a weak band at the estimated size of the chimeric envelope protein of 85 kDa. A very distinct band was observed at 170 kDa, which is twice its size observed on the standard reduced gel. This is PDGF-B
Forms an intermolecular disulfide bond between envelope proteins adjacent to each other,
This resulted in the migration as a disulfide-bonded dimer on a non-reducing gel. Sc
Lanes 3 and 4 corresponding to PDGFNG4SA and ScPDGFNXA are 1
There was a clear band at 00 kDa and a weaker band above this at about 15 kDa, showing similar characteristics to the unmodified 4070A Env. That is, since these chimeric envelopes did not dimerize with each other via a disulfide bond, the displayed single-chain dimer should form an intramolecular disulfide bond.

FIG. 7 shows an immunoblot of the same envelope protein treated (+) or untreated (−) with factor Xa, followed by loading (+) or without (−). Factor Xa protease treatment had no effect on any of the envelope proteins other than those containing the Xa cleavage site. PDGFNXA (2) and PDG
All of FNXA (5) showed similar band characteristics to unmodified 4070A after cleavage with factor Xa. This indicates that the Factor Xa protease could cleave the displayed domain when Factor Xa was present between the displayed domain and the underlying envelope protein. Furthermore,
PDGFNXA must be dimerized via the displayed domain (PDGF), since the remaining envelope protein is converted into a monomer by its removal. PDGFNG4SMo, PDGFNXMo, ScPDGF
Similar results were obtained for NG4SMo and PDGFNXMo.

In order to show that the displayed single-chain form is able to bind its corresponding receptor, PDGF receptor positive NIH 3T3 cells were infected with a vector carrying the chimeric envelope protein. Previously displayed ligands with the ability to bind to the tyrosine kinase receptor were found to prevent viral entry by sequestering the vector on this non-permissive receptor distal to the viral receptor. ing. Addition of agonist-free ligand abrogates this interference. Thus, the characteristics of infection observed on ligand-receptor positive cells can be used as evidence that the displayed ligand binds to its receptor (Chadwick et al., 1999). NIH 3T3 cells were infected with ScPDGFNG4SA vector in the presence of increasing concentrations of PDGF-BB-free ligand (see Figure 8). PDGF-BB increased the virus titer at a concentration as low as 100 pM and produced the optimum virus titer at 5 nM. Unmodified 4070A
No such effect was observed on the titer of the vector with the envelope protein (data not shown). These results show that the single-stranded PD displayed
It has been shown that GF can bind to the PDGF receptor on NIH 3T3 cells.

Example 3 VEGF Display Eight kinds of vectors displaying VEGF-Env chimera were prepared. The chimeric envelope protein is linked to the underlying envelope protein (4070A or Moloney) via a short peptide, either AAAGGGS (SEQ ID NO: 8) or the Factor Xa site AAAIEGR (SEQ ID NO: 9), displayed Domain (single domain VEGF or single chain dimer VEGF (sc
VEGF)).

Unmodified 4070A Env, Moloney Env and 8 VEGF chimera E
nv expression plasmid according to the manufacturer's instructions Superfect (Qage
n) was transfected into the TelCeB6 packaging cell line.

Immunoblotting of the pelleted virus was performed to determine if the chimeric envelope protein was incorporated into the vector particles. FIG. 9 shows an immunoblot of chimeric vectors VEGFNG4SA, VEGFNXA, scVEGFNG4SA and scVEGFNXA showing uptake at high concentrations. A non-specific low molecular weight band is observed in all lanes at about 60 kDa. The chimera Moloney envelope vector showed similar results to the Chimera 4070A envelope vector, although the uptake concentration was low.

To examine the formation of disulfide bonds between the displayed VEGF subunits, we examined the chimeric vector using a non-reducing gel (FIG. 10).
reference). Su (70 kDa) and SU-TM in unmodified 4070A Env
Two bands corresponding to (85 kDa) were observed. On the other hand, VEGFNG4S
A band was observed at about 170 kDa for A and VEGFNXA, indicating that these envelope proteins were associated as dimers as a result of intermolecular association of the displayed VEGF domains. As a result of factor Xa protease treatment (+), the apparent motility of the VEGFNG4SA dimer band was unchanged. However, the VEGFNXA dimer was reduced to the size of monomeric 4070A Env (lane 2). That is, dimerization was due to association between displayed domains on adjacent envelope proteins. scVEGF. N
G4SA and scVEGF. The NXA envelope protein showed bands at 100 kDa and 115 kDa, indicating that the displayed single chain protein is capable of forming an intramolecular disulfide bond between CKGF domains. Another band was observed at 200 kDa, indicating that some intermolecular dimerization still occurred between adjacent envelope proteins. ScVEGFNG4S by factor Xa treatment
Motility of A band was unchanged. The band corresponding to the dimeric scVEGFNXA disappeared and some of the displayed protein cross-linked with the adjacent Env subunit, which cross-linking was removed when the displayed domain was cleaved off. confirmed. The remaining band corresponded to the size of unmodified 4070A Env (lane 9). VEGF. NG4SMo, VEGF
． NXMo, scVEGF. NG4SMo and scVEGF. Similar results were obtained with NXMo.

[References]

[0066]

[Sequence list]

[Brief description of drawings]

FIG. 1 is a display showing a trimeric murine leukemia virus envelope polypeptide that forms an “oligomer cap” on the envelope protein.

FIG. 2 is a diagram showing the structure of VEGF, showing intermolecular disulfide bonds and antiparallel sequences of cysteine knot domains.

FIG. 3a shows the display of a single CKGF domain per Env subunit. A (intermolecular) disulfide bond is formed between domains displayed on adjacent Env subunits.

FIG. 3b is a diagram showing a display of CKGF single chain dimer. (Intramolecular) disulfide bonds are formed between the CKGF domains within each single chain dimer, displaying one dimer for each Env subunit.

FIG. 4a is a diagram showing a display of one CKFG domain.

FIG. 4b is a diagram showing the display of two CKGF domains as single chain molecules.

FIG. 5 is an immunoblot of retrovirus envelope proteins. Lane 1, PDGFNG4SA; Lane 2, PDGFNXA; Lane 3, S
cPDGFNG4SA; lane 4, ScPDGFNXA; lane 5, unmodified 4
070A envelope protein.

FIG. 6 is an immunoblot of chimeric retrovirus envelope proteins after non-reducing SDS-PAGE. Lane 1, PDGFNG4SA; Lane 2, PDGFNXA; Lane 3, ScPDGFNG4SA; Lane 4, ScPD
GFNXA; lane 5, unmodified 4070A envelope protein.

FIG. 7 shows an immunoblot after non-reducing SDS-PAGE of the chimeric retrovirus envelope protein with or without Factor Xa protease treatment (−) or with Factor Xa protease treatment (+) for 90 minutes before loading. Lane 1, PDGFNG4SA; Lane 2, PDGFNXA; Lane 3, unmodified 4
070A Env; Lane 4, ScPDGFNG4SA; Lane 5, ScPDG.
It is FNX.

FIG. 8 shows ScP in the presence of increasing concentrations of PDGF-BB free ligand.
FIG. 6 is a graph showing infection of NIH 3T3 cells with DGFNG4SA vector.

FIG. 9 is an immunoblot of retrovirus envelope proteins. Lane 1, VEGFNG4SA; Lane 2, VEGFNXA; Lane 3, Sc
VEGFNG4SA; lane 4, ScVEGFNXA; lane 5, unmodified 40
70A envelope protein.

FIG. 10 shows an immunoblot after non-reducing SDS-PAGE of a chimeric retrovirus envelope protein in the case of no treatment with factor Xa protease (−) or treatment with factor Xa protease for 90 minutes before loading (+).
Lane 1, VEGFNG4SA; Lane 2, VEGFNXA; Lane 3, ScV
EGFNG4SA; lane 4, ScVEGFNX; lane 5, unmodified 4070
A envelope protein.

─────────────────────────────────────────────────── ─── Continued Front Page (51) Int.Cl. ⁷ Identification Code FI Theme Coat (Reference) G01N 33/15 G01N 33/50 Z 33/50 33/53 D 33/53 M 33/566 33/566 C12N 15/00 ZNAA (72) Inventor Belcher, Craig, S.G.191.N.E.L. Bedfordshire, Sandy, Mill Lane, 45 (72) Inventor Glenn, Daphne England, C.B.・ 17 S S Cambridge, Mowbray Road, 22 (72) Inventor Bluff, Francis Joanne UK, CB 14 S S Cambridge, Cherry Hinton, Lusarn Claus, 128 ( 72) Inventor Russell, Stephen James USA, 55902 Mi 2701F Term, Salem Road, Southwest, Rochester, Nesota AA10 AA20 AA30 BA41 CA01 CA40 DA01 DA86 EA28 EA29 FA74

Claims (44)

[Claims] 1. A recombinant fusion protein comprising a first polypeptide and a second polypeptide fused to each other via a peptide bond, wherein the first polypeptide self-associates with a receptor. A recombinant fusion protein comprising first and second domains within a continuous polypeptide chain forming a homo-oligomeric ligand capable of binding. 2. The first polypeptide is a dimer or trimer.
The recombinant fusion protein according to 1. 3. A recombinant fusion protein comprising a first polypeptide and a second polypeptide fused to each other via a peptide bond, wherein the first polypeptide self-associates with an oligomeric ligand. A recombinant fusion protein comprising first and second domains within a continuous polypeptide chain forming, said domain comprising a disulfide-linked growth factor, and said oligomeric ligand having the ability to bind to a receptor. 4. The recombinant fusion protein of claim 1 or 3, wherein the first polypeptide further comprises a third domain that associates with the first and second domains to form the ligand. 5. A recombinant fusion protein according to any one of the preceding claims, wherein the ligand is a growth factor. 6. The recombinant fusion protein according to claim 5, wherein the growth factor is cysteine knot growth factor. 7. The recombinant fusion protein according to claim 6, wherein the cysteine knot growth factor is a growth factor having a PDGF-like family signature. 8. A recombinant fusion protein according to any one of the preceding claims, wherein the second polypeptide is tethered to a solid support. 9. The recombinant fusion protein according to claim 8, wherein the solid support is a lipid envelope particle or a biological membrane. 10. The recombinant fusion protein according to any one of the preceding claims, wherein the second polypeptide is a glycoprotein. 11. The recombinant fusion protein of claim 10, wherein the glycoprotein comprises a substantially intact envelope of the virus that enhances the fusion between the lipid envelope particle and the cell membrane. 12. The glycoprotein is a virus envelope protein.
The recombinant fusion protein according to 1. 13. The recombinant fusion protein according to claim 11, wherein the virus is a retrovirus. 14. The recombinant fusion protein according to claim 13, wherein the retrovirus is a mammalian type C retrovirus. 15. The recombinant fusion protein of claim 14, wherein the mammalian C-type retrovirus is selected from the group consisting of 4070A virus, Moloney murine leukemia virus, and gibbon ape leukemia virus. 16. A recombinant fusion protein according to any one of the preceding claims further comprising a protease recognition site between the first and second polypeptides. 17. The recombinant fusion protein of claim 1, further comprising an amino acid linker sequence between the first and second domains of the first polypeptide. 18. A recombinant fusion protein comprising a first polypeptide and a second polypeptide fused to each other via a peptide bond, wherein the first polypeptide comprises at least two cysteine knot growth factors. Second, including subunits
Polypeptide contains a substantially intact viral envelope protein that enhances the fusion between the cell membrane and the viral membrane, and at least two subunits of the cysteine knot growth factor associate to form the cysteine knot growth factor receptor. A recombinant fusion protein that forms a cysteine knot growth factor that binds to. 19. The recombinant fusion protein according to claim 18, wherein the cysteine knot growth factor is a growth factor having a PDGF-like family signature. 20. The recombinant fusion protein according to claim 18 or 19, wherein the virus envelope protein is a mammalian C-type retrovirus envelope protein. 21. A mammalian C-type retrovirus envelope protein is 4070.
The recombinant fusion protein according to claim 20, which is selected from the group consisting of A envelope protein, Moloney MLV envelope protein and gibbon ape leukemia virus envelope protein. 22. A lipid envelope virus display package comprising the recombinant fusion protein of any one of the preceding claims, wherein the second polypeptide of the fusion protein is anchored in the viral lipid envelope. Lipid envelope virus display package. 23. A library of virus display packages comprising a plurality of virus display packages of claim 22. 24. A method for screening a test substance capable of regulating the binding of an oligomeric ligand to a receptor, which comprises the step of contacting a lipid envelope particle and a target cell with the test substance, the lipid envelope particle comprising: (A) a transposable label, and (b) a recombinant fusion protein that is present on the outer surface of the lipid envelope particle and comprises a first and a second polypeptide, and the first polypeptide is Comprising self-associating first and second domains within a continuous polypeptide chain forming an oligomeric ligand capable of binding to a receptor present on the outer surface of a target cell, in the presence of a test substance Measuring the amount of transferable label in the target cells, the ratio of the amount of transferable label in the target cells in the absence of the test substance Increasing the amount of the transposable label in the target cell indicating decrease in the binding of the oligomeric ligand to the receptor when the test substance is capable of modulating the binding of the oligomeric ligand to the receptor. How to screen. 25. The method of claim 24, wherein the lipid envelope particle is a virus. 26. The virus according to claim 24 or 25, wherein the virus is a retrovirus.
The recombinant fusion protein according to 1. 27. The second polypeptide enhances fusion of the particle with the target cell,
27. A method according to any one of claims 24, 25 or 26. 28. The method of claim 24, wherein the second polypeptide is of viral origin.
The method according to any one of 27. 29. The method of any one of claims 24-28, wherein the second polypeptide is a substantially intact viral envelope protein. 30. The method of any one of claims 24-29, wherein the second polypeptide is a mammalian C-type retrovirus envelope protein. 31. A mammalian C-type retrovirus envelope protein is 4070.
31. The method of claim 30, selected from the group consisting of A envelope protein, Moloney MLV envelope protein and gibbon ape leukemia virus envelope protein. 32. The method according to any one of claims 24 to 31, wherein the target cell is a eukaryotic cell. 33. The method of claim 32, wherein the target cells are mammalian cells. 34. The method of claim 32, wherein the target cells are human cells. 35. The method of any one of claims 24-34, wherein the transposable label is a reporter gene that encodes a detectable product. 36. A method of targeting a targetable marker to a target cell, the method comprising contacting the target cell with a lipid envelope particle, the lipid envelope particle being (a) a transferable label, and (b). Is present on the outer surface of a lipid envelope particle, comprises a recombinant fusion protein comprising a first and a second polypeptide, and the first polypeptide is self-assembled to be present on the outer surface of a target cell. Target comprising the first and second domains within a continuous polypeptide chain forming an oligomeric ligand having the ability to bind to a receptor that forms a lipid envelope particle-target cell complex. A method of targeting a label that can be transferred to cells. 37. A method of delivering a label transferable to a target cell, the method comprising contacting the target cell with a lipid envelope particle, the lipid envelope particle comprising: (a) a transferable label; b) A recombinant fusion protein that is present on the outer surface of the lipid envelope particle and comprises a first and a second polypeptide separated by a protein recognition site, provided that the first polypeptide self-associates and binds to the target cell. The first and second domains within a contiguous polypeptide chain forming an oligomeric ligand capable of binding to a receptor present on the outer surface, thereby forming a lipid envelope particle-target cell complex. A step of containing a protein, and How contacting coalescence, thereby the first polypeptide was cleaved from the second polypeptide, the transferable label and a step of transferring to a target cell, to the delivery ring metastatic labels to target cells. 38. The method according to claim 36 or 37, wherein the target cells are eukaryotic cells. 39. The method of claim 38, wherein the eukaryotic cell is a mammalian cell. 40. The method of claim 39, wherein the mammalian cell is a human cell. 41. The method according to claim 36 or 3, wherein the target cell is in vitro.
7. The method according to 7. 42. The method of claim 36 or 37, wherein the target cell is the mammalian body. 43. A method for screening a test substance having the ability to dissociate an oligomeric ligand into its component subunits, which comprises the step of contacting a target cell with a virus particle, wherein the virus particle is (a)
A) a transferable label, and (b) a recombinant fusion protein present on the outer surface of the viral particle and comprising a first and a second polypeptide, wherein the first polypeptide is self-associating. And comprising a first and a second domain within a continuous polypeptide chain forming an oligomeric ligand capable of binding to a receptor present on the outer surface of the target cell in the target cell in the presence of a test substance. Of the amount of the transferable label in the target cell in the absence of the test substance compared to the amount of the transferable label in the target cell in the absence of the test substance. Screening the test substance with the ability to dissociate the oligomeric ligand into its constituent subunits, including the step of dissociating the ligand into its constituent subunits. Law. 44. An isolated polynucleotide encoding a recombinant fusion protein comprising a first polypeptide and a second polypeptide fused to each other via a peptide bond, the first polypeptide. Comprises at least two subunits of a cysteine knot growth factor with a characteristic PDGF-like family signature selected from the group consisting of PDGF and VEGF, and the second polypeptide is a 4070A envelope protein, a Moloney MLV envelope protein,
And an isolated polynucleotide comprising a substantially intact viral envelope protein selected from the group consisting of gibbon ape leukemia virus envelope proteins.