JP2003511030A - Growth factor polypeptides and nucleic acids encoding growth factor polypeptides - Google Patents

Abstract

(57) SUMMARY The present invention provides nucleic acids encoding polypeptides that are partially related to bone morphogenetic protein-1 (BMP-1), vascular endothelial growth factor (VEGF-E), and platelet-derived growth factor (PDGF). Based on the discovery of The nucleic acids, polynucleotides, proteins and polypeptides described herein, or fragments thereof, are collectively referred to as FCTRLX nucleic acids and FCRTX polypeptides. In one aspect, the invention provides an isolated FCTRLX polypeptide or a fragment of a FCTRLX polypeptide.

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates to nucleic acids and polypeptides. More specifically, the present invention discloses novel nucleic acids and polypeptides having growth factor activity in mammals.
Further disclosed are antibodies specific for these polypeptides.

BACKGROUND OF THE INVENTION Polypeptide growth factors that affect a variety of tissues have been described. These growth factors include bone morphogenetic protein-1 (BMP-1), vascular endothelial growth factor (
VEGF), and Platelet Induced Growth Factor (PDGF).

Multiple effects have been attributed to BMP-1. For example, BMP-1 can induce cartilage formation in vivo. BMP1 is also identical to purified procollagen C proteinase (PCP), a secreted calcium-dependent metalloprotease that has been reported to be required for cartilage and bone formation. BMP-1 cleaves the C-terminal propeptides of procollagen I, II and III, and its activity is increased by the procollagen C-endopeptidase enhancer protein.

Vascular endothelial growth factor (VEGF) polypeptides have been reported to act primarily as mitogens for vascular endothelial cells. Due to its specificity for vascular endothelial cells, VEG
F polypeptides contrast with other polypeptide mitogens, such as the basic fibroblast growth factor and platelet-derived growth factor that are active against a wide range of cell types.

VEGF has also been reported to affect tumor angiogenesis. For example, VEGF
Have been shown to stimulate elongation, network formation and branching of non-proliferating endothelial cells in cultures lacking oxygen and nutrients.

The platelet-derived growth factor (PDGF) family is now composed of at least three different genes (PDGF A, PDGF B, and PDGF C),
These gene products selectively signal through two PDGFRs and regulate various cellular functions. PDGF A, PDGF B, and PDGF C dimerize in solution to form homodimers as well as heterodimers.

Expression of RNA encoding the PDGF A and PDGF B subunits is
Reported in vascular tissue involved in atherosclerosis. PDGF A and PDGF B mRNAs were reported to be present in mesenchymal revealing intimal cells and endothelial cells of atherosclerotic plaques, respectively. Furthermore, PDGF receptor mRNA was also localized mainly in plaque intimal cells.

PDGF B relates to the simian sarcoma virus transforming gene (v-sis). PDGF B was also reported to be a mitogen for cells of mesenchymal origin. PDGF B was further implicated in autocrine growth stimulation in the pathological proliferation of endothelial cells characteristically found in glioblastoma. PDGF was also reported to promote cell proliferation and inhibit apoptosis.

SUMMARY OF THE INVENTION The present invention partially encodes polypeptides for bone morphogenetic protein-1 (BMP-1), vascular endothelial growth factor (VEGF-E), and platelet-derived growth factor (PDGF). Based on the discovery of nucleic acids that Nucleic acids, polynucleotides, proteins and polypeptides described herein, or fragments thereof,
Collectively referred to as FCTRX nucleic acid and FCTRX polypeptide.

In one aspect, the invention features an isolated FCTRX polypeptide or F
A fragment of the CTRX polypeptide is provided. FCTRX polypeptide is
For example, it may include an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10 and 12. Also within the scope of the invention are FCTRX polypeptides comprising amino acid sequences of variants of the amino acid sequences of SEQ ID NOs: 2, 4, 6, 8, 10 and 12. In some embodiments, one or more amino acids in this variant sequence is changed to a different amino acid. In some embodiments, no more than 15% of the amino acid residues in the amino acid sequence of this variant are changed. FCT of the present invention
The RX polypeptide may also be a mature form of the polypeptides of SEQ ID NOs: 2, 4, 6, 8, 10 and 12 (eg, a polypeptide having the amino acid sequence of amino acids 24-370 of SEQ ID NO: 2, or the corresponding in SEQ ID NO: 4). Fragment). In another embodiment, the invention features SEQ ID NOs: 2, 4, 6, 8, 10 and 12.
A variant of the mature form of a polypeptide comprising the amino acid sequence of In the variant form, one or more amino acids identified in the selected sequence are changed to a different amino acid. In some embodiments, 15% or less of the amino acid residues in the amino acid sequence of this mature form of the variant differ from the sequences of the polypeptides of SEQ ID NOs: 2, 4, 6, 8, 10 and 12.

Also provided by the invention are fragments of FCTRX polypeptides, fragments of variant forms of FCTRX polypeptides, fragments of mature forms of FCTRX polypeptides, or fragments of mature forms of FCTRX polypeptides. Fragments of FCTRX polypeptides include, for example, amino acids 247-370 of SEQ ID NO: 2, amino acids 247-338 of SEQ ID NO: 2, and amino acids 339-370 of SEQ ID NO: 2, and the corresponding homologous fragments of SEQ ID NO: 4. .

The present invention also provides FCTRX nucleic acid molecules, including nucleic acid molecules such as SEQ ID NOs: 1, 3, 5, 7, 9 and 11 encoding FCTRX polypeptides, variants of FCTRX polypeptides. , A nucleic acid encoding a mature form of the FCTRX polypeptide, or a nucleic acid encoding a variant of the mature form of the FCTRX polypeptide.

The invention also features an antibody that immunospecifically binds to the FCTRX polypeptide. The antibody can be, for example, a monoclonal antibody, a humanized antibody, or a human antibody.

In another aspect, the invention includes a pharmaceutical composition comprising a therapeutically effective amount or a prophylactically effective amount of a therapeutic agent and a pharmaceutically acceptable carrier. The therapeutic agent is, for example,
It may be an FCTRX nucleic acid, a FCTRX polypeptide, or an antibody specific for a FCTRX polypeptide. In a further aspect, the invention comprises a therapeutically or prophylactically effective amount of this pharmaceutical composition in one or more containers.

[0015] In a further aspect, the present invention provides a cell containing an FCTRX nucleic acid to the FCTRX nucleic acid.
Methods of producing a polypeptide by culturing under conditions that allow expression of the FCTRX polypeptide encoded by the X nucleic acid are included. FCTRX if desired
The polypeptide can then be recovered.

In another aspect, the invention includes a method of detecting the presence of FCTRX polypeptide in a sample. In this method, a sample is contacted with a compound that selectively binds to the polypeptide under conditions that allow complex formation between the polypeptide and the compound. This complex, if present, is detected, thereby identifying the FCTRX polypeptide in the sample. The compound can be, for example, an anti-FCTRX antibody, or a polypeptide that binds to another FCTRX polypeptide.

Contacting the sample with an FCTRX nucleic acid probe or primer detects the presence of the FCTRX nucleic acid in the sample and detects whether the nucleic acid probe or primer is bound to the FCTRX nucleic acid molecule in the sample. Methods are also included in the invention.

In a further aspect, the invention provides methods for modulating the activity of FCTRX polypeptides. The method involves contacting a cell sample containing an FCTRX polypeptide with a compound that binds to the FCTRX polypeptide in an amount sufficient to modulate the activity of the polypeptide. The compound may be a small molecule, eg, a nucleic acid, peptide, polypeptide, peptidomimetic, carbohydrate, lipid or organic (carbon-containing) or inorganic molecule, as further described herein. .

The present invention further includes methods for screening for modulators of disorders or syndromes including, for example, cancer. In this method, the test compound is FCTRX.
Contacting with a polypeptide and determining if the test compound bound to the FCTRX polypeptide. Binding of the test compound to the FCTRX polypeptide indicates that the test compound is a modulator of activity, or a latent or predisposed modulator of a disorder or syndrome. 1
In one embodiment, the candidate test compound has a molecular weight of about 1500 Da or less.

Also within the scope of the invention is a method for screening for modulators of activity against, or latency or predisposition to, any FCTRX-related disorder or syndrome, which involves testing a test compound with the disorder or syndrome described above. Administering to a test animal with an increased risk of. The test animal expresses a recombinant polypeptide encoded by the FCTRX nucleic acid. Then FC
Expression or activity of TRX polypeptide was measured in this test animal, FC
Expression or activity of the protein in control animals that recombinantly express TRX polypeptide and are not at risk for the disorder or syndrome is also measured. Next, the expression of FCTRX polypeptide in both test and control animals is compared. An alteration in the activity of the FCTRX polypeptide in the test animal relative to the control animal indicates that the test compound is a latency modulator of the disorder or syndrome.

[0021] In yet another aspect, the invention provides a subject (eg, a human subject),
FCTRX polypeptides, including methods for determining the presence of or a predisposition to a disease associated with altered levels of FCTRX nucleic acid. This method comprises the steps of measuring the amount of FCTRX polypeptide in a test sample from a subject and determining the amount of polypeptide in this test sample as F present in a control sample.
Comparing the amount of CTRX polypeptide. An altered level of FCTRX polypeptide in the test sample as compared to the control sample is indicative of the presence of or predisposition to the disease in the subject.

In a further aspect, the invention provides a subject (eg, a human subject) with FCTR.
X polypeptide, FCTRX nucleic acid, or FCTRX-specific antibody is administered in an amount sufficient to reduce or prevent the pathological condition to treat the pathological condition associated with the disorder in a mammal or Including methods to prevent.

The FCTRX nucleic acids according to the present invention may be used to identify a variety of cell types, including cancerous cells. For example, Example 7 illustrates that clone 30664188.0.99 (SEQ ID NO: 1) is specifically and strongly expressed in CNS, lung and ovarian cancers. It is also shown in the examples that SEQ ID NO: 1 produces a gene product that either remains intact in conditioned medium resulting from transfected HEK293 cells or is proteolytically cleaved. Example 13
The evidence shown in is active in various experiments (reported in the examples) 30.
The form of the 664188.0.99 protein (SEQ ID NO: 2) is 30664188.
． It is suggested to be a proteolytic product of 0.99 protein. As shown in the examples, the activity due to one or both of these substrates includes:
They include the ability to stimulate net DNA synthesis as monitored by BrdU DNA integration, the proliferation of cell numbers, the ability to transform cells in culture, and the ability to induce tumorigenesis in vivo. These different activities occur in a variety of cell types.

FCTRX nucleic acids, and their encoded polypeptides, can also be used to regulate cell proliferation. For example, SEQ ID NOs: 2, 4, 6, 8, 10 and 12
Or, a polypeptide having the entire amino acid sequence seems to have a specific function in various cells. In addition to stimulating the growth and proliferation of specific cells, it is endogenously expressed in specific classes of tumor cell lines. Accordingly, FCTRX polypeptides (eg, SEQ ID NOs: 2, 4, 6, 8, 10 and 12)
Polypeptides having amino acid sequences of) can be used when net cell growth and proliferation is desired, and in different environments where cell proliferation is inhibited or eliminated.

FCTRX nucleic acids or gene products (eg, nucleic acids encoding SEQ ID NOs: 2, 4, 6, 8, 10 and 12) are used to promote wound healing, neovascularization and tissue growth,
It is also useful as a therapeutic factor when similar tissue regeneration is required. More specifically, FCTRX nucleic acids or polypeptides may be useful in treating anemia and leukopenia, intestinal susceptibility and baldness. Treatment of such conditions may be indicated, for example, in patients who have received radiation or chemotherapy. In such cases, FC
TRX nucleic acids or polypeptides (eg, polypeptides comprising the amino acid sequence of SEQ ID NOs: 2, 4, 6, 8, 10 or 12 or nucleic acid sequences encoding these polypeptides (eg, SEQ ID NOs: 1, 3, 5, 7) , 9 or 11) is intended to be dose controlled such that any hyperproliferative side effects are minimized.

Alternatively, in the case of tumors (eg CNS cancer and ovarian cancer), where FC
TRX nucleic acids are expressed at high levels (eg, tumors in SEQ ID NO: 1 are expressed at high levels), FCTRX nucleic acids or gene products (eg, SEQ ID NO: 2 or SEQ ID NO: 4, or one of these polypeptides). It is desirable to inhibit or eliminate the effects of the production of the For example, this can be achieved by administration of an antibody directed against the polypeptide having the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or a fragment thereof. In particular, the antibody is
It can be directed against the active fragment p35 identified herein (see Examples). An alternative example involves the identification of putative proteases involved in the formation of p35 from p85 (see Examples). Administration of a substance that specifically inhibits the activity of this protease but not the activity of other proteases is effective to prevent the formation of the active p35 form of the FCTRX polypeptide (eg, clone 30664188.0.99 polypeptide). Is.

FCTRX polypeptides and FCTRX nucleic acids in malignant disease progression and gene expression profiles described herein (eg, BMP-1, VEGF-like polypeptides such as fallotein, and PDGF).
For a subset of human gliomas and ovarian epithelial cancers, targeting FCTRX polypeptides with antibodies to tumor growth, matrix invasion, chemoresistance, radioresistance and metastasis. It is expected to have an inhibitory effect on catabolism. In various embodiments, the FCTRX polypeptide is linked to a monoclonal antibody, a humanized antibody or a fully human antibody.

FCTRX polypeptides may potentially block or limit the extension of tumor neovascularization. In addition to the classical modes of administration of effective antibody therapeutics, newly developed modes of administration may be useful. For example, topical administration of ¹³¹ I-labeled monoclonal antibodies for the treatment of primary brain tumors after surgical resection has been reported. Moreover, direct stereotactic intracerebral injections of monoclonal antibodies and fragments thereof have also been studied clinically and preclinically. Intercarotid hyperosmotic perfusion is an experimental strategy for targeting primary brain malignancies with drug-conjugated human monoclonal antibodies.

Furthermore, the nucleic acids of the invention and fragments and variants thereof can be used as a non-limiting example: (a) biosynthesis of the corresponding encoded proteins, polypeptides, fragments and variants, recombinant gene products. Alternatively, it may be used as a heterologous gene product, (b) as a probe for detection and quantification of the nucleic acids disclosed herein, (c) as a sequence template for preparing antisense molecules, and the like. . Such uses are more fully described in the disclosure below.

Furthermore, the proteins and polypeptides of the present invention, and fragments and variants thereof, serve as (a) an immunogen for stimulating the production of anti-FCTRX antibodies, (b) immunization with such antibodies. Capture antigen in an authenticity assay, and (c) as a target for screening for agents that bind to the FCTRX polypeptides of the invention. FCTR
These and other uses for X nucleic acids, polypeptides, antibodies, agonists, antagonists and other related compounds are more fully disclosed below.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
Methods and materials similar or equivalent to those described herein are
Suitable methods and materials that may be used in the practice or testing of the present invention are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other features and advantages of the invention will be apparent from the following detailed description and claims.

DETAILED DESCRIPTION OF THE INVENTION The present invention encodes polypeptides associated with bone-morphogen protein-1 (BMP-1) vascular endothelial growth factor (VEGF-E) and platelet-derived growth factor (PDGF). Provide a nucleic acid.

Novel nucleic acid sequences and their encoded polypeptides are included in the present invention.
These sequences are collectively referred to as "FCTRX nucleic acids" or "FCTRX polynucleotides" and the corresponding encoded polypeptides are referred to as "FCTRX polypeptides" or "FCTRX proteins." Unless otherwise indicated, "FCTRX" is intended to refer to any of the novel sequences disclosed herein. Furthermore, the polypeptides and nucleic acids of the invention are collectively and alternatively referred to herein as "PDGFD." Furthermore, "PDGFXX" (here "X"
Is any of A, B, C or D), which means that
It is intended to refer to a homodimer of DGF. Alternatively, "PDGFXY" (where X and Y are either A, B, C or D, and "X" is "
When different from Y ") is mentioned, this is intended to refer to PDGF heterodimers.

It is shown herein that PDGFD has a high molecular weight latent form (designated p85) and a low molecular weight active form (designated p35).

FCTR1 Nucleic Acids and Polypeptides FCTR1 polynucleotides of the present invention are clones 30664188.0.9.
9 includes a nucleic acid represented by 9. Clone 30664188.0.99 is 1828 nucleotides long. FCTR1 (30664188.0.99 or PDGF
The nucleotide sequence of (also referred to as D) is reported in Table 1 (SEQ ID NO: 1). This clone was originally obtained from RNA derived from pituitary tissue. And this is
Human uterine microvascular endothelial cells (Clonetics, San Diego, CA)
It is also present in RNA from human erythroleukemia cells (ATCC, Manassas, VA), thyroid, small intestine, lymphocytes, adrenal glands and salivary glands.

[0037]   (Table 1. Nucleotides (SEQ ID NO: 1) and proteins (SEQ ID NO: 2)   Sequence of FCTR1 (also called 30664188-0-99)   Translated protein-frame: 2-nucleotides 182-1292)

[0038]

[Table 1] Nucleotides 182-1292 of SEQ ID NO: 1 encode a 370 amino acid protein (SEQ ID NO: 2) that contains the characteristic sequence of the secreted protein. The sequence of the encoded protein, which is referred to herein as "30664188.0.99 protein", "30664188.0.99", "PDGFD" or "human PDG".
(Also referred to as FD)) is shown in Table 1. The estimated molecular weight of 30664188.0.99 protein is 42847.8 daltons and has a pI of 7.88.

BLASTN and BLASTP analyzes indicate that the 30664188.0.99 polypeptide has similarities to human vascular endothelial growth factor E (VEGF-E) and VEGF-E from other vertebrate species. . For example, there is 44% identity to human secretory growth factor-like protein (VEGF-E or fallotein; accession number: AAF00049 (which refers to gene bank ID): AF091434 for nucleic acid sequences). . An alignment of the amino acid sequence of the 30664188.0.99 polypeptide with VEGF-E is:
As shown in FIG. BLASTP analysis also showed that FCTR1 showed that human PDGF C,
It is shown to be associated with PDGF B and PDGF A (42%, 27%, and 25% overall amino acid identity, respectively).

PFAM and PROSITE analyzes indicate that the 30664188.0.99 polypeptide amino acid sequence contains a PDGF domain (amino acids 272-362) and an N-linked glycosylation site (residue 276).

The 30664188.0.99 polypeptide amino acid sequence is derived from human procollagen C-endopeptidase (bone morphogenetic protein-1; BMP-1; PIR-
ID: A58788), which shows similarity to the sequence of a 823 residue polypeptide. Residues 54-16 of the 30664188.0.99 polypeptide
9 shows 30-41% identity over the three segments of BMP-1 polypeptide. This 30664188.0.99 polypeptide also binds to Xenopu.
s lavis (ACC number: P98070) -derived BMP-1 (this is 70
A 7-residue protein). The latter protein may act as a zinc protease during cartilage and bone formation (Wozne
y, et al., Science 242: 1528-34, 1988).

The 30664188.0.99 polypeptide is also associated with other growth factors. For example, this is the chicken spinal cord-derived growth factor (TREMBLNEW-ACC: BA
B03265) and 42% identity, 59% similarity, human secretory growth factor-like protein phallotein (SPTREMBL-ACC: Q9UL22) 42% identity and 59% identity, human platelet derived growth factor C (TREMBLN).
EW-ACC: AAF80597) with 42% identity and 39% similarity,
It also shows 39% identity and 59% similarity to mouse farogen (SPTREMBL-ACC: Q9QY71).

The homology discussed above identifies the 30664188.0.99 polypeptide as a member of the BMP-1 / VEGF-E / PDGF protein family. The BMP-1 protein contains an EGF-like domain, three CUB domains and a PDGF / VEGF domain. The BMP-1 protein is also a member of the astacin subfamily.

SignalP and PSORT analysis predict that the amino acid sequence for 30664188.0.99 contains a cleavable amino-terminal signal peptide with a cleavage site between positions 23 and 24 (TSA-TP). To do. This protein is mostly secreted and localized outside the cell. The InterPro software program uses the CU in residues 3064 to 167 at 30664188.0.99.
Predict the presence of the B domain, the PDGF domain spanning residues 272-306 and 350-362, and the metallothionein domain of residues 302-365. FCTR1 polypeptides of the present invention include polypeptides having 1, 2, 3 or 4 of these domains or combinations thereof.

FCTR1 polypeptides of the present invention include mature forms of FCTR1 polypeptides that include amino acids 24-370 of SEQ ID NO: 2. These sequences are also clone 3
0664188.0. encoded in the construct encoded by m99, which
It is described in more detail below. Nucleic acids encoding FCTRX polypeptide fragments comprising the amino acid sequence 247-370, 247-338 or 339-370 or variants thereof are also within the scope of the invention. In some embodiments, these fragments stimulate proliferation of cells. FCTRX polypeptide fragments encoded by these nucleic acids, or variants thereof, are also
It is within the scope of the present invention.

(FCTR2 Nucleic Acid and Polypeptide) The FCTR2 polynucleotide of the present invention can be cloned into clone 30666418.0.
331 present nucleic acid sequence. Clone 306664188.0.331 is 1587 nucleotides long and originally contains RNA from pituitary tissue.
Isolated from. The nucleotide sequence of FCTR2 (also referred to as 306664188.0.331) is shown in Table 2 (SEQ ID NO: 3).

Table 2. Nucleotide (SEQ ID NO: 3) and protein (SEQ ID NO: 4) sequences of FCTR2 (3066664188-0-331) Translated protein-frame: 3-nucleotides 540-936

[0048]

[Table 2] Clone 306664188.0.331 contains the open reading frame nucleotides 540-936. This open reading frame is 1
It encodes a polypeptide of 32 amino acids (SEQ ID NO: 4). This encoded polypeptide is referred to herein as "306664188.0.331 protein" or "306664188.0.331 polypeptide". 30666
The deduced amino acid sequence of the 4188.0.331 nucleic acid sequence is shown in Table 2 (SEQ ID NO: 4).

Nucleotides 50 to 1472 of clone 306664188.0.331 are
100% identical to nucleotides 406-1828 of clone 30664188.0.99. The 132 amino acids of this clone 30666418.0.331 protein are 100% identical to the carboxy-terminal region of the protein sequence of 30664188.0.99. Therefore, clone 30664188.0.9.
The nucleic acids 9 and 306664188.0.331 are thus associated as common gene splice variants.

The 3066364188.0.331 protein is the human growth factor FIGF (c-
fos-induced growth factor; ptnr: SPTREMBL-ACC: O43915),
Platelet-derived growth factor / vascular endothelial growth factor (PDGF / BEGF) family members, and rat vascular endothelial growth factor D (ptnr: SPTREMBL-AC
C: O35251).

FCTR3 Nucleic Acids and Polypeptides FCTR3 according to the present invention (herein PDGFD or mouse PDGFD
Alternatively, nucleic acids and polypeptides also referred to in Table 3 (SEQ ID NO: 5).
And 6) containing the nucleic acid and encoded polypeptide sequences. FCT
The R3 nucleic acid sequence was identified from a mouse brain library. The putative open reading frame encodes a 370 amino acid long secretory protein. This F
CTR3 has an estimated molecular weight of 42,808 daltons and a pI of 7.53.

Protein structural analysis using PFAM and PROSITE was performed using FCTR3
A core PDFG domain within the polypeptide sequence was identified. The alignment of this domain is shown in FIG.

Table 3. Nucleotide (SEQ ID NO: 5) and protein (SEQ ID NO: 6) sequences of FCTR3)

[0054]

[Table 3] FCTR4 Nucleic Acids and Polypeptides FCTR4 according to the invention (herein PDGFD or mouse PDGFD
Alternatively, nucleic acids and polypeptides also referred to in Table 4 (SEQ ID NO: 7).
And 8) containing the nucleic acid and encoded polypeptide sequences. FCT
The R4 nucleic acid sequence was identified from a mouse brain library and is a splice variant of FCTR3. However, unlike FCTR3, FCTR4 lacks a significant portion of the PDGF-like domain.

Table 4. Nucleotide (SEQ ID NO: 7) and protein (SEQ ID NO: 8) sequences of FCTR4)

[0056]

[Table 4] FCTR5 Nucleic Acids and Polypeptides FCTR5 (also referred to herein as PDGFD or human PDGFD or hPDFGD) nucleic acids and polypeptides according to the invention are clones of pCR2.
1-S852_2B nucleic acid and encoded polypeptide sequences are included and are shown in Table 5 (SEQ ID NOS: 9 and 10). The FCTR5 nucleic acid sequence is FCTR1.
Was identified as a splice variant of.

Similar to FCTR1, the protein structural analysis programs PSORT, PFAM and PROSITE show that FCTR5 has a characteristic signal peptide (amino acid 1
-23), a PDGF domain (amino acids 272-362) and an N-linked glycosylation site (residue 276). BLASTP analysis is based on human FG
TR5 has PDFG C, PDFG B and PDFG A (42%, 27 respectively)
% And 25% overall amino acid identity). An alignment of the core PDGF domains of PDFCG C, PDFG B and PDFGA A with human PDFGD is presented in FIG. From this alignment, it is shown that PDFGD possesses 7 out of 8 invariant cysteines involved in intrachain and interchain disulfide bonds in which the 5th cysteine conserved in other sequences is replaced by a glycine residue. Is clear (FIG. 12, asterisk).

(Table 5. Nucleotide (SEQ ID NO: 9) and protein (SEQ ID NO: 10) sequences of FCTR5 (clone pCR2.1-S852_2B))

[0059]

[Table 5] FCTR6 Nucleic Acids and Polypeptides FCTR6 (also referred to herein as PDGFD or human PDGFD or hPDFGD) nucleic acids and polypeptides according to the invention are clones of pCR2.
1-S869_4B nucleic acid and encoded polypeptide sequences are included and are shown in Table 6 (SEQ ID NOS: 11 and 12). The FCTR6 nucleic acid sequence is FCTR
Was identified as a splice variant of 1.

FCTR6 contains most of the 5'end of the full length gene (FCTR1) but is spliced to a potential non-consensus splice site at the extreme 3'end of the coding sequence. This splicing introduces a stop codon immediately downstream of this splice site. This splice variant contains the intact CUB domain of 30664188.0.99 but lacks the PDGF domain, indicating a possible regulatory function of the molecule.

However, similar to FCTR1, the protein structure analysis programs PSORT, P
FAM and PROSITE predicted that FCTR6 contains a characteristic signal peptide (amino acids 1-23), CUB domain (amino acids 53-167) and N-linked glycosylation site (residue 276). BLASTP analysis showed that human FGTR5 had PDFG C, PDFG B and PDFG A (42% each,
Most closely related to 27% and 25% overall amino acid identity). An alignment of the core PDGF domains of PDFCG C, PDFG B and PDFGA A with human PDFGD is presented in FIG. From this alignment, PDFGD is involved in intrachain and interchain disulfide bonds in which the conserved fifth cysteine in other sequences is replaced by a glycine residue. 8
It is clear that it carries seven of the four invariant cysteines (Figure 12, asterisk).

Table 6. Nucleotide (SEQ ID NO: 11) and protein (SEQ ID NO: 12) sequences of FCTR6 (clone pCR2.1-S869_4B)

[0063]

[Table 6] The similarity of the disclosed FCTRX polypeptides to the BMP-1 VEG-E and PDGF polypeptides described above indicates a similarity of function with the FCTRX nucleic acids and polypeptides of the invention. Their utility is described in more detail below.

Where BMP-1 can also induce cartilage formation in vivo, FCTRX nucleic acids and polypeptides can be used to induce cartilage formation (Wozney et al., S.
science 242: 1528-34, 1988).

A further use for FCTRX nucleic acids and polypeptides is in the regulation of collagen formation. Recombinantly expressed BMP1 and purified procollagen C
The proteinases (PCPs), secretory metalloproteases that require calcium and are required for cartilage and bone formation are virtually identical. Kessler et al.
See Science 271: 360-62 (1996). BMP-1
Cleaves the C-terminal propeptides of procollagen I, II and III, and this activity is enhanced by the procollagen C endopeptidase enhancer protein. FCTRX nucleic acids and polypeptides may play a similar role in the collagen regulatory pathway.

FCTRX nucleic acids and polypeptides are also used to cause a variety of cancers (st
age) get. For example, bone metastases can almost always be correlated with morbidity and mortality of certain prostate cancers. For example, bone morphogenetic proteins have been implicated as having important roles in various cancers. Overexpression of bone morphogenetic protein (BMP) -4 and BMP-2 mRNA was reported in a poorly differentiated type of gastric cancer cell line. Katho et al. Gastro
enterol 31 (1): 137-9 (1996). This observation may have implications for the poor prognosis of patients with diffuse bone forming bone metastases of gastric cancer. In addition, osteosarcoma that produces bone morphogenetic proteins (BMPs) differs in clinical features from osteosarcoma that does not produce BMPs. Yoshikawa et al.
See Cancer 56: 1682-7 (1985). These were radiologically with vertical spiculas, histologically with osteoclast-type cells, and increased serum alkaline phosphatase levels, relative resistance to preoperative chemotherapeutic therapy with Adriamycin (doxorubicin) and high-dose methotrexate, and others. Was clinically characterized by its tendency to metastasize to the bones and lungs.

The relevance of FCTRX polypeptides to VEGF has been implicated in F in neovascularization.
Clarify the uses of CTRX nucleic acids and polypeptides. Neovascularization is the process that contributes to the development of new blood vessels. During neovascularization, new capillaries develop from existing blood vessels. Risau FASEB J. 9 (10): 926-33
(1995); Risau et al., Ann. Rev. Cell Dev Biol.
11: 73-91 (1995). In adult mammals, new blood vessels are created through angiogenesis. The pathological stages in which angiogenesis contributes to the appearance and maintenance of pathology include tumor development and growth. Vascular endothelial growth factor F has been reported to be involved in angiogenesis.

Vascular Endothelial Growth Factor (VEGF) is a multifunctional cytokine that is expressed and secreted at high levels by many tumor cells, both non-human and human. Ferrara, Curr Top Microbiol Immunol
See review at 237: 1-30 (1999). VEGF exerts its effect on the vascular endothelium via at least two receptors, which are expressed on the cell surface. The first is the kinase insertion domain containing receptor (KDR) / fetal liver kinase 1 (Flk-1), and the second is FLT-1 (W
Arren et al., J Clin Invest 95 (4): 1789-97 (1).
995)). These two receptors have different affinities for VEGF and appear to have different cellular responses. Athanassiades et al.,
Plancenta 19 (7): 465-73 (1998); Li et al., Cel.
l Res 9 (1): 11-25 (1999). FLT-1 null mice died at the embryonic stage (about 8.5 days), while KDR null mice survived birth and maintained endothelial and hematopoietic development. KDR activation is
Mitogenic and e-nitric oxide synthase (eNOS) and induced NOS (
Is an enzyme in the nitric oxide pathway that contributes to the regulation of vasodilation, and this results in up-regulation of vascular tumorigenesis).

It has also been reported that VEGF acts as a survival factor to form new blood vessels. For example, in the developing retina, vascular regression in response to hyperoxia has been correlated with inhibition of VEGF release by glial cells. Alon et al.
See Nat Med 1 (10): 1024-8 (1995). Furthermore, administration of anti-VEGF monoclonal antibody results in regression of the already established tumor-associated vasculature at the exit of the xenograft. Yuan et al., Proc Natl Ac
See ad Sci USA 93 (25): 14765-70 (1996). Thus, antibodies to FCTRX polypeptides may also be used to induce or promote regression of newly formed blood vessels.

Tumor cells further responded to hypoxia by secreting VEGF. This response promotes neovascularization and subsequent tumor growth. In addition, some tumor cells (including hematopoietic cells) (Bellamy et al., Cancer
Res 59 (3): 728-33 (1999)), breast cancer cells (Spairs et al., Br J Cancer 80 (5-6): 898-903 (1999)) and Kaposi's sarcoma (Masood et al., Proc Natl Acad Sci).
USA 94 (3): 979-84 (1997)) have been found to express the KDR receptor. Such results indicate that in these tumors VEG
F stimulates endothelial cell proliferation and / or survival and / or promotes tumor cell survival not only through paracrine mode as in angiogenesis, but also through the autocrine mechanism as well. Suggests that it is working. Therefore, FCTR
Modulation of angiogenesis by X antibodies, other antagonists of FCTRX nucleic acids or polypeptide function may also induce endothelial cell proliferation and / or tumor cells (eg, hematopoietic cells, breast cancer cells and Kaposi's sarcoma) in anoxia-related conditions. Can be used to inhibit

The similarity between FCTRX and VEGF polypeptides is
It is suggested that X nucleic acids and their encoded polypeptides may be used to regulate cell survival. It has been reported that VEGF signaling is important for cell survival. Receptor (VEGF receptor-2 (VEGFR-
2 / Flk1 / KDR)) binding to VE-cadherin, β-catenin, phosphoinositide-3-OH kinase (PI3-K) and KDR. PI
It is reported that it induces the formation of a 3-K complex, which activates the serine / threonine protein kinase Akt (protein kinase B) by phosphorylation. Carmeliet et al., 1999 Cell 98 (2): 14.
See 7-57. Activated Akt is then considered necessary and sufficient to mediate VEGF-dependent survival signals. Gerber et al., 1998 J
． Biol. Chem. 273 (46): 30336-43. These findings indicate that there is a relationship between VEGF signaling and cell survival.

The similarity between FCTRX and PDGF polypeptides is
It is suggested that X nucleic acids and their encoded polypeptides may be used in therapeutic and diagnostic applications. For example, FCTRX nucleic acids and their encoded polypeptides can be used to treat cancer, cardiovascular and fibrotic diseases and diabetic ulcers. In addition, FCTRX nucleic acids and their encoded sequences are therapeutically useful in blocking aneurysms and accelerating wound closure via gene therapy. In addition, FCTRX nucleic acids and their encoded polypeptides can be used to stimulate cell proliferation.

The FCTRX nucleic acids according to the present invention can be used to identify a variety of cell types, including cancerous cells. For example, Example 7 is clone 30664188.
． 0.99 (SEQ ID NO: 1) is specifically and strongly expressed in CNS, lung and ovarian cancers. In this example, SEQ ID NO: 1 is HEK293.
It has also been shown to produce gene products that remain intact or are proteolytic in conditioned medium resulting from transfection of cells. The evidence shown in Example 13 shows that the form of the 30664188.0.99 protein (SEQ ID NO: 2), which is active in the experiments reported in this Example, is 306
It is suggested that this is a proteolytic product of the 64188.0.99 protein.
Activities due to one or both of these agents include BrdU incorporation into DNA, the ability to stimulate net DNA synthesis as monitored by an increase in cell number, the ability to transform cells in culture. , And the ability to induce tumor formation in vivo. These different activities occur in different cell types.

FCTRX nucleic acids or gene products (eg, nucleic acids encoding SEQ ID NO: 2 or SEQ ID NO: 4) are useful as therapeutic agents in promoting wound healing, neovascularization and tumor growth, and similar tissue regeneration requirements. is there. More specifically, FCTRX
Nucleic acids or polypeptides are associated with anemia and leukopenia, intestinal hypersensitivity
It is useful in the treatment of tinal tract sensitivity) and baldness. Treatment of such conditions may be desirable, for example, in patients undergoing irradiation or chemotherapy. In such cases, the FCTX nucleic acid or polypeptide (eg, a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3, or a nucleic acid sequence encoding these polypeptides (eg, SEQ ID NO: 1 or SEQ ID NO: 3) The administration of) is intended to be controlled at a dose that minimizes any hyperproliferative side effects.

Alternatively, in the case of tumors (CNS cancer and ovarian cancer) in which FCTRX nucleic acid is expressed at high levels (eg SEQ ID NO: 1 is expressed at high levels), FCT
It is desirable to prevent or eliminate the effects of production of RX nucleic acid or gene product (eg, nucleic acid encoding SEQ ID NO: 2 or SEQ ID NO: 4, or one of these polypeptides). For example, this can be accomplished by administration of an antibody to the polypeptide having the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or a fragment thereof. In particular, the antibody may be directed against the active fragment p35 identified herein (see Examples). An alternative example is p85
Including the identification of putative proteases involved in the formation of p35 from E. coli (see Examples). Administration of a substance that specifically inhibits the activity of this protease and not the activity of other proteases will result in administration of FCTRX polypeptides (eg, 30664188).
． 0.99 polypeptide) is effective in preventing the formation of the active p35 form.

F in malignant disease progression and gene expression profiles described herein
Molecules related to CTRX polypeptides and nucleic acids (eg, BMP-1 and VMP
Targeting FCTRX polypeptides using antibodies to subsets of human gliomas and ovarian epithelial carcinomas based on the role of EGF-like polypeptides (eg, fallotein) is associated with tumor growth, matrix invasion, chemoresistance. , Is expected to have an inhibitory effect on radiation resistance and malignant seeding. In various embodiments, the FCTRX polypeptide is linked to a monoclonal antibody, humanized antibody or fully human antibody.

In addition, based on chromosome location analysis (see Example 15), PDGFD
The nucleic acid is located on chromosome 11q23-24. This chromosomal locus for the D map has been found in various neoplasias (A. Ferti-Passantonopoulou,
A. Panani, S .; Raptis, Cancer Genet. Cytog
enet. 51, 183-188 (1991); Tarkkanen et al., G
enes Chromosomes Cancer 25, 323-331 (1
999)) and Jacobsen's syndrome, which may be partially explained by aberrant growth factor expression (E. Pivnick et al., J. Med. Genet. 33,
772-778 (1996)), a region of genomic instability that has been modified (H. Kurahashi et al., Hum. Mol. Genet. 9, 16).
65-1670 (2000)). Jacobsen's syndrome is characterized by craniofacial cranial abnormalities, heart defects, glandular abnormalities and loss of brain development (E. Pivnic et al.,
(1996)). Accordingly, FCTRX nucleic acids and polypeptides according to the present invention include
It can be used in various diagnostic and therapeutic applications for these disease states.

Furthermore, rearrangements resulting in amplification or deletion of the approximately 11q23-24 locus are associated with breast cancer (A. Ferti-Passantonopoulou, A. Panan).
i, S. Raptis, Cancer Genet. Cytogenet. 51
, 183-188 (1991); Shen et al. Surg. Oncol.
74, 100-107 (2000)), primary sarcomas, their lung metastases (M. Ta.
rkkanen et al. (1999)) and myeloid leukemia (L. Michaux et al.,
Genes Chromosomes Cancer 29, 40-47 (20
00); Crossen, L .; Savage, D.M. Heaton, M .; Mo
rrison, Cancer Genet. Cytogenet. 112,14
4-148 (1999)). Therefore, the FC according to the present invention
TRX nucleic acids, polypeptides and antibodies may also have diagnostic and therapeutic applications in the detection and treatment of these cancers.

FCTRX polypeptides can potentially block or limit the extent of tumor neovascularization. In addition to the classical mode of administration of potential antibody therapeutics, newly developed modes of administration may be useful. For example, topical administration of ¹³¹ I-labeled monoclonal antibodies for the treatment of primary brain tumors after surgical resection has been reported. further,
Direct stereotactic intracerebral injections of monoclonal antibodies and their fragments have also been studied clinically or preclinically. Intercarotid hyperosmotic perfusion is an experimental strategy for targeting primary brain malignancies using drug-conjugated human monoclonal antibodies.

Furthermore, the nucleic acids of the invention, as well as fragments and variants thereof, can be used, as non-limiting examples, for: (a) the recombinant gene product or its corresponding code as a heterologous gene product. To direct the biosynthesis of proteins, polypeptides, fragments and variants, (b) as a probe for the detection and quantification of the nucleic acids disclosed herein, (c) for preparing antisense molecules As an array template, etc. Such uses are more fully described in the disclosure below.

Furthermore, the proteins and polypeptides of the invention, and fragments and variants thereof, act as (a) an immunogen to stimulate the production of anti-FCTRX antibodies, (b) for such antibodies. Capture antigens in immunogenicity assays, and (c) can be used in methods involving them as targets for screening for substances that bind to the FCTRX polypeptides of the invention. FCT
These and other utilities for RX nucleic acids, polypeptides, antibodies, agonists, antagonists and other related compounds are disclosed more fully below. Given its potent effect on the regulation of cell proliferation, increased expression or activity of FCTRX polypeptide can be used to promote cell survival. Conversely, a decrease in FCTRX polypeptide expression can be used to induce cell death.

(FCTRX Nucleic Acids) The novel nucleic acids of the invention include nucleic acids encoding FCTRX polypeptides or biologically active portions thereof. These nucleic acids include SEQ ID NOs: 2, 4, 6, 8, 10
And 12 encoding a FCTRX polypeptide comprising one or more amino acid sequences. In some embodiments, SEQ ID NOs: 2, 4, 6, 8, 10
And a nucleic acid encoding a polypeptide having one or more amino acid sequences of 12,
It comprises the nucleic acid sequence of any of SEQ ID NOs: 1, 3, 5, 7, 9 and 11, or a fragment thereof.

Further, the FCTRX nucleic acids of the invention include SEQ ID NOs: 1, 3, 5, 7, 9 and 1.
1, any variant or variant nucleic acid, or fragment thereof, wherein any of these bases may be altered from the disclosed sequences,
It still encodes a protein that maintains X-like activity and physiological function. The invention further includes complements of nucleic acid sequences of any of SEQ ID NOs: 1, 3, 5, 7, 9 and 11 including fragments, derivatives, analogs and homologs thereof. The invention further includes nucleic acids or nucleic acid fragments, or their complements, whose structures include chemical modifications.

The FCTRX nucleic acid of the invention may encode a mature form of the FCTRX polypeptide. As used herein, a "mature" form or protein of a polypeptide refers to a naturally occurring polypeptide or precursor form or product of a proprotein. Naturally occurring polypeptides, precursor forms or proproteins include, by way of non-limiting example, the full-length gene product encoded by its corresponding gene. Alternatively, they may be defined as polypeptides, precursors or proproteins encoded by the open reading frames disclosed herein. The "mature" form of a product also results, as a non-limiting example, from one or more naturally occurring processing steps, if these steps occur in the cell or host cell in which the gene product occurs. Examples of such processing steps leading to the "mature" form of a polypeptide or protein include:
Examples include cleavage of the N-terminal methionine residue encoded by the start codon of the open reading frame, or proteolytic cleavage of the signal peptide sequence or leader sequence. Thus, the mature form resulting from a precursor polypeptide or protein having residues 1-N, where residue 1 is the N-terminal methionine, remains after removal of this N-terminal methionine. Have N. Alternatively, the mature form resulting from a precursor polypeptide or protein having residues 1-N, in which the N-terminal signal sequence of residues 1-M is cleaved, leaves the remaining residues M +
1 to residue N. In addition, a "mature" protein or fragment may result from a cleavage event other than removal of the initiating methionine or removal of the signal peptide. Furthermore, as used herein, the "mature" form of a polypeptide or protein may result from a step of post-translational modification other than a proteolytic event. Such additional processes include, by way of non-limiting example, glycosylation, myristylation or phosphorylation. In general, a mature polypeptide or protein may result from the manipulation of only one of these processes or any combination thereof.

A nucleic acid fragment sufficient for use as a hybridization probe to identify a nucleic acid encoding an FCTRX polypeptide (eg, FCTRX mRNA encoding SEQ ID NO: 2 or SEQ ID NO: 4), and FCTRX.
Also included are fragments for use as polymerase chain reaction (PCR) primers for amplification or mutation of nucleic acid molecules. As used herein, the term "nucleic acid molecule" refers to a DNA molecule (eg, cDNA or genomic DNA).
, RNA molecules (eg, mRNA), analogs of DNA or RNA produced using nucleotide analogs, and their derivatives, fragments and homologs. The nucleic acid molecule can be single-stranded or double-stranded, but is preferably double-stranded DNA.

“Probe” refers to nucleic acid sequences of various lengths, preferably at least about 10 nucleotides (nt), 100 nt, or as large as, for example, about 6,000 nt, depending on the application. Is in between. The probe is used in the detection of identical, similar or complementary nucleic acid sequences. Longer probes are usually obtained from natural or recombinant sources (but these can also be prepared by chemical synthesis), are very specific and hybridize much slower than oligomers. The probe can be single-stranded or double-stranded and is designed to have specificity in such techniques as PCR, membrane-based hybridization techniques or ELISA.

An “isolated” nucleic acid molecule is a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of this nucleic acid. Examples of isolated nucleic acid molecules include recombinant DNA molecules contained in vectors, recombinant DNA maintained in heterologous host cells.
Molecule, partially or substantially purified nucleic acid molecule, and synthetic DNA or RN
Molecule A, but is not limited thereto. Preferably, an "isolated" nucleic acid has a sequence that naturally flanks it in the genomic DNA of the organism from which it is derived (ie, sequences located at the 5'and 3'ends of the nucleic acid). Not included. For example, in various embodiments, an isolated FCTRX nucleic acid molecule has about 50 kb, 25 k, which naturally flanks this nucleic acid in the genomic DNA of the cell from which it is derived.
It may comprise less than b, 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequence. In addition, an "isolated" nucleic acid molecule, eg,
A cDNA molecule may be substantially free of other cellular material or culture medium when produced by recombinant techniques, or when chemically synthesized,
It may be substantially free of chemical precursors or other chemicals.

Nucleic acid molecules of the invention (eg, nucleic acid molecules having the nucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 9 and 11 or any complement of these nucleotide sequences) can be any standard molecular organism. It can be isolated using biological techniques and the sequence information provided herein. As hybridization probes, SEQ ID NOs: 1, 3, 5,
Using all or part of the nucleic acid of any of 7, 9 and 11, the FCTRX nucleic acid sequence can be generated using standard hybridization and cloning techniques (eg,
Sambrook et al. (Ed.), MOLECULAR CLONING: A LAB
ORATORY MANUAL 2nd Edition, Cold Spring Harbo
r Laboratory Press, Cold Spring Harbo
r, NY, 1989; and Ausubel et al., (eds.), CURRENT PR.
OTOCOLS IN MOLECULAR BIOLOGY, John Wi
ley & Sons, New York, NY, 1993).

Nucleic acids of the invention are labeled as templates according to standard PCR amplification techniques with cDNA as template.
It can be amplified using NA, mRNA or genomic DNA, and appropriate oligonucleotide primers. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, FC
Oligonucleotides corresponding to TRX nucleotide sequences are prepared using standard synthetic techniques,
For example, it can be prepared by using an automated DNA synthesizer.

As used herein, the term “oligonucleotide” refers to a series of linked nucleotide residues, the oligonucleotide having a sufficient number of nucleotide bases to be used in a PCR reaction. Short oligonucleotide sequences can be based on, or designed from, genomic or cDNA sequences, and amplify, confirm, or confirm the presence, in a particular cell or tissue, of identical, similar or complementary DNA or RNA. Used to indicate. The oligonucleotide is about 10 nt, 50 nt or 100 nt long, preferably about 1 nt.
It includes a portion of the nucleic acid sequence having a length of 5nt to 30nt. In one embodiment,
An oligonucleotide comprising a nucleic acid molecule having a length of less than 100 nt further comprises at least 6 contiguous nucleotides of SEQ ID NOs: 1, 3, 5, 7, 9 and 11.
Or its complement. Oligonucleotides can be chemically synthesized and used as probes.

In another embodiment, the isolated nucleic acid molecule of the invention is SEQ ID NO: 1, 3, 5, 7.
, 9 and 11 which are the complements of the nucleotide sequences. In another embodiment, the isolated nucleic acid molecule of the invention is SEQ ID NO: 1, 3,
It includes a nucleic acid molecule that is the complement of the nucleotide sequence shown in any of 5, 7, 9 and 11 or a part of the nucleotide sequence. SEQ ID NOs: 1, 3, 5, 7, 9
Nucleic acid molecules that are complementary to the nucleotide sequences shown in and 11 are SEQ ID NO: 1
A nucleic acid molecule that is sufficiently complementary to the nucleotide sequences shown in 3, 5, 7, 9, and 11 and has little or no mismatch with the nucleic acid sequences shown in SEQ ID NOs: 1, 3, 5, 7, 9, and 11. It can hydrogen bond altogether, thereby forming a stable duplex.

As used herein, the term “complementary” refers to Watson-Crick or Hoogsteen base pairing between the nucleotide units of nucleic acid molecules, and the term “binding” refers to two polypeptides or compounds or related By physical or chemical interaction between polypeptides or compounds or combinations thereof.
Binding includes ionic, nonionic, van der Waals, hydrophobic interactions and the like. Physical interactions can be direct or indirect. The indirect interaction may be via another polypeptide or compound or may be due to their effect. Direct binding refers to interactions without other substantial chemical intermediates that do not occur through or due to the effects of other polypeptides or compounds.

Furthermore, the nucleic acid molecules of the present invention include only a portion of the nucleic acid sequences of SEQ ID NOs: 1, 3, 5, 7, 9 and 11 (eg, fragments that can be used as probes or primers, or biological fragments of FCTRX). Fragment which encodes the active portion of The fragments provided herein are at least 6 (consecutive) nucleic acids or at least 4 (contiguous) amino acids, each of which, in the case of nucleic acids, are sufficient to allow specific hybridization. Length, or in the case of amino acids, a sequence of sufficient length to allow specific recognition of the epitope), and at most some portion less than the full length sequence. Fragments can be derived from any contiguous portion of the selected nucleic acid or amino acid sequences. A "derivative" is a nucleic acid or amino acid sequence formed from a native compound, either directly or by modification or partial substitution. An analog is a nucleic acid or amino acid sequence that has a structure that is similar (but not identical) to its native compound, but which differs from that native compound in certain components or side chains. Analogs can be synthetic or derived from evolutionarily different sources and have similar or opposite metabolic activity as compared to wild type.

Derivatives and analogs can be full length or, as described below,
If the derivative or analog comprises a modified nucleic acid or amino acid, it may be other than full length. Derivatives or analogs of the nucleic acids or proteins of the invention may, in various embodiments, span nucleic acid or amino acid sequences of the same size, or aligned sequences, which alignments are computer homology known in the art. At least about 70 when compared to
Regions that are substantially homologous to a nucleic acid or protein of the invention with%, 80%, 85%, 90%, 95%, 98%, or even 99% identity (preferred identity is 80-99%). , Or its encoding nucleic acid, under stringent conditions,
Examples include, but are not limited to, molecules that include a region capable of hybridizing under moderately stringent or low stringent conditions to the complement of a sequence encoding the above protein. For example, Ausubel et al., CURR
ENT PROTOCOLS IN MOLECULAR BIOLOGY, J
See Ohn Wiley & Sons, New York, NY, 1993, and below. An exemplary program uses the default settings, Ga
p program (Wisconsin Sequence Analysis P
package, Version 8 for UNIX (registered trademark), Gene
tics Computer Group, University Research
rch Park, Madison, WI), which is based on the algorithm of Smith and Waterman (Adv. Appl. Math., 1981,
2: 482-489, which are incorporated herein by reference in their entirety).

“Homologous nucleic acid sequence” or “homologous amino acid sequence”, or variants thereof, refer to sequences characterized by homology at the nucleotide or amino acid level, as discussed above. The homologous nucleotide sequence is FCTR
Encodes a sequence encoding an isoform of the X polypeptide. Isoforms can be expressed in different tissues of the same organism as a result of, for example, alternative splicing of RNA. Alternatively, the isoforms can be encoded by different genes. In the present invention, homologous nucleotide sequences include species other than humans (including, but not limited to, mammals), such as mouse, rat, rabbit, dog, cat, cow, horse and other organisms. Can be mentioned) FC
It includes a nucleotide sequence that encodes a TRX polypeptide. Homologous nucleotide sequences also include, but are not limited to, naturally occurring allelic variants and variants of the nucleotide sequences described herein. However, a homologous nucleotide sequence does not include the nucleotide sequence encoding the human FCTRX protein. Homologous nucleic acid sequences include nucleic acid sequences that encode conservative amino acid substitutions (see below) in any of SEQ ID NOs: 2, 4, 6, 8, 10, and 12, and polypeptides that have FCTRX activity. The biological activity of the FCTRX protein is described below.

As used herein, an “identical” residue corresponds to the same residue in a comparison between two sequences, where the equivalent nucleotide bases in the alignment of the two sequences or The amino acid residue is the same residue. Comparison between two sequences in one alignment reveals that residues at equivalent positions in the comparison are
Residues are alternatively described as "similar" or "positive" when they are shown to be the same amino acid or any of the conserved amino acids defined below.

Nucleotide sequences determined from the cloning of the human FCTRX gene can be used to identify disclosed cell types and / or FCTRX protein homologs in other cell types (eg, from other tissues) and FCTRX from other mammals. Allows the production of probes and primers designed for use in cloning homologs. The probe / primer typically comprises a substantially purified oligonucleotide. This oligonucleotide is typically
At least about 12, about 25, about 5 of SEQ ID NOs: 1, 3, 5, 7, 9 and 11;
0, about 100, about 150, about 200, about 250, about 300, about 35
0 or about 400 or more contiguous sense strand nucleotide sequences; or the antisense strand nucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 9 and 11; or to the naturally occurring variant of SEQ ID NO: 1 It includes regions of nucleotide sequences that hybridize under mild conditions.

Probes based on the human FCTRX nucleotide sequence can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In various embodiments, the probe further comprises a labeling group attached to the probe, eg, the labeling group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor. Such a probe may, for example, measure the level of FCTRX protein-encoding nucleic acid in a sample of cells from the subject (eg, detect mRNA levels, or the genomic FCTRX gene is mutated or deleted). Determining whether or not) can be used as part of a diagnostic test kit to identify cells or tissues that misexpress the FCTRX protein.

A “polypeptide having a biologically active portion of FCTRX” refers to the activity of a polypeptide of the invention, as measured in a particular biological assay, with or without dose dependence. A polypeptide (including mature forms) that exhibits similar (but not necessarily identical) activity. A nucleic acid fragment that encodes a "biologically active portion of an FCTRX polypeptide" is one of SEQ ID NOs: 1 or 3 that encodes a polypeptide having a biological activity of FCTRX, as disclosed herein. Can be prepared by isolating a portion, expressing the encoded portion of the FCTRX protein (eg, by recombinant expression in vitro), and assessing the activity of the encoded portion of the FCTRX polypeptide.

FCTRX Variants The present invention further encompasses nucleic acid molecules that differ from the disclosed FCTRX nucleotide sequences due to the degeneracy of the genetic code. Thus, these nucleic acids encode the same FCTRX protein encoded by the nucleotide sequences shown in SEQ ID NOs: 1, 3, 5, 7, 9 and 11. In another embodiment, the isolated nucleic acid molecule of the invention has a nucleotide sequence that encodes a protein having the amino acid sequence set forth in any of SEQ ID NOs: 2, 4, 6, 8 and 10.

Human FCTRX shown in any of SEQ ID NOs: 1, 3, 5, 7, 9 and 11
DN that leads to changes in the amino acid sequence of FCTRX in addition to the nucleotide sequence
It will be appreciated by those of skill in the art that A sequence polymorphisms may exist within a population (eg, the human population). Such genetic polymorphisms in the FCTRX gene may exist among individuals within a population due to natural allelic variation. As used herein, the terms "gene" and "recombinant gene" refer to a nucleic acid molecule containing an open reading frame encoding an FCTRX protein, preferably a mammalian FCTRX protein. Such natural allelic variations typically result in 1-5% variability in the nucleotide sequence of the FCTRX gene. The resulting amino acid polymorphisms of the FCTRX gene that are the result of any and all nucleotide variations, and natural allelic variations and do not alter the functional activity of FCTRX are intended to be within the scope of the invention. It

In addition, it encodes FCTRX proteins from other species and is therefore SEQ ID NO: 1
Nucleic acid molecules having a nucleotide sequence that differs from the human sequence of any of 3, 5, 7, 9 and 11 are intended to be within the scope of the present invention. FCT of the present invention
Nucleic acid molecules corresponding to naturally occurring allelic variants and homologs of RX cDNA are based on their homology to the human FCTRX nucleic acids disclosed herein,
It can be isolated under stringent hybridization conditions using the human cDNA or part thereof as a hybridization probe according to standard hybridization techniques.

In another embodiment, the isolated nucleic acid molecule of the invention is a nucleic acid molecule that is at least 6 nucleotides in length and comprises the nucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 9 and 11. Hybridizes under stringent conditions. In another embodiment, the nucleic acid is at least 10, 25, 50, 100, 250, 500.
Or 750 nucleotides long. In another embodiment, the isolated nucleic acid molecule of the invention hybridizes to the coding region. As used herein, the term “hybridize under stringent conditions” is intended to describe conditions relating to hybridization and washing, under which conditions a minimum degree of similarity to each other is exceeded. The nucleotide sequences typically remain hybridized to each other. For example, depending on the degree of stringency imposed, nucleotide sequences that are at least about 60% homologous to one another may hybridize.

As used herein, the phrase “stringent hybridization conditions” refers to the probe, primer or oligonucleotide hybridizing to its target sequence; It refers to conditions that do not hybridize optimally and, more commonly, do not hybridize to sequences below a certain degree of similarity to the probe. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures than shorter sequences. Generally, stringent conditions are selected at a defined ionic strength and pH of about 5 ° C. below the thermal melting point (T _m ) for a particular sequence. The T _m is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probe complementary to the target sequence hybridizes to the target sequence at equilibrium. Since the target sequence is generally present in excess,
At _Tm , 50% of the probe is occupied at equilibrium. Typically, stringent conditions are pH 7.0-8.3 with a salt concentration of less than about 1.0 M sodium ion, typically about 0.01-1.0 M sodium ion (or other salt). ), And the temperature is at least about 30 ° C. for short probes, primers or oligonucleotides (eg 10 nt to 50 nt) and at least about 60 ° C. for longer probes, primers and oligonucleotides. Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.

Stringent conditions, such as those described above, are known to those of skill in the art and are CURR.
ENT PROTOCOLS IN MOLECULAR BIOLOGY, J
ohn Wiley & Sons, N.M. Y. (1989), 6.3.1-6.
Can be found in 3.6. Preferably, this condition is at least about 65% of each other,
About 70%, about 75%, about 85%, about 90%, about 95%, about 98% or about 99%
Conditions under which the identical sequences will typically remain hybridized to each other. A non-limiting example of stringent hybridization conditions is 6xSS
C, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02
% PVP, 0.02% Ficoll, 0.02% BSA, and 500 m
Hybridization at 65 ° C. in high salt buffer containing g / ml denatured salmon sperm DNA. After this hybridization 0.2x SSC, 0.01
One or more washes at 50 ° C. in% BSA follow. Hybridizes to the sequence of any of SEQ ID NOs: 1, 3, 5, 7, 9 and 11 under stringent conditions,
The isolated nucleic acid molecule of the present invention corresponds to a naturally occurring nucleic acid molecule. As used herein, a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule that has a naturally-occurring (eg, encoding a native protein) nucleotide sequence.

Homologs (ie, nucleic acids encoding FCTRX proteins from species other than human) or other related sequences (eg, paralogs) are probed with all or part of a particular human sequence and are labeled with nucleic acid hybrids. It can be obtained by low, medium, or high stringency hybridization using methods well known in the art for hybridization and cloning.

In a second embodiment, a nucleic acid molecule comprising the nucleotide sequence of any of SEQ ID NOs: 1, 3, 5, 7, 9 and 11 or a fragment, analog or derivative thereof is provided under moderate stringency conditions. A nucleic acid sequence that hybridizes with is provided. A non-limiting example of moderate stringency hybridization conditions is hybridization at 55 ° C. in 6 × SSC, 5 × Denhardt's solution, 0.5% SDS and 100 mg / ml denatured salmon sperm DNA, followed by One or more washes at 37 ° C. in 1 × SSC, 0.1% SDS. Other conditions of moderate stringency that can be used are well known in the art. For example, Ausubel et al. (Eds.), 1993, CURRENT PROTOCOLS.
IN MOLECULAR BIOLOGY, John Wiley & S
ons, NY and Kriegler, 1990, GENE TRANSFER
AND EXPRESSION, A LABORATORY MANUAL,
See Stockton Press, NY.

In a third embodiment, nucleic acid molecules comprising the nucleotide sequences of SEQ ID NOs: 1, 3, 5, 7, 9 and 11 or fragments, analogs or derivatives thereof, hybridize under low stringency conditions. A nucleic acid is provided. A non-limiting example of low stringency hybridization conditions is 35% formamide, 5xSSC, 50 mM Tris-HCl (pH 7.5), 5 mM E.
DTA, 0.02% PVP, 0.02% Ficoll, 0.2% BSA,
Hybridization at 40 ° C. in 100 mg / ml denatured salmon sperm DNA, 10% (weight / volume) dextran sulfate, followed by 2 × SSC, 25 mM T.
One or more washes in ris-HCl (pH 7.4), 5 mM EDTA and 0.1% SDS at 50 ° C. Other low stringency conditions that can be used are well known in the art (eg, as used for cross-species hybridization). For example, Ausubel et al. (Eds.), 1993, CURR.
ENT PROTOCOLS IN MOLECULAR BIOLOGY, J
own Wiley & Sons, NY and Kriegler, 1990
, GENE TRANSFER AND EXPRESSION, A LABO
RATORY MANUAL, Stockton Press, NY; Shil
O and Weinberg, 1981, Proc Natl Acad Sci.
USA 78: 6789-6792.

Conservative Variations In addition to naturally occurring allelic variants of FCTRX nucleotide sequences (eg, gene sequences) that may be present in the population, one of skill in the art would appreciate that SEQ ID NOs: 1, 3, 5, 7
, 9 and 11 may be introduced by mutation to the nucleotide sequence, thereby altering the functional capacity of the FCTRX protein,
It is further understood that changes are made to the amino acid sequence of the encoded FCTRX protein. For example, nucleotide substitutions that result in amino acid substitutions at "non-essential" amino acid residues can be made in the sequences of any of SEQ ID NOs: 1, 3, 5, 7, 9, and 11. A "non-essential" amino acid residue is a residue at a position in a sequence that can be altered from the wild-type sequence of an FCTRX polypeptide without altering biological activity, while an "essential" amino acid residue is , Residues at certain positions required for biological activity. For example, amino acid residues that are conserved among members of the FCTRX protein family, of which the FCTRX proteins of the invention are members, are predicted to be particularly unacceptable for alteration.

For example, an FCTRX protein according to the present invention may comprise at least one domain that is typically a conserved region in FCTRX protein family members. As such, these conserved domains are unlikely to undergo mutation. However, other amino acid residues (eg, less conserved residues among members of the FCTRX protein family) may not be essential for activity and are therefore likely to be more susceptible to alteration.

Another aspect of the invention pertains to nucleic acid molecules that encode FCTRX proteins that include changes in amino acid residues associated with the amino acid sequences of SEQ ID NO: 2 or SEQ ID NO: 4 that are not essential for activity. In one embodiment, the isolated nucleic acid molecule is
A nucleotide sequence encoding a protein, wherein the protein is
For the amino acid sequence of any of SEQ ID NOs: 2, 4, 6, 8, 10 and 12,
It includes amino acid sequences that are at least about 75% similar. Preferably, the protein encoded by this nucleic acid is SEQ ID NO: 2, 4, 6, 8, 10 and 12.
Of at least about 80%, more preferably at least about 90%, about 95%, about 98% homologous to SEQ ID NO: 2, and most preferably at least about 99% homology.

An isolated nucleic acid molecule encoding a protein homologous to the protein of any of SEQ ID NOs: 2, 4, 6, 8, 10 and 12 may have one or more nucleotide substitutions, additions or additions to the corresponding nucleotide sequence. It may be made by introducing a deletion such that one or more amino acid substitutions, additions or deletions are introduced in the encoded protein.

Mutations are standard techniques (eg, site-directed mutagenesis and PCR-mediated mutagenesis).
Can be introduced into SEQ ID NOS: 1, 3, 5, 7, 9, and 11. Preferably, conservative amino acid substitutions are made at one or more putative nonessential amino acid residues. "
A "conservative amino acid substitution" is an amino acid substitution in which an amino acid residue is replaced with an amino acid residue having a similar side chain. A family of amino acid residues with similar side chains has been defined in the art. Certain amino acids have side chains with more than one classifiable feature. These families include: amino acids with basic side chains (eg lysine, arginine, histidine), amino acids with acidic side chains (eg aspartic acid, glutamic acid), uncharged polar side chains. Amino acids (eg, glycine, asparagine, glutamine, serine, threonine, tyrosine, tryptophan, cysteine), amino acids having non-polar side chains (eg, alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tyrosine, tryptophan), Amino acids with β-branched side chains (eg threonine, valine, isoleucine) and amino acids with aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in the FCTRX polypeptide is replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, the mutations may be randomly introduced (eg, by saturation mutagenesis) along all or part of the FCTRX coding sequence, and the resulting variant is a FCTRX polypeptide. Can be screened for biological activity to identify variants that retain the activity. Following mutagenesis of SEQ ID NOs: 1, 3, 5, 7, 9, and 11, the encoded protein can be expressed by any recombinant technique known in the art and the activity of this protein determined. obtain.

Amino acid family relatedness can also be determined based on side chain interactions. Substituted amino acids can be fully conserved “strong” residues or completely conserved “weak” residues. "Strong" groups of conserved amino acid residues are of the following groups: STA, NEQK, NHQK, NDEQ, QHRK, MILV, MILF.
, HY, FYW, wherein the one-letter amino acid codes are grouped by amino acids that can substitute for each other. Similarly, “weak” groups of conserved residues are: CSA, ATV, SAG, STNK, STPA, SGN.
It may be any one of D, SNDEQK, NDEQHK, NEQHRK, VLIM, HFY.

In one embodiment, variant FCTRX polypeptides may be assayed for: (1) other FCTRX proteins, other cell surface proteins, or biologically active portions thereof, and proteins: Ability to form protein interactions, (2) complex formation between mutant FCTRX protein and FCTRX receptor; (3) mutant FCTRX protein binds to intracellular target protein or biologically active portion thereof Ability; (eg, avidin protein); (
4) Ability to bind to the BRA protein; or (5) Ability to specifically bind to an antibody against the FCTRX polypeptide.

In other embodiments, the mutant FCTRX proteins, as to their ability to induce tumorigenesis or transform cells (eg, NIH 3T3 cells), are described in the Examples below. Can be assayed.

Antisense FCTRX Nucleic Acids Another aspect of the invention relates to an isolated antisense nucleic acid molecule that is capable of hybridizing to or complementary to an FCTRX nucleic acid, eg, the antisense nucleic acid has the sequence It may be complementary to a nucleic acid molecule comprising the nucleotide sequence of numbers 1, 3, 5, 7, 9, and 11, or fragments, analogs or derivatives thereof.
An "antisense" nucleic acid comprises a nucleotide sequence that is complementary to a "sense" nucleic acid that encodes a protein (eg, complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence). . In certain aspects, at least about 1
FC of 0, about 25, about 50, about 100, about 250 or about 500 nucleotides
Antisense nucleic acid molecules are provided that include sequences complementary to the TRX coding strand or the entire FCTRX coding strand, or only a portion thereof. SEQ ID NOs: 2, 4, 6
, 8, 10 and 12 nucleic acid molecules encoding fragments, homologs, derivatives and analogs of the FCTRX protein, or SEQ ID NOs: 1, 3, 5
Further provided are antisense nucleic acids that are complementary to the nucleic acid sequences of FCTRX, 7, 9, and 11.

In one embodiment, the antisense nucleic acid molecule is antisense to the “coding region” of the coding strand of a nucleotide sequence encoding a FCTRX polypeptide. The term "coding region" refers to the region of a nucleotide sequence that contains the codons that are translated into amino acid residues (eg, SEQ ID NOs: 2, 4, 6, 8, 10, and 12).
A protein coding region of FCTRX polypeptide corresponding to any of In another embodiment, the antisense nucleic acid molecule is antisense to the “non-coding region” of the coding strand of the nucleotide sequence encoding FCTRX polypeptide. The term "non-coding region" refers to the 5'and 3'sequences that are flanked by coding regions and are not translated into amino acids (ie, also referred to as 5'untranslated regions and 3'untranslated regions).

FCTRX coding strand sequences disclosed herein (eg, SEQ ID NOs: 1, 3,
5, 7, 9, and 11) have antisense nucleic acids of Watson and Cric.
It allows to be designed according to the rules of k or Hoogsteen base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of FCTRX mRNA. Alternatively, the antisense nucleic acid molecule is FCTRX mRN
It may be an oligonucleotide that is antisense only to a part of the coding or non-coding region of A. For example, antisense oligonucleotides are FCTRX
It may be complementary to the region surrounding the translation start site of mRNA. Antisense oligonucleotides have, for example, lengths of about 5, about 10, about 15, about 20, about 25,
It can be about 30, about 35, about 40, about 45 or about 50 nucleotides.

The antisense nucleic acids of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using procedures known in the art. For example, antisense nucleic acids (eg,
Antisense oligonucleotide) is a naturally occurring nucleotide, or the physical stability of a duplex formed to increase the biological stability of this molecule or between an antisense nucleic acid and a sense nucleic acid. Can be chemically synthesized with variously modified nucleotides designed to increase (eg, phosphorothioate derivatives and acridine substituted nucleotides can be used).

Examples of modified nucleotides that can be used to make antisense nucleic acids include: 5-fluorouracil, 5-bromouracil, 5-
Chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxymethyl) uracil, 5-carboxymethylaminomethyl 2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β- D-galacto silk eosin
ylqueosine), inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-.
Adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosyleosin (mann
osylqueosine), 5'-methoxycarboxymethyluracil, 5-
Methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wibutoxin, pseudouracil, queocin (
queosine), 2-thiocytosine, 5-methyl-2-thiouracil, 2-
Thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3- (3-amino-3-N-2 -Carboxypropyl) uracil, (
acp3) w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be biologically produced using an expression vector in which the nucleic acid has been subcloned in the antisense orientation (ie, the RNA transcribed from the inserted nucleic acid is
In antisense orientation to the target nucleic acid of interest, further described in the following subsections).

Antisense nucleic acid molecules of the invention are typically administered to a subject or produced in situ so that they hybridize to the cellular mRNA and / or genomic DNA encoding the FCTRX protein. Soybeans or bind to them, thereby inhibiting the expression of this protein, for example by inhibiting transcription and / or translation. Hybridization allows for specific interactions in the major groove of the double helix, either by conventional nucleotide complementation to form a stable duplex, or in the case of antisense nucleic acid molecules that bind to DNA duplexes, for example. Can be through. Examples of routes of administration of the antisense nucleic acid molecules of the invention include direct injection at the tissue site. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules can be modified so that they specifically bind to a receptor or antigen expressed on the surface of selected cells. This is, for example, by linking the antisense nucleic acid molecule to a peptide or antibody that binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein.
In order to achieve a sufficient intracellular concentration of antisense molecule, vector constructs in which the antisense nucleic acid molecule is placed under the control of the strong pol II or pol III promoter are generally preferred.

In yet another embodiment, the antisense nucleic acid molecule of the invention is an α-anomeric nucleic acid molecule. The α-anomeric nucleic acid molecule forms a specific double-stranded hybrid with complementary RNA. Here, in contrast to the normal β-units, the chains run parallel to each other (Gaultier et al. (1987) Nucleic Acids.
Res 15: 6625-6641). This antisense nucleic acid molecule also contains 2
'-O-methyl ribonucleotide (Inoue et al. (1987) Nucleic
Acids Res 15: 6131-6148) or chimeric RNA-DNA
Analog (Inoue et al. (1987) FEBS Lett 215: 327-3.
30) may be included.

Such modifications include, by way of non-limiting example, modified bases and nucleic acids with modified or derivatized sugar phosphate backbones. These modifications are performed, at least in part, to enhance the chemical stability of the modified nucleic acid, so that
They can be used, for example, as antisense binding nucleic acids in therapeutic applications in a subject.

FCTRX ribozymes are also within the scope of the invention. Ribozymes are catalytic RNA molecules with ribonuclease activity that can cleave single-stranded nucleic acids (eg, FCTRX mRNA) and these have a complementary region to the single-stranded nucleic acid. Therefore, a ribozyme (for example, a hammerhead ribozyme (Hasel)
hoff and Gerlach (1988) Nature 334: 585-5.
91))) can be used to catalytically cleave FCTRX mRNA transcripts, thereby inhibiting translation of FCTRX mRNA. Ribozymes having specificity for a nucleic acid encoding FCTRX are disclosed in FCTRX disclosed herein.
The nucleotide sequence of the nucleic acid (ie, SEQ ID NOs: 1, 3, 5, 7, 9, and 11)
). For example, the nucleotide sequence of the active site is FCTR
Derivatives of Tetrahymena L-19 IVS RNA can be constructed that are complementary to nucleotide sequences that are cleaved within the mRNA encoding X. For example, Cech
Et al., U.S. Pat. No. 4,987,071; and Cech et al., U.S. Pat. No. 5,11.
See 6,742. Alternatively, using FCTRX mRNA, RN
From the pool of A molecules, catalytic RNAs with specific ribonuclease activity can be selected. See, for example, Bartel et al. (1993) Science 261: 141.
See 1-1418.

Alternatively, the FCTRX gene expression is a regulatory region of the FCTRX gene (eg,
It can be inhibited by targeting a nucleotide sequence complementary to the promoter and / or enhancer of the FCTRX gene and forming a triple helix structure that interferes with transcription of the FCTRX gene in target cells. Generally, Helene. (
1991) Anticancer Drug Des. 6: 569-84; He
len et al. (1992) Ann. N. Y. Acad. Sci. 660: 27-3
6; and Maher (1992) Bioassays 14: 807-15.

In various embodiments, the FCTRX nucleic acid can be modified at the base, sugar or phosphate backbones to improve, for example, the stability, hybridization or solubility of the molecule. For example, the deoxyribose phosphate backbone of nucleic acids can be modified to produce peptide nucleic acids (Hyrup et al. (1996) Bioorg Med C.
hem 4: 5-23). As used herein, the term "peptide nucleic acid" or "PNA" replaces the deoxyribose phosphate backbone with a pseudopeptide backbone and retains only the four natural nucleobases. Refers to nucleic acid mimics (eg, DNA mimics). The neutral backbone of PNA has been shown to allow specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomer is
Hyrup et al. (1996) above; Perry-O'Keefe et al. (1996).
Proc. Nat. Acad. Sci. (USA) 93: 14670-675, using standard solid phase peptide synthesis protocols.

PNAs based on FCTRX nucleic acids can be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific regulation of gene expression, for example by inducing transcription or translation arrest or inhibiting replication. PNAs based on FCTRX nucleic acids can also be used as artificial restriction enzymes (Hyrup B when used in combination with other enzymes (eg, S1 nuclease), eg, in the analysis of single base pair mutations in genes by PNA-directed PCR clamping). (1996) supra); or DNA
As a probe or primer for sequence and hybridization (Hy
Rup et al. (1996) supra; Perry-O'Keefe (1996) supra),
Can be used.

In a further embodiment, PNAs of FCTRX nucleic acids are conjugated to PNA-DNA chimeras, eg, by attaching a lipophilic group or other helper group to the PNAs to enhance their stability or cellular uptake. Or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA-DNA chimeras of this nucleic acid can be generated that can combine the advantageous properties of PNA and DNA. While the PNA moiety provides high binding affinity and specificity, such chimeras have DNA recognition enzymes (eg, RN).
ase H and DNA polymerase) are allowed to interact with the DNA part. PNA-DNA chimeras can be ligated using a linker of appropriate length selected with consideration of stacking of bases, the number and orientation of bonds between nucleobases (Hy.
rup (1996) supra). The synthesis of PNA-DNA chimeras is described in Hyrup (19
96) supra and Finn et al. (1996) Nucl Acids Res 24.
: 3357-63. For example, the DNA strand
Modified nucleoside analogs (eg, 5 '-(4-methoxytrityl) amino-5'-deoxy-thymidine phosphoramidite that can be synthesized on solid supports using standard phosphoramidite coupling chemistry. ) Is PNA and DN
It may be used between the 5'end of A (Mag et al. (1989) Nucl Acid.
Res 17: 5973-88). The PNA monomers are then coupled in a stepwise fashion to produce a chimeric molecule having a 5'PNA segment and a 3'DNA segment (Finn et al. (1996) supra). Alternatively, a 5'DNA segment and a 3'PNA segment can be used to synthesize a chimeric molecule. Pe
tersen et al. (1975) Bioorg Med Chem Lett 5:
See 1119-11124.

In other embodiments, the FCTRX nucleic acid or FCTRX antisense nucleic acid can include other accessory groups such as: peptides (eg, for targeting host cell receptors in vivo), or cell membranes. Factors that facilitate translocation (eg, Letsinger et al., 1989, Proc. Natl. Acad.
Sci. U. S. A. 86: 6553-6556; Lemaitre et al., 198.
7, Proc. Natl. Acad. Sci. 84: 648-652; PCT Publication No. WO88 / 09810), or blood-brain barrier (e.g., PC.
See T Publication No. WO 89/10134). In addition, oligonucleotides may be labeled with hybridization-triggered cleavage agents (eg, Krol et al., 1988, Bi.
oTechniques 6: 958-976), or intercalator agents (eg, Zon, 1988, Pharm. Res. 5: 539-).
549)). To this end, the oligonucleotide may be linked to another molecule, such as a peptide, hybridization-triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, and the like.

FCTRX Polypeptides FCTRX polypeptides of the invention include the proteins whose sequences are provided in SEQ ID NO: 2 or 4. The invention also includes the mature form of the FCTRX polypeptide as well as the mutant or variant form of the FCTRX polypeptide. In some embodiments, the mutant FCTRX or variant FCTRX may be a protein in which any residue may be altered from the corresponding residue shown in FIG. Or a protein encoding a functional fragment thereof. The invention includes a polypeptide encoded by the variant FCTRX nucleic acid described above. In this mutant or variant protein,
Over 20% of residues can be so changed.

In general, FCTRX polypeptide variants that retain FCTRX function include any FCTRX polypeptide variant in which a residue at a particular position in the sequence has been replaced with another amino acid. FCTRX variant polypeptides also include the parent protein 2
FCTRX polypeptides with an additional residue introduced between one residue, as well as proteins in which one or more residues have been deleted from the reference FCTRX polypeptide sequence (eg, SEQ ID NO: 2 or SEQ ID NO: 4, or a sequence). No. 2 or the mature form of SEQ ID No. 4). Thus, a reference FCTRX polypeptide sequence (eg, SEQ ID NO: 2 or SEQ ID NO: 4, or a mature form of SEQ ID NO: 2 or SEQ ID NO: 4).
Any amino acid substitutions, insertions or deletions relative to are included in the present invention. In some embodiments, the mutant or variant protein is a reference FCT.
It may contain one or more substitutions, insertions or deletions with respect to the RX sequence.

The invention also includes an isolated FCTRX protein, and biologically active portions thereof, or derivatives, fragments, analogs or homologs thereof. Polypeptide fragments suitable for use as an immunogen to raise anti-FCTRX antibodies are also provided. In one embodiment, the native FCTRX protein may be isolated from a cell or tissue source by a suitable purification scheme using standard protein purification techniques. In another embodiment, the FCTRX protein is produced by recombinant DNA technology. FCT as an alternative to recombinant expression
RX proteins or polypeptides can be chemically synthesized using standard peptide synthesis techniques.

An “isolated” or “purified” protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins derived from the cell or tissue source from which the FCTRX protein is derived. Or substantially free of chemical precursors or other chemicals when chemically synthesized. The term "substantially free of cellular material" includes a preparation of FCTRX protein in which the FCTRX protein is separated from the cellular components of cells in which the FCTRX protein is isolated or recombinantly produced. ing. In one embodiment, the term "substantially free of cellular material" refers to less than about 30% (by dry weight) of non-FCTRX protein (also referred to herein as "contaminant protein"), more preferably. Less than about 20% non-FCTRX protein, even more preferably non-FCT
Included are preparations of FCTRX protein having less than about 10% RX protein, and most preferably less than about 5% non-FCTRX protein. If the FCTRX proteins or biologically active portions thereof are recombinantly produced, they are also preferably substantially free of culture medium. That is, the culture medium exhibits less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation.

The term “substantially free of chemical precursors or other chemicals” refers to a preparation of FCTRX proteins in which the protein is separated from the chemical precursors or other chemicals involved in the synthesis of the protein. including. In one embodiment, the term "
"Substantially free of chemical precursors or other chemicals" means a chemical precursor or non-F
Less than about 30% CTRX polypeptide (by dry weight), more preferably less than about 20% chemical precursor or non-FCTRX polypeptide, even more preferably less than about 10% chemical precursor or non-FCTRX polypeptide, And most preferably it comprises a preparation of FCTRX protein having less than about 5% of chemical precursors or non-FCTRX polypeptides.

The biologically active portion of the FCTRX protein comprises fewer amino acids than the full length FCTRX protein and exhibits at least one activity of the FCTRX protein (eg, the amino acid set forth in SEQ ID NO: 2). Sequence), or a peptide containing an amino acid sequence derived from the amino acid sequence of this FCTRX protein. Typically,
The biologically active portion comprises at least one active domain or motif of the FCTRX protein. The biologically active portion of the FCTRX protein can be, for example, a polypeptide that is 10, 25, 50, 100 or more amino acids in length.

The biologically active portion of FCTRX of the present invention may comprise at least one of the above identified domains that are conserved between FCTRX family proteins. In addition, other biologically active portions lacking other regions of the protein can be prepared by recombinant techniques and evaluated for one or more of the functional activities of the native FCTRX protein. obtain.

[0138] In some embodiments, the FCTRX proteins differ in amino acid sequence due to natural allelic variants or mutagenesis, as described in detail below, but SEQ ID NOs: 2, 4, 6 , 8, 10, and 12 and is substantially homologous to and retains the functional activity of the protein of any of SEQ ID NOs: 2, 4, 6, 8, 10, and 12. Thus, in another embodiment, the FCTRX protein is at least about 45% homologous to the amino acid sequence of any of SEQ ID NOs: 2, 4, 6, 8, 10, and 12, and more preferably about 55, 65, 70. ,
FCTRX protein of 75, 80, 85, 90, 95, 98, or even 99% homologous amino acid sequence and corresponding polypeptide having the sequence of SEQ ID NOs: 2, 4, 6, 8, 10 and 12. Is a protein that retains the functional activity of.

Determination of Homology between Two or More Sequences To determine the percent homology of two amino acid sequences or two nucleic acids, the sequences are aligned for the purpose of optimal comparison. (For example, a gap can be introduced in any of the sequences that are compared for optimal alignment between the sequences). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. If a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are homologous at that position (ie, as used herein). , "Homology" of amino acids or nucleic acids is equivalent to "identity" of amino acids or nucleic acids).

Nucleic acid sequence homology can be determined as the degree of identity between two sequences. Homology can be determined using computer programs known in the art, such as GAP software provided in the GCG program package. Needleman and Wunsch 1970 J Mol Biol
48: 443-453. The following settings for comparing nucleic acid sequences (GA
Using the GCG GAP software with a P production penalty of 5.0, and a GAP extension penalty of 0.3), the coding regions for similar nucleic acid sequences referred to above are SEQ ID NOs: 1, 3, 5, 7 , 9 and 11 with the CDS (coding) portion of the DNA sequence, preferably at least 70%, 75%, 80%,
It indicates a degree of identity of 85%, 90%, 95%, 98% or 99%. Equivalent software procedures for determining the degree of sequence identity are widely known in the art and can be used in the present context.

The term “sequence identity” refers to the degree to which two polynucleotide or polypeptide sequences are identical on a residue-by-residue basis over a particular region of comparison. The term “percentage of sequence identity” is calculated by: comparing two sequences that are optimally aligned over this region of comparison, the same nucleobase in both sequences (eg A in the case of nucleic acids). , T or U, C, G, or I) determines the number of positions that occur and derives the number of matched positions, the number of matched positions being the total number of positions (ie, window Size) and multiply the result by 100 to derive the percentage sequence identity. The term "substantial identity" as used herein refers to a characteristic of a polynucleotide sequence, where the polynucleotide has at least 80% of the sequence compared to the reference sequence over the comparison region. Includes sequences that have identity, preferably at least 85% sequence identity, and often 90-95% sequence identity, more usually at least 99% sequence identity. The term "percentage of positive residues" is calculated by: comparing two sequences that are optimally aligned over their region of comparison, identical amino acid and conservative amino acid substitutions as described above. Determining the number of positions that occur in both sequences and deriving the number of matching positions, dividing this number of matching positions by the total number of positions in the comparison region (ie window size), and Multiply the result by 100 to derive the percentage of positive residues.

Chimeric FCTRX Proteins and Fusion FCTRX Proteins The present invention also provides FCTRX chimeric proteins or FCTRX fusion proteins. As used herein, a FCTRX "chimeric protein" or FCTRX "fusion protein" comprises a FCTRX polypeptide operably linked to a non-FCTRX polypeptide. "FCTRX polypeptide" is
An FCTRX polypeptide, or a polypeptide having an amino acid sequence corresponding to a fragment, variant or derivative thereof, wherein a "non-FCTRX polypeptide" is a protein that is not substantially homologous to the FCTRX protein (eg, the FCTRX protein. And a protein having an amino acid sequence corresponding to the same or a protein derived from a different organism). Therefore, in the FCTRX fusion protein, this FCTRX polypeptide is
It may correspond to all or part of the RX protein. In one embodiment, FC
The TRX fusion protein comprises at least one biologically active portion of the FCTRX protein. In another embodiment, the FCTRX fusion protein is FCTR.
It comprises at least two biologically active portions of the X protein. In a fusion protein, the term "operably linked" is intended to indicate that the FCTRX polypeptide and the non-FCTRX polypeptide are fused in frame to each other. The non-FCTRX polypeptide can be fused to the N-terminus or C-terminus of the FCTRX polypeptide.

For example, in one embodiment, the FCTRX fusion protein comprises a FCTRX polypeptide operably linked to the extracellular domain of a second protein. Such fusion proteins can be further utilized in screening assays for compounds that modulate FCTRX activity (such assays are described in detail below).

In another embodiment, the fusion protein is a GST-FCTRX fusion protein, where the FCTRX sequence is fused to the C-terminus of the GST (ie glutathione S-transferase) sequence. Such a fusion protein may facilitate the purification of recombinant FCTRX.

In yet another embodiment, the fusion protein is a FCTRX protein containing a heterologous signal sequence at its N-terminus. For example, the native FCTRX signal sequence can be removed and replaced with a signal sequence from another protein. In certain host cells, such as mammalian host cells, FCTRX expression and / or secretion can be increased through the use of heterologous signal sequences.

In a further embodiment, the fusion protein is an FCTRX-immunoglobulin fusion protein, wherein an FCTRX sequence containing one or more domains is fused to a sequence derived from a member of the immunoglobulin protein family. . This FCTRX-immunoglobulin fusion protein of the invention is incorporated into a pharmaceutical composition and administered to a subject to inhibit the interaction between FCTRX ligand and FCTRX protein on the surface of cells, May inhibit FCTRX-mediated signaling in vivo. In one example, the contemplated FCTRX ligands of the invention are FCTRX receptors. This FCT RX
-The immunoglobulin fusion protein may be used to regulate the bioavailability of FCTRX cognate ligands. Inhibition of FCTRX ligand / FCTRX interactions may be therapeutically useful in treating both proliferative and differentiation disorders and in modulating (eg, promoting or inhibiting) cell survival. Furthermore, this FC of the present invention
The TRX-immunoglobulin fusion protein can be used as an immunogen to produce anti-FCTRX antibodies in a subject, purified FCTRX ligand, and FC.
It can be used in screening assays to identify molecules that inhibit the interaction of FCTRX with TRX ligands. FCTRX chimeric protein or FC of the present invention
TRX fusion proteins can be produced by standard recombinant DNA techniques. For example, DNA fragments encoding different polypeptide sequences may be labeled according to conventional techniques, eg, blunt or staggered ends for ligation, restriction enzyme digestion to provide suitable ends, sticky ends if appropriate. (Cohesive
A) In-frame ligation by employing end filling, alkaline phosphatase treatment to avoid unwanted ligation, and enzymatic ligation. In another embodiment, the fusion gene may be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of the gene fragment can be performed with an anchor primer that results in a complementary overhang between two consecutive gene fragments, which can then be annealed and reamplified to produce a chimeric gene sequence (
For example, Ausbel et al. (Ed.) CURRENT PROTOCOLS IN M
OLECULAR BIOLOGY, John Wiley & Sons, 199
2). In addition, many expression vectors are commercially available that already encode a fusion component (eg, a GST polypeptide). The nucleic acid encoding FCTRX can be cloned into such an expression vector such that the fusion component is linked in-frame to the FCTRX protein.

FCTRX Agonists and Antagonists The present invention also relates to variants of FCTRX proteins that function as either FCTRX agonists (mimetics) or FCTRX antagonists. FCT
Variants of RX protein, eg, discrete point mutations or truncations of FCTRX protein, can be generated by mutagenesis. An agonist of FCTRX protein has substantially the same biological activity as the naturally occurring form of FCTRX protein,
Or it may retain a subset of its biological activity. Antagonists of the FCTRX protein may inhibit one or more activities of the naturally occurring form of the FCTRX protein, eg, by competitively binding to a downstream or upstream member of the cell signaling cascade that includes the FCTRX protein. Therefore, specific biological effects can be elicited by treatment with variants of limited function. In one embodiment, treatment of the subject with a variant having a subset of biological activities of the naturally occurring form of the protein is carried out by treating the subject against treatment with the naturally occurring form of the FCTRX protein. Have less side effects in.

A variant of the FCTRX protein that functions as either a FCTRX agonist (mimetic) or a FCTRX antagonist is a variant of the FCTRX protein for FCTRX protein agonist activity or FCTRX protein antagonist activity (eg, a truncation variant). It can be identified by screening combinatorial libraries. In one embodiment, a variegated library of FCTRX variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A diverse library of FCTRX variants can be obtained, for example, by mixing a mixture of synthetic oligonucleotides, where the degenerate set of potential FCTRX sequences is as individual polypeptides, or
It can be produced by enzymatically linking into a gene sequence so that it can be expressed as a larger set of fusion proteins (eg, for phage display) that includes the set of FCTRX sequences therein. There are a variety of methods that can be used to generate a library of potential FCTRX variants from degenerate oligonucleotide sequences. Chemical synthesis of degenerate gene sequences can be performed in an automated DNA synthesizer, which synthetic gene is then ligated into an appropriate expression vector. The use of a degenerate set of genes allows for the full supply of sequences encoding the desired set of potential FCTRX variant sequences in one mixture. Methods of synthesizing degenerate oligonucleotides are known in the art (eg, Narang (1
983) Tetrahedron 39: 3; Itakura et al. (1984) A.
nnu Rev Biochem 53: 323; Itakura et al. (1984).
) Science 198: 1056; Ike et al. (1983) Nucl Aci.
d Res 11: 477).

Polypeptide Libraries In addition, a library of fragments of the FCTRX protein coding sequence can be used to generate a diverse population of growth promoter fragments for screening and subsequent selection of variants of the FCTRX protein. In one embodiment, the library of coding sequence fragments comprises treating the double-stranded PCR fragment of the FCTRX coding sequence with a nuclease under conditions that produce only about one nick per molecule. Double-stranded reformed by denaturing the DNA, regenerating this DNA to form double-stranded DNA that may contain sense / antisense pairs from different nick products, treatment with S1 nuclease Can be generated by removing the single-stranded portion from the product and ligating the resulting fragment library into an expression vector. By this method, FCT
Expression libraries can be derived that encode various sized N-terminal and internal fragments of the RX protein.

For screening gene products of combinatorial libraries generated by point mutations or truncations, for gene products with selected properties, c
Several techniques for screening DNA libraries are known in the art. Such techniques are applicable to the rapid screening of gene libraries generated by combinatorial mutagenesis of FCTRX proteins. The most widely used technique suitable for high-throughput analysis for screening large gene libraries is typically cloning the gene library into a replicable expression vector, in which the resulting library of vectors is Transforming appropriate cells, and expressing the combinatorial gene under conditions under which detection of the desired activity facilitates isolation of the vector encoding the gene for which the product was detected. Recruitable Ensemble Mutagenesis (REM), a novel technique to increase the frequency of functional variants in libraries, can be used in combination with screening assays to identify FCTRX variants (Ark).
in and Yourvan (1992) PNAS 89: 7811-7815;
Delgrave et al. (1993) Protein Engineering 6
: 327-331).

Anti-FCTRX Antibodies As used herein, the term "antibody" refers to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules (ie, specific for an antigen). A molecule containing an antigen-binding site that binds to (immunoreacts with). Such antibodies include polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies,
F _ab fragments, F _{ab '} and F _{(ab') 2} fragments, and F _ab expression libraries are included, but are not limited to. In general, antibody molecules of human origin are related to any class of IgG, IgM, IgA, IgE and IgD, which differ from each other by the nature of the heavy chains present in the molecule. Certain classes also have subclasses (eg, IgG ₁ , IgG _2, etc.). Further, in humans, the light chain can be a kappa or lambda chain. References to antibodies herein include references to all such classes, subclasses and types of human antibody species.

The isolated protein of the invention may be intended to serve as an antigen, or part or fragment thereof, and may further be used as an immunogen, standard for the preparation of polyclonal and monoclonal antibodies. Using traditional technology,
Antibodies can be generated that immunospecifically bind an antigen. Full length proteins can be used, or the invention provides antigenic peptide fragments of the antigen for use as immunogens. An antigenic peptide fragment comprises at least 6 amino acid residues of the amino acid sequence of a full-length protein (eg, the amino acid sequences set forth in SEQ ID NOs: 2, 4, 6, 8, 10, and 12) and includes their epitopes, As a result, antibodies raised against this peptide form specific immune complexes with the full-length protein or any fragment containing this epitope. Preferably, the antigenic peptide is at least 10 amino acid residues, or at least 15 amino acid residues, or at least 20 amino acid residues, or at least 30 amino acid residues.
Contains amino acid residues. The preferred epitopes encompassed by this antigenic peptide are regions of the protein located on the surface of the peptide; usually these are hydrophilic regions.

In certain embodiments of the invention at least one encompassed by an antigenic peptide.
One epitope is a region of FCTRX that is located on the surface of the protein, eg
It is a hydrophilic region. Hydrophobicity analysis of human FCTRX-related protein sequences was performed using FCT.
It indicates which region of the RX polypeptide is particularly hydrophilic and, therefore, appears to encode a surface residue useful for targeting antibody production. As a means of targeting antibody production, Kyte, with or without a hydropathic plot showing hydrophilic and hydrophobic regions, eg, with or without a Fourier transform.
It may be produced by any method known in the art, including the Doolittle method or the Hopp Woods method. For example, Hopp and Woods, 1981, Proc., Each of which is hereby incorporated by reference in its entirety. Nat. Ac
ad. Sci. USA 78: 3824-3828; Kyte and Dooli.
Title 1982, J. Mol. Biol. 157: 105-142. Antibodies specific for one or more domains within the antigenic protein or derivative, fragment, analog or homologue thereof are also provided herein.

The proteins of the invention, or derivatives, fragments, analogs, homologs or orthologs thereof, can be utilized as immunogens in the production of antibodies that immunospecifically bind these protein components.

Various procedures known in the art can be used for the production of polyclonal or monoclonal antibodies directed against the proteins of the invention, or derivatives, fragments, analogs, homologs or orthologs thereof ( For example, Antibodies: A Laboratory Manual, Ha.
rlow E, and Lane D, 1998, Cold Spring Ha.
rbor Laboratory Press, Cold Spring Ha
rbor, NY (see incorporated herein by reference)). Some of these antibodies are discussed below.

Polyclonal Antibodies For the production of polyclonal antibodies, a variety of suitable host animals (eg, rabbit, goat, mouse or other animal) may use native proteins, synthetic variants thereof, or derivatives of the foregoing. It can be immunized by one or more injections used. Suitable immunogenic preparations include, for example, a naturally occurring immunogenic protein, a chemically synthesized polypeptide presenting the immunogenic protein, or a recombinantly expressed immunogenic protein. obtain. In addition, this protein can be conjugated to a second protein known to be immunogenic in the immunized mammal. Examples of such immunogenic proteins include, but are not limited to, keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. The preparation may further include an adjuvant. Various adjuvants can be used to increase the immunological response,
Such adjuvants include Freund's (complete and incomplete), mineral gels (eg aluminum hydroxide), surface-active substances (eg lysolecithin,
Pluronic polyols, polyanions, peptides, oil emulsions, dinitrophenol, etc., human-useable adjuvants (eg Bacille Calmette-Guerin and Coryneba).
Cerium parvum) or similar immunostimulants. Further examples of adjuvants that may be used include MPL-
TDM adjuvant (monophosphoryl lipid A, synthetic trehalose dicorynomycolate).

Polyclonal antibody molecules directed against immunogenic proteins can be isolated from mammals (eg from blood) and are well known in the art (eg affinity chromatography using protein A or protein G (eg. This can be further purified mainly by providing the IgG fraction of immune sera)). Subsequently, or alternatively, the specific antigen or epitope thereof that is the desired immunoglobulin target can be immobilized on a column and the immunospecific antibody purified by immunoaffinity chromatography. Purification of immunoglobulins is described, for example, in D. Wil
Kinson (The Scientist (The Scientist, I
nc. , Philadelphia PA), Volume 14, Issue 8 (20
April 17, 2000), pp. 25-28).

Monoclonal Antibody As used herein, the term “monoclonal antibody” (MAb) or “monoclonal antibody”.
A "monoclonal antibody composition" refers to a population of antibody molecules that comprises an antibody molecule of a unique species consisting of a unique light chain gene product and a unique heavy chain gene product. In particular, the complementarity determining regions (CDRs) of monoclonal antibodies are identical to all molecules in the population. Thus, MAbs contain an antigen binding site capable of immunoreacting with a particular epitope of the antigen characterized by a unique binding affinity for the antigen.

Monoclonal antibodies can be prepared using hybridoma methods, such as those described in the art. For example, Kohler and Mi
See lstein, Nature, 256: 495 (1975). In the hybridoma method, the mouse, hamster, or other suitable host animal is
Is typically immunized with an immune factor and produces antibodies that specifically bind to the immune factor,
Or induce lymphocytes that can be produced. Alternatively, lymphocytes can be immunized in vitro.

Immune factors typically include protein antigens, fragments thereof or fusion proteins thereof. Generally, one of the following: peripheral blood lymphocytes are used if cells of human origin are desired, or spleen cells or lymph nodes if a non-human mammalian source is desired. Cells are used. Then
The lymphocytes are fused to an immortalized cell line using appropriate fusion factors (eg, polyethylene glycol) to form hybridoma cells (Goding, Mono.
Clonal Antibodies: PRINCIPLES AND PRA
CTICE, Academic Press (1986), pp. 59-103).
Immortalized cell lines are usually transformed into mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are used. The hybridoma cells may be cultured in a suitable culture medium that suitably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for hybridomas typically contains hypoxanthine, aminopterin, and thymidine ("
HAT medium "), these substances inhibit the growth of HGPRT-deficient cells.

Preferred immortalized cell lines are those that fuse efficiently, which support stable high level expression of antibody by the selected antibody-producing cells and are sensitive to a medium such as HAT medium. Is. More preferred immortalized cell lines are mouse myeloma cell lines, which are derived from, for example, the Salk Institute Cell Di.
distribution Center, San Diego, California
ia and American Type Culture Collectio
n, Manassas, Virginia. Human myeloma cell lines and mouse-human myeloma cell lines have also been described for the production of human monoclonal antibodies (eg Kozbor, J. Immunol., 133.
: 3001 (1984); Brodeur et al., MONOCLONAL ANTI.
BODY PRODUCTION TECHNIQUES AND APPLI
CATION, Marcel Dekker, Inc. , New York, (
1987) pp. 51-63).

The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies against the antigen. Preferably, the binding specificity of the monoclonal antibody produced by the hybridoma cells is determined by immunoprecipitation or in vitro binding assay (eg radioimmunoassay (R
IA) or enzyme-linked immunosorbent assay (ELISA)). Such techniques and assays are known in the art. The binding affinity of a monoclonal antibody can be determined by Scatchard analysis. For example, Munson and Pollard, Anal. Biochem. , 107:
220 (1980). Identifying antibodies with a high degree of specificity and high binding affinity for the target antigen is a particularly important objective in therapeutic applications of monoclonals.

After the desired hybridoma cells have been identified, clones can be subcloned by limiting the dilution procedure and grown by standard methods (Go.
ding, 1986). Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle Medium and RPMI-1640 medium. Alternatively, hybridoma cells can be grown in vivo as ascites fluid in mammals.

Monoclonal antibodies secreted by subclones can be isolated from culture medium or ascites by conventional immunoglobulin purification procedures (eg, Protein A Sepharose, hydroxyapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography). It can be isolated or purified.

Monoclonal antibodies can also be prepared by recombinant DNA methods (eg, US Pat. No. 4,811).
Method described in No. 6,567). The DNA encoding the monoclonal antibody of the invention is readily prepared using conventional procedures (eg, by using an oligonucleotide probe capable of specifically binding to the genes encoding the heavy and light chains of the mouse antibody). Can be isolated and sequenced. The hybridoma cells of the invention serve as a preferred source of such DNA.
Once isolated, the DNA can be placed into an expression vector, which then allows them to be expressed in a host cell (eg, monkey CO that otherwise does not produce immunoglobulin proteins).
S cells, Chinese hamster ovary (CHO) cells, or myeloma cells) to obtain monoclonal antibody synthesis in recombinant host cells.
DNA also replaces coding sequences for human heavy and light chain constant domains, for example, in place of homologous mouse sequences (US Pat. No. 4,816,16).
567; Morrison, Nature 368, 812-13 (1994).
)) Or by covalent linkage to an immunoglobulin that encodes all or part of the coding sequence for a non-immunoglobulin polypeptide. Such non-immunoglobulin polypeptides may be substituted in the constant region of the antibody of the invention or in the variable region of one of the antigen binding sites of the antibody of the invention, producing chimeric bivalent antibodies. .

(Humanized Antibody) The antibody against the protein antigen of the present invention may further include a humanized antibody or a human antibody. These antibodies are suitable for administration to humans who do not elicit an immune response by the human against the administered immunoglobulins. Humanized forms of antibodies include chimeric immunoglobulins, immunoglobulin chains or fragments thereof (eg, Fv, F
ab, Fab ′, F (ab ′) ₂ or another antibody antigen-binding subsequence),
They are composed primarily of human immunoglobulin sequences and contain minimal sequences derived from non-human immunoglobulin. Humanization is performed by the method of Winter and co-workers (Jones et al., Nature, 321: 522-525 (1986) by substitution of rodent CDRs or CDR sequences for the corresponding sequences of human antibodies.
); Riechmann et al., Nature, 332: 323-327 (1988).
); Verhoeyen et al., Science, 239: 1534-1536 (1
988)). (See also US Pat. No. 5,225,539). In some cases, the Fv backbone of human immunoglobulin (fr
residue) is replaced by the corresponding non-human residue. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or backbone sequences. Generally, a humanized antibody substantially comprises at least one, and typically two, variable domains. Within these regions all or substantially all CDR regions correspond to regions of the non-human immunoglobulin and all or substantially all scaffold regions correspond to regions of the human immunoglobulin consensus sequence. Humanized antibodies also include, if necessary, at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin (Jones et al., 1986; Riechamann et al., 198).
8; and Presta, Curr. Op. Struct. Biol. , 2: 5
93-596 (1992)).

Human Antibodies Completely human antibodies are essentially associated with antibody molecules in which the entire sequence of both the light and heavy chains, including the CDRs, arise from human genes. Such an antibody is referred to as “human antibody”,
Or referred to herein as a "fully human antibody." Human monoclonal antibodies are derived from trioma technology; human B cell hybridoma technology (Kozbor).
Et al., 1983 Immunol Today 4:72) and the EBV hybridoma technology for producing human monoclonal antibodies (Cole et al., 1985: MONOCLONAL ANTIBODIES AND CANC.
ER THERAPY, Alan R. et al. Liss, Inc. , Pp. 77-96)). Human monoclonal antibodies can be used in the practice of the invention, and use of human hybridomas (Cote et al., 1983.
． Proc Natl Acad USA 80: 2026-2030) or with Epstein-Barr virus human B in vitro.
Transformation of cells (Cole et al., 1985: MONOCLONAL ANTIBO
DIES AND CANCER THERAPY, Alan R.A. Liss,
Inc. , Pp. 77-96).

In addition, human antibodies have also been described using additional techniques (phage display libraries (Hoogenboom and Winter, J. Mol. Biol., 227.
: 381 (1991); Marks et al., J. Am. Mol. Biol. , 222: 58
1 (1991))). Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, such as mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production was observed, which in all respects, including gene rearrangement, assembly, and antibody repertoire, closely resembles that observed in humans. This approach is described, for example, in US Pat. Nos. 5,545,807; 5,545,806;
No. 5,569,825; No. 5,625,126; No. 5,633,42.
5, No. 5,611,016, and Marks et al. (Bio / Techno).
logy 10, 779-783 (1992)); Lonberg et al. (Natur).
re 368 856-859 (1994)); Morrison (Natur.
e 368, 812-13 (1994)); Fishwild et al. (Nature).
Biotechnology 14, 845-51 (1996)); Neub.
erger (Nature Biotechnology 14, 826 (19
96)); and Lonberg and Huszar (Intern. Rev.
． Immunol. 13 65-93 (1995)).

Human antibodies can be further produced using transgenic non-human animals that have been modified to produce human antibodies more fully than the animal's endogenous antibodies in response to challenge with an antigen. (See publication WO 94/02602). Endogenous genes encoding immunoglobulin heavy and immunoglobulin light chains in non-human hosts have become intolerable, and active positions encoding human heavy and light chain immunoglobulins are located in the host genome. Inserted in.
For example, human genes are integrated using yeast artificial chromosomes containing auxotrophic human DNA segments. Animals that provide all the desired modifications are then obtained as progeny by crossing intermediate transgenic animals that contain less than the complement of the modification's full complement. A preferred embodiment of such non-human animals is the mouse, PCT publications WO 96/33735 and WO 96/34.
It called Xenomous ^TM as disclosed in 096. This animal produces B cells that secrete fully human immunoglobulin. Antibodies can be obtained directly from animals after immunization with the immunogen of interest (eg, preparation of polyclonal antibodies) or from immortalized B cells of origin (eg, hybridomas that produce monoclonal antibodies). is there. In addition, the gene encoding the immunoglobulin having human variable regions can be restored and expressed to directly obtain the antibody, or further modified to obtain an analog of the antibody (eg, a single chain Fv molecule). Can be done.

An example of a method for producing a non-human host lacking expression of an endogenous immunoglobulin heavy chain (exemplified as a mouse) is disclosed in US Pat. No. 5,939,598. It can be obtained by a method comprising the following steps: preventing rearrangement of the locus and forming a transcript of the rearranged immunoglobulin heavy chain locus, and a gene encoding a selectable marker. Deleting the J segment gene from at least one endogenous heavy chain locus in embryonic stem cells to prevent the deletion caused by the targeting vector comprising; Including a gene encoding a marker) from embryonic stem cells.

Methods for producing antibodies of interest (eg, human antibodies) are described in US Pat. No. 5,916,16.
No. 771. It comprises the following steps: introducing an expression vector containing a nucleotide sequence encoding a heavy chain into one mammalian host cell in culture, an expression vector containing a nucleotide sequence encoding a light chain, Introducing into another mammalian host cell and fusing the two cells to form a hybrid cell. Hybrid cells express an antibody that includes a heavy chain and a light chain.

In a further refinement of this procedure, methods for identifying clinically relevant epitopes on the immunogen and correlating methods for selecting antibodies that immunospecifically bind with high affinity to the relevant epitopes are provided. , PCT Publication WO 99/53049.

F _ab Fragments and Single Chain Antibodies Techniques can be applied to the production of single chain antibodies specific for the antigenic proteins of the invention (see, eg, US Pat. No. 4,946,778). ). Furthermore, the method is
It can be applied to the construction of _Fab expression libraries (eg Huse et al., 1989 S.
cience 246: 1275-1281 see), to allow protein, or derivatives, fragments, a rapid and effective identification of monoclonal F _ab fragments with the desired specificity for analogs or homologs thereof.
Antibody fragments containing idiotypes to protein antigens ((i) F _{(ab ') 2} fragments produced by pepsin digestion of antibody molecules; (ii) produced by reducing disulfide bonds of F _{(ab') 2} fragments. F _ab fragments; (iii) F _ab fragments produced by treatment of antibody molecules with pepsin and a reducing agent, and (iv) F _v fragments, are known in the art. Can be produced by technology.

Bispecific Antibodies Bispecific antibodies are monoclonal antibodies, preferably human or humanized monoclonal antibodies, which are directed against at least two different antigens. Have binding specificity. In this case, one of the binding specificities is for the antigenic protein of the invention. The second binding target is any other antigen, and is preferably a cell surface protein or receptor or receptor subunit.

Methods of making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy / light chain pairs, where the two heavy chains have different specificities (Milstein and Cuello). , Nature, 305: 537-539 (1983)). Due to the random combination of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of 10 different antibody molecules,
Only one of these has the correct bispecific structure. This precise molecular purification is
Usually accomplished by an affinity chromatography step. A similar procedure is described in WO93 / 08829, published May 13, 1993, and Traun.
Ecker et al., 1991 EMBO J. 10: 3655-3659.

Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion preferably has an immunoglobulin heavy chain constant domain and comprises at least a portion of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy-chain constant region (CH1) containing the site necessary for light chain binding, present in at least one of the fusions.
The immunoglobulin heavy chain fusions and, if desired, the DNA encoding the immunoglobulin light chains are inserted into separate expression vectors and cotransfected into a suitable host organism. Further details of making bispecific antibodies can be found in, for example, Suresh et al., Methods in Enzymology, 121: 2.
10 (1986).

According to another means described in WO 96/27011, the interface between pairs of antibody molecules can be engineered to maximize the percentage of heterodimers recovered from recombinant cell culture. A preferred interface comprises at least part of the CH3 region of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (eg tyrosine or tryptophan). Compensatory "cavities" of the same or similar size to the large side chains are created on the interface of the second antibody molecule by replacing large amino acid side chains with small amino acid side chains (eg alanine or threonine). Is made. This provides a mechanism for increasing the yield of heterodimers over other unwanted end products such as homodimers.

[0178]   Bispecific antibodies are full-length antibodies or antibody fragments (eg, F (ab ')). ₂ Bispecific antibody). Bispecific antibodies from antibody fragments
Techniques for making are described in the literature. For example, a bispecific antibody
, Can be prepared using chemical coupling. Brennan et al., Science 22
9:81 (1985), the intact antibody is proteolytically cleaved to produce F (
ab ')₂The procedure for making fragments is described. These fragments are
To stabilize vicinal dithiols and prevent intermolecular disulfide formation
In the presence of the dithiol complexing agent sodium arsenite. Then this
The Fab 'fragment generated was a thionitrobenzoate (TBN) derivative.
Is converted to. Then one of the Fab'-TBN derivatives was mercaptoethyl acetate.
It is reconverted to Fab'-thiol by reduction with min, and this is an equimolar amount.
And other Fab'-TBN derivatives to form bispecific antibodies. Generated
The resulting bispecific antibody can be used as an agent for the selective immobilization of enzymes.

In addition, Fab ′ fragments were isolated from E. E. coli and can be chemically coupled to form bispecific antibodies. Shalaby et al., J
． Exp. Med. 175: 217-225 (1992) describe the generation of fully humanized bispecific antibody F (ab ') ₂ molecules. Each Fab 'fragment was isolated from E. E. coli are separately secreted and subjected to directed in vitro chemical coupling to form bispecific antibodies. Thus, this bispecific antibody that was formed was found to bind cells that overexpress the ErbB2 receptor and normal human T
It can bind cells and trigger the lytic activity of human cytotoxic lymphocytes against human breast cancer targets.

Various techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies are produced using leucine zippers. Kostelny et al. Immuno
l. 148 (5): 1547-1553 (1992). Leucine zipper peptides derived from the Fos and Jun proteins are linked to the Fab ′ portion of two different antibodies by gene fusion. This antibody homodimer is reduced at the hinge region to form a monomer and then reoxidized to form the antibody heterodimer. This method can also be utilized for the production of antibody homodimers. H
ollinger et al., Proc. Natl. Acad. Sci. USA 90:
This "diabody (diab) described in 6444-6448 (1993).
The "ody)" technique provided an alternative mechanism for making bispecific antibody fragments. This fragment is a heavy chain variable region (V _L ) connected to a light chain variable region ( _VL ) by a linker that is too short to pair between two domains on the same chain.
V _H ). Thus, the V _H and V _L domains of one fragment are forced to pair with the complementary V _L and V _H domains of another fragment, thereby forming two antigen binding sites. Another strategy for making bispecific antibody fragments by the use of single chain Fv (sFv) dimers has also been reported. Gruber et al. Immunol. 152: 536
8 (1994).

Antibodies with valencies of greater than 2 are contemplated. For example, trispecific antibodies can be prepared. Tutt et al. Immunol. 147: 60 (1991)
.

Exemplary bispecific antibodies may bind to two different epitopes, at least one of which has its origin in a protein antigen of the invention. Alternatively, the anti-antigenic arm of an immunoglobulin molecule allows T cell receptor molecules (eg, CD2, CD3) to focus on the cellular defense mechanism against cells expressing a particular antigen.
, CD28, or B7), or Fc receptor for IgG (FcγR
) (Eg, FcγRI (CD64), FcγRII (CD32) and Fcγ
It can be attached to an arm that binds a triggering molecule on leukocytes such as RIII (CD16)). Bispecific antibodies can also be used to direct cytotoxic factors to cells that express a particular antigen. These antibodies include antigen binding arms and cytotoxic factors or radionuclide chelators (eg, EOTUBE,
Possesses an arm that binds DPTA, DOTA, or TETA). Another bispecific antibody of interest binds the protein antigens described herein and also binds tissue factor (TF).

Heteroconjugate Antibodies Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are
It consists of two covalently bound antibodies. Such antibodies can be used, for example, to target immune system cells to unwanted cells (US Pat. No. 4,676,980), and to H
For the treatment of IV infection (WO91 / 00360; WO92 / 200373; E
(P03089) has been proposed. It is contemplated that the antibody, including antibodies that include cross-linking agents, can be prepared in vitro using methods known in synthetic protein chemistry. For example, immunotoxins can be constructed by using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate, and the reagents disclosed, for example, in US Pat. No. 4,676,980.

Manipulation of Effector Function It is desirable to modify the antibody of the present invention with respect to effector function, such as to increase the efficacy of the antibody in treating cancer. For example, the cysteine residue is F
It can be introduced in the c region, which allows the formation of interchain disulfide bonds in this region. Thus, the homodimeric antibody produced may have improved internalization potential and / or increased complement-mediated cell killing, as well as antibody-dependent cellular cytotoxicity (ADCC). Caron et al., 1192, J.
． Exp. Med. 176: 1191-1195 and Shopes, 199.
2, J. Immunol. 148: 2918-2922. Homodimeric antibodies with increased antitumor activity have also been described by Wolff et al., 1993, Can.
Cer Research, 53: 2560-2656, and may be prepared using a heterobifunctional crosslinker. Alternatively, the antibody may be engineered which has a dual Fc region and thereby has increased likelihood of complement lysis and ADCC. Stevenson et al., 1989, Anti-Cancer D
See rug Design, 3: 219-230.

Immunoconjugates The present invention also provides for cytotoxic agents (eg, chemotherapeutic agents, toxins (eg, enzymatically active toxins of bacterial, fungal, plant or animal origin, or their Fragment), or an immunoconjugate comprising an antibody conjugated to a radioisotope (ie, radioconjugate).

Chemotherapeutic agents useful in making such immunoconjugates are described above. Enzymatically active toxins and their fragments that can be used include diphtheria A chain, non-binding active fragments of diphtheria toxin, exotoxin A chain (Pse
udomonas aeruginosa), ricin A chain, abrin A chain,
Modeccin A chain, α-sarcin, Aleurites fo
rdii protein, dianthin protein, Phyto
laca americana protein (PAPI, PAPII, and PA
P-S), momordica charantia
) Inhibitors, curcin, crotin, sepaonaria officinalis inhibitors, gelonin, mitogellin
), Restrictocin, phenomycin (phe)
nomycin), enomycin, and trichothecene (
tricothecene). Various radionuclides are available for the production of radioactively bound antibodies. For example, ²¹² Bi, ¹³¹ I, ¹³¹ I
n, ⁹⁰ Y, and ¹⁸⁶ Re.

[0187] Conjugates of antibodies and cytotoxic factors can be used to bind various bifunctional protein binding factors (
For example, N-succinimidyl-3- (2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), a bifunctional derivative of an imide ester (eg, dimethyl adipimidate HCL),
Active esters (eg, disuccinimidyl suberate), aldehydes (eg, glutaraldehyde), bisazide compounds (eg, bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (eg, bis- ( p-diazoniumbenzoyl) -ethylenediamine), diisocyanates (eg triene 2,6-diisocyanate), and bis-active fluorine compounds (eg 1,5-difluoro-2,4-dinitrobenzene)). It For example, the ricin immunotoxin is Vitetta.
Et al., Science, 238: 1098 (1987). Carbon-14-labeled 1-isothiocyanatobenzyl-3-methyldiethylenetriaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See WO94 / 11026.

In another embodiment, for use in pretargeting tumors, the antibody is
A "receptor" (eg, streptavidin) may be bound, where the antibody-receptor conjugate is administered to a patient, followed by removal of unbound conjugate from the circulation using a clearing agent, followed by cytotoxicity. A “ligand” (eg, avidin) that is sequentially conjugated to the sex factor is administered.

Immunoliposomes The antibodies disclosed herein can be formulated as immunoliposomes. Liposomes containing this antibody are prepared by methods known in the art (eg, E
pstein et al., 1985, Proc. Natl. Acad. Sci. USA,
82: 3688; Hwang et al., 1980, Proc. Natl. Acad. S
ci. USA 77: 4030; and U.S. Pat. Nos. 4,485,045 and 4,544,545). Liposomes with enhanced circulation time are disclosed in US Pat. No. 5,013,556.

Particularly useful liposomes can be produced by the reverse layer evaporation method with a lipid composition containing phosphatidylcholine, cholesterol, and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size, yielding liposomes with the desired diameter. Fab 'fragments of antibodies of the invention are described in Martin et al., 1982, J. Am. B
iol. Chem. , 257: 286-288, and can be conjugated to liposomes via a disulfide exchange reaction. A chemotherapeutic agent (eg, doxorubicin) can optionally be included within the liposome. Gabizon et al., 198.
9, J. National Cancer Inst. , 81 (19): 148
See 4.

Diagnostic Applications of Antibodies Directed to the Proteins of the Invention Antibodies directed against the proteins of the invention are known in the art to relate to protein localization and / or quantification. Can be used in the method of
For use in measuring levels of proteins in a suitable physiological sample, for use in diagnostic methods, for use in imaging proteins, etc.). In certain embodiments, antibodies to the protein or derivatives, fragments, analogs or homologs thereof that contain the antigen binding domain are used as the pharmacologically active compound (see below).

Antibodies specific for the proteins of the invention can be used to isolate the protein by standard techniques such as immunoaffinity chromatography or immunoprecipitation. Such antibodies may facilitate the purification of native protein antigens from cells and the recombinantly produced antigens expressed in host cells. further,
Such antibodies can be used to detect antigenic proteins (eg, in cell lysates or cell supernatants) in order to assess the amount and pattern of expression of the antigenic proteins. Antibodies directed against this protein can be used, for example, to diagnostically monitor protein levels in tissues as part of a clinical trial procedure to determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling (ie, physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent substances, luminescent substances, bioluminescent substances and radioactive substances. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; Examples of such fluorescent substances include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine (dic
hlorotriazinylamine) fluorescein, dansyl chloride or phycoerythrin; examples of luminescent substances include luminol; examples of bioluminescent substances include luciferase, luciferin and aequorin, and examples of suitable radioactive substances. ^{Includes 125} I, ¹³¹ I, ³⁵ S or ³ H.

Pharmaceutical Compositions of Antibodies Antibodies that specifically bind to the proteins of the invention, as well as other molecules identified by the screening assays disclosed herein, are in the form of pharmaceutical compositions. It can be administered for the treatment of various disorders. Principles and considerations regarding the preparation of such compositions, as well as guidance in selecting the ingredients, can be found in, for example, Remin.
gton's The Science And Practice Of Pha
rmacy 19th edition (Alfonso R. Gennaro et al., Ed.) Mack
Pub. Co. , Easton, Pa: 1995; Drug Absorbt.
Ion Enhancement: Concepts, Posibiliti
es, Limitations, And Trends, Harwood Ac
academic Publishers, Langhorne, Pa. , 1994
; And Peptide And Protein Drug Deliver
y (Advances In Parental Sciences, Vo
l. 4), 1991, M .; Dekker, New York. Provided to.

If the antigenic protein is intracellular and a whole antibody is used as the inhibitor, it is preferable to internalize the antibody. However, liposomes can also be used to deliver the antibody or antibody fragment to cells. When antibody fragments are used, the minimal inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, peptide molecules can be designed that maintain the ability to bind to target protein sequences based on the variable region sequences of the antibody. Such peptides can be chemically synthesized and / or produced by recombinant DNA technology. For example, Marasco et al., 1993 Pr.
oc. Natl. Acad. Sci. USA, 90: 7889-7893. The formulations herein may also contain more than one active compound as necessary for the particular indication being treated, preferably compounds with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition may include an agent that enhances its function, such as a cytotoxic agent, cytokine, chemotherapeutic agent or antiproliferative agent. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.

The active ingredients are also colloids, for example microcapsules prepared by coacervation techniques or interfacial polymerization, such as hydroxymethylcellulose or gelatin-microcapsules and poly- (methylmethacrylate) microcapsules, respectively. Drug delivery systems such as liposomes, albumin microparticles, microemulsions, nanoparticles, and nanocapsules or macroemulsions.

The formulations used for in vivo administration must be sterile. This is easily accomplished by filtration through a sterile filtration membrane.

Antibody Therapy The antibodies of the present invention, including polyclonal antibodies, monoclonal antibodies, humanized antibodies, and fully human antibodies can be used as therapeutic agents. Such drugs
Generally used to treat or prevent diseases and pathologies in a subject. An antibody preparation, preferably one with high specificity and high affinity for its target antigen, is administered to a subject and generally has an effect due to its binding to its target. Such effects can be of one of two types, depending on the specific nature of the interaction between a given antibody molecule and the target antigen of interest. In the first example, administration of the antibody may prevent or inhibit the binding of the target to the endogenous ligand to which the target naturally binds. In this case, the antibody binds to the target and masks the binding site of the naturally occurring ligand, where that ligand acts as an effector molecule. Thus, receptors mediate signal transduction pathways and ligands are involved in signal transduction.

Alternatively, the effect may be that the antibody elicits a physiological result by binding to an effector binding site on the target molecule. In this case, the target (receptor with an endogenous ligand that may be absent or defective in disease or pathology)
Binds the antibody as a surrogate effector ligand and
Initiate a receptor-based signaling event.

A therapeutically effective amount of an antibody of the invention generally refers to the amount required to achieve a therapeutic purpose. As mentioned above, this may be a binding interaction between the antibody and its target antigen, which in some cases interferes with the function of the target and in others promotes a physiological response. The amount required to be administered further depends on the binding affinity of the antibody for its specific antigen, and also the amount is such that the administered antibody is in the free volume to which it is administered. It depends on the rate at which it is depleted from other subjects. A general range for a therapeutically effective dose of an antibody or antibody fragment of the invention is, without limitation, from about 0.1 mg / kg body weight to about 50 mg / kg body weight. Common dosing frequencies can range, for example, from twice daily to once a week.

(FCTRX Recombinant Expression Vector and Host Cell) Another aspect of the present invention relates to a vector, preferably an expression vector, containing a nucleic acid encoding the FCTRX protein, or a derivative, fragment, analog or homologue thereof. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been attached. One type of vector is a "plasmid", which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, where additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomously replicating in and are introduced into host cells (eg, bacterial vectors having a bacterial origin of replication and episomal mammalian vectors).
. Other vectors, such as non-episomal mammalian vectors, integrate into the host cell's genome when introduced into the host cell, and thereby replicate in synchronization with the host's genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operably linked. Such a vector is referred to herein as an "expression vector". In general, expression vectors useful in recombinant DNA technology are often in the form of plasmids. In the present specification, "plasmid" and "vector" may be used interchangeably as the plasmid is the most commonly used form of vector. However, the present invention provides viral vectors (eg,
It is intended to include such other forms of expression vectors such as replication defective retroviruses, adenoviruses and adeno-associated viruses, which serve equivalent functions.

The recombinant expression vector of the invention comprises the nucleic acid of the invention in a form suitable for the expression of the nucleic acid in a host cell, which means that the recombinant expression vector will be expressed in the host cell in which it is used for expression. It is meant to include one or more regulatory sequences selected on the basis, which are operably linked to the expressed nucleic acid sequence. In the recombinant expression vector,
"Operably linked" is regulated in such a manner that the nucleotide sequence of interest allows expression of the nucleotide sequence (eg, in an in vitro transcription / translation system or host cell when the vector is introduced into a host cell). It is intended to mean linked to the sequence. The term “regulatory sequence” is intended to include promoters, enhancers and other expression control elements (eg, polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel, 1990, GENE.
EXPRESSION TECHNOLOGY: METHODS IN EN
ZYMOLOGY 185, Academic Press, San Diego
o, Calif. It is described in. Regulatory sequences include sequences that direct constitutive expression of nucleotide sequences in many types of host cells, and sequences that direct expression of nucleotide sequences only in particular host cells (eg, tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector may depend on such factors as the choice of host cell to be transformed, the level of expression of the desired protein, etc.
The expression vector of the invention is introduced into a host cell, whereby a protein or peptide (including fusion protein or fusion peptide) encoded by a nucleic acid as described herein (eg, FCTRX protein, FCTRX). Mutated forms, fusion proteins, etc.) can be produced.

The recombinant expression vector of the invention may be used in prokaryotic or eukaryotic cells,
It can be designed for the expression of FCTRX nucleic acids. For example, FCTRX can be expressed in bacterial cells (eg, E. coli), insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. A suitable host cell is G
oeddel, GENE EXPRESSION TECHNOLOGY: ME
THEDS IN ENZYMOLOGY 185, Academic Pre
ss, San Diego, Calif. Further discussion is made in (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. executed in E. coli. Fusion vectors add a number of amino acids to the protein encoded therein, usually at the amino terminus of recombinant proteins. Such fusion vectors are typically
Useful for the following three purposes: (i) increasing the expression of the recombinant protein; (ii) increasing the solubility of the recombinant protein; and (iii)
To assist in the purification of recombinant proteins by acting as a ligand in affinity purification. Frequently, in a fusion expression vector, a proteolytic cleavage site is introduced at the junction of the fusion moiety and allows the recombinant protein to be separated from the fusion moiety of the recombinant protein after purification of the fusion protein. . Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin, and enterokinase. As a typical fusion expression vector, glutathione S-transferase (GST), maltose E binding protein, or protein A is fused to the target recombinant protein, respectively, pGEX (
Pharmacia Biotech Inc; Smith and John
son (1988) Gene 67: 31-40), pMAL (New Eng.
land Biolabs, Beverly, Mass. ) And pRIT5 (
Pharmacia, Piscataway, N .; J. ) Is mentioned.

Appropriate inducible non-fusion E. An example of an E. coli expression vector is pTrc (Am
runn et al. (1988) Gene 69: 301-315) and pET 11
d (Studier et al., GENE EXPRESSION TECHNOLOG
Y: METHODS IN ENZYMOLOGY 185, Academic
Press, San Diego, Calif. (1990) 60-89).

E. One strategy for maximizing recombinant protein expression in E. coli is to express the protein in a host bacterium with impaired ability to proteolytically cleave the recombinant protein. For example, Gottesman,
GENE EXPRESSION TECHNOLOGY: METHODS I
N ENZYMOLOGY 185, Academic Press, San
Diego, Calif. (1990) 119-128. Another strategy is that the individual codons for each amino acid are to modify the nucleic acid sequence of the nucleic acid inserted into the expression vector so that it is preferentially utilized in E. coli (eg Wada et al. (1992) Nucl. Acids Res. 2).
0: 2111-2118). Such alterations of the nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.

[0206] In another embodiment, the FCTRX expression vector is a yeast expression vector. Yeast S. Examples of vectors for expression in S. cerevisiae include pYe
pSec1 (Baldari et al., (1987) EMBO J 6: 229-23.
4), pMFa (Kurjan and Herskowitz, (1982) Ce.
11: 30: 933-943), pJRY88 (Schultz et al., (1987).
) Gene 54: 113-123), pYES2 (Invitrogen C
corporation, San Diego, Calif. ), And picZ
(InVitrogen Corp., San Diego, Calif.).

Alternatively, FCTRX can be expressed in insect cells using a baculovirus expression vector. Baculovirus vectors available for expression of proteins in cultured insect cells (eg, SF9 cells) include pAc series (
Smith et al. (1983) Mol Cell Biol 3: 2156-216.
5) and the pVL series (Lucklow and Summers (1989)
Virology 170: 31-39).

In yet another embodiment, the nucleic acids of the invention are expressed in mammalian cells using mammalian expression vectors. An example of a mammalian expression vector is pCDM8
(Seed (1987) Nature 329: 840) and pMT2PC (
Kaufman et al. (1987) EMBO J 6: 187-195). When used in mammalian cells, the expression vector's control functions are often
Provided by the regulatory elements of the virus. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, and simian virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells, see, eg, Sambrook et al., MOLECUL.
AR CLONING: A LABORATORY MANUAL. Second edition, C
old Spring Harbor Laboratory, Cold Sp
ring Harbor Laboratory Press, Cold Sp
ring Harbor, N.M. Y. , 1989, chapters 16 and 17.

In another embodiment, the recombinant mammalian expression vector can direct the expression of the nucleic acid preferentially in a particular cell type (eg, use the tissue-specific regulatory elements to express the nucleic acid). . Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (
Liver-specific; Pinkert et al. (1987) Genes Dev 1: 268-.
277), a lymphoid-specific promoter (Calame and Eaton (198).
8) Adv Immunol 43: 235-275), especially the T cell receptor promoter (Winoto and Baltimore (1989) EMBO.
J 8: 729-733) and immunoglobulins (Banerji et al. (198).
3) Cell 33: 729-740; Queen and Baltimore (
1983) Cell 33: 741-748), neuron-specific promoters (eg, neurofilament promoter; Byrne and Ruddle (1989P.N.A.S. 86: 5473-5477), pancreas-specific promoter (Edlund et al. 1985) Science 230: 9.
12-916), and mammary gland specific promoters (eg, milk whey promoter; US Pat. No. 4,873,316 and European Patent Publication No. 264,166). Developmentally regulated promoters are also included (eg, murine hox promoters (Kessel and Gr).
uss (1990) Science 249: 374-379) and the α-fetoprotein promoter (Campes and Tilghman (1989).
Genes Dev 3: 537-546).

The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in the antisense orientation. That is, the DNA molecule expresses an RNA molecule that is antisense to FCTRX mRNA (D
Operatively linked to regulatory sequences in a manner that allows (by transcription of NA molecules). A regulatory sequence operably linked to the nucleic acid cloned in the antisense orientation can be chosen which directs the continuous expression of the antisense RNA molecule in various cell types. For example, viral promoters and / or enhancers, or regulatory sequences that direct constitutive, tissue-specific, or cell-type specific expression of antisense RNA may be selected. The antisense expression vector can be in the form of a recombinant plasmid, phagemid, or attenuated virus, where the antisense nucleic acid is produced under the control of a high efficiency regulatory region, the activity of which is introduced into the vector. Cell type. For a discussion of the regulation of gene expression using antisense genes, see, eg, Weintraub et al., “An.
tissue RNA as a molecular tool for
genetic analysis ", Reviews-Trends in
See Genetics, Volume 1 (1) 1986.

Another aspect of the present invention relates to a host cell into which the recombinant expression vector of the present invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell, but to the progeny or potential progeny of such a cell. Such progeny may, in fact, not be identical to the parental cell, as the particular modification may be present in the next generation, either due to mutations or environmental influences, but is still referred to herein. Within the scope of the term as used in.

The host cell can be any prokaryotic or eukaryotic cell. For example, F
The CTRX protein can be expressed in bacterial cells (eg E. coli), insect cells, yeast or mammalian cells (eg human Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those of skill in the art.

Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation" and "transfection" refer to various art-recognized techniques for introducing exogenous nucleic acid (eg, DNA) into a host cell. Are intended to include and include calcium phosphate or calcium chloride co-precipitation, DEAE dextran mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells are described by Sambrook et al. (MOLECULAR CL
ONING: A LABORATORY MANUAL. Second Edition, Cold S
pring Harbor Laboratory, Cold Spring
Harbor Laboratory Press, Cold Spring
Harbor, N.M. Y. , 1989) and other laboratory manuals.

For stable transfection of mammalian cells, it is known that only a fraction of the cells can integrate foreign DNA into their genome, depending on the expression vector and transfection technique used. . To identify and select for these elements, a gene encoding a selectable marker (eg, resistance to antibiotics) is generally introduced into the host cell along with the gene of interest. Various selectable markers include markers that confer resistance to drugs (eg, G418
, Hygromycin, and methotrexate). The nucleic acid encoding the selectable marker can be introduced into the host cell on the same vector as the vector encoding the growth promoter or can be introduced on a separate vector. Cells that are stably transfected with the introduced nucleic acid can be identified by drug selection (eg, cells that have incorporated the selectable marker gene will survive but other cells will die).

Host cells of the invention (eg, prokaryotic and eukaryotic host cells in culture) can be used to produce (ie, express) FCTRX protein. Accordingly, the invention further provides methods for producing FCTRX protein using the host cells of the invention. In one embodiment, the method comprises
The host cell of the invention (in a suitable medium in which the FCTRX protein is produced)
Here, a recombinant expression vector encoding the FCTRX polypeptide is introduced). In another embodiment, the method further comprises
Isolating FCTRX from the medium or host cells.

Transgenic Animals The host cells of the invention can also be used to produce nonhuman transgenic animals. For example, in one embodiment, the host cell of the invention is FCTR.
A fertilized oocyte or embryonic stem cell into which the X coding sequence has been introduced. Such host cells can then be used to produce non-human transgenic animals, where the exogenous FCTRX sequences are modified by their genomic or homologous recombinant animals (where the endogenous FCTRX sequences are altered). Has been introduced). Such animals are used to study FCTRX function and / or activity, and in FCT.
Useful for identifying and / or evaluating modulators of RX activity.
As used herein, a "transgenic animal" is a non-human animal,
It is preferably a mammal, more preferably a rodent such as a rat or mouse, wherein one or more cells of these animals contain the transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats,
Including chickens and amphibians. A transgene is exogenous DNA that integrates into the genome of a cell (from which cells a transgenic animal develops) and remains in the genome of a mature animal, thereby producing one or more cells of this transgenic animal. Directs expression of the encoded gene product in the form or tissue. As used herein, a "homologous recombinant animal" is a non-human animal, preferably a mammal, more preferably a mouse, wherein the endogenous FCTRX gene is
This endogenous gene and the animal's cells (eg, animal's embryonic cells) prior to animal development
Has been modified by homologous recombination with an exogenous DNA molecule introduced into E. coli.

The transgenic animals of the present invention have a nucleic acid encoding FCTRX (eg, by introducing into the male pronucleus of a fertilized oocyte, eg, by microinjection, retroviral infection), and Pseudopregnant females can be made by allowing them to develop in foster animals. Human FCTRX of SEQ ID NOs: 1, 3, 5, 7, 9 and 11
The DNA sequence can be introduced as a transgene into the genome of a non-human animal. Alternatively, a non-human homologue of the human FCTRX gene, such as the mouse FCTRX gene, can be isolated based on hybridization to the human FCTRX cDNA (described further above) and used as a transgene.
Intron sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. The tissue-specific regulatory sequence (s) directs expression of the FCTRX protein to specific cells,
Operably linked to the FCTRX transgene. Methods for producing transgenic animals, particularly animals such as mice, via embryo manipulation and microinjection are conventional in the art and are described, for example, in US Pat. No. 4,736,866. No. 4,870,009; and No. 4,873.
191; and Hogan 1986, MANIPULATING THE.
MOUSE EMBRYO, Cold Spring Harbor Lab
Oratory Press, Cold Spring Harbor, N.M. Y
． It is described in. Similar methods are used for the production of other transgenic animals. Transgenic primary animals have FCTRX in their genome
Presence of transgene and / or FCTRX m in tissue or cells of the animal
It can be identified based on the expression of RNA. The transgenic founder animal can then be used to breed additional animals carrying the transgene. further,
Transgenic animals carrying a transgene encoding FCTRX can be further bred to other transgenic animals carrying other transgenes.

[0218] Deletions, additions or substitutions have been introduced to produce a homologous recombinant animal, thereby altering (eg, functionally disrupting) the FCTRX gene, at least a portion of the FCTRX gene. A vector containing is prepared. The FCTRX gene can be a human gene (eg, DNA of SEQ ID NOs: 1, 3, 5, 7, 9 and 11), but more preferably is a non-human homologue of the human FCTRX gene.
For example, the mouse homologues of the human FCTRX gene of SEQ ID NOs: 1, 3, 5, 7, 9 and 11 can be used to construct a homologous recombination vector suitable for altering the endogenous FCTRX gene in the mouse genome. . In one embodiment, the vector is designed such that upon homologous recombination, the endogenous FCTRX gene is functionally disrupted (ie, no longer encodes a functional protein; also referred to as a "knockout" vector). .

Alternatively, the vector is designed such that upon homologous recombination, the endogenous FCTRX gene is mutated or otherwise altered, but still encodes a functional protein (eg, , May alter upstream regulatory regions, thereby altering the expression of endogenous FCTRX). In the homologous recombination vector, FCT
The altered portion of the RX gene is flanked by additional nucleic acid of the FCTRX gene at its 5'and 3'ends, and homologous recombination results in the exogenous FCTRX protein gene carried by the vector and the endogenous FCTRX in embryonic stem cells. Allows to happen with protein genes. The additional flanking FCTRX protein nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both 5'and 3'ends) are included in the vector. See, for example, Thomas et al. (1987) Cell 51: 503 for a description of homologous recombination vectors. This vector was introduced into an embryonic stem cell line (eg, by electroporation) and the introduced F
Cells in which the CTRX gene has undergone homologous recombination with the endogenous FCTRX gene are selected (see, eg, Li et al. (1992) Cell 69: 915).

The selected cells are then injected into the blastocyst of an animal (eg mouse) to form an aggregated chimera. For example, TERATO from Bradley (1987)
CARINOMAS AND EMBRYONIC STEM CELLS:
A PRACTICAL APPROACH, edited by Robertson, IRL,
See Oxford pages 113-152. The chimeric embryo can then be transferred to a suitable pseudopregnant female foster animal, and the embryo is allowed to rest for a period of time. Offspring carrying homologous recombination DNA in their germ cells may be used to breed animals,
Here, all cells of this animal contain this homologous recombinant DNA by germline transmission of the transgene. Methods for constructing homologous recombination vectors and homologous recombinant animals are described further below; Bradley (1991) Cur.
r. Opin. Biotechnol. 2: 823-829; PCT International Publication Numbers: WO90 / 1184; WO91 / 01140; WO92 / 0968; and WO93 / 04169.

In another embodiment, non-human transgenic animals can be produced that contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre / loxP recombinase system of bacteriophage P1.
For a description of the cre / loxP recombinase system, see, eg, Lakso et al.
1992, P.I. N. A. S. 89: 6232-6236. Another example of a recombinase system is Saccharomyces cerevisiae F.
LP recombinase system (O'Gorman et al., 1991, Science).
251: 181-185). If the cre / loxP recombinase system is used to regulate transgene expression, then an animal containing the transgene encoding both the Cre recombinase and the selected protein is required. Such animals can be "double-stranded", for example, by crossing two transgenic animals, one containing the transgene encoding the selected protein and the other containing the transgene encoding the recombinase. '' Can be provided by the construction of transgenic animals.

A clone of the transgenic non-human animal described herein also contains W
ilmut et al., 1997, Nature 385: 810-813. Briefly, cells from transgenic animals (
For example, somatic cells) can be isolated and induced, exit the growth cycle and enter G ₀ phase. The quiescent cells can then be fused, eg, by use of electric pulses, to isolated oocytes from the same animal from which the quiescent cells are isolated. The reconstructed oocytes are then cultured, which allows them to develop into morula or undifferentiated germ cells and then transferred to pseudopregnant female foster animals. The progeny of the female Foster animal is a clone of the animal from which the cells (eg, somatic cells) are isolated.

Pharmaceutical Compositions FCTRX nucleic acid molecules, FCTRX proteins, and anti-FCTRX antibodies of the invention, and their derivatives, fragments, analogs, and homologs are referred to herein as "active compounds," or "therapies." It is called "agent". Further, the F of the present invention
CTRX nucleic acid molecules, FCTRX proteins, and anti-FCTRX antibodies, and their derivatives, fragments, analogs, and homologs, or common to FCTRX nucleic acid molecules, FCTRX proteins, and their derivatives, fragments, analogs, and homologs. Low molecular weight compounds that have the property of either inducing a mediated pharmaceutical agonist or antagonist response are also referred to herein as "active compounds" or "therapeutic agents." These therapeutic agents can be incorporated into pharmaceutical compositions suitable for administration to a subject. Such compositions typically include a nucleic acid molecule, a protein or antibody, and a pharmaceutically acceptable carrier.

As used herein, "pharmaceutically acceptable carrier" means any and all solvents, dispersions, coatings, antibacterial and antifungal agents that are compatible with pharmaceutical administration. It is intended to include isotonic and delaying agents and the like. A suitable carrier is Remington's Pharmaceutical Sciences, a standard reference text in the field.
s latest version, which is incorporated herein by reference. Preferred examples of such carriers or excipients include water, saline, finger solution,
Includes, but is not limited to, dextrose solution, and 5% human serum albumin. Liposomes and non-aqueous vehicles such as fixed oils can also be used. The use of such media and agents for pharmaceutically active substances is well known in the art. Except to the extent of any conventional vehicle or drug that is incompatible with the active compound, its use in the composition is intended. Supplementary active compounds can also be incorporated into the compositions.

A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (eg, intravenous, intradermal, subcutaneous), oral (eg, inhalation), transdermal (ie, topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application may include the following ingredients: sterile vehicle (eg water for injection, saline solution, non-volatile) Oils, polyethylene glycol, glycerin, propylene glycol or other synthetic solvents); antibacterial agents (eg benzyl alcohol or methylparaben); antioxidants (eg ascorbic acid or sodium bisulfite)
Chelating agents (eg ethylenediaminetetraacetic acid); buffers (eg acetate, citrate or phosphate); and agents for adjusting tonicity (eg sodium chloride or dextrose). pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include saline, bacteriostatic water, Crem.
Ophor EL ^™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition should be sterile and should be easy to inject.
It should be fluid to the extent that y) is present. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols such as glycerol, propylene glycol, and liquid polyethylene glycols, and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size for dispersion and by the use of surfactants. Preventing the action of microorganisms
It can be achieved by various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Long-term absorption of an injectable composition
Agents that delay absorption (eg, aluminum monostearate and gelatin)
Can be included in a composition.

Sterile injectable solutions are prepared by incorporating the required amount of the active compound (eg, FCTRX protein or anti-FCTRX protein antibody) in a suitable solvent with one or a combination of the above-listed components. In some cases, it can be prepared by subsequent filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the method of preparation is vacuum drying and freeze drying, whereby a powder of the active ingredient and any further desired ingredients from that solution which has been previously sterile filtered. To get

Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. The oral composition also
It can be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and exhaled. Or swallowed. A pharmaceutically compatible binder and / or adjuvant material,
It may be included as part of this composition. Tablets, pills, capsules, troches and the like may contain any of the following ingredients or compounds having similar properties: binders (eg microcrystalline cellulose, gum tragacanth or gelatin); excipients (eg Starch or lactose), disintegrants (eg alginic acid, Primog)
EL, or corn starch); lubricants (eg magnesium stearate or Sterotes); glidants (eg colloidal silicon dioxide); sweeteners (eg sucrose or saccharin); or flavoring agents (eg peppermint). , Methyl salicylate, or orange flavor).

For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, eg, a gas such as carbon dioxide, or a nebulizer.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished by nasal spray or suppositories. For transdermal administration, the active compound may be an ointment, which is generally known in the art,
Formulated in ointment, gel, or cream.

The compounds can also be prepared in the form of suppositories (eg, with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

In one embodiment, the active compound is prepared with a carrier that protects the compound against rapid elimination from the body (eg, controlled release formulations),
This includes implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
Methods for the preparation of such formulations will be apparent to those of skill in the art. These materials are also commercially available from Alza Corporation and Nova Phar.
scientifics, Inc. Commercially available from Liposomal suspensions, including liposomes targeted to infected cells, containing monoclonal antibodies against viral antigens, can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in US Pat. No. 4,522,811.

Sustained-release preparations can be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped particles, eg films or microcapsules. Examples of sustained release matrices include polyesters, hydrogels (eg, poly (2-hydroxyethyl-methacrylate) or poly (vinyl alcohol)).
, Polylactide (US Pat. No. 3,773,919), copolymers of L-glutamic acid and ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers (eg, LUPRON DEPOT ^™ (lactic acid-lactic acid- Injectable microspheres composed of glycolic acid copolymer and leuprolide acetate), and poly-D-(−)-3-hydroxybutyric acid.Polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid have While allowing release of molecules over days, certain hydrogels release proteins in shorter time periods.

It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically individual units suitable as unitary dosages for the subject to be treated; each unit being associated with a required pharmaceutical carrier. And a predetermined amount of active compound calculated to produce the desired therapeutic effect. Details regarding the dosage unit forms of the present invention are given by the unique properties of the active compound, and the particular therapeutic effect achieved, as well as limitations inherent in the art of formulating such active compounds for treatment of individuals. Determined or directly dependent on them.

The nucleic acid molecule of the present invention can be inserted into a vector and used as a gene therapy vector. Gene therapy vectors can be delivered to a subject by any of several routes, such as those described in US Pat. No. 5,703,055. Thus, delivery may be, for example, intravenous injection, topical administration (see US Pat. No. 5,328,470) or stereotactic injection (eg Chen et al. (1994) Proc. Natl.
． Sci. USA. 91: 3054-3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can include a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, the complete gene delivery vector can be produced intact from recombinant cells (eg, retroviral vectors) and the pharmaceutical preparation can include one or more cells that produce the gene delivery system.

The pharmaceutical composition may be included in a kit (eg, container, package, or dispenser) together with instructions for administration.

Use in therapy in the manufacture of a medicament for treating a syndrome associated with a human disease is also within the scope of the present invention, wherein the disease is selected from FCTRX-related disorders, wherein This treatment includes FCTRX polypeptides, FCTRX nucleic acids,
And an anti-FCTRX antibody.

Further Uses and Methods of the Invention Nucleic acid molecules, proteins, protein homologs, and antibodies described herein can be used in one or more of the following methods: (a) screening assays. (B) detection assays (eg, chromosome mapping, cell and tissue typing, forensic biology); (c) predictive medicine (eg, diagnostic assays, prognostic assays, clinical trial monitoring, and pharmacogenomics); and (d). Methods of treatment (eg, treatment and prevention).

The isolated nucleic acid molecule of the present invention is FCTRX as described further below.
To express a protein (eg, via a recombinant expression vector in a host cell in gene therapy applications), to detect gene damage in the FCTRX mRNA (eg, in a biological sample) or in the FCTRX gene, as well as to detect FCTRX activity. It can be used to adjust. In addition, the FCTRX protein has decreased or aberrant activity for screening drugs or compounds that modulate FCTRX activity or expression, as well as by insufficient or overproduction of the FCTRX protein, or as compared to the FCTRX wild-type protein. Can be used to treat disorders characterized by the production of FCTRX protein forms having, for example, proliferative disorders or differentiation disorders. Further, the anti-FCTRX antibodies of the invention can be used to detect and isolate FCTRX protein and to modulate FCTRX activity.

The invention further relates to novel agents identified by the screening assays described above, and their use for treatment as described herein.

Screening Assays The present invention provides a candidate or test compound or agent that binds to a modulator, ie, FCTRX protein, or that has a stimulatory or inhibitory effect on, for example, FCTRX expression or FCTRX activity. (Eg protein,
Provide a method (also referred to herein as "screening assay") for identifying a polypeptide, nucleic acid or polynucleotide, peptide, peptidomimetic, small molecule (agonist or antagonist) or other drug) . Candidates or test compounds or agents capable of binding FCTRX polypeptide have the following molecular weights: about 50 Da, 100 Da, 150 Da, 300D.
a, 330 Da, 350 Da, 400 Da, 500 Da, 750 Da, 1000
Da, 1250 Da, 1500 Da, 1750 Da, 2000 Da, 5000 D
a, 10,000 Da, 25,000 Da, 50,000 Da, 75,000 D
a, 100,000 Da or 100,000 Da or more. In certain embodiments, candidates that bind FCTRX polypeptides have a molecular weight of less than about 1500 Da.

Details of functional assays are provided further below herein. Any of the assays described, as well as additional assays known to those of skill in the art such as pharmacology, hematology, internal medicine, oncology, can be used to screen candidates for their properties as therapeutic agents. However, therapeutic agents of the present invention include proteins, polypeptides, nucleic acids or polynucleotides, peptides, peptidomimetics, small molecules (including agonists or antagonists) or other drugs described herein. Including.

In one embodiment, the invention provides a candidate for binding to or modulating the activity of a membrane-bound form of a protein or polypeptide of FCTRX, or a biologically active portion thereof. An assay is provided for screening compounds or test compounds. The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, these libraries include: biological libraries; spatial libraries. Parallel solid-phase or solution-phase libraries accessible to the library; synthetic library methods that require deconvolution; "one-bead-one-compound" library methods; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, but the other four approaches are applicable to small molecule libraries of peptides, non-peptide oligomers or compounds (Lam (1997) Anticancer Drug).
Design 12: 145).

Examples of methods for the synthesis of molecular libraries can be found in the art, for example: DeWitt et al. (1993) Proc Natl Acad.
Sci U. S. A. 90: 6909; Erb et al. (1994) Proc Nat.
l Acad Sci U.I. S. A. 91: 11422; Zuckermann
Et al. (1994) J Med Chem 37: 2678; Cho et al. (1993).
Science 261: 1303; Carrell et al. (1994) Angew.
Chem Int Ed Engl 33: 2059; Carell et al. (19).
94) Angew Chem Int Ed Engl 33: 2061; and Gallop et al. (1994) J Med Chem 37: 1233.

Compound libraries are available in solution (see, eg, Houghten (1992).
Biotechniques 13: 412-421) or on beads (L
am (1991) Nature 354: 82-84) on chip (Fodor)
(1993) Nature 364: 555-556), bacteria (Ladner.
US Pat. No. 5,223,409), spores (Ladner US Pat. No. 5,23)
3,409), plasmid (Cull et al. (1992) Proc Natl A.
cad Sci USA 89: 1865-1869) or on a phage (Sc
Ott and Smith (1990) Science 249: 386-390.
Devlin (1990) Science 249: 404-406; Cwi
rla et al. (1990) Proc Natl Acad Sci U. S. A. 8
7: 6378-6382; Felici (1991) J Mol Biol 2
22: 30-310; Ladner (supra).

[0246] In one embodiment, the assay is a cell-based assay, wherein:
Cells expressing the membrane-bound form of the FCTRX protein, or a biologically active portion thereof, on the cell surface are contacted with a test compound, and the test compound is treated with FC
The ability to bind the TRX protein is determined. For example, the cell can be of mammalian origin or a yeast cell. Determining the ability of the test compound to bind to the FCTRX protein can be accomplished, for example, by coupling the test compound with a radioisotope label or an enzyme label, such that the FCTRX protein of the test compound or its biologically active Binding to the moiety can be achieved by being able to be determined by detecting its labeled compound in the complex. For example, a test compound can be labeled either directly or indirectly with ¹²⁵ I, ³⁵ S, ¹⁴ C, or ³ H, and its radioisotope can be labeled by direct counting of radiation emission or by scintillation counting. Can be detected by Alternatively, the test compound can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determining conversion of the appropriate substrate to product. . In one embodiment, the assay involves contacting cells expressing a membrane-bound form of the FCTRX protein, or a biologically active portion thereof, on its cell surface with a known compound that binds FCTRX, Forming a mixture, contacting a test compound with the assay mixture, and determining the ability of the test compound to interact with the FCTRX protein, wherein the test compound interacts with the FCTRX protein. The step of determining the ability of the test compound to compare with known compounds
Determining the ability to preferentially bind FCTRX or a biologically active portion thereof.

In another embodiment, the assay is a cell-based assay, which comprises
Contacting a cell expressing a membrane-bound form of the FCTRX protein or a biologically active portion thereof on the cell surface with a test compound, as well as the test compound comprising: Determining the ability to modulate (eg, stimulate or inhibit) activity. This test compound is F
Determining the ability to modulate the activity of a CTRX polypeptide or biologically active portion thereof is accomplished, for example, by determining the ability of an FCTRX protein to bind to or interact with an FCTRX target molecule. obtain. As used herein, a "target molecule" is a molecule with which a FCTRX protein naturally binds or interacts, eg, a molecule on the cell surface that expresses the FCTRX protein, a second cell surface. The above molecules, molecules in the extracellular environment, molecules that associate with the inner surface of the cell membrane, or cytoplasmic molecules. The FCTRX target molecule is a non-FCTRX molecule or a FCTRX protein or polypeptide of the invention. In one embodiment, the FCTRX target molecule is a component of a signal transduction pathway, which is an extracellular signal through the cell membrane and into the cell (eg,
The compound promotes transmission of a signal generated by binding to a membrane-bound FCTRX molecule. The target is, for example, a second intracellular protein having catalytic activity,
Or it may be a protein that facilitates the association of the downstream signal molecule with the FCTRX polypeptide.

Determining the ability of the FCTRX protein to bind to or interact with the FCTRX target molecule can be accomplished by one of the above methods for determining direct binding. In one embodiment, the FCTRX protein is FCTR
Determining the ability to bind to or interact with the X target molecule can be accomplished by determining the activity of the target molecule. For example, the activity of this target molecule can be detected by detecting the induction of its target cellular second messenger (ie, intracellular Ca ²⁺ , diacylglycerol, IP _3, etc.), the catalytic activity / enzymatic activity of the target to the appropriate substrate. Detecting a reporter gene (FCTRX operably linked to a nucleic acid encoding a detectable marker (eg, luciferase))
It can be determined by detecting the induction of responsive regulatory elements) or by detecting the cellular response (eg, cell viability, cell differentiation, or cell proliferation).

In yet another embodiment, the assay of the present invention is a cell-free assay, F
Contacting the test compound with the CTRX protein or biologically active portion thereof, as well as determining the ability of the test compound to bind to the FCTRX protein or biologically active portion thereof. FCTR of this test compound
Binding to the X protein can be determined either directly or indirectly, as described above. In one embodiment, the assay comprises contacting the FCTRX protein or a biologically active portion thereof with a known compound that binds FCTRX to form an assay mixture, contacting the assay mixture with a test compound. And determining the ability of the test compound to interact with the FCTRX protein, wherein the step of determining the ability of the test compound to interact with the FCTRX protein comprises: Determining the ability to preferentially bind FCTRX or a biologically active portion thereof, as compared to the compound.

[0250] In another embodiment, the assay is a cell-free assay, wherein the FCTRX protein or biologically active portion thereof is contacted with a test compound, as well as the test compound is an FCTRX protein or biologically active thereof. Determining the ability of the active moiety to modulate (eg, stimulate or inhibit) the activity of the active moiety. Determining the ability of this test compound to modulate the activity of FCTRX polypeptide can be accomplished, for example, by
It can be achieved by determining the ability of the FCTRX protein to bind to the FCTRX target molecule by one of the above methods for determining direct binding. In an alternative embodiment, determining the ability of the test compound to modulate the activity of the FCTRX polypeptide can be accomplished by determining the ability of the FCTRX protein to further modulate the FCTRX target molecule. For example, the catalytic / enzymatic activity of the target molecule on the appropriate substrate can be determined as described above.

In yet another embodiment, the cell-free assay comprises contacting a FCTRX protein or a biologically active portion thereof with a known compound that binds an FCTRX polypeptide to form an assay mixture, the assay Contacting the mixture with a test compound, and determining the ability of the test compound to interact with the FCTRX protein, wherein determining the ability of the test compound to interact with the FCTRX protein comprises , FCTRX target molecule binding preferentially or determining the ability to modulate the activity of that target molecule preferentially.

The cell-free assay of the present invention is acceptable for use with both soluble or membrane bound forms of FCTRX polypeptides. For cell-free assays that include a membrane-bound form of FCTRX polypeptide, it may be desirable to utilize a solubilizer such that the membrane-bound form of FCTRX polypeptide is maintained in solution. Examples of such solubilizers include nonionic surfactants such as n-octyl glucoside, n-dodecyl glucoside, n-dodecyl maltoside, octanoyl-.
N-methylglucamide, decanoyl-N-methylglucamide, Triton (registered trademark) X-100, Triton (registered trademark) X-114, Thesit (registered trademark), isotridecyl poly (ethylene glycol ether) _n (Isotr)
decypoly (ethylenglycol ether) _n ), N
-Dodecyl-N, N-dimethyl-3-ammonio-1-propanesulfonate,
3- (3-cholamidopropyl) dimethylammonio-1-propanesulfonate (3- (3-cholamidopropyl) dimethylammini
ol-1-propane sulphonate) (CHAPS), or 3-
(3-Colamidopropyl) dimethylammonio-2-hydroxy-1-propanesulfonate (3- (3-cholamidopropyl) dimethyl)
amminiol-2-hydroxy-1-propane sulfona
te) (CHAPSO).

Immobilizing either the FCTRX polypeptide or its target molecule to facilitate separation of the complexed form from the uncomplexed form of one or both of the proteins,
And it may be desirable to apply it to automation of the assay. The binding of the test compound to the FCTRX polypeptide, or the interaction of the FCTRX polypeptide with the target molecule in the presence and absence of the candidate compound, can be carried out in any container suitable for containing these reactants. , Can be achieved. Examples of such containers include
Microtiter plates, test tubes, and microcentrifuge tubes are included. In one embodiment, a fusion protein can be provided that adds a domain that allows one or both of the proteins to bind to the matrix. For example,
GST-FCTRX polypeptide fusion protein or GST target fusion protein can be glutathione sepharose beads (Sigma Chemical, St.
． Louis, MO) or glutathione derivatized microtiter plates, which are then combined with the test compound or with the test compound and either non-adsorbed target protein or FCTRX protein, and the mixture Are incubated under conditions that contribute to complex formation (eg, physiological conditions with respect to salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components and, in the case of beads, to immobilize the matrix, e.g. It is decided either by the target. Alternatively, the complex can be dissociated from the matrix and the level of FCTRX binding or activity determined using standard techniques.

Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention. For example, either the FCTRX polypeptide or its target molecule can be immobilized utilizing the conjugation of biotin and streptavidin. Biotinylated FCTRX proteins or target molecules can be prepared from biotin NHS (N-hydroxysuccinimide) using techniques well known in the art (eg, biotinylation kit, Pierce).
Chemicals, Rockford, Ill. ), And streptavidin coated 96-well plates (Pierce Chemical). Alternatively, an antibody that is reactive with the FCTRX protein or target molecule but does not interfere with the binding of the FCTRX protein to its target molecule can be derivatized to the wells of the plate, and the unbound target or FCCTR.
The X protein can be trapped within the well by conjugation of the antibody. Methods for detecting such complexes include, in addition to those described above for GST-immobilized complexes, immunodetection of the complexes using antibodies reactive with the FCTRX protein or target molecule, as well as the FCTRX protein or Enzyme-linked assays that rely on the detection of enzymatic activity on target molecules are included.

In another embodiment, modulators of FCTRX expression are identified in a method wherein a cell is contacted with a candidate compound and the expression of FCTRX mRNA or protein in the cell is determined. The level of FCTRX mRNA or protein expression in the presence of the candidate compound is
MRNA or protein expression level. The candidate compound can then be identified as a modulator of FCTRX expression based on this comparison. For example, when the expression of FCTRX mRNA or protein is greater in the presence of the candidate compound than in the absence thereof (statistically significantly greater),
This candidate compound is identified as a stimulator of FCTRX mRNA or protein expression. Alternatively, expression of FCTRX mRNA or protein is
A candidate compound is identified as an inhibitor of FCTRX mRNA or protein expression if it is smaller (statistically significantly smaller) in the presence of the candidate compound than in the absence of the candidate compound. The level of FCTRX mRNA or protein expression in the cell can be determined by the methods described herein for detecting FCTRX mRNA or protein.

In yet another aspect of the invention, the FCTRX protein can be used as a “bait protein” in a two-hybrid or three-hybrid assay (eg, US Pat. No. 5,283,317; Zer.
Vos et al., (1993) Cell 72: 223-232; Madura et al., (
1993) J Biol Chem 268: 12046-12054; Bar.
tel et al., (1993) Biotechniques 14: 920-924;
Iwabuchi et al., (1993) Oncogene 8: 1693-1696.
And Brent WO94 / 10300), a protein that binds to or interacts with FCTRX ("FCTRX binding protein" or "
FCTRX-bp "), as well as other proteins that regulate the activity of FCTRX. Such FCTRX binding proteins also appear to be involved in signal transduction by the FCTRX protein, eg, as an element upstream or downstream of the FCTRX pathway.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, this assay uses two different DNA constructs. In one construct, the gene encoding FCTRX is a known transcription factor (eg, GAL
-4) fused to the gene encoding the DNA binding domain. In the other construct, an unidentified protein (“pre (pr)
The DNA sequence encoding ey) "or" sample ") is fused to a gene encoding the activation domain of a known transcription factor. When the "bait" and "prey" proteins are capable of interacting in vivo, they form an FCTRX-dependent complex,
The DNA binding and activation domains of transcription factors are in close proximity. This proximity allows transcription of a reporter gene (eg, LacZ) operably linked to transcriptional regulatory sites responsive to transcription factors. Expression of the reporter gene can be detected, and cell colonies containing this functional transcription factor can be isolated and used to obtain a cloned gene encoding a protein that interacts with FCTRX.

Screening can also be performed in vivo. For example, in one embodiment, the present invention provides a method for screening modulators of HDGCX-related disorder activity or latency or predisposition by administering a test compound to a test animal having an increased risk of an FCTRX-related disorder. Including. In some embodiments, the test animal recombinantly expresses the HDGCX polypeptide. The activity of the polypeptide in the test animal after administration of the compound is measured and the activity of the protein in the test animal is compared to the activity of the polypeptide in a control animal that was not administered the polypeptide. Changes in the activity of this polypeptide in this test animal relative to control animals indicate that this test compound is a modulator of latency or predisposition to FCTRX-related disorders.

In some embodiments, the test animal expresses the test protein transgene or expresses the transgene under the control of a promoter at increased levels compared to the wild-type test animal. It is an animal. Preferably the promoter is not the native gene promoter of the transgene.

The present invention further relates to novel reagents identified by the above screening assays and their use for the treatments described herein.

Detection Assays Portions or fragments of the cDNA sequences identified herein (and the corresponding complete gene sequences) can be used in many ways as polynucleotide reagents. For example, these sequences (i) map each gene onto a chromosome; thereby locating a genetic region associated with a genetic disease; (ii) identifying an individual from a small biological sample (tissue type Determination); and (iii) can be used as an aid in forensic identification of biological samples.

The FCTRX sequences of the invention can also be used to identify an individual from a small biological sample. In this technique, genomic DNA of an individual is digested with one or more restriction enzymes and probed on Southern blots to generate unique bands for identification. The sequences of the present invention are RFLP (US Pat.
It is useful as an additional DNA marker for the "restriction fragment length polymorphism" described in No. 2,057.

Furthermore, the sequences of the present invention may be used to provide an alternative technique for determining the DNA sequence of each base in a selected portion of the genome of an individual. Thus, the FCTRX sequence described herein can be used to prepare two PCR primers from the 5'and 3'ends of the sequence. These primers can then be used to amplify an individual's DNA and subsequently sequence it.

The panel of corresponding DNA sequences from individuals prepared in this way was
Having a unique set of such DNA sequences due to allelic differences,
It may provide unique identification. The sequences of the present invention can be used to obtain such discrimination of sequences of individual and tissue origin. The FCTRX sequences of the present invention uniquely represent a portion of the human genome. Allelic variations occur to some extent in the coding regions of these sequences and to a greater extent in non-coding regions. It is estimated that allelic variation between individual humans occurs approximately once every 500 bases. Many of the allelic variations result from single nucleotide polymorphisms (SNPs), including restriction fragment length polymorphisms (RFLPs).

Each of the sequences described herein can be used, to some extent, as a standard against which DNA from an individual can be compared for purposes of discrimination. Not so many sequences are required to distinguish individuals, as more polymorphisms occur in non-coding regions. The non-coding sequences of SEQ ID NOs: 1, 3, 5, 7, 9, and 11 can comfortably provide positive individual identification, possibly using a panel of 10-1,000 primers, as described above. Each of these primers is 1
This produces a 00 base amplified non-coding sequence. If a putative coding sequence is used, a more suitable number of primers for positive identification is 500-2,0.
00.

Use of Partial FCTRX Sequences in Forensic Biology DNA-based identification techniques based on FCTRX nucleic acid sequences or polypeptide sequences can also be used in forensic biology. Forensic biology is a scientific discipline that utilizes genotyping of biological evidence found at crime scenes, for example, as a means to positively identify criminals. To make such an identification,
Amplify DNA sequences obtained from very small biological samples using PCR technology, such as tissues (eg hair or skin found in crime scenes or body fluids such as blood, saliva or semen) You can The amplified sequence may then be compared to a standard, thereby allowing identification of the origin of the biological sample.

The sequences of the invention can be used to provide polynucleotide reagents (eg, PCR primers) that can be targeted to specific loci in the human genome. This PC
R-primers may increase the reliability of DNA-based forensic discrimination, for example, by providing another "discriminating marker" (ie, another DNA sequence unique to a particular individual). As mentioned above, the actual nucleotide sequence information can be used for identification as an accurate alternative to the pattern formed by the restriction enzyme generated fragments. Sequences targeted to the non-coding region of SEQ ID NO: 2n-1 (where n = 1 to 13) produce more polymorphisms in the non-coding region, which results in
It is particularly suitable for this application as it makes it easier to distinguish individuals using this technique. Examples of polynucleotide reagents can include FCTRX sequences or portions thereof, eg, fragments derived from one or more non-coding regions of SEQ ID NOs: 2n-1 (where n = 1-13), At least 2 parts
It has a length of 0 bases, preferably at least 30 bases.

The FCTRX sequences described herein provide polynucleotide reagents (eg, labeled or labelable probes that can be used in in situ hybridization techniques) to direct specific tissue (eg, brain tissue, etc.). Can be further used to identify This can be very useful if forensic pathologists are presented with tissue of unknown origin. Such a panel of FCTRX probes can be used to identify tissue by species and / or by organ type.

Thus, these reagents (eg, FCTRX primers or probes)
Can be used to screen tissue cultures for contaminants (ie, screening for inclusion of different types of cells in culture).

Predictive Medicine The invention also uses monitoring diagnostic assays, prognostic assays, pharmacogenetics and clinical trials for prognostic (predictive) purposes, thereby treating an individual prophylactically. The field of predictive medicine. Accordingly, one aspect of the present invention is F
Expression of CTRX protein and / or nucleic acid, and activity of FCTRX,
Determined in the context of a biological sample (eg, blood, serum, cells, tissues), thereby determining whether an individual suffers from a disease or disorder, or a disorder, associated with aberrant FCTRX expression or activity. It relates to diagnostic assays for determining whether at risk of developing. The invention also provides a prognostic (or prognostic) assay for determining whether an individual is at risk of developing a disorder associated with FCTRX protein, nucleic acid expression or activity. For example, mutations in the gene for FCTRX can be assayed in biological samples. Such an assay may be used for prognostic or predictive purposes, thereby allowing FCTR
Individuals are treated prophylactically prior to the onset of disorders characterized by or related to the expression or biological activity of X proteins, nucleic acids.

Another aspect of the invention provides a method for determining the expression or activity of FCTRX protein, nucleic acid in an individual, thereby selecting an appropriate therapeutic or prophylactic reagent for that individual. (Referred to herein as "pharmacogenetics"). Pharmacogenetics is based on an individual's genotype (eg, an individual's genotype tested to determine an individual's ability to respond to a particular drug) for the therapeutic or prophylactic treatment of the individual. Allows selection of drug (eg, drug).

Yet another aspect of the invention relates to monitoring the effect of an agent (eg, drug, compound) on FCTRX expression or activity in clinical trials. These and other agents are described in further detail in the sections below.

Diagnostic Assays Other conditions in which cell proliferation plays a role include tumors, restenosis, psoriasis, Dupuytren's contracture, diabetic complications, Kaposi's sarcoma and rheumatoid arthritis.

FCTRX polypeptides may be used to identify polypeptides that interact with a sample or tissue. The method comprises the steps of contacting a sample or tissue with FCTRX, forming a complex between the FCTRX polypeptide and an interacting polypeptide, and detecting the complex, if present. Include.

The proteins of the invention can be used to stimulate the production of antibodies that specifically bind the protein. Such antibodies can be used in immunodiagnostic procedures to detect the development of proteins in a sample. Using the protein of the invention,
Under conditions where cell proliferation is favorable, cell growth and cell proliferation can be stimulated. One example is inhibiting the toxic side effects of chemotherapeutic agents on, for example, hematopoiesis and platelet formation, the walls of the gastrointestinal tract, and hair follicles. They can also be used to stimulate new cell proliferation in neurological disorders including, for example, Alzheimer's disease. Alternatively, an antagonistic treatment can be administered, where an antibody that specifically binds an FCTRX-like protein of the invention blocks the specific growth-inducing effect of this protein. Such antibodies may be useful in the treatment of proliferative disorders including, for example, various tumors and benign hyperplasia.

A polynucleotide or oligonucleotide corresponding to a portion of any of the FCTRX nucleic acids of SEQ ID NOs: 1, 3, 5, 7, 9 and 11 is used to generate the corresponding O
The DNA containing the RF gene can be detected, or the expression of the corresponding FCTRX gene or FCTRX-like gene can be detected. For example, as seen in Table 3,
The FCTRX nucleic acid expressed in a particular cell or tissue can be used to identify the presence of that particular cell type.

An exemplary method for detecting the presence or absence of FCTRX in a biological sample is the step of obtaining a biological sample from a test subject, and using the biological sample as a protein of FCTRX or FCTRX protein. A nucleic acid encoding (eg, mRNA, genomic DNA) is contacted with a compound or agent capable of detection, such that the presence of FCTRX is detected in the biological sample. The agent for detecting FCTRX mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to FCTRX mRNA or genomic DNA. This nucleic acid probe is, for example, a full-length FCTRX nucleic acid (for example, the nucleic acid sequence of SEQ ID NO: 2n-1 (where n = 1 to 13)) or a nucleic acid of a portion thereof (for example, at least 15, 30, 50, 10
Oligonucleotides 0, 250 or 500 nucleotides in length, which are sufficient to specifically hybridize under stringent conditions to FCTRX mRNA or genomic DNA). Other suitable probes for use in the diagnostic assays of the invention are described herein.

The agent for detecting the FCTRX protein is an antibody capable of binding to the FCTRX protein, preferably an antibody having a detectable label. The antibody can be polyclonal or, more preferably, monoclonal. Intact antibodies or fragments thereof (eg, _Fab or F _{(ab ') 2} ) can be used. As used herein, the term "labeled" refers to a probe or antibody by coupling (ie, physically linking) a detectable substance to the probe or antibody. It is intended to include direct labeling of the probe or antibody as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of primary antibody with a fluorescently labeled secondary antibody, and end labeling with biotin of a DNA probe so that it can be detected with fluorescently labeled streptavidin. To be As used herein, the term "biological sample" refers to tissue, isolated from a subject,
It is intended to include cells and biological fluids as well as tissues, cells and fluids present in a subject. That is, using the detection method of the present invention, the mRN of FCTRX is
A, protein or genomic DNA can be detected in vitro and in vivo in biological samples. For example, in vitro techniques for detection of FCTRX mRNA include Northern hybridizations and in situ hybridizations. In vitro techniques for the detection of FCTRX proteins include enzyme linked immunosorbent assay (ELISA), Western blot, immunoprecipitation and immunofluorescence. In vitro techniques for detecting FCTRX genomic DNA include Southern hybridizations. In addition, in vivo techniques for detection of FCTRX proteins include introducing a labeled anti-FCTRX antibody into a subject. For example, the antibody can be labeled with a radioactive marker. The presence and location of radioactive markers in a subject can be detected by standard imaging techniques.

[0279] In one embodiment, the biological sample comprises protein molecules from the test subject. Alternatively, the biological sample may include mRNA molecules from the test subject or genomic DNA molecules from the test subject. A preferred biological sample is a peripheral blood leukocyte sample isolated by conventional means from a subject.

In another embodiment, these methods further comprise the step of obtaining a control biological sample from a control subject, the control sample being FCTR.
X protein, mRNA or genomic DNA is contacted with a detectable compound or drug, resulting in FCTRX protein, mRNA or genomic D
The process of detecting the presence of NA in the biological sample, and the protein, mRNA or genome D of FCTRX in the control sample and its control sample.
Comparing the presence of NA with the presence of FCTRX protein, mRNA or genomic DNA in the test sample.

The present invention also includes a kit for detecting the presence of FCTRX in a biological sample. For example, the kit may comprise: a labeled compound or agent capable of detecting FCTRX protein or mRNA in a biological sample; a means for determining the amount of FCTRX in the sample;
And means for comparing the amount of FCTRX in the sample with a standard. The compound or agent can be packaged in a suitable container. This kit is also FC
Instructions for using the kit to detect TRX proteins or nucleic acids may be provided.

Prognostic Assays The diagnostic methods described herein may be further utilized to identify subjects having or at risk of developing a disease or disorder associated with aberrant expression or activity of FCTRX. obtain. For example, the assays described herein (eg,
The diagnostic assays described above or the assays described below) can be utilized to identify subjects at risk of, or at risk of developing, disorders associated with FCTRX protein, nucleic acid expression or activity. Alternatively, this prognostic assay may be utilized to identify subjects who have or are at risk of developing a disease or disorder. Therefore, the present invention is
Methods are provided for identifying diseases or disorders associated with aberrant expression or activity of RX. Here, the test sample is obtained from the subject, and is FCTRX.
Protein or nucleic acid (eg, mRNA, genomic DNA) is detected, wherein the presence of the protein or nucleic acid of FCTRX has or is at risk of developing a disease or disorder associated with aberrant expression or activity of FCTRX. It is a diagnostic indicator for a subject. As used herein, "test sample" refers to a biological sample obtained from a subject of interest. For example, the test sample can be a biological fluid (eg, serum), cell sample, or tissue.

Further, using the prognostic assays described herein, a subject can be tested for agents (eg, agonists, antagonists, peptidomimetics, proteins, peptides, nucleic acids, small molecules, or other drug candidates). It may be determined whether or not it can be administered to treat a disease or disorder associated with aberrant expression or activity of FCTRX. For example, such methods can be used to determine whether a subject can be effectively treated with an agent for a disorder. Accordingly, the invention provides a method for determining whether a subject can be effectively treated with an agent for a disorder associated with aberrant expression or activity of FCTRX. Here, a test sample is obtained and the FCTR
X protein or nucleic acid is detected (eg, where the presence of FCTRX protein or nucleic acid is diagnostic for a subject to which an agent may be administered to treat a disorder associated with aberrant expression or activity of FCTRX. Is an indicator).

The method of the present invention also detects genetic damage in the gene of FCTRX, whereby a subject carrying the damaged gene is at risk for a disorder characterized by abnormal cell growth and / or differentiation. It can also be used to determine whether or not. In various embodiments, the method of the invention comprises a genetic damage in a sample of cells from the subject characterized by at least one of the alterations that affect the integrity of the gene encoding the protein of FCTRX, or Detecting the presence or absence of misexpression of the FCTRX gene. For example, such genetic damage can be detected by confirming the presence of at least one of the following: (i) deletion of one or more nucleotides from the gene of FCTRX; (ii) to the gene of FCTRX. Addition of one or more nucleotides; (i
ii) Substitution of one or more nucleotides in the gene of FCTRX, (iv) FCTR
Chromosomal rearrangement of X gene; (v) Messenger RNA of FCTRX gene
Alterations in transcript levels; (vi) aberrant alterations in FCTRX genes (eg, alterations in genomic DNA methylation patterns); (vii) presence of non-wild-type splicing patterns in FCTRX gene messenger RNA transcripts; (
viii) non-wild type levels of FCTRX protein; (ix) deletion of alleles of FCTRX gene; and (x) inappropriate post-translational modification of FCTRX protein. As described herein, there are a number of known assay techniques in the art, which can be used to detect damage in the gene of FCTRX. A preferred biological sample is a peripheral blood leukocyte sample isolated from a subject by conventional means. However, any biological sample containing nucleated cells can be used, including, for example, buccal mucosal cells.

[0285] In certain embodiments, the detection of damage is performed by polymerase chain reaction (PCR) (
See, eg, US Pat. Nos. 4,683,195 and 4,683,202) (eg, anchor PCR or RACE PCR) or ligation chain reaction (LCR) (eg, Landegran et al., 1988, Science
e 241: 1077-1080; and Nakazawa et al., 1994, Pr.
oc. Natl. Acad. Sci. USA 91: 360-364)). The latter may be particularly useful for detecting point mutations in the gene of FCTRX (see Abravaya et al., 1995, Nucl. Acids Res. 23: 675-682). The method comprises collecting a sample of cells from a patient, isolating nucleic acid (eg, genomic, mRNA or both) from the cells of the sample, FC
Contacting one or more primers that specifically hybridize to the TRX gene with a nucleic acid sample thereof under conditions such that hybridization and amplification of the FCTRX gene (if present) occurs, and an amplification product Of the presence or absence of, or detecting the size of the amplification product and comparing its length with a control sample. It is anticipated that PCR and / or LCR may be desired to be used as a preliminary amplification step with any of the techniques used to detect the mutations described herein.

Alternative amplification methods include: Self-sustaining sequence replication (Guat).
elli et al., 1990, Proc. Natl. Acad. Sci. USA 87
: 1874-1878), transcription amplification system (Kwoh, et al., 1989, Proc N.
atl Acad Sci USA 86: 1173-1177), Qβ replicase (Lizardi et al., 1988, BioTechnology 6:11).
97), or any other nucleic acid amplification method, followed by detection of the amplified molecule using techniques well known to those of skill in the art. These detection schemes are particularly useful for the detection of nucleic acid molecules when such molecules are present in very low numbers.

In an alternative embodiment, mutations in the gene for FCTRX from sample cells can be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (if necessary), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. To be done. Differences in fragment length size between sample and control DNA indicate mutations in the sample DNA. Furthermore, the use of sequence-specific ribozymes (eg,
US Pat. No. 5,493,531) can be used to score for the presence of specific mutations by the occurrence or loss of ribozyme cleavage sites.

In another embodiment, the genetic variation in FCTRX hybridizes sample and control nucleic acids (eg, DNA or RNA) to a high density array containing hundreds or thousands of oligonucleotide probes. (Eg Cronin et al., 1996, Human Mu).
station 7: 244-255; Kozal et al., 1996, Nat. Med
． 2: 753-759). For example, genetic mutations in FCTRX can be identified in a two-dimensional array containing photogenerated DNA probes as described above in Cronin et al. Briefly, the first probe hybridization array was used to scan through long stretches of DNA in the sample and control to create a linear array of consecutively overlapping probes to detect base changes between their sequences. Can be identified. This step allows the identification of point mutations.
Following this step, a second hybridization array that allows the characterization of a particular mutation by using a smaller specialized probe array complementary to all detected variants or mutations. There is. Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene.

In yet another embodiment, the FCTRX gene may be sequenced directly using any of a variety of sequencing reactions known in the art, and a sample FCTR may be sequenced.
Mutations can be detected by comparing the sequence of X with the corresponding wild type (control) sequence. Examples of sequencing reactions include Maxim and Gilbert.
, 1977, Proc. Natl. Acad. Sci. USA 74: 560 or Sanger, 1977, Proc. Natl. Acad. Sci. USA
74: 5463, which is based on the technology developed by It is also contemplated that any of a variety of automated sequencing procedures may be utilized when performing diagnostic assays (eg, Naeve et al., 1995, BioTechnique).
s 19: 448). These include sequencing by mass spectrometry (eg PC
T International Publication No. WO 94/16101; Cohen et al., 1996, Adv. C
chromatography 36: 127-162; and Griffin et al., 1993, Appl. Biochem. Biotechnol. 38: 147
-159).

Other methods for detecting mutations in the FCTRX gene include methods of detecting mismatched bases in RNA / RNA or RNA / DNA heteroduplexes using protection from cleavage agents. (Myers et al., 1985
, Science 230: 1242). In general, the art of "mismatch cleavage" describes RNA or DNA containing (labeled) wild-type FCTRX sequences.
Begins by providing a heteroduplex formed by hybridizing with a potential mutant RNA or DNA obtained from a tissue sample. Treating this double-stranded duplex with an agent that cleaves the single-stranded region of the duplex (eg, which is present due to a base pair mismatch between its control and sample strands) To do. For example, RNA / DNA duplexes can be treated with RNase, and DNA / DNA hybrids can be treated with S ₁ nuclease as opposed to enzymatically digesting their mismatched regions. In other embodiments, either DNA / DNA or RNA / DNA duplexes can be treated with hydroxylamine or osmium tetroxide and piperidine to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then size-separated on a denaturing polyacrylamide gel to determine the site of mutation. For example, Cotton et al., 1988, Proc. Natl. Acad. S
ci. USA 85: 4397; Saleeba et al., 1992, Methods.
Enzymol. 217: 286-295. In one embodiment, the control DNA or RNA can be labeled for detection.

In yet another embodiment, the mismatch cleavage reaction involves the removal of one or more proteins (so-called “DNA mismatch repair” enzymes) that recognize mismatched base pairs in double-stranded DNA from FCTRX obtained from a sample of cells. Used in defined systems to detect and map point mutations in cDNA. For example, E. E. coli mutY enzyme cleaves A at a G / A mismatch and He
Thymidine DNA glycosylase from La cells cleaves T at a G / T mismatch (Hsu et al. (1994) Carcinogenesis 15: 1657-.
1662). According to an exemplary embodiment, probes based on FCTRX sequences (eg, wild-type FCTRX sequences) are hybridized to cDNA or other DNA products from test cells. The duplex is treated with a DNA mismatch repair enzyme and its cleavage product (if any) can be detected, such as by electrophoresis protocols. See, eg, US Pat. No. 5,459,039.

In another embodiment, alterations in electrophoretic mobility are used to identify mutations in the FCTRX gene. For example, single-stranded conformational polymorphisms (SSCP) can be used to detect differences in electrophoretic mobility between mutant and wild-type nucleic acids (Orita et al. (1989) Proc Natl.
Acad Sci USA: 86: 2766, also Cotton (1993).
Mutat Res 285: 125-144; Hayashi (1992) G.
enet Anal Tech Appl 9: 73-79). Single-stranded DNA fragments of sample and control FCTRX nucleic acids are denatured and regenerated. The secondary structure of single-stranded nucleic acids varies according to sequence, and the resulting changes in electrophoretic mobility even allow the detection of single base changes. The DNA fragment can be labeled or detected with a labeled probe. The sensitivity of the assay can be enhanced by using RNA, rather than DNA, whose secondary structure is more sensitive to changes in sequence. In one embodiment, the method of the invention utilizes heteroduplex analysis to separate double-stranded heteroduplex molecules based on changes in electrophoretic mobility. See, eg, Keen et al. (1991) Trends Genet 7: 5.

In yet another embodiment, migration of mutant or wild-type fragments in a polyacrylamide gel containing a gradient of denaturing agent is assayed using denaturing gradient gel electrophoresis (DGGE). For example, Myers et al. (1985) N
See ature 313: 495. When DGGE is used as the method of analysis, the DNA can be, for example, by PCR a high melting point GC-rich DN of about 40 bp.
It is modified by adding a GC clamp of A to ensure that it is not completely denatured. In a further embodiment, temperature gradients are used instead of denaturant gradients to identify differences in the mobility of control and sample DNA. For example, Rosenbaum and Reissner (198
7) See Biophys Chem 265: 12753.

Other techniques for detecting point mutations include, but are not limited to, the following: selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers are
Known mutations can be prepared that are centrally located and then hybridized to the target DNA under conditions that allow hybridization only if a perfect match is found. For example, Saiki et al. (1986) Nature 324.
163); Saiki et al. (1989) Proc Natl Acad. Sci
USA 86: 6230. Such allele-specific oligonucleotides are PCR amplified target D when the oligonucleotides are attached to a hybridizing membrane and hybridized with labeled target DNA.
It hybridizes to NA or many different mutations.

Alternatively, allele-specific amplification techniques that rely on selective PCR amplification can be used in conjunction with the present invention. Oligonucleotides used as primers for specific amplification are in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Ac).
ids Res 17: 2437-2448), or may carry the mutation of interest at the 3'-most end of one primer, which may prevent mismatches or reduce polymerase extension under appropriate conditions (Prossner). (1993)
Tibtech 11: 238). Furthermore, it may be desirable to introduce new restriction sites in the mutated region to effect cleavage-based detection. For example, Gas
See parini et al. (1992) Mol Cell Probes 6: 1. It is envisioned that in certain embodiments, amplification may also be performed using Taq ligase for amplification. For example, Barany (1991) Proc
See Natl Acad Sci USA 88: 189. In such cases, ligation will only occur if there is an exact match at the 3'end of the 5'sequence, and the presence or absence of amplification will be sought to detect the presence of a known mutation at a particular site. Allows to detect.

The methods described herein may be practiced, for example, by utilizing a pre-packaged diagnostic kit that includes at least one probe nucleic acid or antibody reagent described herein. , Which can conveniently be used, for example, in a clinical setting for diagnosing patients exhibiting symptoms or familial history of a disease or disorder that comprises the FCTRX gene.

In addition, any cell type or tissue in which FCTRX is expressed, preferably peripheral blood leukocytes, can be utilized in the prognosis assay described herein. However, any biological sample containing nucleated cells can be used, including, for example, buccal mucosal cells.

Pharmacogenomics Factors, or modulators, that have a stimulatory or inhibitory effect on FCTRX activity (eg, FCTRX gene expression) are identified by the screening assays described herein. As such, it can be administered to an individual to treat (prophylactically or therapeutically) a disorder associated with aberrant FCTRX activity, such as a cancer or an immune disorder. In conjunction with such treatment, an individual's pharmacogenomics, ie, a study of the relationship between an individual's genotype and that individual's response to foreign compounds or drugs, may be considered. Differences in the metabolism of therapeutic agents can lead to severe toxicity or treatment failure by altering the relationship between dose and blood concentration of the pharmacologically active drug. Therefore, the pharmacogenomics of an individual allows for the selection of effective agents (eg, drugs) for prophylactic or therapeutic treatment based on consideration of the individual's genotype. Such pharmacogenomics can further be used to determine the appropriate dosage and therapeutic agent regimen. Thus, the activity of the FCTRX protein, the expression of the FCTRX nucleic acid, or the mutation content of the FCTRX gene in an individual can be determined, thereby selecting an appropriate agent for therapeutic or prophylactic treatment of the individual.

Pharmacogenomics deals with clinically significant hereditary alterations in response to drugs due to altered drug properties and aberrant effects in affected individuals. For example, Eich
Elbaum, 1996, Clin Exp Pharmacol Physi
ol, 23: 983-985 and Linder, 1997, Clin Che.
m, 43: 254-266. In general, two types of pharmacogenomic states can be distinguished. A genetic condition transmitted as one factor that modifies the way a drug acts on the body (altered drug action), or a genetic condition transmitted as one factor that modifies the way the body acts on a drug ( Modified drug metabolism). These pharmacogenomic states can occur either as rare defects or as polymorphisms. For example, glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common inherited enzymatic disease, the main clinical complications of which are oxidative drugs (antimalarials, sulfonamides, analgesics, nitrofuran). ) Ingestion and consumption of broad beans.

In an exemplary embodiment, the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action. The discovery of genetic polymorphisms in drug-metabolizing enzymes, such as N-acetyltransferase 2 (NAT2) and cytochrome P450 enzymes CYP2D6 and CYP2C19, has led to the reason why some patients do not expect the expected drug effect, or the standard. It provided an explanation as to why it exhibits an excessive drug response and severe toxicity after ingesting a targeted and safe dose of the drug. These polymorphisms are associated with two phenotypes in the population, those with high metabolic capacity.
tabolizer (EM) and poor metabolizing capacity (poor meta)
(Bolizer) (PM)). The prevalence of PM varies between different populations. For example, the gene encoding CYP2D6 is highly polymorphic, and some mutations have been identified in PM, all of which are functional CYP2D6.
Leading to the non-existence of. Those who have low metabolic potential for CYP2D6 and CYP2C19
Quite often they experience exaggerated drug responses and side effects when they receive standard doses. When the metabolite is the active therapeutic moiety, PM does not show a therapeutic response, as demonstrated for the analgesic effect of codeine mediated by its CYP2D6-forming metabolite, morphine. The other extreme are the so-called ultra-rapid metabolizers who do not respond to standard doses. Molecules that are the basis for ultrarapid metabolism have recently been identified to be due to CYP2D6 gene amplification.

Therefore, the activity of the FCTRX protein, the expression of the FCTRX nucleic acid, or the mutational content of the FCTRX gene in an individual is determined, thereby providing an agent suitable for therapeutic or prophylactic treatment of that individual. You can choose. In addition, pharmacogenomic studies can be used to apply the genotype of polymorphic alleles encoding drug-metabolizing enzymes to the identification of an individual's drug-responsive phenotype. This finding, when applied to dose or drug selection, may avoid adverse reactions or treatment failures, thus allowing subjects to be modulators of FCTRX (eg, the exemplary screening described herein. The therapeutic or prophylactic efficacy may be enhanced when treated with modulators identified by one of the assays.

Monitoring Clinical Efficacy Monitoring the effect of an agent (eg, drug, compound) on FCTRX expression or activity (eg, ability to regulate aberrant cell growth and / or differentiation) is fundamental. It can be applied to various drug screenings and clinical trials. For example, determined by a screening assay as described herein,
To increase FCTRX gene expression, protein levels, or FCTRX
The potency of agents that upregulate activity can be monitored in clinical trials in subjects who exhibit reduced FCTRX gene expression, protein levels, or downregulated FCTRX activity. Alternatively, the potency of agents that decrease FCTRX gene expression, protein levels, or downregulate FCTRX activity, as determined by screening assays, has increased FCTRX activity.
X gene expression, protein level, or upregulated FCTRX
Can be monitored in clinical trials of subjects exhibiting the activity of In such clinical trials, FCTRX expression or activity, and preferably other genes involved in, for example, cell proliferation or immune disorders, may be detected by the "readout (r)".
can be used as a marker of responsiveness of particular cells.

For example, without limitation, a gene comprising POLY, which modulates FCTRX activity (eg, identified in a screening assay as described herein) (eg, compound, drug or By treatment with small molecules) can be identified. Thus, to study the effects of agents on cellular proliferative disorders, cells may be isolated, for example, in clinical trials,
RNA can then be prepared and analyzed for levels of expression of FCTRX and other genes involved in this disorder. The level of gene expression (ie, gene expression pattern) can be determined by Northern blot analysis or RT-PCR, as described herein, or by measuring the amount of protein produced. By one of the methods described in the text, or by F
It can be quantified by measuring the level of activity of CTRX or other genes. In this manner, the gene expression pattern can act as a marker that is indicative of the physiological response of cells to the drug. Thus, the response state can be determined prior to treatment of an individual with the agent, and at various times during treatment.

In one embodiment, the invention is identified by an agent (eg, agonist, antagonist, protein, peptide, nucleic acid, peptidomimetic, small molecule, or other by a screening assay described herein. Of drug candidates) for monitoring the efficacy of treatment in a subject, which comprises:
Comprising the steps of: (i) obtaining a pre-dose sample from the subject prior to administration of the drug; (ii) in this pre-dose sample, FCTRX protein, m
Detecting the level of expression of RNA, or genomic DNA; (iii) obtaining one or more post-dose samples from this subject; (iv) FCTRX protein, mRNA, or genomic DNA in the post-dose sample. (V) the level of expression or activity of FCTRX protein, mRNA, or genomic DNA in the pre-dose sample is compared with the level of expression or activity of FCTRX protein, mRNA, or genomic DN in the post-dose sample.
Comparing the level of expression or activity of A; and (vi) thus altering the administration of the drug to this subject. For example, increased doses of this drug
It may be desirable to increase FCTRX expression or activity to a higher level than detected (ie, increase the efficacy of the agent). Alternatively, it may be desirable to reduce the administration of the agent to reduce FCTRX expression or activity to a level below that detected (ie, reduce the efficacy of the agent).

Methods of Treatment The present invention provides prophylactic and therapeutic treatments for subjects who are at risk (or susceptible) to a disorder associated with aberrant FCTRX expression or activity, or who have this disorder. Both methods are provided.

Diseases and disorders characterized by increased levels or biological activity (compared to a subject not afflicted with the disease or disorder) antagonize activity (
That is, it can be treated with a therapeutic agent (which reduces or inhibits). Therapeutic agents that antagonize activity can be administered in a therapeutic or prophylactic manner. Therapeutic agents that may be utilized include, but are not limited to: (i) FCTRX polypeptides, or analogs, derivatives, fragments or homologs thereof; (ii)
An antibody against the FCTRX peptide; (iii) a nucleic acid encoding the FCTRX peptide; (iv) the endogenous function of the FCTRX polypeptide by homologous recombination.
Antisense nucleic acids and "dysfunctional" utilized to "knock out"
(Ie due to a heterologous insertion within the coding sequence of the coding sequence for the FCTRX polypeptide) (eg Capecchi, 1989, S
science 244: 1288-1292); or (v) FC
Modulators (ie inhibitors, agonists and antagonists, including additional peptidomimetics of the invention or antibodies specific for the peptides of the invention) that alter the interaction between the TRX peptide and its binding partner. .

Diseases and disorders characterized by decreased levels or biological activity (compared to a subject not afflicted with the disease or disorder) have increased activity (ie, are agonists of the activity). It can be treated with a therapeutic agent. A therapeutic that upregulates activity can be administered in a therapeutic or prophylactic manner. Therapeutic agents that may be utilized include, but are not limited to: FCTRX peptides, or analogs, derivatives, fragments or homologs thereof; or agonists that increase bioavailability.

Increased or decreased levels can be easily detected by quantifying the peptide and / or RNA. This quantification involves obtaining a tissue sample of a patient (eg, from a biopsy tissue) and obtaining the sample at the RNA or polypeptide level of the expressed polypeptide (or mRNA encoding the FCTRX polypeptide), structure and / Or by assaying for activity in vitro. Methods well known in the art include, but are not limited to, immunoassays such as Western blot analysis, immunoprecipitation followed by sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis, immunocytochemistry, and the like. ) And / or hybridization assays for detecting the expression of mRNA (eg Northern assays, dot blots, in situ hybridization, etc.).

[0309] In one aspect, the invention administers to a subject an agent that modulates FCTRX expression or at least one FCTRX activity of a disease or condition associated with aberrant FCTRX expression or activity in the subject. Thereby providing a method for prevention. A subject at risk of disease caused by or caused by aberrant FCTRX expression or activity is, for example, by any of the diagnostic or prognostic assays described herein, or a combination thereof. Can be identified. Administration of the prophylactic agent may be preceded by the onset of symptoms characteristic of this FCTRX abnormality so that the disease or disorder is prevented or slowed down. Depending on the type of FCTRX abnormality, for example, a FCTRX agonist or FCTRX antagonist agent may be used to treat the subject. The appropriate agent can be determined based on the screening assays described herein.

Another aspect of the invention relates to a method of modulating FCTRX expression or activity for therapeutic purposes. The modulating methods of the invention include contacting a cell with an agent that modulates one or more of the activities of FCTRX protein activity for that cell. Agents that modulate FCTRX protein activity include nucleic acids or proteins, FC
It can be an agent as described herein, such as a naturally occurring cognate ligand of the TRX protein, a peptide, an FCTRX peptidomimetic, or other small molecule. In one embodiment, the agent is FCTRX.
Stimulates one or more of protein activities. Examples of such stimulatory agents include active FCTRX proteins, and nucleic acid molecules encoding FCTRX that are introduced into the cell. In another embodiment, the agent is FCTRX.
Inhibits one or more of the protein activities. Examples of such inhibitory agents include antisense FCTRX nucleic acid molecules, and anti-FCTRX antibodies. These methods of modulation can be performed in vitro (eg, by culturing the cells with the agent) or in vivo (eg, by administering the agent to a subject). Thus, the invention provides a method of treating an individual afflicted with a disease or disorder characterized by aberrant expression or activity of a FCTRX protein or nucleic acid molecule. In one embodiment, the method comprises an agent that modulates (eg, upregulates or downregulates) FCTRX expression or activity (eg, an agent identified by a screening assay described herein) or The step of administering a combination of such agents is included. In another embodiment, the method uses FC as a treatment to compensate for reduced or aberrant FCTRX expression or activity.
Administering a TRX protein or nucleic acid molecule.

Determining Biological Effects of Therapeutic Agents In various embodiments of the invention, the effect of a particular therapeutic agent and its administration is indicative of treatment of diseased tissue, utilizing an appropriate in vitro or in vivo assay. Decide whether or not.

In various specific embodiments, an in vitro assay is performed on a representative cell type involved in the disorder of the patient to determine if a given therapeutic agent exerted the desired effect on this cell type. You can decide. The compounds used in therapy may be tested in suitable animal model systems before testing in human subjects. These animal model systems include, but are not limited to: rat, mouse, chicken, cow, monkey, rabbit and the like. Similarly, for in vivo testing, any animal model system known in the art can be used prior to administration to human subjects.

Malignant Diseases Some FCTRX polypeptides are expressed in cancerous cells and are therefore
It is associated with the regulation of cell proliferation. Accordingly, the therapeutic agents of the present invention are useful in the therapeutic or prophylactic treatment of diseases or disorders associated with defective cell hyperproliferation and / or cell proliferation control (eg, cancer, malignant diseases and tumors). obtain. For reviews of such hyperproliferative disorders, see, eg, Fishman et al., 1
985, MEDICINE, 2nd edition, J. B. Lippincott Co. ,
See Philadelphia, PA.

The therapeutic agents of the invention may be assayed for efficacy in treating or preventing malignant diseases and related disorders by any method known in the art. Such assays include, but are not limited to, in vitro assays that utilize transformed cells or cells from a patient's tumor, as well as in vivo assays that use animal models of cancer or malignancy. A potential effective therapeutic agent is, for example, a therapeutic agent that inhibits the growth of tumor-derived cells or transformed cells in culture or causes tumor regression in an animal model as compared to a control. ..

In the practice of the present invention, once a malignancy or cancer is shown to be susceptible to treatment by modulating (ie, inhibiting, antagonizing, or agonizing) activity. And subsequently, the cancer or malignancy can be treated or prevented by administration of a therapeutic agent that acts to regulate protein function.

(Pre-malignant state) The therapeutic agent of the present invention effective in the therapeutic or prophylactic treatment of cancer or malignant disease may also be used for the treatment of pre-malignant state and / or to change from pre-malignant state to neoplastic state or malignant disease state. It can be administered for treatment to prevent progression. Such prophylactic or therapeutic uses consist of conditions known or suspected of progressing to a preceding neoplasm or cancer (especially consisting of hyperplasia, metaplasia, or most especially dysplasia). (If non-neoplastic cell growth occurs). For a review of such abnormal cell proliferation see, eg, Robbins and Angel, 1976, BA.
SIC PATHOLOGY, Second Edition, W.S. B. Saunders Co. , P
See hiladelphia, PA.

Hyperplasia is a form of controlled cell growth involving an increase in cell number in a tissue or organ without significant alteration in cell structure or function. For example, endometrial hyperplasia has often been demonstrated to progress to endometrial cancer.
Metaplasia is a form of controlled cell growth in which one type of mature or fully differentiated cell replaces another type of mature cell. Metaplasia can occur in epithelial or connective tissue cells. Dysplasia is generally considered to be a precursor to cancer and is found predominantly in the epithelium. Dysplasia is the most unregulated form of non-neoplastic cell growth and involves loss of individual cell homogeneity and cellular architectural orientation. Dysplasia characteristically occurs where there is chronic irritation or inflammation and is often found in the cervix, respiratory tract, oral cavity, and gallbladder.

Alternatively, or in addition to the presence of abnormal cell growth characterized as hyperplasia, metaplasia, or dysplasia, a transformed phenotype is demonstrated either in vivo or in vitro within a cell sample from a patient. Alternatively, the presence of one or more features of the malignant disease phenotype is an indication of the desirability of prophylactic / therapeutic administration of therapeutic agents that have the ability to modulate the activity of the above proteins. Transformed phenotypic characteristics include, but are not limited to: (i) morphological changes; (ii)
Loose adhesion to the substratum; (iii) loss of intercellular contact inhibition; (iv) anchorage-dependent loss; (v) protease release; (vi) increased glucose transport; (vii) reduced serum requirements; (viii) ) Expression of fetal antigen; (ix) disappearance of 250 kDa cell surface protein, etc. For example, Richards et al., 1986, MOLECULAR.
PATHOLOGY, W.A. B. Saunders Co, Philadelph
See ia, PA.

In certain embodiments of the invention, patients exhibiting one or more of the following predispositions for malignancy are treated by administration of an effective amount of a therapeutic agent: (i) chromosomal translocations associated with malignancy. Loci, such as the Philadelphia chromosome (bcr / abl) for chronic myelogenous leukemia and t (14; 20) for follicular lymphoma)
(Ii) familial polyposis or Gardner's syndrome (a possible precursor of colon cancer); (iii) unidentified monoclonal hypergammaglobulinemia of significant importance (a possible precursor of multiple myeloma); Body); and (vi) cancers or precancerous diseases that exhibit Mendelian (gene) inheritance patterns (eg, familial polyposis of the colon, Gardner's syndrome, hereditary exostoses, multiple endocrine adenomas (polyendocrine).
adenomatosis), Peutz-Jeghers syndrome, von Recklinghausen's neurofibromatosis, medullary thyroid carcinoma with amyloidogenesis and pheochromocytoma, retinoblastoma, carotid body tumor, skin First-degree relatives of people with black cancer, intraocular black cancer, xeroderma pigmentosum, ataxia-telangiectasia, Chediak-Higashi syndrome, albinism, Fanconi aplastic anemia and Bloom syndrome).

In another embodiment, the Therapeutics of the invention are administered to human patients to prevent progression of breast, colon, lung, pancreatic, or uterine cancer, or melanoma or sarcoma.

Hyperproliferative Disorders and Dysproliferative Disorders In one embodiment of the invention, the therapeutic agent is in the therapeutic or prophylactic treatment of a hyperproliferative disorder or a benign hyperproliferative disorder. Is administered. The efficacy of the therapeutic agents of the invention in treating or preventing hyperproliferative diseases or disorders can be assayed by any method known in the art. Such assays include in vitro cell proliferation assays, in vitro or in vivo assays using animal models of hyperproliferative diseases or disorders, and the like. A potential effective therapeutic agent may promote cell proliferation in culture, or cause growth or cell proliferation in an animal model, eg, as compared to a control.

Certain embodiments of the present invention include cirrhosis of the liver (a condition in which scarring exceeds the normal liver regeneration process); Treatment of pneumonic scarring; psoriasis, a common skin condition characterized by overgrowth of the skin and delay in determining proper cell fate
Benign tumor; relates to the treatment or prevention of fibrous sac condition and tissue thickening (eg, benign prostatic hypertrophy).

Neurodegenerative Disorders Several FCTRX proteins are involved in deregulation of cell maturation and apoptosis (
Both are found in cell types associated with neurodegenerative disease features).
Therefore, the therapeutic agent of the present invention (in particular, but not exclusively, a therapeutic agent that modulates (or supplies) the activity of the above-mentioned protein) may be effective in treating or preventing a neurodegenerative disease. The therapeutic agents of the invention that modulate the activity of the above proteins involved in neurodegenerative disorders are assayed for efficacy in treating or preventing such neurodegenerative diseases or disorders by any method known in the art. obtain. Such assays include in vitro assays for the inhibition of regulated cell maturation or apoptosis, or in vivo assays using animal models of neurodegenerative diseases or disorders, or any of the assays described below. Potential effective therapeutic agents include, but are not limited to, promoting regulated cell maturation, preventing cell apoptosis in culture, or reducing neurodegeneration in animal models, as compared to controls. .

Once a neurodegenerative disease or disorder has been shown to be susceptible to treatment with a modulatory activity, that neurodegenerative disease or disorder may be treated or prevented by administration of a therapeutic agent that modulates the activity. . Such diseases include all age-related degenerative disorders, especially osteoarthritis and neurodegenerative disorders.

Organ Transplantation-Related Disorders Several FCTRX proteins may be associated with organ transplantation-related disorders, including, but not limited to, organ rejection. The therapeutic agent of the present invention (in particular, a therapeutic agent that regulates (or supplies) activity) can be effective in treating or preventing a disease or disorder associated with organ transplantation. The therapeutic agent of the present invention (in particular, a therapeutic agent that regulates the level or activity of the above-mentioned protein) can be administered by any method known in the art for its efficacy in treating or preventing diseases and disorders associated with such organ transplantation. Can be assayed. Such assays include in vitro assays using cell culture models as described below, or in vivo assays using animal models of organ transplant related diseases and disorders. For example, see:
Potentially effective therapeutic agents reduce immune rejection response in an animal model as compared to, for example, without limitation, a control.

Thus, once a disease and disorder associated with organ transplantation has been shown to be susceptible to treatment by modulating activity, such disease or disorder may be administered by a therapeutic agent that modulates activity. Can be treated or prevented by.

Cardiovascular Disease Proteins related to the FCTRX protein may be involved in cardiovascular disorders, including atherosclerotic plaque formation. Cardiovascular disease (including cerebral thrombosis or cerebral hemorrhage), ischemic heart disease or ischemic kidney disease, peripheral vascular disease, or other major vascular thrombosis, and other diseases (diabetes mellitus, hypertension, thyroid dysfunction,
Cholesterol ester storage disease, systemic lupus erythematosus, homocystinemia,
And familial protein or lipid processing diseases
diseases, etc.) are directly or indirectly associated with atherosclerosis. Therefore, the therapeutic agent of the present invention (in particular, a therapeutic agent that regulates (or supplies) activity or formation) may be effective in treating or preventing a disease or disorder associated with atherosclerosis. The therapeutic agent of the present invention (in particular, a therapeutic agent that regulates the level or activity) can be treated by any method known in the art (including the method described below) for efficacy in treating or preventing such diseases and disorders. Can be assayed by.

A wide range of animal and cell culture models exist for the processes involved in atherosclerosis. A list of limited and non-exclusive animal models includes: Knockout mice for early-onset atherosclerosis (Kurabayashi and Yazaki, 1996, In.
t. Angiol. 15: 187-194), a transgenic mouse model of atherosclerosis (Kappel et al., 1994, FASEB J. 8: 5).
83-592), antisense oligonucleotide treatment of animal models (Call
ow, 1995, Curr. Opin. Cardiol. 10: 569-576
), A transgenic rabbit model for atherosclerosis (Ta
Ylor, 1997, Ann. N. Y. Acad. Sci 811: 146-1
52), an animal model for hypercholesterolemia (Rosenfeld, 1996, D
iabetes Res. Clin. Pract. 30 (Addendum): 1-11),
Hyperlipidemic mice (Paigen et al., 1994, Curr. Opin. Lipid
ol. 5: 258-264), and inhibition of lipoxygenase in animals (S
igal et al., 1994, Ann. N. Y. Acad. Sci. 714: 211-
224). In addition, in vitro cell models include, but are not limited to: Monocytes exposed to low density lipoprotein (Frostega).
rd et al., 1996, Atherosclerosis 121: 93-103).
, Cloned vascular smooth muscle cells (Suttles et al., 1995, Exp. C.
ell Res. 218: 331-338), T cells exposed to chemoattractants derived from endothelial cells (Katz et al., 1994, J. Leukoc. Biol. 55: 5.
67-573), cultured human aortic endothelial cells (Farber et al., 1992,
Am. J. Physiol. 262: H1088-1085), and foam cell cultures (Libby et al., 1996, Curr Opin Lipidol 7:
330-335). Potentially effective therapeutic agents include, but are not limited to, reducing foam cell formation in a cell culture model or atherosclerotic arteries in a hypercholesterolemic mouse model of atherosclerosis, as compared to controls. Reduces plaque formation in sclerosis.

Accordingly, once a disease or disorder associated with atherosclerosis has been shown to be susceptible to treatment by modulation of activity or formation, the disease or disorder is treated to modulate activity. It can be treated or prevented by administration of the agent.

Cytokines and Cell Proliferation / Differentiation Activity The FCTRX protein or cognate therapeutic agent of the present invention may have cytokine activity, cell proliferation activity (either inducing or inhibiting), or cell differentiation activity (inducing). Or to inhibit) or induce the production of other cytokines in a particular cell population. Many protein factors discovered to date, including all known cytokines, show activity in one or more factor-dependent cell proliferation assays, thus these assays provide a convenient confirmation of cytokine activity. To work. The activity of the proteins of the invention is confirmed by any one of a number of conventional factor dependent cell proliferation assays on cell lines including, but not limited to: 32D, DA2, DA1G, T.
10, B9, B9 / 11, BaF3, MC9 / G, M + (preB M +), 2
E8, RB5, DA1, 123, T1165, HT2, CTLL2, TF-1,
Mo7e and CMK.

The activity of the proteins of the invention can be measured, among other methods, by the following methods: T including, but not limited to, the assays described below.
Assay for cell or thymocyte proliferation: Current Proto
cols in Immunology, edited by Coligan et al., Green P
Publishing Associates and Wiley-Inter
science (Chapter 3 and 7); Takai et al., J Immunol.
137: 3494-3500, 1986; Bertagnoili et al., J Im.
munol 145: 1706-1712, 1990; Bertagnolli.
Et al., Cell Immunol 133: 327-341, 1991; Bert.
agnoli et al., J Immunol 149: 3778-3783, 199.
2; Bowman et al., J Immunol 152: 1756-1761, 19.
94.

As an assay for cytokine production and / or proliferation of splenocytes, lymph node cells or thymocytes, Kruisbeek and Shevach: Cu
rent Prtocols in Immunology. Coligan
Et al., Vol. 1, pp. 3.12.1-14, John Wiley and Son.
S., Toronto 1994; and Schreiber: Current.
Protocols in Immunology. First edition by Coligan et al.
Volume, 6.8.1-8, John Wiley and Sons, Toron.
to 1994, but is not limited thereto.

Assays for proliferation and differentiation of hematopoietic cells and lymphopoietic cells include, but are not limited to, the assays described by: B
ottomly et al .: Current Protocols in Immuno
logy. Edited by Coligan et al., Volume 1, 6.3.1-6.3.12, Joh.
n Wiley and Sons, Toronto 1991; deVrie
s et al., J Exp Med 173: 1205-1121, 1991; More.
au et al., Nature 336: 690-692, 1988; Greenber.
ger et al., Proc Natl Acad Sci U. S. A. 80: 293
1-2938, 1983; Nordan: Current Protocols.
in Immunology. Edited by Coligan et al., Volume 1, 6.6.1-5
P., John Wiley and Sons, Toronto 1991; S
Smith et al., Proc Natl Acad Sci U .; S. A. 83:18
57-1861, 1986; Measurement of human In.
terleukin 11-Bennett et al .: Current Protocol
ols in Immunology. Edited by Coligan et al., Volume 1, 6.15.
． Page 1, John Wiley and Sons, Toronto 1991.
Carletta et al .: Current Protocols in Imm;
unology. Edited by Coligan et al., Vol. 1, pp. 6.13.1, John W.
iley and Sons, Toronto 1991.

Assays for T Cell Clonal Responses to Antigens (Affecting APC-T Cell Interactions by Measuring Proliferation and Cytokine Production, inter alia,
And to identify proteins that direct the effects of T cells) include, but are not limited to, the assays described below: Current Pro
tocols in Immunology. Edited by Coligan et al., Green
Publishing Associates and Wiley-Int
erscience (chapter 3, chapter 6 and chapter 7); Weinberger et al., Proc Natl Acad Sci USA 77: 6091-6095.
, 1980; Weinberger et al., Eur J Immun 11: 405.
-411, 1981; Takai et al., J Immunol 137: 3494-.
3500, 1986; Takai et al., J Immunol 140: 508-5.
12, 1988.

Immunostimulatory or Suppressive Activity The FCTRX protein or syngeneic therapeutic agent of the present invention also has an immunostimulatory or immunosuppressive activity, including but not limited to those described in the assays herein. Can be shown. The protein is in the treatment of various immunodeficiencies and disorders (severe combined immunodeficiency (SCID)), for example to regulate (up- or down-regulate) T and / or B lymphocyte growth and proliferation, and It may be useful in affecting the cytolytic activity of NK cells and other cell populations. These immunodeficiencies can be genetic, or can be lethal (eg, HIV), caused by bacterial or fungal infections, or can result from autoimmune disorders. More specifically, deadly, infectious diseases caused by bacteria, fungi or other infections (infection by various fungal infections such as HIV, hepatitis virus, herpes virus, mycobacteria, Leishmania, malaria and Candida). Can be treated with the proteins of the invention. Of course, in this regard, the proteins of the invention may also be useful if boosting the immune system may be generally desired (ie, in the treatment of cancer).

Autoimmune disorders that may be treated with the proteins of the present invention or cognate therapeutics include, for example: connective tissue disease, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmunity. Pneumonia, Guyan-Barre syndrome, autoimmune thyroiditis, insulin-dependent diabetes mellitus, myasthenia gravis, graft-versus-host disease and autoimmune inflammatory eye disease. Such proteins of the invention may also be useful in treating allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory system disorders. Other conditions for which immunosuppression is desired, including organ transplantation, may also be treatable using the proteins of the invention.

The proteins of the invention or cognate therapeutic agents may be capable of producing an immune response in a number of ways. Down-regulation may be in the form of blocking or blocking an already ongoing immune response, or may include preventing the induction of an immune response. The function of activated T cells can be inhibited by suppressing the T cell response, or by inducing specific tolerance in the T cells, or both. Immunosuppression of T cell responses is generally an active, non-antigen specific process that requires continuous exposure of T cells to the suppressive agent. Tolerance, including inducing unresponsiveness or energy in T cells, is generally antigen-specific and immunosuppressive in that exposure to tolerizing agents persists after cessation. It is identifiable. Operationally, tolerance can be demonstrated by the lack of a T cell response upon re-exposure to a specific antigen in the absence of tolerizing agent.

Down-regulating or preventing one or more antigenic functions, including but not limited to B lymphocyte antigenic functions (such as, but not limited to, B7) (eg, high levels of activated T cells). Interfering with lymphokine synthesis) is useful in the context of tissue, skin and organ transplantation, and in graft versus host disease (GVHD). For example, blocking T cell function should result in reduced tissue destruction in tissue transplants. Typically, in tissue transplantation, graft rejection is initiated through its foreign recognition by T cells, followed by an immune response that destroys the graft. Molecules that inhibit or block the interaction of B7 lymphocyte antigen with its natural ligands on immune cells prior to transplantation (eg, a soluble monomeric form of a peptide having B7-2 activity alone, or another B lymphocyte antigen ( For example, administration of B7-1, B7-3) or a blocking antibody in combination with the monomeric form of the peptide) has the effect of activating the molecule's native molecule on immune cells without the corresponding shift in costimulatory signals. It can lead to binding to the ligand. Blocking B lymphocyte antigen function in such a form prevents cytokine synthesis by immune cells (eg, T cells),
Therefore, it acts as an immunosuppressant. Moreover, lack of costimulation may also be sufficient to activate T cells, thereby inducing tolerance in the subject.
Induction of long-term tolerance by B lymphocyte antigen blocking reagents may avoid the need for repeated administration of these blocking reagents. It may be necessary to block the function of the B lymphocyte antigen in order to achieve sufficient immunosuppression or tolerance in the subject.

The efficacy of certain blocking reagents in the prevention of organ transplant rejection or GVHD can be assessed using animal models that predict efficacy in humans. Examples of suitable systems that may be used include allogeneic heart transplants in rats and xenogeneic pancreatic islet cell transplants in mice, both of which are described by Lenschow et al.
Science 257: 789-792 (1992) and Turka et al., P.
roc Natl Acad Sci USA, 89: 11102-11105
It has been used to test the immunosuppressive effect of CTLA4Ig fusion proteins in vivo as described in (1992). Furthermore, a mouse model of GVDH (Edited by Paul, Fundamental Immunology, Raven).
(See Press, New York, 1989, pp. 846-847).
Can be used to determine the effect of blocking B lymphocyte antigen function in vivo on the development of the disease.

Blocking antigen function may also be therapeutically useful in the treatment of autoimmune diseases. Many autoimmune disorders are the result of inappropriate activation of T cells that are reactive to self tissue and promote the production of cytokines and autoantibodies involved in the pathology of the disease. Prevention of activation of autoreactive T cells can reduce or eliminate the symptoms of the disease. Administration of a reagent that blocks T cell costimulation by disrupting the B lymphocyte antigen receptor: ligand interaction inhibits T cell activation and may be involved in the disease process of autoantibodies or T cells It can be used to prevent the production of inducible cytokines. In addition, blocking reagents can induce antigen-specific tolerance of autoreactive T cells that can lead to long-term relief of disease. The efficacy of blocking reagents in the prevention or alleviation of autoimmune disorders can be determined using a number of well-characterized animal models of human autoimmune disease.
Examples include mouse experimental autoimmune encephalitis, systemic lupus erythematosus in MRL / lpr / lpr mice or NZB hybrid mice, murine autoimmune collagen arthritis, diabetes mellitus in NOD and BB rats, and mouse experimental myasthenia gravis. Mentioned by Paul (Fundamental)
Immunology, Raven Press, New York, 198.
9, 840-856).

As a means of upregulating the immune response, upregulation of antigen function (preferably B lymphocyte antigen function) may also be useful in therapy. Upregulation of an immune response can be in the form of enhancing an existing immune response or eliciting an early immune response. For example, enhancing the immune response via stimulation of B lymphocyte antigen function can be useful in the case of viral infections. Furthermore, systemic viral diseases such as influenza, colds and encephalitis can be alleviated by systemic administration of stimulated forms of B lymphocyte antigens.

Alternatively, the antiviral immune response was pulsed with a viral antigen, either depleting T cells from the patient and expressing a peptide of the invention, or with a stimulatory form of the soluble peptide of the invention. It can be enhanced in infected patients by co-stimulating the T cells in vitro with APC and reintroducing the in vitro activated T cells into the patient. Another method of enhancing an antiviral immune response is to isolate infected cells from a patient and transfect the infected cells with a nucleic acid encoding a protein of the invention as described herein. The result is that these cells express all or part of this protein on their surface), and retransfect the transfected cells into the patient. Here, the infected cells are capable of delivering costimulatory signals to T cells in vivo, thereby activating T cells.

In another application, upregulation or enhancement of antigen function, preferably B lymphocyte antigen function, may be useful in inducing tumor immunity. Tumor cells (eg, sarcoma, melanoma, lymphoma, leukemia, neuroblastoma, carcinoma) transfected with a nucleic acid encoding at least one peptide of the present invention overcome tumor-specific tolerance in a subject. May be administered to the subject. If desired, tumor cells can be transfected to express the peptide combination. For example, an expression vector expressing a peptide having B7-2-like activity alone or a combination of peptides having B7-1-like activity and / or B7-3-like activity in a tumor cell obtained from a patient is used. And can be transfected ex vivo. The transfected tumor cells are returned to the patient causing expression of the peptide on the surface of the transfected cells. Alternatively, gene therapy techniques can be used to target tumor cells for transfection in vivo.

The presence of peptides of the invention having the activity of B cell lymphocyte antigens on the surface of tumor cells provides the necessary costimulatory signals for T cells and T cell mediated for transfected tumor cells. Induces an immune response. Furthermore, it lacks MHC class I or MHC class II molecules, or has a sufficient amount of MHC class I or M
Tumor cells that do not re-express HC class II molecules may have MHC class Ia chain proteins and β ₂ microglobulin proteins, or all or part of MHC class IIa chain proteins and MHC class II β chain proteins (eg, cytoplasmic-domain shortening moieties). ) Encoding a nucleic acid encoding MHC class I or MHC class II protein on the cell surface. Expression of appropriate class I or class II MHC in combination with peptides having activity of B lymphocyte antigens (eg, B7-1, B7-2, B7-3) is T cell mediated to transfected tumor cells. Induces an immune response. If necessary, MHC class I such as invariant chain
Genes encoding antisense constructs that block the expression of I-related proteins can also be co-transfected with DNA encoding peptides having the activity of B lymphocyte antigens, promote presentation of tumor-associated antigens and are tumor-specific. Induces immunity. Therefore, induction of a T cell-mediated immune response in a human subject may be sufficient to overcome tumor-specific tolerance in the subject.

The activity of a protein of the invention or a cognate therapeutic agent can be measured, inter alia, by the following methods: CURRENT PROTOCOLS IN IMMUNOL.
OGY. Edited by Coligan et al., Greene Publishing Publishing Aso
Cities and Wiley-Interscience (Chapter 3, Chapter 7)
Chapter); Herrmann et al., Proc Natl Acad Sci USA.
78: 2488-2492, 1981; Herrmann et al., J Immuno.
128: 1968-1974, 1982; Handa et al., J Immuno.
135: 1564-1572, 1985: Takai et al., J Immuno.
1 137: 3494-3500, 1986; Takai et al., J Immuno.
140: 508-512, 1988; Herrmann et al., Proc Na.
tl Acad Sci USA 78: 2488-2492, 1981; He.
rrmann et al., J Immunol 128: 1968-1974, 1982.
Handa et al., J Immunol 135: 1564-1572, 1985;
Takai et al., J Immunol 137: 3494-3500, 1986;
Bowman et al., J Virology 61: 1992-1998; Tak.
ai et al., J Immunol 140: 508-512, 1988; Berta.
gnolli et al., Cell Immunol 133: 327-341, 199.
1; Brown et al., J Immunol 153: 3079-3092, 199.
Suitable assays for cytotoxicity of thymocytes or splenocytes, including but not limited to the assay described in 4.

For T cell-dependent immunoglobulin responses and isotype switching (
In particular, Maliszewski is an assay that identifies proteins that modulate the T cell-dependent antibody response and that influence the Th1 / Th2 profile.
, J Immunol 144: 3028-3033, 1990; and Mo.
nd and Brunswick, CURRENT PROTOCOLS IN
IMMUNOLOGY, edited by Coligan et al., Volume 1, 3.8.1. -3.8.
16, but not limited to assays such as those described in John Wiley and Sons, Toronto 1994.

Mixed Lymphocyte Response (MLR) Assays (especially with preferential Th1 and CT
As an assay for identifying a protein that produces an L response), CURRENT
PROTOCOLS IN IMMUNOLOGY. Edited by Coligan et al., Gr
eene Publishing Associates and Wiley
-Interscience (Chapter 3, Chapter 7); Takai et al., J Immu.
nol 137: 3494-3500, 1986; Takai et al., J Immu.
Nol 140: 508-512, 1988; Bertagnolli et al., J.
Immunol 149: 3778-3783, 1992, but is not limited thereto.

For dendritic cell-dependent assays, particularly those that identify proteins expressed by dendritic cells that activate naive T cells, see Guery et al., J I.
mmunol 134: 536-544, 1995; Inaba et al., J Exp.
Med 173: 549-559, 1991; Macatonia et al., JI.
mmunol 154: 5071-5079, 1995; Porgador et al.,
J Exp Med 182: 255-260, 1995; Nair et al., JV.
irol 67: 4062-4069, 1993; Huang et al., Science.
e 264: 961-965, 1994; Macatonia et al., J. Am. Exp
Med 169: 1255-1264, 1989; Bhardwaj et al., JC.
lin Investig 94: 797-807, 1994; and Inab.
a, et al., J Exp Med 172: 631-640, 1990, but is not limited thereto.

As an assay for lymphocyte survival / apoptosis (specifically identifying proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis), Darzynkiewicz et al., Cytom.
etry 13: 795-808, 1992; Gorczyca et al., Leuke.
mia 7: 659-670, 1993; Gorczyca et al. Cancer.
Res 53: 1945-1951, 1993; Itoh et al., Cell 66:
233-243, 1991; Zacharchuk, J Immunol 14
5: 4037-4045, 1990; Zamai et al., Cytometry 14
: 891-897, 1993; Gorczyca et al., Internat J O.
ncol 1: 639-648, 1992, but is not limited thereto.

Assays for proteins affecting T cell arrest and early stages of development include: Antica et al., Blood 84: 111-117, 1994; Fine et al., Cell Immunol 155: 111-122, 1994; Galy et al., Blood. 85: 2770-2778, 1995; Toki et al., Proc.
Nat Acad Sci USA 88: 7548-7551, 1991, but is not limited thereto.

(Hematopoiesis-regulating activity) The FCTRX protein of the present invention and a syngeneic therapeutic agent are
And consequently it may be useful in the treatment of bone marrow or lymphocytic insufficiency. Peripheral biological activity in support of colony-forming cells or factor-dependent cell lines, in the regulation of hematopoiesis, for example, alone or in combination with other cytokines, growth and proliferation of erythroid progenitor cells. In combination with radiation / chemotherapy to treat various anemias or to stimulate the production of erythroid progenitor cells and / or erythroid cells, for example. Utility for use; eg, supporting growth and proliferation of bone marrow cells (eg, granulocytes and monocytes / macrophages) useful in combination with chemotherapy to prevent or treat myelosuppression as a result Utility (ie, traditional CSF activity); growth and proliferation of megakaryocytes and consequently platelets And / or to allow for the prevention or treatment of various platelet disorders, such as thrombocytopenia, and, in general, for use as an alternative to or benefit from platelet transfusion; and / or above. Can mature into any and all hematopoietic stem cells and, therefore, are associated with various stem cell disorders, such as those commonly treated with transplants, including but not limited to aplastic anemia and paroxysmal nocturnal hemoglobinuria. ), In supporting growth and proliferation of hematopoietic stem cells, and as normal cells or cells engineered for gene therapy, in vivo or ex vivo (ie, bone marrow transplant or peripheral precursors). Cell transplant (combined with allogeneic or xenogeneic), re-stem cell compartment after irradiation / chemotherapy Show utility in be fertilized.

[0352]   The activity of the proteins of the invention can be measured, inter alia, by the following method:   Suitable assays for proliferation and differentiation of various hematopoietic strains are cited above.

Assays for embryonic stem cell differentiation, particularly those that identify proteins that affect embryonic differentiation hematopoiesis, include, but are not limited to: Joha.
NSSON et al., Cell Biol 15: 141-151, 1995; Kel.
Ler et al., Mol Cell Biol 13: 473-486, 1993; M.
Assay described by cClanahan et al., Blood 81: 2903-2915, 1993.

Assays for stem cell survival and differentiation, particularly those that identify proteins that regulate lympho-hematopoiesis, include, but are not limited to: methylcellulose colony formation assay, CULTURE OF HEMAT.
OPOIETIC CELLS. Freshney et al., Eds. Vol 265-2
68, Wiley-Liss, Inc. New York, N.M. Y 1994
In Freshney ;; Hirayama et al., Proc Natl A.
cad Sci USA 89: 5907-5911, 1992; CULTUR.
E OF HEMATOPOIETIC CELLS. Freshney et al., Eds., Vol. 23-39, Wiley-Liss, Inc. New York,
N. McNiece and Briddeli; Nebe in Y 1994.
n et al., Exp Hematol 22: 353-359, 1994; CULTU.
RE OF HEMATOPOIETIC CELLS. Freshney et al.
Ed., Vol. 1-21, Wiley-Liss, Inc. New York,
N. Ploecher; CULTURE OF H in Y 1994
EMATOPOIETIC CELLS. Freshney et al., Ed., Vol 1
63-179, Wiley-Liss, Inc. New York, N.M. Y
1994, Spoonceret et al .; CULTURE OF HEMA.
TOPOIETIC CELLS. Freshney et al., Eds., Vol 139-
162, Wiley-Liss, Inc. New York, N.M. Y 199
4. The assay described in Sutherland, at 4.

Tissue Proliferative Activity The FCTRX protein or syngeneic therapeutic agents of the present invention also include compositions used for bone or cartilage, tendon, ligament and / or nerve tissue growth or regeneration, as well as wound healing and tissue. The compositions used for repair and tissue replacement, and may have utility in the treatment of burns, incisions and ulcers.

The proteins of the present invention or syngeneic therapeutic agents induce cartilage and / or bone growth in situations where bone is not normally formed and have applications in the healing of fractures and cartilage damage or defects in humans and other animals. . Such preparations employing the proteins of the invention may be used for prophylactic use in closed and open fracture reduction,
And also may have use in improved fixation of artificial joints. De novo osteogenesis induced by osteogenic agents contributes to the repair of congenital, trauma-induced, or tumor-removal-induced craniofacial cranial defects and is also useful in cosmetic surgery.

The proteins of the invention or cognate therapeutic agents may also be used in the treatment of periodontal disease and in other tooth repair processes. Such agents may provide an environment that triggers osteogenic cells, stimulates the proliferation of osteogenic cells, or induces the differentiation of osteogenic cell precursors. The proteins of the invention may also have osteoporosis, such as by stimulating bone and / or cartilage repair or by blocking inflammation or processes of tissue destruction mediated by inflammatory processes (collagenase activity, osteoclast activity, etc.). Or it may be useful in the treatment of osteoarthritis.

Another category of tissue regeneration activity that may contribute to the proteins of the invention is tendon / ligament formation. Proteins of the invention that induce the formation of tendon / ligament-like tissue or other tissue in the absence of such tissue formation are found in humans and other animals in tendon or ligament tears, deformities and other tendon or ligament defects. Has application in healing. Such preparations, which employ tendon / ligament-like tissue-inducible proteins, have prophylactic use in preventing damage to tendon or ligament tissue, as well as immobilizing tendon or ligament to bone or other tissue. It may have applications in improving and repairing defects in tendon or ligament tissue. De novo tendon / ligament-like tissue formation induced by the compositions of the present invention contributes to the repair of other tendon or ligament defects of congenital, trauma-inducing, or other origin, and also tendon or ligament attachment or It is useful in cosmetic surgery for repair. The composition of the present invention attracts tendonogenic cells or ligamentogenic cells, stimulates the proliferation of tendonogenic cells or ligamentous cells, or develops tendonogenic cells or precursors of ligamentous cells. An environment may be provided that induces proliferation of tendon / ligament cell or progenitor ex vivo to induce differentiation or to return to in vivo for tissue repair. The compositions of the present invention may also be useful in treating tendinitis, root canal syndrome and other tendon or ligament defects. The composition may also include a suitable matrix and / or sequestrant as a carrier, as is well known in the art.

The protein or syngeneic therapeutic agents of the present invention may also be used for the proliferation of neuronal cells and for the regeneration of nerve and brain tissue, ie, central and peripheral nervous system diseases and disorders, and neurons. It may be useful for the treatment of mechanical and trauma disorders, including degeneration, death or trauma to cells or neural tissue.
More specifically, the protein is associated with diseases of the peripheral nervous system such as peripheral nerve injury, peripheral neuropathy and local neuropathy, as well as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. It can be used in the treatment of diseases of the central nervous system such as. Additional conditions that may be treated according to the present invention may include mechanical and traumatic disorders such as spinal cord disorders, head trauma and cerebrovascular diseases such as stroke. Peripheral neuropathy resulting from chemotherapy or other medical treatments may also be treatable with the proteins of the invention.

The proteins of the invention also promote better or more rapid closure of non-healing wounds including, but not limited to, pressure ulcers, ulcers associated with vascular insufficiency, surgical or traumatic wounds and the like. Can be useful for.

The proteins of the invention may also include organs (eg, pancreas, liver, intestine, kidney, skin, endothelium), muscles (smooth muscle, skeletal muscle or myocardium) and blood vessels (including vascular endothelium).
It is expected that it may be active in the production or regeneration of other tissues, such as tissue, or to promote the growth of cells containing such tissues. Part of the desired effect may be due to the inhibition or modulation of fibrotic scars, causing normal tissue to regenerate.
The proteins of the invention may also exhibit angiogenic activity.

The proteins of the invention may also be useful for the protection or regeneration of the intestine and for the treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage. .

The proteins of the invention may also be useful for promoting or inhibiting the differentiation of the above tissues from precursor tissues or cells; or for inhibiting the growth of the above tissues.

The activity of the proteins of the invention may also be measured, inter alia, by the following methods: Assays for tissue-generating activity include, but are not limited to, International Patent Publication No. WO 95/16035 ( International Patent Publication No. WO95 / 05846 (Nerve, Neuron); International Patent Publication No. WO91
07491 (skin, endothelium).

Assays for wound healing activity include, but are not limited to, the following: Eaglstein and Menz, J. MoI. Invest. Dermat
Ol 71: 382-84 (1978).
r, Epidermal Wound Healing, pp. 71-112 (Ma.
Ibach and Rovee), Year Book Medical Pu
blishers, Inc. , Chicago.

Activin / Inhibin Activity The FCTRX protein or syngeneic therapeutic agents of the invention may also exhibit activin-related activity or inhibin-related activity. Inhibin is a follicle-stimulating hormone (F
SH) is characterized by its ability to inhibit the release of activin, while activin
It is characterized by its ability to stimulate the release of follicle stimulating hormone (FSH). Thus, the proteins of the invention, either alone or in heterodimers with members of the inhibin family, as a contraceptive agent based on the ability of inhibin to reduce fertility in female mammals and reduce spermatogenesis in male mammals. Can be useful. Administration of sufficient amounts of other inhibins can induce infertility in these mammals. Alternatively, the protein of the invention may act as a homodimer or as a heterodimer with other protein subunits of the inhibin b group on the ability of the activin molecule to stimulate FSH release from cells of the anterior pituitary. On the basis of,
It may be useful as a fertility-inducing therapy. For example, US Pat. No. 4,798,885
See issue. The proteins of the invention may also be useful for facilitating the onset of conception in sexually immature mammals so as to increase the lifetime reproductive efficiency of livestock such as cattle, sheep and pigs.

The activity of the proteins of the invention may be measured, inter alia, by the following methods: Assays for activin / inhibin activity include, but are not limited to, those described below: Vale et al., Endocrinology.
91: 562-572, 1972; Ling et al., Nature 321: 77.
9-782, 1986; Vale et al., Nature 321: 776-779,
1986; Mason et al., Nature 318: 659-663, 1985;
Forage et al., Proc. Natl. Acad. Sci. USA 83:30
91-3095, 1986.

(Chemotaxis / chemokinesis activity) The protein of the present invention or a syngeneic therapeutic agent is a mammalian cell (eg, monocyte, fibroblast, neutrophil, T cell, mast cell, eosinophil, epithelium). Cells and / or endothelial cells) may have chemotactic or chemokinesis activity (eg, act as a chemokine). Chemotaxis and chemokinesis proteins can be used to recruit or attract a desired cell population to a desired site of action. Chemotaxis or chemokinesis proteins offer particular advantages in the treatment of wounds and other trauma to tissues, as well as in the treatment of local infections. For example, the attraction of lymphocytes, monocytes or neutrophils to the tumor or site of infection can result in an improved immune response to the tumor or infectious agent.

A protein or peptide has chemotactic activity for a particular population of cells if it can directly or indirectly stimulate the directed orientation or migration of that particular population of cells. Preferably, the protein or peptide has the ability to directly stimulate cell migration. Whether or not a particular protein has chemotactic activity for a population of cells is determined by any known assay for cell chemotaxis,
By using such proteins or peptides, it can be easily determined.

The activity of the proteins of the invention can be measured, inter alia, by the following method.
An assay for chemotactic activity (identifying proteins that induce or prevent chemotaxis) is the ability of a protein to induce migration across a cell's membrane, as well as one cell population to another. It consists of an assay that measures the ability of a protein to induce adhesion to. Suitable assays for migration and adhesion include, but are not limited to, those described below: CURRENT.
PROTOCOLS IN IMMUNOLOGY, edited by Coligan et al. (Chapter 6.12, Measurement of alpha and beta).
Chemokines 6.12.1-6.12.28); Taub et al., JC.
lin Invest 95: 1370-1376, 1995; Lind et al., A.
PMIS 103: 140-146, 1995; Muller et al., Eur J.
Immunol 25: 1744-1748; Gruberet et al., J Imm.
unol 152: 5860-5867, 1994; Johnston et al., J.
Immunol 153: 1762-1768, 1994.

Hemostatic and Thrombolytic Activity The proteins of the invention or syngeneic therapeutic agents may also exhibit hemostatic or thrombolytic activity. As a result, such proteins are useful in the treatment of various coagulation disorders, including inherited disorders such as hemophilia, or the treatment of wounds caused by coagulation and trauma, surgery or other causes. Are expected to promote other hemostatic events in. The proteins of the invention are also useful for inhibiting the dissolution or formation of thrombosis and for the treatment and prevention of conditions resulting therefrom (eg, cardiovascular and central nervous system vascular infarctions (eg, stroke)). obtain.

The activity of the proteins of the invention can be measured, inter alia, by the following methods: Assays for hemostasis and thrombolytic activity include, but are not limited to, those described below: Linet et al. J. Clin. Pharmac
ol. 26: 131-140, 1986; Burdick et al., Thrombos.
is Res. 45: 413-419, 1987; Humphrey et al., Fib.
rinolysis 5: 71-79 (1991); Schaub, Prost
aglandins 35: 467-474, 1988.

Receptor / Ligand Activity The proteins of the invention or cognate therapeutics may also demonstrate activity as inhibitors or agonists of receptors, receptor ligands or receptor / ligand interactions. Examples of such receptors and ligands include:
These include but are not limited to: cytokine receptors and their ligands, receptor kinases and their ligands, receptor phosphatases and their ligands receptors and their ligands involved in cell-cell interactions (
Cell adhesion molecules, including but not limited to selectins, integrins and their ligands, and receptor / ligand pairs involved in antigen presentation, antigen recognition and the generation of cellular and humoral immune responses. Receptors and ligands are also useful in screening peptides or small molecule inhibitors for potential related receptor / ligand interactions. The protein of the present invention (
(Including but not limited to fragments of receptors and ligands), may themselves be useful as inhibitors of receptor / ligand interactions.

The activity of the proteins of the invention may be measured, inter alia, by the following methods: Suitable assays of receptor-ligand activity include, but are not limited to, those described below: CURRENT PROTOCOLS IN.
IMMUNOLOGY, edited by Coligan and others, Greene Publish
ing Associates and Wiley-Interscience
e (Chapter 7.28, Measurement of Cellular Adh)
session under static conditions 7.28.1
-7.28.22), Takai et al., Proc. Natl. Acad. Sci.
USA 84: 6864-6868, 1987; Bierer et al., J. Am. Exp.
Med. 168: 1145-1156, 1988; Rosstein et al., J.
． Exp. Med. 169: 149-160 1989; Stolltenbor
g., et al. Immunol. Methods 175: 59-68, 1994;
Stitt et al., Cell 80: 661-670, 1995.

Anti-Inflammatory Activity The protein of the present invention or a cognate therapeutic agent may also exhibit anti-inflammatory activity. Anti-inflammatory activity may be due to providing a stimulus to cells involved in the inflammatory response (by inhibiting or promoting cell-cell interactions such as cell adhesion) or of cells involved in the inflammatory process. By inhibiting or promoting chemotaxis, by inhibiting or promoting cell extravasation,
Alternatively, it can be achieved by stimulating or suppressing the production of other factors that directly inhibit or more enhance the inflammatory response. Proteins exhibiting such activity may be used to treat inflammation conditions, including but not limited to chronic or acute conditions, such as infection-related inflammation (eg, septic shock, sepsis or systemic inflammatory response syndrome (SIRS). )), Ischemia-perfusion injury, endotoxin lethality, arthritis, complement-mediated fulminant rejection, nephritis, cytokine-induced embryonic injury or chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease, or TNF. Or resulting from overproduction of cytokines such as IL-1) can be treated. The proteins of the invention may also be useful for the treatment of anaphylaxis and hypersensitivity to antigenic substances or materials.

Tumor Inhibitory Activity In addition to the activity described above for immunological treatment or prevention of tumors, the proteins of the invention may exhibit other anti-tumor activities. The protein may directly or indirectly (eg, via ADCC) inhibit tumor growth. By acting on tumor tissue or tumor precursor tissue, the protein inhibits tumor growth by inhibiting the formation of tissue necessary to support tumor growth (eg, by inhibiting angiogenesis). It may exhibit its tumor-inhibiting activity by causing the production of other factors, substances or cell types that inhibit or by suppressing, eliminating or inhibiting factors, substances or cell types that promote tumor growth.

Other Activities The protein of the present invention or a cognate therapeutic agent may also exhibit one or more of the following additional activities or effects: but not limited to bacteria, viruses, fungi and other parasites. Inhibiting or killing the growth, infection or function of infectious agents, including; physical characteristics such as, without limitation, height, weight, hair color, eye color, skin, fat to lean ratio, or others. Tissue pigmentation, or the size or shape of organs or body parts (eg, breast enlargement or decrease, changes in bone morphology or shape)
Etc.) (inhibiting or enhancing); producing a biorhythm or circadian cycle or circadian rhythm; producing fertility of male or female subjects; dietary fat, lipids, proteins, carbohydrates, vitamins , Metabolism, catabolism, assimilation, processing, utilization, storage or elimination of minerals, cofactors or other trophic factors or components.
Producing behavioral features (including, but not limited to, appetite, libido, stress, cognition (including cognitive impairment), depression (including depressive disorder) and violence; analgesic effects or other pain reduction Providing an effect; promoting differentiation or proliferation of embryonic stem cells in a lineage other than the hematopoietic lineage; hormonal activity or endocrine activity;
In the case of enzymes, correcting enzyme deficiencies and treating deficiency-related diseases;
Treatment of hyperproliferative disorders (eg, psoriasis); immunoglobulin-like activity (eg, activity to bind antigen or complement); as well as act as an antigen in vaccine compositions, such proteins or other substances or such Ability to elicit an immune response against an entity that cross-reacts with various proteins.

Neuropathies generally include Parkinson's disease, Alzheimer's disease, Huntington's disease, multiple sclerosis, amyotrophic lateral sclerosis (ALS), peripheral neuropathy, nervous system tumors, exposure to neurotoxins, acute brain injury. , Peripheral nerve trauma or injury, and other nerve injuries, epilepsy, and / or tremor.

[0379]   The invention is further illustrated in the following non-limiting examples.

Example 1 Example 1. Mature form (3066) derived from clone 30664188.0.99.
4188.0. Molecular cloning of m99)) The mature form of clone 30664188.0.99 (encoding residues 24-370 of the amino acid sequence of SEQ ID NO: 2) was cloned. This fragment is 3
0664188.0. It corresponds to the polypeptide sequence called m99 and which remains after the signal peptide, which is presumed to be cleaved between residues 23 and 24, is removed. The following oligonucleotide primers were used for 30664188.0.9.
Nine putative mature forms were designed for PCR amplification.

30664188 Eco Forward: CTCGTC GAATTC ACC CCG CAG AGC GCAT
CC ATC AAA GC (SEQ ID NO: 25) 3066418 Xho Reverse direction: CTCGTC CTC GAG TCG AGG TGG TCT TGA
GCT GCA GAT ACA (SEQ ID NO: 26) The forward primer contained an in-frame EcoRI restriction site and the reverse primer contained an XhoI restriction site. The EcoRI / XhoI fragment was isolated from pET28 E. E. coli expression vector and pMelV5His baculovirus expression vector.

PCR reactions were set up using 5 ng of human spleen and fetal lung cDNA templates. The reaction mixture had a volume of 50 μl and each 1 μM of 3066.
4188 Eco forward primer and 3066418Xho reverse primer, 5 micromolar dNTP (Clontech Laboratories,
Palo Alto CA) and 1 microliter of 50 × Advanta.
ge-HF2 polymerase (Clontech Laboratories, P.
alo Alto CA). The following PCR reaction conditions were used: a) 96 ° C. for 3 minutes b) 96 ° C. for 30 seconds denaturation c) 70 ° C. for 30 seconds, primer annealing. This temperature was gradually reduced at 1 ° C / cycle.

[0383]   d) 72 ° C 1 minute extension   Repeat steps (b) to (d) 10 times   e) Denaturation at 96 ° C for 30 seconds   f) 60 ° C, 30 seconds annealing   g) 72 ° C 1 minute extension   Steps (e) to (g) are repeated 25 times   h) Final extension at 72 ° C for 5 minutes.

The amplified product predicted to have 1041 bp was detected by agarose gel electrophoresis in both samples. These fragments were purified from an agarose gel and the pCR2.1 vector (Invitrogen, Carls
bad, CA). The cloned insert was digested with M13 forward and M13 reverse primers and the following gene specific primers: 3066418 S1: GGA CGA TGG TGT GGA CAC.
AAG (SEQ ID NO: 27), 3066418 S2: CTT GTG TCC ACA CCA TCG
TCC (SEQ ID NO: 28), 3066418 S3: TAT CGA GGC AGG TCA TAC.
CAT (SEQ ID NO: 29) and 3066418 S4: ATG GTA TGA CCT GCC TCG
Sequencing was performed using ATA (SEQ ID NO: 30).

The cloned insert was confirmed as an open reading frame encoding the putative mature form of 30664188.0.99. The construct from fetal lung (designated 30664188-S31la) was used for further subcloning into an expression vector (see below). 306 in the restricted area
The nucleotide sequence of 64188-S1la has an O of 30664188.0.99.
It was found to be 100% identical to the corresponding fragment in RF (Table 1; SEQ ID NO: 1).

Example 2. Preparation of mammalian expression vector pCEP4 / Sec FCTRX nucleic acid was expressed in mammalian cells with the vector named pCEP4 / SEC. This vector was prepared using the following oligonucleotide primers: pSec-V5-His forward CTCGTCCCTCGAGGGTAAGCCTATCCCTAAC (SEQ ID NO: 31) and pSec-V5-His reverse CTCGTCGGGCCCCTGATCAGCGGGTTTAAAC (SEQ ID NO: 32).

These primers were cloned into pcDNA3.1-V5H containing V5 and His6.
Designed to amplify the fragment from the is (Invitrogen, Carlsbad, CA) expression vector. The PCR product was digested with XhoI and ApaI and the Igκ leader sequence (Invitrogen, Carlsbad.
Ligated to the XhoI / ApaI digested pSecTag2B vector containing CA). The exact structure of the resulting vector pSecV5His (I in frame
The g-kappa leader and V5-His6) were confirmed by DNA sequence analysis. The vector pSecV5His was digested with PmeI and NheI to provide a fragment holding the above elements in the correct frame. This PmeI-
The NheI fragment was ligated into the BamHI / Klenow and NheI treated vector pCEP4 (Invitrogen, Carlsbad, CA). The resulting vector was named pCEP4 / Sec and contains an in-frame Igκ leader, the insertion site of the clone of interest, and V5 and 6 × His under the control of the PCMV and / or PT7 promoters. pCEP4 / S
ec is an expression vector that allows heterologous protein expression and secretion by fusing any protein to the Igκ chain signal peptide. Detection and purification of expressed proteins is aided by the presence of V5 epitope tag and 6xHis tag at the C-terminus (Invitrogen, Carlsbad, CA).
.

Example 3. Expression of 30664188.m99 polypeptide in E. coli Vector pRSETA (InVitrogen Inc., Carlsbad).
． CA) was digested with XhoI and NcoI restriction enzymes. Oligonucleotide linkers: CATGGTCAGCCCTAC (SEQ ID NO: 33); and TCGAGTAGGCTGAC (SEQ ID NO: 34) were annealed at 37 degrees Celsius and ligated to XhoI-NcoI treated pRSETA. The resulting vector was confirmed by restriction analysis and sequencing and named pETMY. BglII-Xho of sequences containing 30664188 sequence
The I fragment (Example 3) was ligated into the vector pETMY digested with BamHI and XhoI. The resulting expression vector is pETMY-3066418.
It is named 8. In this vector, 30664188 was fused at its N-terminus to a 6xHis tag and a T7 epitope. Then the plasmid pE
TMY-30664188 was added to E. coli expression host BL21 (DE3, pLy
s) (Novagen, Madison, WI) and protein expression was induced according to the manufacturer's instructions. After induction, E. E. coli cells were collected and the protein was loaded with anti-His6Gly antibody (Invitrog
En, Carlsbad, CA) and analyzed by Western blotting. FIG. 2 shows 30664188. m99 has an apparent molecular weight of 40 kDa
Is expressed as a protein of. This is 30664188.
It is close to the molecular weight predicted for the m99 sequence.

Example 4. Expression of 0664188.m99 Polypeptide in Human Embryonic Kidney 293 Cells 30664188. The EcoRi-XhoI fragment containing the m99 sequence was replaced with 3
It was isolated from 0664188-S311a (Example 1) (Example 1) and subcloned into vector pE28a (Novagen, Madison, Wis.) To generate plasmid pE28a-30664188. Then pE28a-3
0664188 was partially digested with BamHI restriction enzyme and then completely digested with XhoI.
Digested with. The 1.1 kb fragment was isolated and BamHI-XhoI
Expression vector pCEP4 / S ligated to digested pCEP4 / Sec (Example 2)
ec-30664188 was produced. The pCEP4 / Sec-30664188 vector was added to human embryonic kidney 293 cells (ATCC No. CRL-1573, Mana).
ssas, VA) using LipofectaminePlus reagent and manufacturer's instructions (Gibco / BRL / Life Technologies, Ro.
ckville, MD). Cell pellets and supernatants were harvested 72 hours post-transfection and 306641 by Western blotting with SDS-PAGE manipulation under reducing conditions using anti-V5 antibody.
88. Tested for m99 protein expression. FIG. 3 shows that 30664188. m
It is shown that 99 is expressed as three distinct protein bands with apparent molecular weights of the 50, 60, and 98 kDa proteins secreted by 293 cells. The 50 kDa band is 30664188. The monomeric glycosylated form of m99 migrated with the expected size, and the 98 kDa band migrated with a size consistent with the dimer of this monomeric form.

Radiation Hybrid Mapping of Example 5.306664188.0.99 Radiation hybrid mapping using human chromosomal markers was performed on clone 306.
64188.0.99. The procedure used to obtain these results is similar to the procedure described in Steen, RG et al. (A H
high-Density Integrated Genetic Linka
ge and Radiation Hybrid Map of the L
Laboratory Rat, Genome Research 1999 (1
Published online May 21, 1999) Volume 9, AP1-AP8,19
99). A panel of 93 cell clones containing randomized radiation-induced human chromosomal fragments was designed in a unique manner to identify the clones sought.
Screened in 96-well plates using CR primers.
Clone 30664188.0.99 was found to be located on chromosome 11 (markers WI-9345 to 3.1 cR and marker CHLC.GAT).
A6C11 to 1.7 cR).

Example 6. Expression and Purification of 30664188.m99 Protein The segment representing the mature protein cloned in Example 1 was excised and a vector suitable for transfection of HEK293 cells under the control of the pCEP4 promoter. Subcloned into pCEP4 / Sec (Example 2). The resulting vector was named pCEP4 / Sec / 30664188.

HEK293 cells were grown to 90% confluence in Dulbecco's Modified Eagle Medium (DMEM) / 10% fetal bovine serum medium. These cells,
Manufacturer's instructions (Gibco / BRL / Life Technologies, R
pCEP4sec or pCEP4sec / 30664188. using Lipofectamine 2000 according to Ockville, MD). Transfected with m99. Transfected cells were incubated with DMEM for 2 days, and conditioned medium was prepared by collecting cell supernatant. This conditioned medium was subjected to Talon metal affinity chromatography (Clonte).
ch, Palo Alto, CA). Briefly, 7 ml conditioned medium was incubated with 1 ml Talon metal affinity resin in a spin column. The spin column was washed twice with 1 ml PBS. The columns were then eluted twice with 0.65 ml PBS / 0.5M imidazole pH 8.0 and the eluates pooled. Imidazole was removed by buffer exchange dialysis into PBS using a Microcon centrifuge filter device (Millipore Corp., Bedford, MA). The enriched gene product was stored at 4 ° C.

The resulting purified protein was subjected to SDS-PAGE under reducing conditions and probed with anti-V5 antibody, which was detected with an enzyme label.
The results of two separate transfection and purification procedures are shown on a gel. These indicate that the product is a mixture of V5-containing polypeptides. The largest has an apparent molecular weight of approximately 50 kDa (Figure 4). The program proSite predicts one N-glycosylation site in the mature protein. Glycosylation
It may explain the apparent molecular weight detected. Therefore, the 50 kDa band is consistent with the expected length for the full length gene product. Other bands also occurred, with predominantly an apparent molecular weight of approximately 20-25 kDa. These are presumed to be the result of proteolysis that occurs either intracellularly in 293 cells or extracellularly after their secretion.

Example 7 Real-Time Tissue Expression Profiling of Sequence 30664188 by Quantitative PCR Real-time PCR was then performed on a 5 ′ fluorogenic label from a proprietary oligonucleotide probe with a 3 ′ quencher. Was performed on multiple tissue or cell samples by monitoring the release of A. Ta
qMan® PCR Reagent Kit (Roche Molecular S
systems, Inc. ) And Perkin-Elmer Biosystem
30 as OCR occurred using a fluorogenic 5 ′ nuclease assay using the ms ABI PRISM® 7700 Sequence Detection System.
Target sequences specific for the 664188 transcript are detected and monitored in real time.

Perkin Elmer Biosystem's Primer Expr using the probe and primer as the input, the sequence of 30664188.
ess software package (Apple Computer Macintosh)
Designed according to version I) for osh Power PC. The default settings were used for the reaction conditions and the following parameters were set before selecting the primers: primer concentration = 250 nM, primer melting temperature (T _m ) range = 58 ° C.
To 60 ° C., primer optimal T _m = 59 ° C., the maximum primer difference = 2 ° C., the probe has no 5'G, probe T _m is must be higher 10 ° C. than primer T _m, amplicon size Should be between 75 bp and 100 bp. Three
A pair of probes and primers were prepared according to Synthegen (Houston, TX
, USA) and double purified by HPLC to remove unbound dye. Using mass spectrometry, the 5'end and 3'of the probe, respectively
'Effective coupling of reporter dye and quencher dye to the end was confirmed.

PCR preparation and conditions included the following steps: Each tissue (poly A + RNA
2.8 pg) and sample RNA from cell lines (total RNA, 70 ng),
96-well PCR plate (Perkin Elmer Biosystems)
) Was spotted on each well. 41 normal human tissues and 55 human cancer cell lines were adopted.

Table 7. Results of real-time TaqMan ^™ tissue profiling.

[0398]

[Table 7] In Table 7, the following abbreviations are used: ca = carcinoma, * = established from metastasis, met = metastasis, s cell var = small cell variant, non-s = non-sm = non-small, squam = flat. , Pl. eff = pl effusion = pleural effusion, glio = glioma, astro = astrocytoma, neuro = neuroblastoma.

Two sets of primers and probes (30664188 specific probe, generally β-actin and / or GAPDH, and reference gene specific probe 306
PCR containing 64188 probes and multiplexed
Cocktails with 1x TaqMan ^™ PC for PE Biosystems 7700
Using R Master Mix, 5 mM MgCl ₂ , dNTPs (dA
, DG, dC, dU (1: 1: 1: 2 ratio)), 0.25 U / ml Ampl
iTaq Gold ^™ (PE Biosystems) and 0.4 U / μl
RNase inhibitor, as well as 0.25 U / μl reverse transcriptase. Reverse transcription is carried out at 48 ° C. for 30 minutes, then amplification / PCR as follows.
Cycles performed: 95 ° C. for 10 minutes, then 40 cycles of: 95 ° C.
15 seconds at 60 ° C for 1 minute.

[0400]   The TaqMan probes and primers used were the following:

[0401]

[Chemical 1] .

Among the normal tissues tested, clone 30664188 is highly expressed in pancreas, adrenal gland, adipose tissue, stomach, trachea, mammary gland and testis. Among the various cancer cell lines, this clone was especially found in the CNS cancer (CNS ca. (glio) SF-29.
5), lung cancer (squamous cell, SW900) and ovarian cancer (ovary ca.OVCAR)
Particularly strongly expressed in -5).

Example 8. Clone 30664188.0.m99 protein is expressed in cellular DN
Induce A synthesis) Human CCD-1070 fibroblasts (ATCC No. CRL-2091, Mana)
sss, VA) or mouse NIH 3T3 (ATCC number CRL-1658).
, Manassas, VA) were cultured in DMEM supplemented with 10% fetal bovine serum or 10% calf serum, respectively. Fibroblasts to confluence at 37 ° C
It was grown in in 10% CO ₂ / air. Cells were starved with DMEM for 24 hours. pCEP4 / Sec (Example 2) or pCEP4 / Sec / 306641
88. Conditioned medium enriched with m99 (Example 6) was added for 18 hours (10 μL / medium 1).
00 μL). BrdU (10 μM) was then added and incubated with the cells for 5 hours. BrdU incorporation was determined by the manufacturer (B
Oehringer Mannheim, Indianapolis, IN).

FIG. 5 shows that 30664188. We demonstrate that m99 induced an approximately 4- to 5-fold increase in BrdU incorporation in either cell type compared to control conditioned medium or untreated cells. The observed increase in proliferation is due to the platelet-derived FCTR.
It was similar to the increase in BredU integration induced by X (PDGF), basal fibroblast growth factor (bFGF), or serum treatment. Furthermore, 30664
188. Partially conditioned medium of m99 did not induce BrdU integration in human MG-63 endothelial cells or CCD1106 keratinocytes (data not shown). These results suggest that 30664188 selectively induces DNA synthesis in human and mouse fibroblasts but not in endothelial cell lines.

In another experiment, CC treated with pCEP4 / Sec / 30664188
D-1070 cells and MG-63 osteosarcoma cells (ATCC Cat. No. CR.
L-1427) each incorporated BrdU in a dose-dependent manner (1 μg / ml produced a full effect (approximately 2.5-3 fold increase over control), 100 n).
g / ml produced slightly less than half of this effect, and 10 and 1 ng / ml produced levels close to the control incorporation level). Furthermore, the dose response of NIH3T3 cells was 50% pCEP4 / Sec / 306.
It is shown that 64188 occurs between 10 and 50 ng / ml (Fig. 6).
).

Example 9. Induction of proliferation of NIH 3T3 cells by 30664648.m99 Mouse NIH3T3 fibroblasts were plated at 40% confluency,
Then, the cells were cultured in DMEM supplemented with 10% fetal bovine serum or 10% calf serum for 24 hours. The culture medium was removed and an equal volume of pCEP4 / Sec (Example 2
) Or pCEP4 / Sec / 30664188 (Example 6) conditioned medium. After 48 hours, cells were photographed on a Zeiss Axiovert 100. Trypsinization of cell numbers followed by Coulter Z1 Particle C
Counted using an outer.

3064188 transfected HEK293 of NIH3T3 fibroblasts.
Treatment with conditioned medium from kidney endothelial cells resulted in a 6-8 fold increase in cell number over 2 days (Figure 7). Cells treated with control conditioned medium from HEK293 cells transfected with pCEP4 / Sec vector alone showed little or no growth (Figure 7).

30664188. To determine whether m99 conditioned medium was able to induce the phenotypic changes characteristic of cell transformation, 30664188 conditioned medium or mock (mo) was used.
ck) Cells treated with either conditioned medium were examined by light microscopy. FIG. 8 shows 30
664188. It shows that NIH3T3 cells treated with m99 showed a marked increase in cell number and refractive properties, whereas control treated NIH3T3 cells did not. The loss of contact inhibition of growth was apparent. Confluent NIH
The cobblestone appearance characteristic of 3T3 cells was lost and density-independent growth was evident. The latter was also suggested by the rounder appearance of NIH3T3 cells due to faint refraction. pCEP4 / Sec / 30664188. Transfection of m99 also showed almost identical potency in transformation efficacy on days 2-5 of culture. However, after 7-10 days in culture, the morphologically transformed phenotype appeared to have reverted.

Example 10. Human Human Primary with 3066464188 Primary
) Induction of Osteoblast Proliferation) In an experiment similar to that described in Example 9, human primary osteoblasts (NHost
Clonetics) also underwent a dose-dependent increase in cell number 3- to 4-fold (
(Figure 9). The dose required to elicit a 50% response in Figure 9 is 100 ng /
pCEP4 / Sec / 30664188. It is m99. Furthermore, 3
Jurkat cells contacted with partially purified conditioned medium containing the 0664188 gene product were BrdU compared to medium from mock transfections.
Although it showed a doubling of uptake, Cu, which is thought to have other growth promoting activities,
Thirteen identical cells contacted with the gene product of raGen Corporation evoked no effect.

Taken together, the result that the protein induces DNA synthesis (Example 8), cell growth (Examples 9 and 10), and morphological transformation (Example 9) is that the protein transforms. It has a characteristic.

Example 11. Induction of tumorigenesis by 30664188 protein NIH3T3 cells treated with conditioned medium from cells transfected with pCEP4 / Sec or pCEP4 / Sec / 30664188 were cultured as described above. 10 ⁶ cells in 0.1 mL PBS were then injected subcutaneously into the lateral superficial fascia of female nude mice (Charles River Laboratory) (n = 5 per group) (eg pCEP4 / Sec / 306641).
88. referred to as m99 mouse). Tumor formation was assayed with calipers after 11 and 14 days.

After 11 days, tumorigenesis was observed in pCEP4 / Sec / 30664188. It was apparent in m99 mice. pCEP4 / Sec / 30664188. m99
Mice (5/5) were positive for tumor formation with a tumor size of 6.73 ± 0.58 mm ³ . After 14 days in culture, a marked decrease in tumor size was observed in pCEP.
4 / Sec / 30664188. Obvious in m99 mice, 3/5 mice are positive, and mean tumor volume is 1.44 ± 0.88 mm ^3.
Met. Remarkably and as a positive control, 5 out of 5 mice treated with bFGF developed tumors with an increased volume to 66.56 ± 13.2 mm ³ . Control vector mice (0/5) were negative for tumor formation. These data are 30664188. It is strongly suggested that m99 overexpression induces tumorigenesis in nude mice, but the tumors appear to disappear as a function of time. Remarkably, these data show that NIH3T3
Equivalent to the morphological reversion characteristics described in the transformation assay.

Example 12. Purification of Intact and Cleavage Products of the 3066464188.m99 Protein In certain experiments, the vector pCEP4 / Sec / 306664188. m9
It was observed that treatment with 9 did not result in DNA synthesis or cell proliferation.
In a further experiment, 30664188. The m99 conditioned medium was obtained from HEK293 cells grown in the presence of serum (Example 6). 30664188. m9
The 9 gene product was purified by cation exchange chromatography followed by nickel affinity chromatography. This protein product was designated as SDS-PAG.
E was operated under non-reducing and reducing conditions and the Coomassie stain was developed. The results are shown in Figures 10A and 10B. In the presence of serum, 30664188. The m99 gene product appeared as a protein of approximately 35 kDa under non-reducing conditions (Fig. 10B).
). However, this polypeptide appears as three degradation bands when operated under reducing conditions. The apparent molecular weights of the two bands were 22-25 kDa (Band I), about 16 kDa (Band II) and about 5-6 kDa (Band III). N-terminal amino acid analysis of these fragments revealed that both bands I and II were 30664188. It was shown that the m99 amino acid sequence begins at residue 247 and band III begins at residue 339. These results are band I
It is consistent with the cleavage of the polypeptide corresponding to that produces fragments of bands II and III. It is possible that the 35 kDa band observed under non-reducing conditions is a dimer containing band I and / or a bound polypeptide containing bands I and III observed under reducing conditions.

Amino-terminal analysis was performed on pCEP4sec / 3066641 grown in the presence of serum.
88. It is shown that the gene product from m99-transfected 293 cells (isolated according to the procedure above) is a carboxy-terminal fragment of the full length protein. The 35 kDa band found under non-reducing conditions is described below as p35.
Call.

Different gene products are observed when 293 cells are cultured in the absence of serum and then subjected to the same isolation and detection procedures described in the previous paragraph. A band is observed at approximately 85 kDa under non-reducing conditions (Figure 10A). This protein is referred to below as p85. The corresponding gene product observed under reducing conditions was approximately 53-5.
It is found at 4 kDa. N-terminal amino acid analysis of this gene product was performed using pCEP4s
ec / 30664188. The amino acids of the multiple cloning sites used in m99 (Example 6) are provided. There are no residues corresponding to the Igκ leader sequence (cloned upstream from multiple cloning sites). These results are
The gene product obtained in the absence of serum is pCEP4sec / 30664188
． It represents the complete amino acid sequence encoded by m99. The p85 polypeptide is believed to be the dimer of the 50 kDa species observed on reducing SDS-PAGE.

Example 13. Activity of Intact and Cleavage Fragments of the Example 3030664188.m99 Protein Purified p85 and p35FCTRX proteins were used in a range of concentrations of N
Applied separately to IH3T3 cells. BrdU incorporation was assessed as described in Example 8. The results are shown in Fig. 11. It can be seen that p85 has a growth promoting activity that is similar to the level of controls except for the highest concentration used. On the other hand,
p35 was at least more active than unfractionated pCEP4 / Sec / 30664188 conditioned medium. The concentration of p35, which gives 50% of maximum DNA synthesis, is 20 ng
/ ML and 50 ng / mL.

These results show that the intact 30664188. The p35 fragment from m99 has growth promoting activity, but. The intact dimeric form of the m99 protein (p85) suggests that it has no activity. Thus, the transformation and reversion of tumorigenesis seen in Examples 9 and 11 is a consequence of the development of species that inhibit or prevent the formation of p35-like species from p85 in such longer time cultures. possible.

Example 14. Isolation of mouse PDGFD cDNA A mouse nucleic acid sequence encoding a PDGFD polypeptide was forward-primed by PCR from a mouse brain library (Clontech);

[0419]

[Chemical 2] (SEQ ID NO: 44) and reverse primer:

[0420]

[Chemical 3] (SEQ ID NO: 45) was used for amplification.

The mouse polynucleotide (SEQ ID NO: 5) and the corresponding polypeptide encoded by it (SEQ ID NO: 6) are shown in Table 3.

Example 15. Genomic organization of the PDGFD gene The genomic DNA sequence obtained from GenBank was used to determine the exon / intron organization of the PDGFD gene. The intron / exon boundaries are standard consensus slice parameters (1616.S.Mount, Nucleic
Acids Res. 10, 459-472. (1982). ) Was used for the estimation. The Phase I genomic DNA sequence reveals that the PDGF D gene, like PDGF A and PDGF B, is composed of 7 exons (FIG. 13). BLASTN analysis showed that hits against the following genomic clones (> 99%)
): Registration numbers AC026640, AC023129, AC024052
, And AC067870. All clones mapped to chromosome 11q23.3-24. The chromosomal location was further refined by radial hybrid analysis.

The start codon is located in exon 1 and the TAA stop codon is located in exon 7. Exon 1 is located at AC023129, while exons 2-7 are AC
Located on 024052. Clones containing the majority of these exons (AC0
23129 and AC024052) are non-ordered Phase I genomic clones and intron size could not be determined. For PDGF D, CUB
Both (exons 2 and 3) and PDGF (exons 6 and 7) domains spanned the two exons. PDGF D is PDGF A exon 6
Lacking the COOH-terminal retention motif found in splice variants and PDGF B (W. LaRochelle, M. May-Siroff, K. Ro.
bbins, S. Aaronson, Genes Dev. 5,1191-11
99 (1991). ). An in-frame stop codon was found 9 bp upstream of the initiation methionine.

Molecular Cloning of the Novel Splice Variant of Example 16.30664188.0.99 In this example, cloning was carried out using clone 30664188.0.99.
, A novel splice variant of A. Oligonucleotide primers were designed to PCR amplify this sequence. These primers are:

[0425]

[Chemical 4] (SEQ ID NO: 46), and

[0426]

[Chemical 5] (SEQ ID NO: 47).

The PCR reaction was set up using 5 ng of human pancreatic cDNA template.
The reaction mixture had a volume of 50 μl each containing 1 μM 30664188 E.
co forward primer and 3066418Xho reverse primer, 5 micromolar dNTPs (Clontech Laboratories, Palo A
1 to CA) and 1 microliter of 50 × Advantage-HF2.
Polymerase (Clontech Laboratories, Palo Al
to CA). The following PCR reaction conditions were used: a) 96 ° C. for 3 minutes b) 96 ° C. for 30 seconds denaturation c) 70 ° C. for 30 seconds, primer annealing. This temperature was gradually reduced at 1 ° C / cycle.

[0428]   d) 72 ° C 1 minute extension   Repeat steps (b) to (d) 10 times   e) Denaturation at 96 ° C for 30 seconds   f) 60 ° C, 30 seconds annealing   g) 72 ° C 1 minute extension   Steps (e) to (g) are repeated 25 times   h) Final extension at 72 ° C for 5 minutes.

In addition to the deduced amplification product (with 1041 bp) for the 3066418.0.99 full length clone with 1041 bp, two additional bands were detected. These fragments were purified from an agarose gel and pCR
2.1 vector (Invitrogen, Carlsbad, CA) was ligated. The cloned insert was sequenced using the M13 forward and M13 reverse primers and the four gene-specific primers shown in Example 1.

Both cloned inserts were sequenced and 3066418.
A shorter splice morphology of 8.0.99 was confirmed.

Example 17 Purification of Recombinant PDGF DD The gene product of PDGFD was
Porous microcarriers in a 1 L spinner flask (Cultisphere-G)
L, Hyclone; Logan, UT) and expressed in HEK293 cells. As shown in Examples 2 and 4, the recombinant PDGF D gene
Contains a 6xHis fusion at the 3'end. Cells were cultured in the presence or absence of 5% fetal bovine serum (FBS) with 1% penicillin / streptomycin in DMEM / F1.
It was grown in 2 medium. The conditioned medium was harvested by centrifugation (4000 xg 4 ° C for 15 minutes) and POROS HS50 column (PE Biosystems;
Foster City, CA) (20 mM Tris-acetate (pH 7.
0), which was previously equilibrated). After washing with equilibration buffer, bound proteins were eluted with a NaCl step gradient (0.25M, 0.5M, 1.0M and 2.0M). Fractions containing PDGF DD p35 (1.0 M NaCl step elution) or p85 (0.5 M NaCl step elution) (see Example 12) were pooled and equal volumes of phosphate buffered saline ( P
BS) (pH 8.0, containing 0.5 M NaCl) and then loaded onto a POROS MC20 column pre-packed with nickel sulfate (PE Biosystems). After washing with PBS / 0.5M NaCl, bound proteins were eluted with a linear gradient of imidazole (0-0.5M). PDGF DD (
(Homodimer of PDGF D) (100-150 mM imidazole fractions were pooled, and twice 1000 volumes of 20 mM Tris-HCl (
It was dialyzed against 50 mM NaCl, pH 7.5. Protein purity was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE;
4-20% Tris-glycine gradient gel; Invitrogen, Carls
Bad, CA) was estimated to be> 95% (see, for example, the results of Example 12 including FIG. 10A).

(Biochemical Properties of PDGF D) In order to examine the biochemical properties of the PDGF D gene product, the PDGF D protein encoded by the cDNA was added to the mammalian expression vector pCEP4 / Sec-30664188 (Example 4). Subcloned. This construct incorporates an epitope tag (V5) and a polyhistidine tag at the COOH terminus of the protein to aid its identification and purification (expression vector pCEP4 / Sec-30664188; Example 4).

Following transfection into 293HEK cells and growth in serum-free medium, a secreted polypeptide with an apparent molecular weight of approximately 49 kDa (p49 species) was identified by Western blot analysis under reducing conditions ( Figure 14, Lane 2
). The fact that the apparent molecular weight of p49 is greater than the expected value of about 43 kDa may be due to glycosylation. In contrast, the 20 kD protein is PDGF
Secreted when D-transfected cells were grown in the presence of FBS (Figure 14A, lane 3). Conditioned medium from mock-transfected cells did not react with anti-V5 antibody (Figure 14A, lane 1).

In addition, PFGF D was expressed in the presence or absence of FBS and purified to> 95% homogeneity. As shown in FIG. 14B (lane 2), PD
Expression of GFD under serum-free conditions resulted in the expected detection of the 49 kD gene product under reducing conditions when the gel was stained with Coomassie blue. About 84
A polypeptide species with an apparent molecular weight of kDa (corresponding to the dimer p85 species of p49) was found under non-reducing conditions (Figure 14B, lane 1). PDGF D
Approximately 3 when D was purified from serum-containing conditioned medium and operated under non-reducing conditions
A species with an apparent molecular weight of 5 kDa (p35) was observed (Figure 14B, lane 3). It was found that under reducing conditions p35 produced three bands when visualized with Coomassie blue, which migrates with an apparent molecular weight of approximately 20, 14 and 6 kDa (FIG. 14B, lane 4).

Amino-terminal sequence analysis of p35 showed proteolysis after R247 or R249 (FIG. 15). As shown in FIG. 15, panel A, two peptides were found, one beginning with GlyArg (these two residues are underlined) and the second is the third. Start with the residue Ser. The ratio of these peptides is
It was found that SYHDR: GRSYHDR = 4: 1. Further sequencing results in Figure 15 (panels B and C) showed the remaining polypeptides, 16kDa and 6kDa, with further processing shown by Coomassie blue staining but not by anti-V5 Western blot. These combine to give rise to p35.

The results presented in this example demonstrate that the PDGF D gene product is a homoprotein (holoprotein).
It is a dimer of both the protein form (p85) and the C-terminal fragment (p35). The p85 form appears to be processed in the presence of FBS to give rise to the p35 form. These dimeric forms are called PDGF DD.

Example 18. 30664188 in the presence of fetal bovine serum and calf serum
Gene Product Processing 30664188 gene products were incubated in the presence of increasing concentrations of calf serum (Figure 16, panel A) or fetal calf serum (panel B). These results indicate that fetal bovine serum (panel B) alone is the p85 of the 30664188 gene product.
It was demonstrated that the morphology was processed to yield p35 but not calf serum (panel A).

[0438]   (Example 19: Induction of DNA synthesis)   This example demonstrates the ability of PDGF DD to induce DNA synthesis.

Various cells were cultured in 96-well plates to approximately 100% confluence, washed, fed DMEM, and starved for 24 hours. Then recombinant P
18 DGF DD, PDGF AA, or PDGF BB at the indicated concentrations
Time added to cells. In some examples, the cells are untreated or 10
Treated with% FBS. BrdU assay was performed by the manufacturer (Roche Molecu).
Lar Biochemicals, Indianapolis, IN) using a BrdU integration time of 5 hours.

In human CCD1070 foreskin fibroblasts, p35 was determined to induce DNA synthesis at half maximum concentration of approximately 20 ng / ml (FIG. 17A). In contrast, p85 did not induce outgoing DNA synthesis up to a concentration of 100 ng / ml. Relatively, PDGF AA and PDGF BB were about 5 and 8 ng / m, respectively.
Half of the maximum DNA synthesis of 1 was induced. PDGF DD and PDGF BB induced similar DNA synthesis at the highest dose, whereas PDGF AA was 4-fold less potent.

In NIH3T3 embryonic lung fibroblasts, p35 induced DNA synthesis at a half maximal concentration of approximately 20 ng / ml (FIG. 17B). In contrast, p85 did not induce DNA synthesis integration at concentrations up to 1 μg / ml (FIG. 17B), p35 or PDGF
It did not block BB-induced DNA synthesis.

P35 also induced DNA synthesis in various human cells (MG-63 osteosarcoma cells and primary smooth muscle cells). This suggests that PDGF DD is a latent growth factor whose activity depends on proteolytic dissociation from the CUB-containing region of the PDGF core domain.

Example 20 Cell Proliferation This example demonstrates that PDGF DD can sustain cell growth. NIH3T3 fibroblasts are cultured in 6-well plates to approximately 35% confluence, washed with DMEM, and then starved for 8 hours. The cells are then
Recombinant PDGF DD, PDGF AA, or PDGF BB (200 ng /
ml) or DMEM supplemented with 5% FBS. Growth factors were added 24 hours later and after trypsinization Beckman Coulte.
r Z1 Series Counter (Beckman Coulter, Fuller
ton, CA).

PDGF DD had an approximately 2-fold increase in NIH3T3 cell number after day 1 and an approximately 4-fold increase after day 2 compared to untreated cells. This increase in proliferation is due to P
Similar to the increase in DGF AA and PDGF BB (Fig. 17C). PDGF
DD can also sustain growth of CCD1070 fibroblasts, and cells of some smooth muscle types for several days, and when used in combination with PDGF BB, slightly increased the growth rate of NIH3T3 cells. Increase.

Example 21 PDGF Receptor Tyrosine Phosphorylation This example demonstrates the ability of PDGF D to bind to the PDGF receptor.

NIH3T3 fibroblasts were serum starved, then 200 ng / ml P2.
Treatment with DGF DD, PDGF AA or PDGF BB for 10 minutes. The cells were washed once with PBS, 100 μM sodium orthovanadate. Whole cell lysate was treated with RIPA buffer [50 mM Tris-HCI, pH 7.4, 50 mM.
NaCl, 1.0% Triton X-100, 5 mM EDTA, 10 mM
Sodium pyrophosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, leupeptin (10
μg / ml) pepstatin (10 μg / ml), and aprotinin (1 μg / ml)
ml)], sonicated and incubated on ice for 30 minutes. The lysate was clarified by centrifugation at 15,000 xg for 10 minutes. The supernatant containing an equal amount of total protein was treated with anti-αPDGFR antibody or anti-βPDGFR antibody (
Santa Cruz Biotechnology; Santa Cruz
, CA, 5 μg) for 2 hours. Then 100 μl of 1: 1
The slurry of G protein agarose was added for 2 hours. Immune complex 3 times RI
Washed with PA buffer. SDS-PA containing 100 mM dithiothreitol
GE sample buffer was added and the samples were separated on a 4-15% SDS-polyacrylamide gel. Immobilon P membrane (Millipore
After electrophoretic transfer to Bedford, MA), the filter was replaced with TTBS (20
mM Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% Tw
een 20) Blocked with 3% non-fat milk. The membrane is then anti-α or βP
PDGFR antibody (1: 500) or anti-phosphotyrosine monoclonal antibody (
Upstate Biotechnology Inc. ; Lake Placi
d, NY, 1: 1000) for 1-2 hours in TTBS, 1% BSA, and washed 4 times with TTBS. The bound antibody was labeled with horseradish peroxidase (Boehringer Mannheim, Indiana).
goris anti-rabbit IgG conjugated to polis, IN) (whole molecule; 1: 2,000
0) or goat anti-mouse IgG (H &L; 1: 10,000) for 1 hour and then detected after washing 4 times with TTBS. Enhanced chemiluminescence (
(Amersham; Piscataway, NJ) was performed according to the manufacturer's protocol.

To investigate the possibility that PDGF DD could signal through α and / or βPDGFR, PDGFR autophosphorylation on tyrosine residues was examined after ligand treatment. NIH3T3 fibroblasts were serum starved and 10
Stimulation was performed with 0 ng / ml 3066, PDGF AA or PDGF BB for 10 minutes. The cells were washed once with PBS, 100 μM sodium orthovanadate. Whole cell lysate was treated with RIPA buffer [50 mM Tris pH 7.4, 50 mM.
NaCl, 1.0% Triton X-100, 5 mM EDTA, 10 mM sodium pyrophosphate, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, leupeptin (10 ug /
ml), pepstatin (10 ug / ml), and aprotinin (1 ug / ml)
], Sonication, and incubation on ice for 30 minutes. The lysate was clarified by centrifugation at 14,000 rpm for 10 minutes. Lysates containing equal amounts of total protein were treated with anti-αPDGFR antibody or anti-βPD
Incubated with GFR antibody for 2 hours. Next, 100 μl of a 1: 1 slurry of G protein agarose was added for 2 hours. The immune complex was washed 3 times with RIPA buffer. Dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer containing 100 mM dithiothreitol was added and the samples were fractionated on a 4-15% SDS-polyacrylamide gel. Im
After electrophoretic transfer to a Mobilon P membrane, the filter was transferred to TTBS (20 mM
Tris-HCl, pH 7.4, 150 mM NaCl, 0.05% Twee
n 20) Blocked with 3% non-fat milk. The membrane is then treated with anti-α or β PDGF
1 with R antibody (1: 1000) or anti-phosphotyrosine (1: 1000)
Incubated in TTBS, 1% BSA for 2 hours and washed 4 times with TTBS. The bound antibody was labeled with horseradish peroxidase (Amersham).
, Arlington Heights, IL) conjugated goat anti-rabbit I
gG (total molecule; 1: 10,000) or goat anti-mouse IgG (1: 10,000)
0) incubated for 30 minutes and then detected after washing 4 times with TTBS. Enhanced chemiluminescence (Amersham) was performed according to the manufacturer's protocol.

As shown in FIG. 17D, 1 of NIH3T3 fibroblasts on PDGF DD.
A 0 minute exposure induces tyrosine phosphorylation of α and β PDGFR. The phosphorylation observed was identical to that observed after PDGF BB treatment. As expected, PDGF AA induces only αPDGFR phosphorylation,
The specificity of this assay was confirmed. PDGF DD (like PDGF BB but not PDGF AA) is also H-expressing only βPDGFR.
It can induce tyrosine phosphate of βPDGFR in 157 cells (K. Fors).
Berg, J .; Bergh, B.A. Westermark, Int. J. Canc
er 53, 556-560 (1993)). These data are PDGF D
D (as well as PDGF BB) stimulates cell growth and proliferation by activation of both αPDGFR and βPDGFR.

Example 22.306664188 p85 Competition with Other Growth Factors Inducing Growth of NIH / 3T3 Cells NIH3T3 cells were treated with PDGF BB alone in 30664188 p35.
Alone, with p35 in the presence of 100-fold increasing concentrations of p85, or 100
Incubated with PDGF BB (left to right in Figure 18) in the presence of fold increasing concentrations of p85. Cell growth was determined by BrdU integration assay.
30664188 p35 alone and PDGF BB alone stimulate deeper growth of NIH3T3 cells than occurs by starving the cells (FIG. 18,
left). It is shown that p85 has no effect on growth induced by any of these growth factors, even at very high concentrations of 5000 ng / mL. Therefore, p85, which is a dimer of the full-length gene product, is associated with p35 and PDGF.
It has no affinity for the receptor (s) to which BB binds. In this experiment, the processing of p85 to p35 was 30664188.
We show that the gene product is a prerequisite for its activity.

Example 23 Differential Gene Expression Induced by Treatment with Growth Factors GeneCalling ^™ reaction was performed for 3 hours at 200 ng PDGF DD, PD.
GF BB, PDGF AA or control buffer (20 mM Tris
-HCI, pH 7.5, 50 mM NaCl) on CCD1070 primary human foreskin fibroblasts. GeneCalling ^™ analysis is described in US Pat. No. 5,871,697, and Shimkets et al. , "G
ene expression analysis by transcrib
t profiling coupled to a gene database
se query "Nature Biotechnology 17: 19
8-803 (1999), which is incorporated herein by reference in its entirety.

Three identical samples were prepared for each treatment. Trizol (L
if Technologies, Inc. Rockville MD), and prepared poly (A) + mRNA. cDNA to Superscr
Synthesized using ipt II (Life Technologies, Inc.) and then digested with 48 separate pairs of 6 bp recognition site restriction endonucleases. The restriction fragment was then tagged with both biotin and fluorescent label and amplified by PCR for 20 cycles. The resulting products from the individual digests were separated on a streptavidin column and the fragments containing both restriction enzyme recognition sites were eluted and these were run on the MegaBase instrument (Molec).
Uranular Dynamics; Sunnyvale, CA) and resolved by capillary electrophoresis. Trace data output to Open Genome Init
iative software suit (Shimckets et al., (199
9). ) And differentially expressed peaks and vehicle controls between each treatment were identified using the GeneScape ™ data analysis suite. Putative genes for each of the differentially expressed fragments were assigned using the size determined for each fragment as well as the 12 bp known sequence pre-determined by the presence of terminal restriction sites. Gene assignment was confirmed by database lookup using the oligonucleotide poisoning described above. Oligonucleotide poisoning is described in US patent application Ser. No. 09 / 381,779 (1
Filed Aug. 7, 999) and in Shimkets et al. (1999), incorporated herein by reference.

Fragmentation of the cDNA with 48 pairs of restriction enzymes is approximately 85%, or 19,000 individual gene fragments of the CCD1070 toranscriptme (R. Shimkets et al., (1999)).
Brought an overview of. As shown in FIG. 19A, 301 gene fragments (
It was found that at least one treatment differentially regulated (representing 1.6% of all expressed genes) (more than ± 2 fold, shaded or shaded boxes). Was issued. PDGF AA demonstrated the most restricted activity and altered the expression of only 57 gene fragments (FIG. 19A; 0.3% of expressed fibroblast genes). PDGF DD and PDGF BB regulated gene fragments of 209 (1.1% of expressed genes) and 289 (1.5% of expressed genes), respectively. Of all the detected gene fragments, 237 (
78.5%) was upregulated in the assayed treatments, so that all PDG
The F protein showed a preferential inducing effect on transcription (Figure 19A).

Surprisingly, of the 209 gene fragments regulated by PDGF DD, 199 were similarly affected by PDGF BB (FIG. 19A). As shown in FIG. 19B, genes regulated by both PDGF DD and BB include secreted cytokines / chemokines (eg, vascular endothelial growth factor (V
EGF), IL-11, pre-B cell enhancing factor, monocyte chemoattractant protein (MCP-
1)), receptors (eg IL-1 receptors), proteases and protease inhibitors (eg plasminogen activator inhibitor 1)
, Signal transduction modules / transcription factors (eg guanylate binding protein 1
And adenosylmethionine decarboxylase), and substrate-related proteins. Moreover, PDGF BB differentially regulated an additional 90 gene fragments, but was not significantly affected by PDGF DD (<±
2 times). Examples of genes that are preferentially induced by PDGF BB include, for example, plasminogen activator inhibitor-2, progressive (progressio).
n) Related proteins, glycerol kinase, and aminopeptidase N / C
D13 is mentioned. These results indicate that PDGF DD and PDGF BB share a similar signaling mechanism, suggesting that they signal through the same receptor (Fambrough D, Mc.
Clure K, Kazlauskas A, L .; ES, Cell 97, 72
7-741 (1999)).

Example 24. Competitive Growth of CCD1070 Cells in Response to Growth Factors in the Absence or Presence of Receptor Antibodies CCD1070 cells were treated with 30664188, PDGF AA or PDGF.
Incubated in the presence of the purified p35 form of BB. In each case, the growth factor is incubated with itself, or with a non-specific antibody (Rab), or with an αPDGF receptor (αRab) specific antibody, a βPDGF receptor (βRab) specific antibody, or both. Incubated in the presence of specific antibody. Specific antibody is from R & D Sustems and
Added at g / ml. Cell growth was monitored using an ELISA assay specific for BrdU incorporation by determining BrdU incorporation.

The results are shown in FIG. It can be seen that in the presence of p35, BrdU incorporation is reduced by co-incubation with anti-βPDGF receptor or with a mixture of both specific antibodies. The same pattern is
Observed in PDGF BB-induced growth. On the other hand, PDGF AA
, Growth factor-induced growth is reduced in the presence of anti-αPDGF receptor antibody or in the presence of this mixture.

The results of this experiment showed that the active form of the 30664188 gene product, p35, was PDG.
We show that it preferentially or exclusively binds to the Fβ receptor and minimally or not at all to the α receptor.

Example 25. Stimulation of Pulmonary Artery Smooth Muscle Cell Growth by Growth Factors This example demonstrates the ability of PDGF DD to stimulate pulmonary artery smooth muscle cell growth.

3064188, pGF dimer of PDGF AA or PDGF BB, was added to pulmonary artery smooth muscle cells (Clontics) at various concentrations after culturing to about 35% confluence in 6-well plates, washed with DMEM, and I was starving overnight. After 18 hours BrdU was added and after 5 hours cells were analyzed for BrdU incorporation using a BrdU directed ELISA.

The results are shown in FIG. The maximal effect achieved by treatment with p35 dimer exceeds that produced by both PDGF AA and PDGF BB. As can be seen in Example 23, it can be seen that the effects of p35 dimer and PDGF BB more closely resemble each other than those obtained with PDGF AA. Of all three growth factors tested, p35 dimer induced maximal growth in smooth muscle cells as determined by BrdU integration, resulting in 50%.
The maximal effect was less than 12.5 ng / mL.

Example 26: Proliferation of Pulmonary Artery Smooth Muscle Cells in Response to Various Proliferative Treatments This example demonstrates the ability of PDGF DD to stimulate proliferation of pulmonary artery smooth muscle cells.

Pulmonary artery smooth muscle cells were cultured in 6-well plates to approximately 35% confluence, washed with DMEM, and starved overnight. The cells are then treated with recombinant 30664188, PDGF AA, or PDGF BB (20
0 ng / ml) or DMEM supplemented with 10% FBS for 3 days. The medium was removed and replaced with the same medium for an additional 2-3 days. To quantify the smooth muscle cell proliferation assay, cells were trypsinized and Beckm
an Coulter Z1 Series Counter (Beckman Coult
er, Fullerton, CA).

The results are shown in FIG. PDGF produces a moderate increase in cell number, while treatment with 30664188 provides almost twice the effect observed with PDGF as compared to controls. The positive control with treatment with 10% FBS gave a very pronounced effect. Treatment of smooth muscle cells with 30664188 and PDGF BB resulted in flat clots (cl) observed with serum.
In contrast to the ub) -shaped phenotype, it led to an elongated bipolar spindle-shaped phenotype.

30664188 is an effective stimulator of pulmonary arterial smooth muscle cell proliferation, 306
It is suggested that the 64188 and 30664188 antibodies have therapeutic use in wound healing, tissue repair and cartilage repair. In addition, antibodies directed against 30664188 may have therapeutic use in inhibiting or preventing restenosis of the patient's vasculature.

Example 27 Proliferation of Saphenous Vein Cells in Response to Different Proliferative Treatments This example demonstrates the ability of PDGF DD to stimulate proliferation in saphenous vein cells. Saphenous vein cells were treated and analyzed as described in Example 26.
The results are shown in FIG. PDGF appears to produce a slightly lower increase in cell number than with treatment with 30664188, which provides nearly a 5-fold expansion of cell number found in controls. The positive control using treatment with 10% FBS gave a very pronounced effect. 30664188 is an effective stimulant of saphenous vein cell proliferation, which is 30664188 and 30664188.
The antibodies are suggested to have therapeutic use in wound healing, tissue repair and cartilage repair. In addition, antibodies directed against 30664188 may have therapeutic use in inhibiting or preventing restenosis of the patient's vasculature.

Example 28: Inhibition of proliferation of NIH3T3 mouse cells This example demonstrates the ability of anti-30664188 antibody to inhibit proliferation of NIH3T3 cells. NIH3T3 fibroblasts are grown in the presence of 30664188 alone or in the presence of 30664188 in combination with increasing concentrations of antibody. 306
Either fully human polyclonal antibodies directed against 64188 or non-immune antibodies as controls were used. Polyclonal antibodies were obtained by methods such as those described above in the "Antibodies" section of the Detailed Description of the Invention.

The results are shown in FIG. 30664188 specific antibody is 30664
It appears to eliminate the proliferative effects induced by treatment with 188 alone. Treatment with non-immune antibodies does not result in any reduction in induced proliferation. The specific antibody has a 50% maximal effect at a concentration of about 500 ng / ml. In parallel experiments, anti-30664188 antibody has no effect on the proliferation of NIH / 3T3 cells induced by PDGF AA or PDGF BB.

Therapeutic applications for treatment with 30664188-specific antibodies include, for example, 30
Includes any pathology or disease in which growth stimulated by 664188 is advantageously inhibited or prevented. These pathologies include, for example, diseases related to the growth of the vasculature, inflammatory disorders (eg, arthritis), intestinal disorders, atherosclerosis, restenosis of the patent vascular structure, and various solid tumors. .

Other Embodiments The present invention is described in combination with the detailed description thereof, and the foregoing description is intended to exemplify the scope of the present invention defined by the appended claims. However, it is understood that it is not intended to limit the scope of the invention. Other aspects, advantages, and modifications are within the scope of the appended claims.

[Brief description of drawings]

FIG. 1 is an alignment of the amino acid sequence of clone 30664188.0.99 with the amino acid sequence of the human secretory growth factor-like protein VEGF-E amino acid sequence (SEQ ID NO: 24).

FIG. 2 shows that E. expressed in E. coli cells 30664188. FIG. 6 is a Western blot of m99 protein.

FIG. 3 shows that 30664188.Secreted by human 283 cells. FIG. 6 is a Western blot of m99 protein.

FIG. 4A is a schematic diagram of a scheme for recombinant production, purification and precise molecular weight of the mature form of the protein of clone 30664188.0.99.

FIG. 4B shows a diagram of 30664188. Includes diagrams of two Western blot analyzes showing expression of m99 polypeptide.

FIG. 5: BrdU NIH3T3 cells and CCD-10 in response to various treatments.
It is a graph which shows the integration in 70 cells.

FIG. 6 is a graph showing proliferation of NIH3T3 5-24 cells in response to various treatments.

FIG. 7: NIH3 exposed to mock treatment or 30664188.
It is a graph which shows the number of cells in T3 cell.

FIG. 8 is a micrograph showing cell density and cell morphology of NIH 3T3 cells in response to treatment with pCEP4sec CM or 30664188 protein.

FIG. 9 is a graph (photomicrograph) showing changes in the number of NHost osteoblasts in response to various treatments.

FIG. 10A shows 30664188.Expressed by HEK293 cells cultured in the absence of serum. FIG. 7 is a diagram of a Western blot of m99. FIG. 10B shows 30664188.expressed by HEK293 cells cultured in the presence of serum. m
FIG. 9 is an SDS-PAGE diagram of 99 proteins.

FIG. 11 is a schematic diagram of FIG. FIG. 8: Dose titration of BrdU incorporated into NIH3T3 cells stimulated with p85 fragment and m35 protein stimulated NIH3T3 cells.

FIG. 12 shows a comparison of core PDGF domains among PDGF family members. Human and mouse PDGF D-core PDGF domain
GFC, human PDGF B and human PDGF A core PDGF domain (
GenBank registration numbers: AAF80597, P01127 and P0, respectively
4085). Shadow constant cysteine residues. The asterisk
Conserved cysteine residues not present in PDGF D are shown.

FIG. 13 is a diagram of the nucleotide and deduced amino acid sequences of the human PDGF D gene. The human PDGF D genomic structure is also shown. The start and stop codons are boxed and the intron / exon boundaries are indicated by arrows.

FIG. 14 shows a diagram of Western blot and SDS-PAGE analysis of PDGF D. In panel A, pCEP4 / Sec (lane 1) or pCEP
From conditioned medium of HEK293 cells transiently transfected with 4 / Sec-PDGF D (lanes 2 and 3) and cultured in the presence (lane 3) or absence (lanes 1 and 2) of FBS. SDS the sample under reducing conditions
-Tested by PAGE and then immunoblot analysis using anti-V5 antibody.
In panel B, purified PDGF D from pCEP4 / Sec-PDGF D-transfected HEK293 cells cultured in the presence (lanes 3 and 4) or absence (lanes 1 and 2) of FBS was treated with SDS-PAGE. And were stained with Coomassie blue. Sample (+) using DTT
And (-) treated without. Molecular weight markers are shown on the left.

FIG. 15 shows a diagram of the fragments obtained from p35 and identified by N-terminal sequencing. In each panel, the black top sequence is the predicted sequence from the clone and the gray bottom sequence is the sequence obtained from N-terminal sequencing. The shaded shadow indicates the two fragments of p35. Horizontal shadows indicate the V5 epitope and vertical shadows indicate the 6His tag, both of which are in vector pCE.
It originates in P4 / Sec-30664188 (Example 4). In panel A, two sequences were identified, one beginning with GlyArg (these two residues are underlined) and a second beginning with the third residue Ser.

FIG. 16 is an SDS-PAGE diagram of the 30664188 gene product in the presence of fetal bovine serum (panel B) and calf serum (panel A). Lane 1 and lane 2 in each panel represent the reference 30664188 p35 alone or in the presence of serum, respectively. Lane 3 in each panel shows p85 in the absence of serum and lanes 4-6 show p85 in the presence of increasing concentrations of each serum.

FIG. 17 includes a diagram showing the biological activity of recombinant PDGF DD and PDGF receptor activation, including its effect on DNA synthesis and cell proliferation.
Panels A and B show BrdU incorporation assay. CCD1070 human (A
) Fibroblasts or NIH 3T3 mouse (B) fibroblasts were serum-starved, PDGF DD p35 (filled circles), PDGF DD p85 (filled triangles) P
Incubated with DGF BB (open triangles) or PDGF AA (filled squares) for 18 hours and analyzed by BrdU incorporation assay. Panel C shows a proliferation assay. NIH 3T3 cells were loaded with the indicated factors (symbols above) or 5
Incubated in serum-free medium supplemented with% calf serum (open circles) and counted at indicated time intervals. Panel D shows PDGFR activation in fibroblasts. NIH 3T3 fibroblasts were serum starved for 18 hours and PDGF
Incubation was for 10 minutes in the absence or presence of DD, PDGF AA, or PDGF BB (200 ng / ml). Whole cell lysates were then immunoprecipitated (designated IP) with antibodies directed against the α or β PDGF receptor (PDGFR), and anti-phosphotyrosine mAb (anti-PY), anti-αPD.
Western blot analysis was performed with GFR antibody or anti-βPDGFR antibody. The position of PDGFR is shown.

FIG. 18: 3066 against 30664188p85 competition with other growth factors that induce proliferation of NIH / 3T3 cells, and cell proliferation of NIH / 3T3 cells.
100-fold range of 3 in the presence of either 4188p35 or PDGF BB
It is a figure which shows the effect of addition of 0664188 p85.

FIG. 19 is a diagram of differential gene expression analysis after PDGF DD, PDGF BB, and PDGF AA treatment. In panel A, primary human foreskin fibroblasts were treated with PDGF DD, PDGF BB, PDGF AA or control buffer for 3 hours. Total RNA was harvested and subjected to GeneCalling (US Pat. No. 5,871,697 and R. Shimkets et al., N.
at. Biotechnol. 18, 798-803 (1999)). The number of cogene fragments induced (grey shaded box) or suppressed (grey shaded box) by each treatment is shown on the right. In panel B, P
Representative genes induced by DGF DD and PDGF BB are shown. Fold induction (gray shaded box) or suppression (gray lined box) is shown in each box.

FIG. 20: CC as a function of growth factor in the absence or presence of receptor antibody
It is a figure which shows the result of competition of proliferation of D1070 cell. 3 CCD1070 cells
Incubated in the presence of the p35 form of 0664188, PDGF AA or PDGF BB. In each case, the growth factor itself, the non-specific antibody (
Rab) with an antibody (αRab) or βP specific for the αPDGF receptor
Incubation was with antibodies specific for the DGF receptor (βRab) or in the presence of both specific antibodies.

FIG. 21 is a diagram of stimulation of proliferation of pulmonary artery smooth muscle cells by growth factors. Smooth muscle cells were purified p35 PDGF DD, PDGF AA or PDGF BB
The concentration of BrdU incorporated into the DNA was determined by treating the cells at the concentrations indicated by.

FIG. 22   FIG. 22 is a diagram showing the proliferation of pulmonary artery smooth muscle cells in response to various treatments.

FIG. 23   FIG. 23 is a diagram showing proliferation of saphenous vein cells according to various treatments.

FIG. 24. N-induced by 30664188 by treatment with specific antibodies.
FIG. 3 shows the neutralization of IH 3T3 mouse cell proliferation.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61K 45/00 A61P 7/02 4C084 48/00 7/04 4C085 A61P 7/02 7/06 4C086 7/04 9/10 4H045 7/06 25/00 9/10 29/00 25/00 35/00 29/00 37/04 35/00 37/06 37/04 43/00 105 37/06 107 43/00 105 111 107 C07K 14/485 111 14/49 C07K 14/485 14/51 14/49 16/18 14/51 16/22 16/18 C12N 1/15 16/22 1/19 C12N 1/15 1/21 1 / 19 C12P 21/02 C 1/21 H 5/06 C12Q 1/02 5/10 1/68 A C12P 21/02 G01N 33/15 Z 33/50 Z C12Q 1/02 33/53 D 1/68 M G01N 33/15 N 33/50 33/566 33/53 33/577 B C12P 21/08 C12N 15/00 ZNAA 33/566 5/00 A 33/577 E // C12P 21/08 A6 K 37/02 (31) Priority claim number 60 / 174,485 (32) Priority date January 4, 2000 (Jan. 4, 2000) (33) Country of priority claim United States (US) (31) Priority Right claim number 60 / 186,707 (32) Priority date March 3, 2000 (March 3, 2000) (33) Priority claim country United States (US) (31) Priority claim number 60 / 188,250 (32) Priority date March 10, 2000 (March 10, 2000) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 223,879 (32) Priority date 2000 August 8 (August 8, 2000) (33) Priority claiming country United States (US) (31) Priority claim number 09 / 662,783 (32) Priority date September 12, 2000 (2000.9) 12) (33) Priority claiming country United States (US) (31) Priority claim number 60 / 234,082 (32) Priority date September 20, 2000 (September 20, 2000) (33) Priority Claiming country United States (US) (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES , FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE) , SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR , LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, N , PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Harman, John El. United States Connecticut 06437, Guildford, Barnstrain 78 (72) Inventor Bordudge, Ferenc El. United States Connecticut 06473, North Haven, Jansen Lane 22 (72) Inventor Minskoff, Stacy United States Connecticut 06903, Stanford, Fairway Drive 57 (72) Inventor Jeffers, Michael United States Connecticut 06405, Branford, Flux Mill Hollow 14 F Term (reference) 2G045 AA34 AA35 BB14 BB20 BB50 BB51 CB01 DA13 DA36 FB02 FB03 FB05 FB07 FB08 4B024 AA01 AA11 BA03 BA63 CA04 CA09 GA11 HA01 HA14 HA15 HA17 4B063 QA01 QA18 QA19 QQ02 QQ43 QR55 QR62 QS34 4B064 AG13 AG27 CA19 CC24 DA01 DA05 DA06 DA07 4B065 AB01 BA02 CA24 CA44 CA46 4C084 AA02 AA06 AA07 AA13 AA17 BA01 BA08 BA22 BA23 DB55 DB57 DB60 MA01 NA14 ZA012 ZA402 ZA532 ZA542 ZA552 ZB022 ZB052 ZB082 ZB092 ZB082 AB07A01 A04 A04 A01 A04 A4 AA07 AA07 AA07 AA02 AA02 AA06 AA07 AA13 AA17 ZA53 ZA54 ZA55 ZB02 ZB05 ZB08 ZB09 ZB11 ZB21 ZB22 ZB26 4H045 AA10 AA11 AA20 AA30 CA40 DA20 DA50 DA76 EA21 EA22 EA27 EA28 EA50 FA74

Claims (85)

[Claims] 1. An isolated polypeptide comprising: a) an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10 and 12; b) SEQ ID NOs: 2, 4, A variant of an amino acid sequence selected from the group consisting of 6, 8, 10 and 12, wherein one or more of the amino acids specified in the selected sequence is changed to a different amino acid, provided that A variant in which 15% or less of amino acid residues in the amino acid sequence of the variant are changed; c) a mature form of the amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10 and 12. And d) a variant of the mature form of an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10 and 12, wherein the amino acid sequence identified in the selected sequence is: One or more different amino A variant, wherein 15% or less of the amino acid residues in the amino acid sequence of the mature form of the variant are altered; and e) fragments of the amino acid sequence described in a) to d), An isolated polypeptide comprising an amino acid sequence selected from the group consisting of: 2. The polypeptide of claim 1, wherein the polypeptide is a fragment of FCTRX polypeptide. 3. The polypeptide of claim 1, wherein the polypeptide is a naturally occurring allelic variant of SEQ ID NO: 2, 4, 6, 8, 10 or 12. 4. The polypeptide of claim 3, wherein the variant is a translation of a single nucleotide polymorphism in a nucleic acid encoding the polypeptide. 5. The polypeptide is a variant polypeptide comprising an amino acid sequence of SEQ ID NO: 2, 4, 6, 8, 10 or 12 and an amino acid sequence which differs by one or more conservative substitutions. The polypeptide according to 1. 6. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding the polypeptide of claim 1. 7. An isolated nucleic acid molecule comprising a nucleic acid sequence encoding the polypeptide of claim 2. 8. The nucleic acid molecule is SEQ ID NO: 2, 4, 6, 8, 10 or 12.
7. A nucleic acid molecule according to claim 6 comprising the nucleotide sequence of a naturally occurring allelic nucleic acid variant of a nucleic acid encoding a polypeptide comprising. 9. The nucleic acid molecule of claim 6, wherein the nucleic acid molecule encodes a variant polypeptide, wherein the variant polypeptide has the polypeptide sequence of a naturally occurring polypeptide variant. 10. The nucleic acid molecule of claim 6, wherein the nucleic acid molecule comprises a single nucleotide polymorphism that encodes the variant polypeptide. 11. The nucleic acid molecule as follows: a) a nucleotide sequence selected from the group consisting of SEQ ID NOS: 1, 3, 5, 7, 9 and 11; b) SEQ ID NOS: 1, 3, 5, 7, 9 A nucleotide sequence that differs from the reference nucleotide sequence selected from the group consisting of and 11 by one or more nucleotides, provided that no more than 20% of the nucleotides differ from the reference nucleotide sequence; c) the sequence described in a) 7. A nucleic acid fragment according to claim 6; d) a nucleic acid fragment of the sequence described in b); and e) the complement of any of a) to d), wherein the nucleotide sequence is selected from the group consisting of: Nucleic acid molecule. 12. The nucleic acid does not encode the full length FCTRX polypeptide,
The nucleic acid according to claim 11. 13. The nucleic acid molecule hybridizes under stringent conditions to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9 and 11 or a complement of the nucleotide sequence. The nucleic acid molecule according to claim 6. 14. A vector comprising the nucleic acid molecule according to claim 6. 15. A cell containing the vector according to claim 14. 16. An antibody that immunospecifically binds to the polypeptide of claim 1. 17. The antibody according to claim 16, which is a monoclonal antibody. 18. The antibody according to claim 16, which is a polyclonal antibody. 19. The antibody according to claim 16, which is a humanized antibody. 20. The antibody according to claim 18, which is a human antibody. 21. A method for identifying the polypeptide of claim 1 in a sample, the method comprising: (a) providing the sample; (b) claiming the sample. Contacting with an antibody that immunospecifically binds to the polypeptide according to item 1, (c) determining the presence or amount of the antibody bound to the polypeptide, and thereby the presence or amount of the polypeptide in the sample A method comprising the steps of: determining. 22. A method for identifying an agent that binds to the polypeptide of claim 1, comprising: (a) contacting the polypeptide with a candidate substance; and (b) ) Determining whether the candidate substance binds to the polypeptide, wherein the binding of the candidate substance to the polypeptide is a factor by which the substance binds to the polypeptide Showing the way. 23. The candidate material has a molecular weight of about 1500 Da or less,
23. The method of claim 22. 24. A method for modulating the activity of the polypeptide of claim 1, wherein the method comprises a compound that binds to the polypeptide in an amount sufficient to modulate the activity of the polypeptide. And a step of contacting the polypeptide with the method. 25. A method for identifying a therapeutic factor, the method comprising: (a) providing a cell expressing the polypeptide of claim 1; (b) testing the cell. Contacting with a factor; (c) determining whether the substance regulates an activity selected from the group consisting of DNA synthesis, protein translation, cell proliferation, and cell division, wherein: The method wherein altering the activity in the presence of the substance indicates that the factor is a therapeutic factor. 26. The candidate material has a molecular weight of about 1500 Da or less,
The method of claim 25. 27. The property or function comprises cell growth or proliferation.
27. The method of claim 26. 28. A therapeutic agent identified according to the method of claim 25. 29. The therapeutic agent of claim 28, having a molecular weight of about 1500 Da or less. 30. A therapeutic agent identified according to the method of claim 26. 31. The therapeutic agent according to claim 30, having a molecular weight of about 1500 Da or less. 32. A method of treating or preventing a disorder associated with the polypeptide of claim 1 in a subject, said method comprising: treating a subject in need of said treatment or prophylaxis according to claim 1; Administering a polypeptide in an amount sufficient and for a sufficient period of time to treat or prevent the protein-related disorder in the subject, wherein the subject is predisposed to the disorder or A method, which is considered to be suffering from the disorder. 33. The method of claim 32, wherein the subject is a human. 34. A method of treating or preventing a disorder associated with aberrant expression, aberrant processing, or aberrant physiological interactions of FCTRX polypeptides, wherein the disorder is a cell or tissue deficiency. 7. A method of administering to a subject the nucleic acid of claim 6 in a sufficient amount and for a sufficient period of time to treat or prevent the disorder in the subject. , Wherein the subject is considered prone to or suffering from the disorder. 35. The method of claim 34, wherein the subject is a human. 36. A method of treating or preventing a disorder associated with aberrant expression, aberrant processing, or aberrant physiological interactions of the polypeptide of claim 1, wherein the disorder is a cell or tissue. Wherein the method comprises the step of administering to the subject a therapeutic agent in an amount sufficient to treat or prevent the disorder in the subject, wherein the subject is Is prone to or suspected of suffering from the disorder. 37. The method of claim 36, wherein the therapeutic agent is an anti-FCTRX antibody. 38. The method of claim 37, wherein the subject is a human. 39. A pharmaceutical composition comprising the polypeptide of claim 1 and a pharmaceutically acceptable carrier. 40. A pharmaceutical composition comprising the nucleic acid molecule of claim 6 and a pharmaceutically acceptable carrier. 41. A pharmaceutical composition comprising the antibody of claim 16 and a pharmaceutically acceptable carrier. 42. A pharmaceutical composition comprising the therapeutic agent of claim 28 and a pharmaceutically acceptable carrier. 43. A pharmaceutical composition comprising the therapeutic agent of claim 30 and a pharmaceutically acceptable carrier. 44. A kit comprising the pharmaceutical composition of claim 40 in one or more containers. 45. A kit comprising the pharmaceutical composition of claim 41 in one or more containers. 46. A kit comprising the pharmaceutical composition of claim 42 in one or more containers. 47. A method for screening for modulators of latency or predisposition to disorders associated with aberrant expression, aberrant processing, or aberrant physiologic interactions of the polypeptide of claim 1. The method comprises: a) providing a test animal at high risk of the disorder, wherein the test animal recombinantly expresses the polypeptide of claim 1; b). Administering a test compound to the test animal; c) measuring the activity of the polypeptide in the test animal after the step of administering the compound in step (a); and d) the protein in the test animal. Comparing the activity with the activity of the polypeptide in a control animal that has not been administered the polypeptide; The method wherein the change in activity of the polypeptide in the test animal relative to the control is indicative of the test compound being a latency or predisposition modulator of the disorder. 48. The test animal is a recombinant test animal, and the test animal is
Expressing the test protein transgene at an increased level relative to a wild-type test animal or expressing the transgene under the control of a promoter, wherein the promoter is not the native gene promoter of the transgene, Item 47. The method according to Item 47. 49. A latency or predisposition modulator for a disorder associated with aberrant expression, aberrant processing, or aberrant physiological interactions of the polypeptide of claim 1. 50. A method for determining the presence or predisposition to a disease associated with altered levels of the polypeptide of claim 1 in a first mammalian subject, said method comprising: The following: a) measuring the expression level of the polypeptide in a sample from the first mammalian subject; and b) the amount of the polypeptide in the sample of step (a) Comparing to the amount of said polypeptide present in a control sample from a second mammalian subject that is not known or is not predisposed to said disease, wherein: , A change in the expression level of the polypeptide in the first subject as compared to the control sample is indicative of the presence of or predisposition to the disease. 51. A method for determining the presence or predisposition to a disease associated with altered levels of the nucleic acid molecule of claim 6 in a first mammalian subject, the method comprising: The following: a) measuring the amount of the nucleic acid in the sample derived from the first mammalian subject; and b) measuring the amount of the nucleic acid in the sample of step (a) without the disease. Or a step of comparing the amount of said nucleic acid present in a control sample from a second mammalian subject known not to have a predisposition to said disease, wherein said control sample The method wherein the altered expression level of the nucleic acid in the first subject as compared to is indicative of the presence of or predisposition to the disease. 52. A method of treating a pathological condition in a mammal comprising:
Wherein the pathology is associated with aberrant expression, aberrant processing, or aberrant physiological interactions of the polypeptide of claim 1, wherein the method comprises administering the polypeptide to the mammal, the pathological condition In a sufficient amount to reduce the amount of the polypeptide, wherein the polypeptide is at least 95% of the polypeptide comprising at least one amino acid sequence of SEQ ID NOs: 2, 4, 6, 8, 10 or 12. A method which is a polypeptide having the same amino acid sequence, or a biologically active fragment thereof. 53. A method of treating a pathological condition in a mammal comprising:
Wherein the pathology is associated with aberrant expression, aberrant processing, or aberrant physiologic interactions of FCTRX polypeptides, and the method in the mammal.
A method comprising the step of administering the antibody of claim 1 in an amount sufficient for ameliorating the pathological condition and for a sufficient period of time. 54. A method of promoting cell proliferation in a subject, the method comprising: administering to a subject the polypeptide of claim 1 in an amount and effective in promoting cell growth. A method comprising administering over a period of time. 55. The method of claim 54, wherein the polypeptide is the fragment of claim 2. 56. The method of claim 54, wherein the subject is a human. 57. A cell whose growth is to be promoted is a cell in the vicinity of a wound, a cell of vascular system, a cell involved in hematopoiesis, a cell involved in erythropoiesis, a cell wall of gastrointestinal tract,
55. The method of claim 54, selected from the group consisting of: and hair follicle cells. 58. A method of inhibiting cell growth in a subject, wherein said growth is associated with expression of a polypeptide of claim 1 and wherein said subject inhibits growth of said cell. A method comprising the step of administering an article. 59. The method of claim 58, wherein the composition inhibits FCTRX polypeptide cleavage in the subject. 60. The method of claim 59, wherein the composition comprises an anti-FCTRX antibody. 61. The method of claim 60, wherein the subject is a human. 62. The method of claim 61, wherein the cells whose growth is to be inhibited are selected from the group consisting of transformed cells, hyperplastic cells, tumor cells, and neoplastic cells. 63. Under conditions permitting the expression of FCTRX polypeptide, F
By culturing cells containing a nucleic acid encoding a CTRX polypeptide, FC
A method of producing a TRX polypeptide. 64. The method of claim 63, wherein the FCTRX polypeptide is further recovered. 65. A mammalian platelet-derived growth factor (PDGF) -like first polypeptide other than mammalian PDGF AA, mammalian PDGF BB, and mammalian PDGF CC, wherein the first polypeptide is Treated to yield a second polypeptide that is a fragment of the first polypeptide, and wherein the second polypeptide is: a) the second polypeptide binds platelet-derived growth factor receptor; b) the second polypeptide induces the growth of mammalian cells; and c) the second polypeptide induces the growth of mammalian cells; a poly-polysaccharide having at least one property selected from the group consisting of: peptide. 66. The method of claim 6, wherein the receptor is the PDGFβ receptor.
5. The first polypeptide according to item 5. 67. The first polypeptide of claim 65, wherein the mammalian cell is a smooth muscle cell. 68. The first polypeptide of claim 65, wherein said polypeptide comprises the polypeptide of claim 1. 69. The polypeptide fragment is residue 24 of SEQ ID NO: 2.
The polypeptide fragment of claim 2, comprising either the sequence set forth in 8-370 or the sequence set forth in residues 250-370 of SEQ ID NO: 2. 70. The polypeptide fragment comprises: a) the fragment binds platelet-derived growth factor receptor; b) the fragment induces growth of mammalian cells; and c) the fragment is mammalian cells. The polypeptide fragment of claim 2, having at least one property selected from the group consisting of: 71. An antibody that immunospecifically binds to the second polypeptide of claim 65 and inhibits the selected property. 72. An antibody that immunospecifically binds to the polypeptide fragment of claim 69. 73. An antibody that immunospecifically binds to the polypeptide fragment of claim 70 and inhibits the selected property of claim 70. 74. The 71, 72, or 7 which is a polyclonal antibody.
The antibody according to 3. 75. The method of claim 71, 72 or 7 which is a monoclonal antibody.
The antibody according to 3. 76. The antibody of paragraphs 71, 72, or 73 which is a fully human antibody. 77. A method of promoting the growth of mammalian cells, the method comprising the steps of:
66. A method comprising contacting with a CTRX polypeptide or the polypeptide of claim 65. 78. A method of promoting the growth of mammalian cells, the method comprising the step of:
66. A method comprising contacting with a CTRX polypeptide or the polypeptide of claim 65. 79. The method of claim 77 or 78, wherein the cells are smooth muscle cells. 80. A method of inhibiting the growth of a mammalian cell comprising contacting said cell with a composition comprising the antibody of claim 71, 72 or 73. 81. A method of inhibiting the growth of mammalian cells, the method comprising contacting said cells with a composition comprising the antibody of claim 71, 72 or 73. 82. The method of claim 80 or 81, wherein the cells are smooth muscle cells. 83. A nucleic acid comprising a sequence encoding the first polypeptide of claim 65. 84. A nucleic acid comprising a sequence encoding the polypeptide fragment of claim 69. 85. A method for determining the presence or amount of a nucleic acid molecule in a sample, said method comprising: (a) providing said sample; (b) said sample. Contacting with a probe that binds to a nucleic acid molecule according to claim 1, and (c) determining the presence or amount of the probe bound to the nucleic acid molecule, thereby determining the presence or amount of the nucleic acid molecule in the sample, A method including a step.