JP2003529334A - Proteins and polynucleotides encoded by them - Google Patents

Abstract

(57) The present invention provides novel polypeptides, referred to as MBSPX polypeptides, and polynucleotides encoding MBSPX polypeptides, and MBSPX or MBSPX polypeptides, polynucleotides, or antibodies, or derivatives, modifications thereof. Antibodies that immunospecifically bind to a body, variant, or fragment are provided. The invention further provides methods wherein the MBSPX polypeptides, polynucleotides, and antibodies are used in the detection and treatment of a wide variety of pathological conditions, and in other applications.

Description

Detailed Description of the Invention

FIELD OF THE INVENTION The present invention relates generally to polynucleotides and polypeptides. The invention more particularly relates to polynucleotide sequences and membrane-bound or secreted proteins encoded by such polynucleotides, as well as vectors, host cells, antibodies and recombinant methods for producing the polypeptides and polynucleotides. Regarding

BACKGROUND OF THE INVENTION Eukaryotic cells are subdivided by membranes into multiple functionally distinct compartments called organelles. Each organelle contains proteins essential for its proper function. These proteins may contain sequence motifs, often referred to as selection signals. This sorting signal may help the proteins target their appropriate cellular organelles. Furthermore, the sorting signal can direct that some proteins are exported (ie, secreted) from the cell.

One type of sorting signal is the signal sequence. (This is also referred to as the signal peptide or leader sequence.) This signal sequence exists as an amino-terminal extension on the newly synthesized polypeptide chain. Signal sequences target proteins to intracellular organelles called the endoplasmic reticulum (ER).

This signal sequence participates in arrays of protein-protein and protein-lipid interactions, resulting in translocation of the polypeptide containing the signal sequence through channels in the ER. After translocation, a membrane-bound enzyme (signal peptidase) releases the mature protein from the signal sequence.

The ER functions to separate membrane-bound and secreted proteins from proteins that remain in the cytoplasm. Once targeted to the ER, both secreted and membrane-bound proteins can be further distributed to another cellular organelle called the Golgi apparatus. The Golgi is responsible for proteins such as vesicles, lysosomes, plasma membrane,
Directs to mitochondria and other cellular organelles.

Only a limited number of genes encoding human membrane-bound and secreted proteins have been identified. Examples of known secretory proteins include human insulin, interferon, interleukin, transforming growth factor β,
Includes human growth hormone, erythropoietin, and lymphokines. There is a need to identify and characterize additional novel human secreted proteins and the genes that encode them.

SUMMARY OF THE INVENTION The present invention is based, in part, on the discovery of novel polynucleotide sequences and membrane-bound or secreted polypeptides encoded by these sequences. These human nucleic acids and the polypeptides encoded by them are referred to herein as
Collectively called "MBSPX".

Accordingly, in one aspect, the invention provides an isolated nucleic acid molecule that encodes a novel polypeptide, or a fragment, homolog, analog, or derivative thereof. For example, the nucleic acid is SEQ ID NO: 2n, where n is 1-11.
Nucleic acid sequence that encodes a polypeptide that is at least 85% identical to a polypeptide that comprises an amino acid sequence of), or a fragment, homolog, analog, or derivative thereof. The nucleic acid is, for example, genomic DNA.
It may include one or more fragments from, or cDNA or RNA molecules. In a particular embodiment, the nucleic acid molecule can comprise the sequence of any of SEQ ID NOs: 2n-1 (where n is an integer between 1-11). These polypeptides and nucleic acids relate to membrane-bound or secreted proteins, as disclosed herein.

Also included within the scope of the invention are vectors that include one or more of the nucleic acids described herein, and cells that include the vectors or nucleic acids described herein.

The invention also relates to host cells transformed with a vector containing any of the nucleic acid molecules described above.

In another aspect, the invention includes a pharmaceutical composition comprising an MBSPX nucleic acid and a pharmaceutically acceptable carrier or diluent.

In a further aspect, the invention includes a substantially purified MBSPX polypeptide (eg, any MBSPX polypeptide encoded by an MBSPX nucleic acid, fragments, homologs, analogs, and derivatives thereof). The present invention also includes pharmaceutical compositions that include the MBSPX polypeptide and a pharmaceutically acceptable carrier or diluent.

In yet a further aspect, the invention provides an antibody that specifically binds to an MBSPX polypeptide. The antibody can be, for example, a monoclonal or polyclonal antibody, and fragments, homologs, analogs, and derivatives thereof. The present invention also includes pharmaceutical compositions that include the MBSPX antibody and a pharmaceutically acceptable carrier or diluent. The present invention also relates to an isolated antibody that binds to an epitope on a polypeptide encoded by any of the above nucleic acid molecules.

[0014]   The invention also includes a kit containing any of the pharmaceutical compositions described above.

The invention further provides MBSPX nucleic acids (eg, vectors containing MBSPX nucleic acids).
By providing a cell containing the MBSP and culturing the cell under conditions sufficient to express the MBSPX polypeptide encoded by the nucleic acid.
Methods for producing an X polypeptide are provided. The expressed MBSPX polypeptide is then recovered from the cells. Preferably, the cells produce little or no endogenous MBSPX polypeptide. The cell can be, for example, a prokaryote or a eukaryote.

The invention also includes contacting the MBSPX polypeptide or nucleic acid in a sample with a compound that specifically binds to the polypeptide or nucleic acid, and forming a complex, if present. It relates to a method of identifying by detecting.

The present invention further identifies a compound that modulates the activity of an MBSPX polypeptide by contacting the MBSPX polypeptide with a compound, and the MBS
Methods are provided for determining whether the activity of a PX polypeptide has been modified.

The invention also provides a nucleic acid molecule that contacts an MBSPX polypeptide with the compound and that modulates the activity of the MBSPX polypeptide, binds to the MBSPX polypeptide, or encodes the MBSPX polypeptide. It relates to compounds that modulate the activity of MBSPX polypeptides identified by determining if they bind.

In another aspect, the invention provides methods for determining the presence of or predisposition to an MBSPX-related disorder in a subject. The method is
Providing a sample from the subject and measuring the amount of MBSPX polypeptide in the subject sample. The amount of MBSPX polypeptide in the subject's sample is then determined by the M in the control sample.
The amount of BSPX polypeptide is compared. M in the subject protein sample
MB in control protein sample in amount of BSPX polypeptide
Alterations relative to the amount of SPX polypeptide indicate that the subject has a pathology associated with dysfunction in the immune system, a tissue growth associated condition, or a neurological disorder. Control samples are preferably matched individuals (ie, individuals of similar age, sex, or other condition, but with pathologies associated with dysfunction in the immune system, tissue growth-related conditions, or neurological disorders). Then unidentified individuals). Alternatively, the control sample may be obtained from the subject at a time when the subject is not suspected of having a pathology associated with dysfunction in the immune system, tissue growth-related condition, or neurological disorder. In some embodiments, MBSPX polypeptides are detected using MBSPX antibodies.

In a further aspect, the invention provides a method of determining the presence of, or predisposition to, an MBSPX-related disorder in a subject. The method includes providing a nucleic acid sample (eg, RNA or DNA, or both) from a subject, and measuring the amount of MBSPX nucleic acid in the subject's nucleic acid sample. The amount of MBSPX nucleic acid sample in the subject nucleic acid is then compared to the amount of MBSPX nucleic acid in the control sample. A change in the amount of MBSPX nucleic acid in the sample compared to the amount of MBSPX in the control sample indicates that the subject has a pathology, tissue growth associated condition, or neurological disorder associated with dysfunction in the immune system. Indicates.

[0021] In a still further aspect, the invention provides methods for treating or preventing or delaying MBSPX-related disorders. The method comprises providing to a subject for whom such treatment or prevention or delay is desired an MBSPX nucleic acid, an MBSPX polypeptide,
Alternatively, the method comprises administering the MBSPX antibody in an amount sufficient to treat, prevent, delay a pathology, tissue growth-related condition, or neurological disorder associated with dysfunction in the immune system in the subject.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and not intended to be limiting.

Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides novel polypeptides and the nucleotides encoded thereby. The present invention includes 11 novel nucleic acid sequences and polypeptides encoded thereby. These sequences are collectively referred to as "MBSPX nucleic acid" or "MB
"SPX polynucleotides" and the corresponding encoded polypeptides are referred to as "MBSPX polypeptides" or "MBSPX proteins". Unless otherwise indicated, "MBSPX" is meant to refer to any of the sequences disclosed herein.

Table 1 provides a summary of MBSPX nucleic acids and their encoded polypeptides.

Column 1 of Table 1 shows the MBSPX number assigned to the nucleic acid according to the invention, entitled "MBSPX No.".

Column 2 of Table 1 is titled "Clone Identification Number" and provides the second identification number for the indicated MBSPX.

Column 3 of Table 1 shows the MBSP, labeled "Tissue of Clone Origin"
X shows the tissue in which the nucleic acid is expressed.

Columns 4-9 of Table 1 provide structural information as shown for the MBSPX nucleic acids and polypeptides shown.

Column 10 of Table 1 is labeled MBSPX, labeled "Protein Similarity".
List previously described proteins related to polypeptides encoded by: GenBank identifications for the previously described proteins are given. These can be found, for example, at http: // www. ncbi. nlm. nih
． It is possible to search from gov /.

Column 11 of Table 1 is entitled "Signal Peptide Cleavage Site" and is
The deduced amino acid position at which the signal peptide is cleaved as determined by IP is shown.

Column 12 of Table 1 shows the putative cellular localization of the MBSPX polypeptide shown, entitled "Cellular Localization".

[0033]

[Table 1] Table 2 gives the citations for the assigned MBSPX numbers, clone identification numbers and sequence identification numbers (SEQ ID NO).

[0034]

[Table 2] The MBSPX nucleic acids and polypeptides encoded by them according to the present invention include:
It is useful in a variety of applications and connections. The various MBSPX nucleic acids and polypeptides according to the present invention are useful, among other things, as novel members of a family of proteins subject to the presence of domains and sequence relatedness to previously described proteins.

For example, the MBSP1 and MBSP2 nucleic acids and the polypeptides encoded by them are derived from the Ig / fibronectin type III repeat family (particularly Ig / fibronectin III, which is regulated by CDO, transgenes, sera, and scaffolds).
It contains structural motifs characteristic of proteins belonging to the type repeat family). CDO is a cell adhesion molecule (CAM) of the Ig superfamily,
It is down-regulated by serum stimulation of confluent resting cells and constitutively down-regulated in cells transformed with the transgene. Ig / fibronectin type III family members are, for example,
Loss of protein expression of at least one Ig superfamily member (DCC) in colorectal tumors, which can function as a tumor suppressor, is a negative prognostic marker of survival in patients with stage II and stage III disease. Is. Another Ig superfamily member (C-CAM / BGP-1) is
Ectopic repair, down-regulated in colorectal and prostate malignancies and its expression, suppressed the tumorigenicity of such tumor-derived cell lines. Thus, the MBSP1 and MBSP2 nucleic acids and polypeptides, antibodies and related compounds of the invention are useful in therapeutic applications related to various cancers. In addition, CAMs play a role in controlling cell proliferation, and thereby CAMs may be involved in inducing and / or maintaining a tumorigenic phenotype. Thus, the MBSP1 and MBSP2 nucleic acids and polypeptides, antibodies and related compounds according to the invention are useful in the treatment of malignant tumors and pre-malignant conditions.

Members of the Ig / fibronectin type III repeat family (eg neural cell adhesion molecule (N-CAM), L1, F11 / contactin).
), Etc.) are also involved in developmental processes of the nervous system, including cell migration, axon outgrowth, and axon guidance and fasciculation. DCCs can also function as receptors or components of receptors for Netulin-1 (a secreted protein, a membrane-associated protein that acts as an inducing cue to move axons into the developing nervous system). Accordingly, the MBSP1 and MBSP2 nucleic acids and polypeptides, antibodies and related compounds of the invention are useful in treating a variety of neurological disorders, such as Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis and psychiatric disorders. Useful in applications.

MBSP3 nucleic acids and encoded polypeptides contain structural motifs characteristic of proteins belonging to the ficolin family of proteins. Ficolin contains collagen-like and fibrinogen-like (FBG) sequences, and they have an overall structure similar to Cq1 and collectins. Ficolin plays an important role in innate immunity by binding to surface oligosaccharides of various microbial pathogens and assisting in initiating phagocytosis. Therefore,
The MBSP3 nucleic acids, polypeptides, antibodies and related compounds according to the invention are useful in treating dysfunctions in the immune system, such as autoimmune diseases, chronic inflammation, and acute inflammatory response disorders.

MBSP4 nucleic acids and encoded polypeptides contain structural motifs that are characteristic of proteins belonging to the neuroligin family of proteins. Neuroligin binds neurexins, thereby mediating cell-cell interactions between neurons. Neuroligins constitute a multigene family of brain-specific proteins with distinct isoforms that function in mediating the recognition process between neurons. Accordingly, the MBSP4 nucleic acids, polypeptides, antibodies and related compounds of the invention have therapeutic applications in a variety of neurological disorders (eg, Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis and neurological disorders). It is useful.

MBSP5 and MBSP6 nucleic acids and their encoded polypeptides contain structural motifs that are characteristic of proteins belonging to the plectin family of proteins. Plectins (intermediate filament-linking proteins) are commonly associated with the myofibrillar network in muscle cell membranes, nuclear membranes, and muscle, as well as semiadhesive patches in the skin. Plectins are essential for muscle and skin structural integrity and normal neuromuscular transmission. Plectin plays an important role in the post-traumatic glial response. Accordingly, the MBSP5 and MBSP6 nucleic acids, polypeptides, antibodies and related compounds of the invention are useful in treating trauma (eg, wounds and trauma created by stroke). Plectin is essential in maintaining the integrity of skin, skeletal muscle, and heart cell architecture. Plectin deficiency is
The abnormally constructed hemiadhesive plaques found in basal cell carcinoma can result, and changes in these adhesion structures can result in depressions around the tumor. Plectin deficiency is associated with muscular dystrophy and amyotrophic lateral sclerosis (EBS), and EBS-Ogna,
Associated with severe autosomal dominant skin blistering disease. Plectin is involved in localized trauma (microcore / multicore disease), typical of autosomal recessive forms of myopathy, and is important in maintaining cardiomyocyte architecture. Therefore, MBSP5 and MBSP of the present invention
6 nucleic acids, polypeptides, antibodies and related compounds, muscular dystrophy, EBS,
It is useful in treating cardiomyopathy and cancer.

The MBSP7 nucleic acid and the encoded polypeptide contain structural motifs characteristic of the human N33 protein. N33 is a candidate tumor suppressor gene that is silenced by methylation in many colon cancer cell lines and some primary colorectal tumors. Methylation of N33 was also confirmed by
It has been shown to occur in tiforme. Therefore, the MBS of the present invention
P7 nucleic acids, polypeptides, antibodies and related compounds are useful for various cancers or as diagnostic markers in the treatment of these cancers.

The MBSP8 nucleic acid and encoded polypeptide contain a structural motif characteristic of keratinocyte growth factor (KGF). Keratinocyte growth factor is a hairpin-binding member of the fibroblast growth factor (FGF) family (alternatively named FGF-7) that is expressed only in epithelial tissues from various tissues. KGF
Are key paracrine mediators of proliferation and differentiation in a wide variety of epithelial cells, including hepatocytes and gastrointestinal epithelial cells, type II lung cells, transitional urothelial cells and keratinocytes of fully stratified squamous epithelium. KGF is used in epithelial and mucosal (eg,
Acts as a cytoprotective agent against injuries (including the gastrointestinal tract, lungs, bladder, and hair follicles) (eg, radiation and chemotherapy-induced injuries). Therefore, the MBSP of the present invention
The 8 nucleic acids, polypeptides, antibodies and related compounds are useful in therapeutic applications for the treatment of inflammation, the repair of various tissues and organs, and the treatment of human epithelial malignancies.

MBSP11 nucleic acids and encoded polypeptides contain structural motifs characteristic of proteins of the nicotinamide nucleotide transhydrogenase family. Energy transfer nicotinamide nucleotide transhydrogenase is a membrane-bound enzyme that catalyzes the direct transport of hydride ions between NAD (H) and NADP (H) in a reaction coupled to transmembrane hydrogen ion transport. Tumor cells
It is often present in the ischemic microenvironment that impairs the growth of normal cells. To minimize intracellular acidification under these conditions, these cells may upregulate the hydrogen ion transport mechanism. Accordingly, the MBSP11 nucleic acids, polypeptides, antibodies and related compounds of the invention are useful in treating ischemic conditions and a variety of cancers, including malignant breast cancers and solid tumors.

(1. MBSP1. Clone 10354784.0.335, type III Ig /
Novel member of the fibronectin repeat family) According to the invention, MBSP1 nucleic acids and polypeptides are clones 103453.
84.0.335 nucleic acids and encoded polypeptide sequence. The polynucleotide of the present invention was identified as clone 10354784.0.335. 10354784.0.335 is a full-length clone of 3562 nucleotides and contains the entire coding sequence of the protein from nucleotides 728-2945 (also referred to herein as "10354784.0.335 protein"). This clone was originally obtained from pituitary gland tissue.

The nucleotide sequence of 10354784.0.3335 is reported in SEQ ID NO: 1. The deduced amino acid sequence of the 10354784.0.335 protein corresponding to the aforementioned nucleotide sequence is reported in SEQ ID NO: 2.

For 10354784.0.335, the nucleotide sequence disclosed herein was searched against the GenBank database using the BLASTN search protocol. The BLASTN search was performed on human CDO mRNA, 3986 bp (
GneBank registration number: AF004841) with 71% identity (632)
450) for the nucleotide.

A search in the publicly available GneBank database BLASTP is A
CC: O35158 rat CDO protein (1256aa) with 50% identity (265/525), and ACC: O14631 human CDO (1240aa).
) With 50% identity (259/518). DCO is a cancer regulatory, serum regulatory, and fixed regulatory member of the type III Ig / fibronectin repeat family (Kang et al., J. Cell Biol. 138 (1), 203-213 (
1997)). Based on homology, 10354784.0.335 protein and each homologous protein or peptide may share at least some activity.

10354784.0.3335 was searched against other databases using the SignalPep and PSort search protocols. 10354784
． 0.335 appears to have a cleavable amino-terminal signal peptide with a cleavage site between position 25 and position 26 (STA-EA). This protein most likely appears to be located on the plasma membrane. The estimated molecular weight is 80202.4 Daltons.

The 10354784.0.3335 nucleic acid and encoded polypeptide has the following sequence:

[0049]

[Chemical 1]

[0050]

[Chemical 2]

[0051]

[Chemical 3]

[0052]

[Chemical 4]

[0053]

[Chemical 5]

[0054]

[Chemical 6] (2. MBSP2. Clone 10354784.0.335.S3347A,
Novel member of the type III Ig / fibronectin repeat family MBSP2 nucleic acids and polypeptides according to the present invention are clone 10340347.
84.0.335. It includes the nucleic acid of S3347A and the encoded polypeptide sequence.

Clone 10354784.0.335. S3347A is a novel member of the type III Ig / figronectin repeat family. The polynucleotide of the present invention is clone 10354784.0.335. It has been identified as S3347A. 10354784.0.335. S3347A is a full-length clone of 3562 nucleotides and contains the entire coding sequence for the protein from nucleotides 728-2945 (also referred to herein as "10354784.0.335. Protein"). This clone was originally obtained from pituitary gland tissue.

10354784.0.335. The nucleotide sequence of S3347A is reported below. 10354784.0.3 corresponding to the above nucleotide sequence
35. The deduced amino acid sequence of the S3347A protein is reported below.

Nucleotide sequence of related sequence 10354784.0.3335 (disclosed in co-pending US Patent No. 60 / 159,231, filed October 13, 1999)
Was searched against the GneBank database using the BLASTN search protocol. A BLASTN search revealed that the sequence 10354784.0.335 is human C
It showed 71% identity to DO mRNA, 3986 bp (GenBank accession number AF004841) (450 to 632 nucleotides).

A search in the publicly available GneBank database BLASTP revealed that the protein encoded by the related sequence 10354784.0.335 was ACC: O.
35158 rat CDO protein (1256aa) with 50% identity (265
/ 525), and ACC: O14631 human CDO (1240aa) and 50
It showed a percent identity (259/518). DCO is a cancer-, serum-, and fixed-regulatory member of the type III Ig / fibronectin repeat family (K
ang et al. Cell Biol. 138 (1), 203-213 (1997)
)). 10354784.0.335 proteins and 10 based on homology
354784.0.335. The S3347A protein as well as each homologous protein or peptide may share at least some activity.

The related polypeptide sequence 10354784.0.335 was added to SignalPep.
And other databases were searched using the PSort search protocol. 10354784.0.335 is between position 25 and position 26 (STA-E
It seems to have a cleavable amino-terminal signal peptide with the cleavage site of A). This protein most likely appears to be located on the plasma membrane. The predicted molecular weight of the protein 10354784.0.335 is 80202.4 Daltons.

[0060]   10354784.0.335. The S3347 nucleic acid has the following sequence:

[0061]

[Chemical 7]

[0062]

[Chemical 8] 10354784.0.335. The encoded polypeptide of S3347A has the following sequence:

[0063]

[Chemical 9] This protein sequence shows the ORF also found at 10354784.0.335.

(3. MBSP3. Clone 17939072.0.47) The MBSP3 nucleic acid sequence and polypeptide according to the present invention are clone 1793.
9072.0.47 nucleic acid and encoded polypeptide sequence.

The polynucleotide of the present invention has been identified as clone 17939072.0.47. 17939072.0.47 is a full-length clone of 950 nucleotides and contains the entire coding sequence for the protein of nucleotides 83-602 (also referred to herein as the "17939072.0.47 protein"). This clone was originally obtained from different tissues including brain, adrenal gland, bone and osteosarcoma.

The nucleotide sequence of 17939072.0.47 is reported in SEQ ID NO: 5. The deduced amino acid sequence of the 17939072.0.47 protein corresponding to the aforementioned nucleotide sequence is reported in SEQ ID NO: 6.

The nucleotide sequence disclosed herein for 17939072.0.47 was searched against the GneBank database using the BLASTN search protocol. BLASTN search was performed on mouse adipocyte-specific mRNA, 1725
65% homology to bp (GenBank accession number M61737) (246
Nucleotides 161); Mouse Angiogenic 3 (Ang3) mRNA, 1530b
p (GenBank accession number AF113707) with 59% identity (24
0 nucleotides 272); and mouse ficolin B
6 for mRNA, 919 bp (GenBank accession number AF06321)
It showed 4% identity (264 nucleotides 169).

A search in the publicly available GneBank database BLASTP using the amino acid sequence of 173 amino acids was performed on human ficoline, 326 amino acids (SP
TREMBL-ACC: O00602) showed 53% identity (48 of 90 amino acids). Based on homology, the 17939072.0.47 protein and each homologous protein or peptide may share at least some activity.

For 17939072.0.47, the nucleotide and amino acid sequences disclosed herein were searched against other databases using the SignalPep and PSsort search protocols. 17939072.0.4
7 does not appear to have the amino terminal signal peptide. This protein most likely appears to be located in the lumen of lysosomes. Estimated molecular weight is 1994
It is 5.9 Dalton.

The 17939072.0.47 nucleic acid and encoded polypeptide has the following sequence:

[0071]

[Chemical 10]

[0072]

[Chemical 11] (4. MBSP4. Clone 21417374.0.9, human neurolysin 2 homolog) MBSP4 nucleic acids and polypeptides according to the present invention are clone 214173.
Includes 74.0.9 nucleic acid and encoded polypeptide sequence.

The polynucleotide of the present invention has been identified as clone 21417374.0.9. 21417374.0.9 is a 2523 nucleotide full-length clone containing the entire coding sequence of the secreted protein from nucleotides 1-2512 (also referred to herein as the "21417374.0.9 protein").
This clone was originally obtained from the pancreas.

The nucleotide sequence of 21417374.0.9 is reported in SEQ ID NO: 7. The deduced amino acid sequence of the 21417374.0.9 protein corresponding to the aforementioned nucleotide sequence is reported in SEQ ID NO: 8.

The nucleotide sequence disclosed herein for 21417374.0.9 was searched against the GneBank database using the BLASTN search protocol. BLASTN search for rat neurologin 2 mRNA, 3993
91% identity to bp (GenBank accession number U41662) (252
The three nucleotides 2311) are shown. The deduced amino acid sequence of 837 amino acids is
The publicly available GenBank database BLASTP was searched and 9 in the sequence of rat neurologin 2 (SPTREMBL-ACC: Q62888).
7% identical (837 of 837 amino acids). 214173 based on homology
The 74.0.9 protein and each homologous protein or peptide may share at least some activity.

The nucleotide and amino acid sequences disclosed herein for 21417374.0.9 were searched against other databases using the SignalPep and PSsort search protocols. 21417374.0.9 is
It appears to have a cleavable amino-terminal signal peptide with a cleavage site (GGA-QR) between position 14 and position 15. This protein most likely appears to be located on the plasma membrane. The estimated molecular weight is 91208.5 daltons.

The 21417374.0.9 nucleic acid and encoded polypeptide has the following sequence:

[0078]

[Chemical 12]

[0079]

[Chemical 13]

[0080]

[Chemical 14]

[0081]

[Chemical 15] (5. MBSP5. Clone 320779.0.59, a novel protein) The MBSP5 nucleic acid sequence and polypeptide according to the present invention are clone 3207.
Includes 791.0.59 nucleic acid and encoded polypeptide sequence.

The polynucleotide of the present invention is identified as clone 320779.1.0.59. 3207791.0.59 is a full-length clone of 1665 nucleotides and contains the entire coding sequence for the protein from nucleotides 77 to 1388 (also referred to herein as "3207791.0.59 protein").

The nucleotide sequence of 3207791.0.59 is reported in SEQ ID NO: 9. The deduced amino acid sequence of the 3207791.0.59 protein corresponding to the aforementioned nucleotide sequence is reported in SEQ ID NO: 10.

For 3207791.0.59, the nucleotide sequence disclosed herein was searched against the GneBank database using the BLASTN search protocol. The BLASTN search is based on the human clone A9A2BRB7 (CAC) n
/ (GTG) n repeat-containing mRNA, 1047 bp (GenBank accession number U0
982) 98% homology (505 of 513 nucleotides at the 3'end)
showed that. The nucleic acid sequence is also plectin, 14189 bp (GENBANK-a
cc: Z54367) showing 56% identity (641 nucleotides 362) to the human gene.

A search in the publicly available GneBank database BLASTP using the amino acid sequence of 437 amino acids showed no significant homology to known proteins.

For 320779.1.0.59, the nucleotide and amino acid sequences disclosed herein were searched against other databases using the SignalPep and PSsort search protocols. 320779.1.0.59 does not appear to have the amino terminal signal peptide. This protein most likely appears to be located in the small retina. The estimated molecular weight is 47136.5 daltons.

The 3207791.0.59 nucleic acid and encoded polypeptide have the following sequences:

[0088]

[Chemical 16]

[0089]

[Chemical 17]

[0090]

[Chemical 18]

[0091]

[Chemical 19] (6. MBSP6. Clone 3207791.0.128, a novel secreted protein) MBSP6 nucleic acids and polypeptides according to the present invention are cloned in clone 320779.
1.0.128 of the nucleic acid and encoded polypeptide sequence.

The polynucleotide of the present invention is identified as clone 3207791.0.128. 3207791.0.128 is a 2739 nucleotide full-length clone containing the entire coding sequence of the protein from nucleotides 670 to 2275 (
Also referred to herein as "3207791.0.128 protein").

3207791.0.128 and 3207791.0.59 appear to splice variants. Nucleotides 4-11 of 3207791.0.128
33; 2017-2552 and 3207791.0.59 nucleotides 1-
1108; 1129-1665 are 99.88% identical; 3207791.
0.128 amino acids 1-155 and 450-535 and 3207791
． Nucleotides 197-351 and 352-437 of 0.59 are 99.58.
5% identical.

The nucleotide sequence of 3207791.0.128 is reported in SEQ ID NO: 11. The deduced amino acid sequence of the 3207791.0.128 protein corresponding to the aforementioned nucleotide sequence is reported in SEQ ID NO: 12.

For 3207201.0.128, the nucleotide sequence disclosed herein was searched against the GneBank database using the BLASTN search protocol. The BLASTN search is based on the human clone A9A2BRB7 (CAC)
n / (GTG) n repeat-containing mRNA, 1047 bp (GenBank accession number U
It showed 98% homology (1042 nucleotides 1029) to 00952). The amino acid sequence of 535 amino acids showed no significant homology to known proteins.

For 3207201.0.128, the nucleotide and amino acid sequences disclosed herein were searched against other databases using the SignalPep and PSsort search protocols. 3207791.0.12.
8 appears to have a cleavable amino-terminal signal peptide with a cleavage site mostly between position 22 and position 23 (GLS-ES). This protein appears to be most located outside the cell. The estimated molecular weight is 60290.7 Daltons. 3207791.0.128 most likely appears to be a secreted protein.

The 3207791.0.128 nucleic acid and encoded polypeptide has the following sequence:

[0098]

[Chemical 20]

[0099]

[Chemical 21]

[0100]

[Chemical formula 22]

[0101]

[Chemical formula 23] (7. MBSP7 clone 3499605.064, homologue to tumor suppressor gene N33) MBSP7 nucleic acid sequences and polypeptides according to the present invention are clone 3499.
Includes 605.064 nucleic acids and encoded polypeptide sequence.

The polynucleotide of the present invention is identified as clone 3499605.064. 3499605.064 is a full-length clone of 681 nucleotides,
Contains the entire coding sequence of the protein from nucleotides 43-463 (herein ""
3499605.0.64 protein "). This clone was originally obtained from pituitary gland tissue.

The nucleotide sequence of 3499605.064 is reported in SEQ ID NO: 13. The deduced amino acid sequence of the 3499605.064 protein corresponding to the aforementioned nucleotide sequence is reported in SEQ ID NO: 14.

The search in the publicly available GneBank database BLASTP is 1
The amino acid sequence of 40 amino acids has a protein (335aa) (A)
It is 75% identical (100/132) to the sequence of CC: O35777) and 72% homologous (89/122) to the sequence of human N33 protein (348aa) (ACC: Q13454). Indicated. N33 has chromosome 8p
22 is a candidate tumor suppressor gene located on 22 and was found to be silenced by the methylation machinery in many colon cancer cell lines and some primary colorectal tumors (Levy et al., Genens Chromosomes Canc.
er 1999 24 (1): 42-7; MacGrogan et al., 1996, G.
enomics 35 (1), 55-65). 349960 based on homology
The 5.064 protein and each homologous protein or peptide may share at least some activity.

For 3499605.064, the nucleotide sequence described herein was searched against the GneBank database using the BLASTN search protocol. The BLASTN search is based on rat transplantation-related protein (IAG2) (12
19 bp) (mRNA encoding GenBank accession number AF008554)
To the mRNA encoding the human N33 protein (1342 bp) (GenBank accession number U42349).

For 3499605.064, the nucleotide and amino acid sequences disclosed herein were searched against other databases using the SignalPep and PSsort search protocols. 3499605.064 appears to have a cleavable amino terminal signal peptide with a cleavage site between position 29 and position 30 (ASA-QR). This protein most likely appears to be located outside the cell. The estimated molecular weight is 16035.8 Daltons.

The 3499605.064 nucleic acid and encoded polypeptide has the following sequence:

[0108]

[Chemical formula 24] (8. MBSP8. Clone AQ013000.0.21, Novel Keratinocyte Growth Factor) According to the present invention, the MBSP8 nucleic acid sequences and polypeptides are clone AQ01.
Includes 3000.0.21 nucleic acid and encoded polypeptide sequence.

The polynucleotide of the present invention is identified as clone AQ013000.0.21. AQ013000.0.21 is a full length 670 nucleotide clone containing the entire coding sequence for the protein from nucleotides 180-471 (also referred to herein as the "AQ013000.0.21 protein"). The original tissue source of this clone is unknown.

The nucleotide sequence of AQ013000.0.21 is reported in SEQ ID NO: 15. The deduced amino acid sequence of the AQ013000.0.21 protein corresponding to the aforementioned nucleotide sequence is reported in SEQ ID NO: 16.

For AQ013000.0.21, the nucleotide sequences disclosed herein were searched against the GneBank database using the BLASTN search protocol. BLASTN searches for human keratinocyte growth factor mRNA, 3
94% homology to 853 bp (GenBank accession number M60828) (
509 nucleotides 481) are shown; 5'of AQ013000.0.21.
The areas are different.

The 97 amino acid amino acid sequence is 89.691 relative to the sequence of the 164 amino acid human keratinocyte growth factor analog C (1,15,102) S protein (patp: W61426, patent application WO9824813, Amgen Inc).
% Is the same. Further searches in the publicly available GneBank database BLASTP include human keratinocyte growth factor precursor (KGF; fibroblast growth factor-7; FGF-7; 194aa) (SWISSPROT-ACC: P21).
781) and 95% identity (93 of 97 amino acids).

Keratinocyte growth factor analogs can be administered to a patient to increase the cytoprotective effect, proliferation and / or differentiation of epithelial cells of the gastrointestinal (GI) tract. Using this method, gastric and duodenal ulcers, enterotoxicity such as in the irradiation and chemotherapy areas, GI tract erosions including erosive gastritis, esophagitis, esophageal reflux or Crohn's disease or ulcerative colitis Inflammatory bowel disease may be treated or prevented.
Based on homology, AQ013000.0.21 protein and each homologous protein or peptide may share at least some activity.

For AQ013000.0.21, the nucleotide and amino acid sequences disclosed herein were searched against other databases using the SignalPep and PSsort search protocols. AQ013000.0.2.
1 appears to have a cleavable amino terminal signal peptide. This protein most likely appears to be located in the membrane of the endoplasmic reticulum. Estimated molecular weight is 11009
． It is 6 Daltons.

The AQ013000.0.21 nucleic acid and encoded polypeptide has the following sequence:

[0116]

[Chemical 25] (9. MBSP9. Clone 16401346.0.337, a novel secreted protein) MBSP9 nucleic acids and polypeptides according to the present invention are clone 164013.
Includes 46.0.337 nucleic acid and encoded polypeptide sequences.

The polynucleotide of the present invention is identified as clone 16401346.0.337. 1640134.0.3337 is a 1135 nucleotide full-length clone containing the entire coding sequence of the protein from nucleotides 261 to 980 (also referred to herein as "16401346.0.337 protein").
This protein, associated with cura 75 16401346.0.337,
It is coded in a negative reading frame (frame: -3). This sequence was shown to be the reverse complement and was renumbered to allow protein reading in the deduced N to C orientation.

The nucleotide sequence of 16401346.0.337 is reported in SEQ ID NO: 17. The deduced amino acid sequence of the 16401346.0.337 protein, which corresponds to the aforementioned nucleotide sequence, is reported in SEQ ID NO: 18.

For 16401346.0.3337, the nucleotide sequences disclosed herein were searched against the GneBank database using the BLASTN search protocol. The BLASTN search was-SRCR domain protein from isotype 2, 6323 bp-Geodia cydonium for membranes.
It showed 57% homology to the mRNA (194 of 335 nucleotides) (G
enBank registration number Y14953).

The amino acid sequence of 240 amino acids has been searched for in the publicly available GneBank database BLASTP and for published proteins:
It showed no significant homology.

For 16401346.0.3337, the nucleotide and amino acid sequences disclosed herein were searched against other databases using the SignalPep and PSsort search protocols. 16401346.0.
337 appears to have a cleavable amino terminus with a signal peptide at position 57 and position 58: ILG-KN. This protein most likely appears to be located in the lumen of lysosomes. The estimated molecular weight is 25397.2 Daltons.

The 16401346.0.337 nucleic acid and encoded polypeptide has the following sequence:

[0123]

[Chemical formula 26]

[0124]

[Chemical 27] This protein, which is associated with cura 75 16401346.0.337, is encoded in the negative reading frame. This sequence was shown to be the reverse complement and was renumbered to allow protein reading in the deduced N to C orientation.

10. MBSP10. Clone 20604798.0.1 The MBSP10 nucleic acid sequence and polypeptide according to the invention are clone 206
0497.0.1 nucleic acid and encoded polypeptide sequence.

The polynucleotide of the present invention is identified as clone 20604798.0.1. 20604798.0.1 is a full length clone of 2437 nucleotides and contains the entire coding sequence for the secreted protein of nucleotides 147-1595 (also referred to herein as "20604798.0.1 protein").

The nucleotide sequence of 20604798.0.1 is reported in SEQ ID NO: 19. The deduced amino acid sequence of the 20604798.0.1 protein corresponding to the aforementioned nucleotide sequence is reported in SEQ ID NO: 20.

For 20604798.0.1, the nucleotide sequences disclosed herein were searched against the GneBank database using the BLASTN search protocol. BLASTN search for Homo sapiens clone 2493
It showed 99% homology (1760 nucleotides 1759) to the 6 mRNA sequence, 1783 bp (GenBank accession number AF131849). 2060
The first 678 nucleotides at the 5'end of 4798.0.1 are 24936mRN.
It shows no identity to the A sequence.

The amino acid sequence of 483 amino acids is a human “unknown” protein fragment,
182aa (TREMBLNEW-ACC: AAD20029) is 100% identical to the carboxyl-terminal 182 amino acids. 20604798.0.
The amino terminal 181 amino acids of 1 showed no significant homology to known proteins.

For 20604798.0.1, the nucleotide and amino acid sequences disclosed herein were searched against other databases using the SignalPep and PSsort search protocols. 20604798.0.1 appears to have a cleavable amino-terminal signal peptide between position 33 and position 34: GRA-LP which usually has a cleavage site. This protein most likely appears to be located outside the cell. The estimated molecular weight is 54857.8 Daltons.

The 20604798.0.1 nucleic acid and encoded polypeptide has the following sequence:

[0132]

[Chemical 28]

[0133]

[Chemical 29]

[0134]

[Chemical 30]

[0135]

[Chemical 31] (11. MBSP11. Clone 27978313.0.29, a novel membrane protein) The MBSP11 nucleic acid sequence and polypeptide according to the present invention are clone 279.
Includes 78313.0.29 nucleic acid and encoded polypeptide sequence.

The polynucleotide of the present invention is identified as clone 27978313.0.29. 27978313.0.29 is a full length clone of 1288 nucleotides and contains the entire coding sequence for the protein of nucleotides 733-1003 (
Also referred to herein as "27978313.0.29 protein").

The nucleotide sequence of 27978313.0.29 is reported in SEQ ID NO: 21. The deduced amino acid sequence of the 27978313.0.29 protein corresponding to the aforementioned nucleotide sequence is reported in SEQ ID NO: 22.

Searches in the publicly available GneBank database BLASTP include 9
The amino acid sequence of 0 amino acids has 61% homology (4) to Rhodospirillum rubrum nicotinamide nucleotide transhydrogenase, β subunit (464 amino acids) (SPTREMBL-ACC: Q59765).
It was shown to be 4 amino acids 27). Based on homology, 27978313
． The 0.29 protein and each homologous protein or peptide may share at least some activity.

For 27978313.0.29, the nucleotide and amino acid sequences disclosed herein were searched against other databases using the SignalPep and PSsort search protocols. 27978313.0.2
Between position 46 and 47: 9 appears to have a cleavable amino-terminal signal peptide with a cleavage site at CWG-AT. This protein most likely appears to be located on the plasma membrane. The estimated molecular weight of the putative membrane protein is 9358.
It is 1 Dalton.

The 27978313.0.29 nucleic acid and encoded polypeptide has the following sequence:

[0141]

[Chemical 32]

[0142]

[Chemical 33] (Nucleic Acid) One aspect of the present invention is an isolated nucleic acid molecule encoding MBSPX or a biologically active portion thereof, as well as a nucleic acid encoding MBSPX (eg,
MBSPX mRNA) and nucleic acid fragments sufficient for use as hybridization probes and for use as PCR primers for amplification or mutation of MBSPX nucleic acid molecules.

As used herein, the term “nucleic acid molecule” refers to a DNA molecule (eg, c
It is intended to include DNA or genomic DNA), RNA molecules (eg mRNA), analogs of DNA or RNA made using nucleotide analogs, and derivatives, fragments and homologs thereof. The nucleic acid molecule may be single-stranded or double-stranded, but is preferably double-stranded DNA.

An "isolated" nucleic acid molecule is a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid. Preferably, an "isolated" nucleic acid does not include sequences that naturally flank the nucleic acid within the genomic DNA of the organism from which the nucleic acid was derived (ie, sequences located at the 5'and 3'ends of the nucleic acid). For example, in various embodiments, an isolated MBSPX nucleic acid molecule has about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb that naturally flank the nucleic acid molecule within the genomic DNA of the cell from which the nucleic acid was derived.
It may include nucleotide sequences of less than kb or 0.1 kb. Furthermore, an "isolated" nucleic acid molecule (eg, a cDNA molecule) may contain substantially no other cellular material or culture medium when produced by recombinant techniques, or is chemically synthesized. If so, it may not include chemical precursors or other chemicals.

[0145] In some embodiments, the MBSPX nucleic acid encodes the mature form MBSPX polypeptide. As used herein, the term "mature" form of a polypeptide or protein is a naturally occurring polypeptide or precursor form or product of the MBSPX protein. Naturally occurring polypeptides, precursors, or proproteins include, by way of non-limiting example, the full length gene product encoded by the corresponding gene. Alternatively, it is a polypeptide, precursor, encoded by an open reading frame described herein.
Or it can be defined as a proprotein. When a product "mature" form occurs, again as a non-limiting example, where one or more naturally occurring process steps can occur within a cell or host cell, where the gene product occurs, It occurs as a result of the process. Examples of processing steps that result in a "mature" form of a polypeptide or protein include cleavage of the N-terminal methionine residue encoded by the start codon of the open reading frame, or proteolytic cleavage of the signal peptide or leader sequence. Is mentioned. Therefore, residues 1-N (
Where residue 1 is the N-terminal methionine), the mature form resulting from the precursor polypeptide or protein has the remaining residues 2 after removal of the N-terminal methionine.
~ N. Alternatively, the mature form resulting from a precursor polypeptide or protein having residues 1-N (where the N-terminal signal sequence from residues 1 to residues M has been cleaved) is replaced by the remaining residues M + 1 to It has residues up to residue N. As further used herein, a "mature" form of a polypeptide or protein is
It may result from a step of post-translational modification rather than a proteolytic event. Such additional processes include, by way of non-limiting example, glycosylation, myristylation, or phosphorylation. Generally, the mature polypeptide or protein may result from the manipulation of only one of these processes, or from any combination thereof.

Nucleic acid molecules of the invention (eg SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15)
, 17, 19, 21, 23 nucleotide sequences, or the complements of any of these nucleotide sequences) using standard molecular biology techniques and the sequence information provided herein. Can be isolated. As hybridization probes, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 1
Using all or part of a 9, 21, or 23 nucleic acid sequence, MBSPX molecules can be isolated using standard hybridization and cloning techniques (eg, S
ambrook et al., ed., MOLECULAR CLONING: A LABOR
ATORY MANUAL 2nd Edition, Cold Spring Harbor L
Laboratory Press, Cold Spring Harbor, N
Y, 1989; and Ausubel et al., Edited, CURRENT PROTOCO.
LS IN MOLECULAR BIOLOGY, John Wiley & S
ons, New York, NY, 1993).

The nucleic acid of the present invention is a standard P
Can be amplified using as template and suitable oligonucleotide primers according to CR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. In addition, oligonucleotides corresponding to MBSPX nucleotide sequences can be prepared by standard synthetic techniques (eg, using an automated DNA synthesizer).

In another embodiment, the isolated nucleic acid molecule of the invention is SEQ ID NO: 1, 3, 5
, 7, 9, 11, 13, 15, 17, 19, 21, or 23, and a nucleic acid molecule that is the complement of the nucleotide sequence shown. In another embodiment, the isolated nucleic acid molecule of the invention is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17,
It includes a nucleic acid molecule that is the complement of a nucleotide sequence shown at 19, 21, or 23, or a portion of this nucleotide sequence. SEQ ID NOs: 1, 3, 5, 7, 9, 1
Nucleic acid molecules that are complementary to the nucleotide sequences shown in 1, 13, 15, 17, 19, 21, or 23 have SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 1,
A nucleic acid molecule that is sufficiently complementary to the nucleotide sequence shown in 7, 19, 21 or 23, and has SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19,
The nucleotide sequence shown at 21, or 23 may hydrogen bond with little or no mismatches, thereby forming a stable duplex.

Further, the nucleic acid molecule of the present invention has the SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 1.
Only a portion of the nucleic acid sequence of 5, 17, 19, 21, or 23 may be included (eg, a fragment that can be used as a probe or primer, or a fragment that encodes a biologically active portion of MBSPX). A fragment provided herein comprises at least 6 (consecutive) nucleic acid sequences or at least 4
Defined as individual (sequential) amino acid sequences, each of which, in the case of nucleic acids, is sufficiently long to allow specific hybridization or, in the case of amino acids, to be of sufficient length to allow specific recognition of an epitope. And, at best, some less than the full length sequence. Fragments can be derived from any contiguous portion of the selected nucleic acid or amino acid sequences. Derivatives are nucleic acid or amino acid sequences formed from a native compound either directly or by modification or partial substitution. An analog is a nucleic acid sequence or amino acid sequence that has a structure (but not identical) similar to that of the native compound, but differs with respect to a particular component or side chain. Analogs can be synthetic or they can be derived from evolutionarily different sources and have similar or opposite metabolic activity as compared to wild type. Homologues are nucleic acid and amino acid sequences of specific genes that are derived from different species.

Derivatives and analogs can be full length or non-full length if the derivatives or analogs include modified nucleic acids or modified amino acids, as described below.
Nucleic acid or protein derivatives or analogs of the invention can, in various embodiments, be aligned sequences of identical size nucleic acid or amino acid sequences, or where the alignment is performed by a computer homology program known in the art. At least about 30%, 50%, 70%, 80%, or 95% identity (wherein preferably 80-95% identity) to the nucleic acid or protein of the invention. A homologous region, or a molecule in which the encoding nucleic acid contains a region capable of hybridizing the complement of the sequence encoding the above protein under stringent, moderately stringent, or low stringent conditions, Not limited to. For example, Ausubel et al., C
CURRENT PROTOCOLS IN MOLECULAR BIOLOG
See Y, John Wiley & Sons, New York, NY, 1993, and below.

Nucleotide sequences determined from cloning of the human MBSPX gene have been used to identify and / or clone MBSPX homologs in other cell types (eg, from other tissues), as well as MBSPX homologs from other mammals. Allows the production of probes and primers designed for use. The probe / primer typically comprises a substantially purified oligonucleotide. This oligonucleotide is typically represented by SEQ ID NOs: 1, 3, 5, 7, 9,
At least about 12, 11, 13, 15, 17, 19, 21, or 23, 25
, 50, 100, 150, 200, 250, 300, 350 or 400 consecutive sense strand nucleotide sequences, or SEQ ID NOs: 1, 3, 5
, 7, 9, 11, 13, 15, 17, 19, 21, or 23 antisense strand nucleotide sequences, or SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15,
At least about 12 of 17, 19, 21 or 23 naturally occurring variants,
25 pieces, 50 pieces, 100 pieces, 150 pieces, 200 pieces, 250 pieces, 300 pieces, 350 pieces
Or 400 contiguous nucleotide sequences contain a region of nucleotide sequences that hybridizes under stringent conditions.

Probes based on human MBSPX nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In various embodiments, the probe further comprises a labeling group attached to the label,
For example, the labeling group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme cofactor. Such a probe may be used as part of a diagnostic test kit to identify cells or tissues that misexpress MBSPX, for example to measure the level of nucleic acid encoding MBSPX in a sample of cells from a subject. (For example, MBS
PX mRNA levels, or determining whether the genomic MBSPX gene is mutated or deleted).

A “polypeptide having a biologically active portion of MBSPX” refers to a polypeptide having an activity similar to, but not necessarily the same as, that of the polypeptide of the present invention, with or without dose dependence. Instead, it includes the mature form as measured in certain biological assays. A nucleic acid fragment encoding a "biologically active portion of MBSPX" is a sequence that encodes a polypeptide having the biological activity of MBSPX (the biological activity of proteins of MBSPX are described above). Isolated a portion of number 1, 3, 5, 7, 9, 1113, 15, 17, 19, 21, or 23 and expressed the encoded portion of MBSPX (eg, by recombinant expression in vitro) , And can be prepared by assessing the activity of the encoded portion of MBSPX.

(MBSPX Variants) The present invention further comprises SEQ ID NOs: 1, 3, 5, 7, 9 due to the degeneracy of the genetic code.
, 11, 13, 15, 17, 19, 21, or 23 and is therefore different from the nucleotide sequence shown in SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15,
Included are nucleic acid molecules that encode the same MBSPX protein as encoded by the nucleotide sequence shown at 17, 19, 21 or 23. In another embodiment, the isolated nucleic acid molecule of the invention is SEQ ID NO: 2, 4, 6, 8, 10, 12,
It has a nucleotide sequence encoding a protein having the amino acid sequence shown at 14, 16, 18, 20, 22 or 24.

SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 2
It will be appreciated by those skilled in the art that, in addition to the human MBSPX nucleotide sequence shown in 3, there may be DNA sequence polymorphisms in the population (eg, human population) that result in changes in the amino acid sequence of MBSPX. Such genetic polymorphisms in the MBSPX gene may exist among individuals within a population due to natural allelic variation. As used herein, the terms "gene" and "recombinant gene" refer to a nucleic acid molecule containing an open reading frame encoding an MBSPX protein, preferably a mammalian MBSPX protein. Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of the MBSPX gene. Any and all such nucleotide variations and resulting amino acid polymorphisms in MBSPX that are the result of natural allelic variation and do not alter the functional activity of MBSPX are intended to be within the scope of the invention. To be done.

Furthermore, the human sequences of MBSPX proteins from other species, and therefore of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23 are: Nucleic acid molecules having different nucleotide sequences are intended to be included within the scope of the present invention. Nucleic acid molecules corresponding to naturally occurring allelic variants and homologues of MBSPX cDNA of the present invention are human cDNAs, or portions thereof, used as hybridization probes under standard hybridization techniques under stringent hybridization conditions. , Can be isolated based on their homology to the human MBSPX nucleic acids disclosed herein. For example,
Soluble human MBSPX cDNA can be isolated based on its homology to human membrane-bound MBSPX cDNA. Similarly, membrane-bound human MBSPX cDNA
Can be isolated based on its homology to soluble human MBSPX cDNA.

Thus, in another embodiment, an isolated nucleic acid molecule of the invention is at least 6 nucleotides in length and, under stringent conditions, SEQ ID NOs: 1, 3
Hybridizes to a nucleic acid molecule containing the nucleotide sequence of 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23. In another embodiment, the nucleic acid is at least 10, 25, 50, 100, 250 or 500 nucleotides in length. In another embodiment, the isolated nucleic acid molecule of the invention hybridizes to the coding region. As used herein, the term "hybridize under stringent conditions" means that nucleotide sequences that are at least 60% homologous to one another under those conditions typically remain hybridized to each other. It is intended to describe the conditions for hybridization and washing.

Homologs (ie, nucleic acids encoding MBSPX proteins from species other than human) or other related sequences (eg, paralogs) can be identified as probes using methods well known in the art of nucleic acid hybridization and cloning. It may be obtained by low, medium or high stringency hybridization with all or part of a human sequence.

Stringent conditions are known to those of skill in the art, and CURRENT P
ROTOCOLS IN MOLECULAR BIOLOGY, John W
iley & Sons, N.M. Y. (1989), 6.3.1-6.3.6. Preferably, this condition is typically at least about 65%, 7% of each other.
0%, 75%, 85%, 90%, 95%, 98%, or 99% homologous sequences
Conditions are such that they remain hybridized to each other. A non-limiting example of stringent hybridization conditions is 6xSSC, 5 at 65 ° C.
0 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PV
Hybridization in salt-rich buffer containing P, 0.02% Ficoll, 0.02% BSA, and 500 mg / ml denatured salmon sperm DNA, followed by 0.2 × SSC, 0.01% at 50 ° C. One or more washes in BSA. SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 2
An isolated nucleic acid molecule of the present invention that hybridizes to the sequence of 3 under stringent conditions corresponds to a naturally occurring nucleic acid molecule. As used herein, a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a naturally-occurring (eg, encoding a native protein) nucleotide sequence.

In a second embodiment, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17
, 19, 21 or 23 nucleotide sequences, or fragments, analogs or derivatives thereof, are provided which are hybridizable under conditions of moderate stringency. A non-limiting example of moderate stringency hybridization conditions is 6X SSC, 5 at 55 ° C.
× Denhardt's solution, 0.5% SDS and 100 mg / ml denatured salmon sperm DNA
Hybridization in, followed by 1 × SSC at 37 ° C., 0.1% SD
One or more washes in S. Other conditions of moderate stringency that can be used are well known in the art. For example, Ausubel et al.
1993, CURRENT PROTOCOLS IN MOLECULAR
BIOLOGY, John Wiley & Sons, NY, and Kriegl
er, 1990, GENE TRANSFER AND EXPRESSION
, A LABORATORY MANUAL, Stockton Press,
See NY.

In a third embodiment, under conditions of low stringency, SEQ ID NOs: 1, 3, 5
Provided is a nucleic acid capable of hybridizing to a nucleic acid molecule comprising a nucleotide sequence of 7, 7, 9, 11, 13, 15, 17, 19, 21 or 23, a fragment, analog or derivative thereof. A non-limiting example of low stringency hybridization conditions is 35% formamide, 5xSSC, 50m at 40 ° C.
M Tris-HCl (pH 7.5), 5 mM EDTA, 0.02% PVP,
0.02% Ficoll, 0.2% BSA, 100 mg / ml denatured salmon sperm DN
A, hybridization in 10% (wt / vol) dextran sulphate, then 2xSSC at 50 ° C, 25 mM Tris-HCl (pH 7.4),
One or more washes in 5 mM EDTA, and 0.1% SDS. Other conditions of low stringency that can be used (eg, cross species hybridization) are well known in the art. For example, Ausubel et al. (Ed.)
, 1993, CURRENT PROTOCOLS IN MOLECULAR
BIOLOGY, John Wiley & Sons, NY, and Krieg
ler, 1990, GENE TRANSFER AND EXPRESSIO
N, A LABORATORY MANUAL, Stockton Press
, NY; Shilo and Weinberg, 1981, Proc Natl.
See Acad Sci USA 78: 6789-6792.

Conservative Variations In addition to naturally occurring allelic variants of MBSPX sequences that may be present in the population, those of skill in the art will appreciate that the changes are SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17
, 19, 21 or 23 nucleotide sequence can be introduced by mutation, thereby without changing the functional capacity of the MBSPX protein, the encoded M
It is further recognized that it leads to changes in the amino acids of the BSPX protein. For example,
Nucleotide substitutions leading to amino acid substitutions at "non-essential" amino acid residues can be made in the sequences of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23. A "non-essential" amino acid residue is a residue that can be modified from the wild-type sequence of MBSPX without modifying the biological activity, wherein the "essential" amino acid residue is necessary for biological activity. is there. For example, amino acid residues conserved among the MBSPX proteins of the present invention are predicted to be particularly unlikely to be modified.

Another aspect of the invention is MBS that includes changes in amino acid residues that are not essential for activity.
It relates to a nucleic acid molecule encoding a PX protein. Such MBSPX protein has the amino acid sequence of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 1.
Unlike 6, 18, 20, 22 or 24, it still retains biological activity. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence that encodes a protein, wherein the protein is SEQ ID NO: 2,4,6,8,10,12.
At least about 45 in the amino acid sequence of 14, 16, 18, 18, 20, 22 or 24.
% Amino acid sequences that are homologous. Preferably, the protein encoded by this nucleic acid molecule is SEQ ID NO: 2,4,6,8,10,12,14,16,18,2.
Is at least about 60% homologous to 0, 22 or 24, and more preferably is at least about 70% homologous to SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24. Yes, and even more preferably SEQ ID NOs: 2, 4, 6, 8,
At least about 80% homologous to 10, 12, 14, 16, 18, 20, 22, or 24, and even more preferably SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14.
, 16, 18, 20, 22, or 24 are at least about 90% homologous, and most preferably SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 2.
At least about 95% homology to 0, 22 or 24.

One or more isolated nucleic acid molecules encoding an MBSPX protein that is homologous to the protein of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24. SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, such that the amino acid substitutions, additions or deletions of
, One or more nucleotide substitutions in the nucleotide sequence of 19, 21 or 23,
It can be created by introducing additions or deletions.

Mutations may be made by standard techniques, eg, site-directed mutagenesis and PCR-mediated mutagenesis, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21,
Or it can be introduced in 23. Preferably, conservative amino acid substitutions are made at one or more predicted nonessential amino acid residues. A "conservative amino acid substitution" is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain.
A family of amino acid residues with similar side chains is defined in the art. These families include amino acids with basic side chains (eg, lysine, arginine, histidine), amino acids with acidic side chains (eg, aspartic acid, glutamic acid), amino acids with uncharged polar side chains (eg, glycine, Asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with non-polar side chains (eg alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), amino acids with β-branched side chains (eg, Threonine, valine, isoleucine), and amino acids with aromatic side chains (eg tyrosine, phenylalanine, tryptophan, histidine). Therefore, a predicted nonessential amino acid residue in MBSPX is replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations may be randomly introduced along all or part of the MBSPX coding sequence, for example by saturation mutagenesis, and the resulting mutants screened for MBSPX biological activity. Mutants that retain activity are identified. Sequence number 1
Following mutagenesis of 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, or 23, the encoded protein may be expressed by any recombinant technique known in the art, and The activity of the protein can be measured.

In one embodiment, the variant MBSPX protein is (1) another MBSPX protein.
Ability to form protein: protein interactions with proteins, other cell surface proteins, or biologically active portions thereof, (2) complex formation between mutant MBSPX protein and MBSPX ligand; (3) cells The ability of the mutant MBSPX protein to bind to an internal target protein or biologically active portion thereof;
For example avidin protein).

(Antisense) Another aspect of the present invention is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17.
, 19, 21 or 23 nucleotide sequence, or an isolated antisense nucleic acid molecule that is hybridizable or complementary to a fragment, analog or derivative thereof. An "antisense" nucleic acid is a nucleotide sequence that is complementary to a "sense" nucleic acid that encodes a protein, eg, a nucleotide sequence that is complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. including. In certain aspects, antisense nucleic acid molecules are provided that include a sequence that is complementary to at least about 10, 25, 50, 100, 250 or 500 nucleotides of the entire MBSPX coding strand, or only to a portion thereof.
SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 2
4, nucleic acid molecules encoding fragments, complements, derivatives and analogs of the MBSPX protein, or SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 1
Further provided is an antisense nucleic acid complementary to the 7, 19, 21 or 23 MBSPX nucleic acid sequences.

In one embodiment, the antisense nucleic acid molecule is antisense to the “coding region” of the coding strand of a nucleotide sequence encoding MBSPX. the term"
A "coding region" refers to a region of a nucleotide sequence that contains codons translated into amino acid residues. In another embodiment, the antisense nucleic acid molecule is antisense to the "non-coding region" of the coding strand of a nucleotide sequence encoding MBSPX. The term "noncoding region" refers to 5'and 3'sequences that flank the coding region that are not translated into amino acids (ie, also referred to as 5'and 3'untranslated regions).
.

Given the coding chain sequence encoding MBSPX disclosed herein (eg, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23). , Antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick or Hoogsteen base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of MBSPX mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or non-coding region of MBSPX mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of MBSPX mRNA. Antisense oligonucleotides, for example, have a length of about 5
It can be 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides. Antisense nucleic acids of the invention can be constructed using chemical synthesis or enzymatic ligation using procedures known in the art. For example, antisense nucleic acids (eg, antisense oligonucleotides) are naturally occurring nucleotides, or duplexes formed to increase the biological stability of the molecule, or between antisense and sense nucleic acids. Can be chemically synthesized using variously modified nucleotides designed to increase the physical stability of, eg, phosphorothioate derivatives and acridine substituted nucleotides can be used.

Examples of modified nucleotides that can be used to generate antisense nucleic acids are: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine. , 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-
2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, β-D-galactosylkeosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2
-Methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, β-D-mannosyl Keosin, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), vibutoxosine, pseudouracil, keosine (q).
ueosine), 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methyl ester, uracil-5-oxyacetic acid (v), 5-methyl -2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (a
cp3) w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector in which the nucleic acid is subcloned in the antisense orientation (ie, RNA transcribed from the inserted nucleic acid is in the subsections below). As described further, in antisense orientation with respect to the target nucleic acid of interest).

Typically, antisense nucleic acid molecules of the invention are administered to a subject such that they hybridize to or bind to cellular mRNA and / or genomic DNA encoding the MBSPX protein. , Or in situ (
in situ), thereby inhibiting expression of the protein, for example by inhibiting transcription and / or translation. This hybridization can either form a stable duplex by conventional nucleotide complementarity, or
For example, in the case of antisense nucleic acid molecules that bind to DNA duplexes, this may be through specific interactions in the major groove of the double helix. Examples of routes of administration of the antisense nucleic acid molecules of the invention include direct injection at the tissue site. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules can be modified so that they specifically bind to a receptor or antigen expressed on the surface of selected cells. For example, this is by linking the antisense nucleic acid molecule to a peptide or antibody that binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. In order to achieve a sufficient intracellular concentration of antisense molecule, vector constructs in which the antisense nucleic acid molecule is placed under the control of the strong pol II or pol III promoter are preferred.

In yet another embodiment, the antisense nucleic acid molecule of the invention is an alpha anomeric nucleic acid molecule. Alpha anomeric nucleic acid molecules form specific double-stranded hybrids with complementary RNA, where the strands run parallel to each other as opposed to the normal β unit (G
aultier et al., (1987) Nucleic acid Res 15: 6.
625-6641). This antisense nucleic acid molecule also contains 2'-o-methyl ribonucleotides (Inoue et al. (1987) Nucleic Acids Res.
15: 6131-6148), or a chimeric RNA-DNA analog (Ino
ue et al. (1987) FEBS Lett 215: 327-330).

Ribozyme and PNA Components In yet another embodiment, the antisense nucleic acids of the invention are ribozymes. Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving single-stranded nucleic acids having complementary regions to them, such as mRNA.
Therefore, ribozymes (eg, hammerhead ribozyme (Haselhoff)
And Gerlach (1988) Nature 334: 585-591)) can be used to catalytically cleave MBSPX mRNA transcripts, thereby inhibiting translation of MBSPX mRNA. Ribozymes having specificity for a nucleic acid encoding MBSPX are disclosed in MBSPX disclosed herein.
The nucleotide sequence of the cDNA (ie, SEQ ID NOs: 1, 3, 5, 7, 9, 11,
13, 15, 17, 19, 21 or 23). For example,
Derivatives of Tetrahymena L-19 IVS RNA can be constructed such that the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in the mRNA encoding MBSPX. For example, Cech et al., US Pat. No. 4,987,071; and Cech et al., US Pat. No. 5,116,742.
See issue. Alternatively, MBSPX mRNA can be used to select catalytic RNAs with specific ribonuclease activity from a pool of RNA molecules. For example, Bartel et al. (1993) Science 261: 1411-.
See 1418.

Alternatively, MBSPX gene expression is regulated by the regulatory region of MBSPX (eg MBSPX).
It can be inhibited by targeting a nucleotide sequence that is complementary to the PX promoter and / or enhancer) and forming a triple helix structure that interferes with transcription of the MBSPX gene in target cells. In general, Helene (1991) An
ticker Drug Des. 6: 569-84; Helene et al. (1
992) Ann. N. Y. Acad. Sci. 660: 27-36; and Ma
See her (1992) Bioassays 14: 807-15.

In various embodiments, MBSPX nucleic acids can be modified at the base, sugar, or phosphate backbones to improve, for example, molecular stability, hybridization, or solubility. For example, the deoxyribose phosphate backbone of nucleic acids can be modified to produce peptide nucleic acids (Hyrup et al. (1996) Bioorg Med Chem.
4: 5-23). As used herein, the term "peptide nucleic acid" or "
PNA "is a pseudopeptide having a deoxyribose phosphate skeleton.
(eptide) backbone and refers to nucleic acid mimetics, for example DNA mimetics, in which only the four natural nucleobases are retained. The neutral backbone of PNA has been shown to allow specific hybridization to DNA and RNA under low ionic strength conditions. The synthesis of PNA oligomers is described by Hyrup et al.
996) supra; Perry-O'Keefe et al. (1996) PNAS 93: 1.
Standard solid phase peptide synthesis protocols, such as those described in 4670-675.

MBSPX PNAs can be used in therapeutic and diagnostic applications. For example, P
NA can be used as an antisense or antigene agent for sequence-specific regulation of gene expression by, for example, inducing transcription or translation arrest, or inhibiting replication. MBSPX PNAs can also be used as artificial restriction enzymes (Hyrup), eg, for analysis of single base pair mutations in a gene, eg, by PNA-specific PCR clumping; when used in combination with other enzymes, eg, S1 nuclease. B. (1966) supra) or as a probe or primer for DNA sequences and hybridization (Hyrup et al. (1966) supra; Perry-O'Keefe (1996) supra).

In another embodiment, MBSPX PNAs are conjugated to PNAs by linking lipophilic groups or other auxiliary groups to PNAs, for example, to increase their stability or cellular uptake. It may be modified by the formation of chimeras or by the use of liposomes or other drug delivery techniques known in the art.
For example, PSP-of MBSPX, which may combine the advantageous properties of PNA and DNA.
DNA chimeras can be generated. Such chimeras allow DNA recognition enzymes, such as RNaseH and DNA polymerase, to interact with the DNA portion while providing the high binding affinity and specificity of the PNA portion. PNA-
DNA chimeras can be ligated using linkers of suitable length selected in terms of base stacking, number of internucleobase linkages, and orientation (Hyrup (1
996) Above). The synthesis of PNA-DNA chimeras was performed as described above in Hyrup (1966).
) And Finn et al. (1996) Nucl Acids Res 24: 335.
It can be carried out as described in 7-63. For example, DNA strands can be synthesized on a solid support using standard foramidite coupling chemistry and modified nucleoside analogs such as 5 '-(4-methoxytrityl) amino-5'-deoxy-thymidine. Phosphoramidites can be used between the PNA and the 5'end of DNA (Mag et al. (1989) Nucl Acid Res 17: 5973-).
88). The PNA monomers are then coupled in a stepwise fashion to generate a chimeric molecule with a 5'PNA segment and a 3'DNA segment (Finn et al. (1
996) Above). Alternatively, the chimeric molecule comprises a 5'DNA segment and a 3'PNA
It can be synthesized using segments. Petersen et al. (1975) Bioor
g Med Chem Lett 5: 1119-11124.

In other embodiments, the oligonucleotide is a peptide (eg, for targeting host cell receptors in vivo), or an agent that facilitates transport across cell membranes (eg, Letsinger et al., 1989, Proc. Natl
． Acad. Sci. U. S. A. 86: 6553-6556; Lemaitr.
Et al., 1987, Proc. Natl. Acad. Sci. 84: 648-652
; PCT Publication No. WO088 / 09810) or other accessory groups such as agents that facilitate transport across the blood-brain barrier (see, eg, PCT Publication No. W089 / 10134). In addition, the oligonucleotide
Hybridization trigger cleaving agents (eg, Krol et al., 1988, Bi
oTechniques 6: 958-976) or intercalating agents (eg, Zon, 1988, Pharm. Res. 5:53).
9-549)). To this end, the oligonucleosides are, for example, peptides, hybridization-triggered cross-linkers,
It may be linked to other molecules such as transport agents, hybridization triggered cleavage agents.

MBSPX Proteins One aspect of the invention pertains to isolated MBSPX proteins, and biologically active portions thereof, or derivatives, fragments, analogs or homologues thereof. Also provided are polypeptide fragments suitable for use as an immunogen to raise anti-MBSPX antibodies. In one embodiment, native MBS
PX protein can be isolated from a cell or tissue source by a suitable purification scheme using standard protein purification techniques. In another embodiment, MBSPX
The protein is produced by recombinant DNA techniques. As an alternative to recombinant expression,
MBSPX proteins or polypeptides can be chemically synthesized using standard peptide synthesis techniques.

An “isolated” or “purified” protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the MBSPX protein is derived. Free or substantially free of chemical precursors or other chemicals when chemically synthesized. The term "substantially free of cellular material" includes preparations of MBSPX protein in which the protein has been isolated or separated from the cellular components of cells which have been recombinantly produced. In one embodiment, the term "substantially free of cellular material" refers to non-MBSP.
About 30% of X protein (also referred to herein as "contaminating protein") (
Less (by dry weight), more preferably less than about 20% non-MBSPX
A protein, even more preferably less than about 10% non-MBSPX protein,
And most preferably having less than about 5% non-MBSPX protein, MB
Includes SPX protein preparations. It is also preferred that the MBSPX protein or biologically active portion thereof be substantially free of culture medium when recombinantly produced. That is, the culture medium contains about 20% of the volume of the protein preparation.
Less, more preferably less than about 10%, and most preferably less than about 5%.

The term “substantially free of chemical precursors or other chemicals” refers to the preparation of MBSPX proteins in which the protein is separated from the chemical precursors or other chemicals involved in the synthesis of the protein. Including things. In one embodiment, the term "substantially free of chemical precursors or other chemicals" means less than about 30% (by dry weight) of chemical precursors or non-MBSPX chemicals, more preferably. Less than about 20% chemical precursors or non-MBSPX chemicals, even more preferably less than about 10% chemical precursors or non-MBSPX chemicals, and most preferably chemical precursors or non-MBSPX chemicals. Include a preparation of MBSPX protein having less than about 5%.

The biologically active portion of the MBSPX protein comprises less amino acid sequence than the full length MBSPX protein and exhibits at least one activity of the MBSPX protein (eg, SEQ ID NO: 2).
4,6,8,10,12,14,16,18,20,22 or 24)) or a peptide containing an amino acid sequence sufficiently homologous thereto or derived therefrom. Typically, the biologically active portion comprises at least one active domain or motif of the MBSPX protein. MB
The biologically active portion of the SPX protein may be, for example, 10, 25, 50, 10
It can be a polypeptide of 0 or more amino acids in length.

In addition, other biologically active portions deleted of other regions of this protein can be prepared by recombinant techniques and evaluated for one or more functional activities of the native MBSPX protein.

In certain embodiments, the MBSPX protein is SEQ ID NO: 2, 4, 6, 8,
It has the amino acid sequence shown in 10, 12, 14, 16, 18, 20, 22, or 24. In another embodiment, the MBSPX protein is SEQ ID NO: 2, 4,
6,8,10,12,14,16,18,20,22, or 24 and is substantially homologous, and due to natural allelic variation or mutagenesis, as described in detail below. The amino acid sequences are still different, but SEQ ID NOs: 2, 4, 6, 8, 10
, 12, 14, 16, 18, 20, 22 or 24 proteins retain their functional activity. Thus, in another embodiment, the MBSPX protein has amino acids that are at least about 45% homologous to the amino acid sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24. MB containing the sequence and SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24
It is a protein that retains the functional activity of the SPX protein.

Determining Homology between Two or More Sequences To determine the percent homology of two amino acid sequences or two nucleic acids, these sequences are aligned for optimal comparison purposes (eg, Gaps may be introduced in the sequence of the first amino acid or nucleic acid sequence for optimal alignment with the second amino acid or nucleic acid sequence). The amino acid residues or nucleotides are then compared at corresponding amino acid positions or nucleotide positions. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, the molecule is homologous at that position (ie, as used herein, the amino acid or Nucleic acid "homology" is equivalent to amino acid or nucleic acid "identity").

Nucleic acid sequence homology can be determined by the degree of identity between two sequences. This homology can be determined using computer programs known in the art such as GAP software provided in the GCG program package. Needlem
an and Wunsch 1970 J Mol Biol 48: 443-4.
See 53. The GCG GAP software uses the following settings for nucleic acid sequence comparisons: 5.0 GAP creation penalty and 0.3 GAP extension penalty, coding regions for similar nucleic acid sequences referred to above are preferably SEQ ID NO: At least 70%, 75 with the CDS (ie coding) portion of the DNA sequence shown in 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23
Indicates a degree of identity of%, 80%, 85%, 90%, 95%, 98%, or 99%.

The term “sequence identity” refers to two polynucleotide or polypeptide sequences
It refers to the degree to which each residue is identical over the particular region of comparison. The term "percentage sequence identity" refers to the comparison of sequences that are optimally aligned over the region of the comparison, such that they are identical nucleobases in both sequences (eg, A, T
, C, G, U, or I) determines the number of matching positions and generates the number of matching positions, dividing the number of matching positions by the total number of positions (ie, window size) in the comparison region. And multiplying this result by 100 to obtain the percent sequence identity. The term "substantially identical" as used herein refers to a characteristic of a polynucleotide sequence, where the polynucleotide has at least 80% sequence identity when compared to a reference sequence over a comparison region, It preferably comprises sequences having at least 85% sequence identity and often 90-95% sequence identity, more usually at least 99% sequence identity.

Chimeras and Fusion Proteins The present invention also provides MBSPX chimeras or fusion proteins. As used herein, MBSPX "chimeric protein" or "fusion protein"
Includes an MBSPX polypeptide operably linked to a non-MBSPX polypeptide. An "MBSPX polypeptide" refers to a polypeptide having an amino acid sequence corresponding to MBSPX, while a "non-MBSPX polypeptide" is a polypeptide having an amino acid sequence corresponding to a protein that is not substantially homologous to this MBSPX protein. Refers to peptides (eg, proteins that differ from the MBSPX protein and are from the same or different organisms). Within the MBSPX fusion protein, the MBSPX polypeptide may correspond to all or part of the MBSPX protein. In one embodiment, the MBSPX fusion protein comprises at least one biologically active portion of the MBSPX protein. In another embodiment, the MBSPX fusion protein comprises at least two biologically active portions of MBSPX proteins. In yet another embodiment, the MBSPX fusion protein comprises at least 3 biologically active portions of MBSPX proteins. In a fusion protein, the term "operably linked" refers to MBSP
It is intended to show that the X polypeptide and the non-MBSPX polypeptide are fused in frame with each other. The non-MBSPX polypeptide can be fused to the N-terminus or C-terminus of the MBSPX polypeptide.

In yet another embodiment, the fusion protein is a GST-MBSPX fusion protein, wherein the MBSPX sequence has GST (ie, glutathione S).
-Transferase) sequence is fused to the C-terminus. Such fusion proteins may facilitate the purification of recombinant MBSPX.

In another embodiment, the fusion protein is a MBSPX protein containing a heterologous signal sequence at its N-terminus. For example, the native MBSPX signal sequence can be removed and replaced with a signal sequence from another protein. In certain hosts, such as mammalian host cells, MBSPX expression and / or secretion can be increased by the use of heterologous signal sequences.

In yet another embodiment, the fusion protein is an MBSPX-immunoglobulin fusion protein, wherein the MBSPX sequences are fused to sequences from a member of the immunoglobulin protein family. This MBSPX-of the present invention
The immunoglobulin fusion protein is incorporated into a pharmaceutical composition and administered to a subject to inhibit the interaction between the MBSPX ligand and the MBSPX protein on the surface of cells, thereby producing an in vivo MBSPX-mediated signal. Can suppress transmission. This MBSPX-immunoglobulin fusion protein can be used to influence the bioavailability of MBSPX cognate ligands. Inhibition of MBSPX ligand / MBSPX interactions can be therapeutically useful in treating both proliferative and differentiation disorders, and in modulating (eg, promoting or inhibiting) cell survival. Furthermore, this MBSPX-immunoglobulin fusion protein of the invention can be used in anti-MBS
Can be used as an immunogen to produce PX antibodies, purify MBSPX ligand,
It can then be used in screening assays to identify molecules that inhibit the interaction of MBSPX with MBSPX ligand.

The MBSPX chimera or fusion protein of the invention can be produced by standard recombinant DNA techniques. For example, DNA fragments encoding different polypeptide sequences may be labeled according to conventional techniques, eg, blunt or staggered ends for ligation, restriction enzyme digestion to provide suitable ends, and optionally sticky ends. (Cohesive) ends are ligated together in-frame by employing a fill-in, alkaline phosphatase treatment to avoid unwanted ligation, and enzymatic ligation. In another embodiment, the fusion gene may be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR of gene fragment
Amplification can be performed with anchor primers that produce complementary overhangs between two consecutive gene fragments that can then be annealed and reamplified to produce a chimeric gene sequence (eg, Ausbel et al. (Eds.) CURRENT).
PROTOCOLS IN MOLECULAR BIOLOGY, John
See Wiley & Sons, 1992). In addition, fusion components (eg,
Many expression vectors are commercially available that already encode GST polypeptides). The nucleic acid encoding MBSPX can be cloned into such an expression vector such that the fusion component is linked in-frame to the MBSPX protein.

MBSPX Agonists and Antagonists The present invention also relates to variants of MBSPX proteins that function as MBSPX agonists (mimics) or as MBSPX antagonists. MBSP
Variants of the X protein, eg, discrete point mutations or truncations of the MBSPX protein, can be generated by mutagenesis. An agonist of MBSPX protein may retain substantially the same biological activity as the naturally occurring form of MBSPX protein, or a subset of that biological activity. An MBSPX protein antagonist may inhibit one or more activities of the naturally occurring form of the MBSPX protein, eg, by competitively binding to a downstream or upstream member of a cell signaling cascade that includes the MBSPX protein. Therefore, specific biological effects can be elicited by treatment with variants of limited function. In one embodiment, treatment of the subject with a variant having a subset of biological activities of the naturally occurring form of the protein comprises treating the subject against treatment with the naturally occurring form of the MBSPX protein. Have less side effects in.

Variants of the MBSPX protein that function either as MBSPX agonists (mimetics) or as MBSPX antagonists are combinatorial live variants of the MBSPX protein for MBSPX protein agonist or antagonist activity, eg truncated variants. It can be identified by screening the rally. In one embodiment, a variegated library of MBSPX variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A diverse library of MBSPX variants includes, for example, a mixture of synthetic oligonucleotides, a degenerate set of potential MBSPX sequences, either as individual polypeptides or within a set of MBSPX sequences (eg, It can be produced by enzymatically linking to a gene sequence so that it can be expressed as a larger set of fusion proteins (for phage display). Degenerate oligonucleotide sequences to potential MBSPX
There are a variety of methods that can be used to produce a library of variants. Chemical synthesis of degenerate gene sequences can be performed in an automated DNA synthesizer, which synthetic gene is then ligated into an appropriate expression vector. The use of degenerate sets of genes is
In one mixture all of the sequences encoding the desired set of potential MBSPX sequences are available. Methods of synthesizing degenerate oligonucleotides are known in the art (eg, Narang (1983) Tetrahedron).
39: 3; Itakura et al. (1984) Annu Rev Biochem.
53: 323; Itakura et al. (1984) Science 198: 10.
56; Ike et al. (1983) Nucl Acid Res 11: 477).

Polypeptide Libraries In addition, a library of fragments of the MBSPX protein coding sequence can be used to generate a diverse population of MBSPX fragments for screening and subsequent selection of variants of the MBSPX protein. In one embodiment,
The library of coding sequence fragments is a double-stranded PC of MBSPX coding sequences.
Treating the R fragment with a nuclease under conditions that produce only about one nick per molecule, denaturing the double-stranded DNA, a duplex that may contain sense / antisense pairs from different nick products. By regenerating this DNA to form, removing the single-stranded portion from the double-stranded reformed by treatment with S1 nuclease, and ligating the resulting fragment library into an expression vector. Can be generated. By this method, an expression library can be derived that encodes N-terminal and internal fragments of various sizes of MBSPX protein.

Several techniques are known in the art for screening gene products of combinatorial libraries generated by point mutations or truncations, and for screening cDNA libraries of gene products having selected properties. . Such techniques are applicable to rapid screening of gene libraries generated by combinatorial mutagenesis of MBSPX proteins. The most widely used technique suitable for high-throughput analysis for screening large gene libraries is typically cloning the gene library into a replicable expression vector, in which the resulting library of vectors is Transforming appropriate cells, and expressing the combinatorial gene under conditions under which detection of the desired activity facilitates isolation of the vector encoding the gene for which the product was detected. A novel technique for increasing the frequency of functional variants in libraries, Recruitable Ensemble Mutagenesis (REM), can be used in combination with screening assays to identify MBSPX variants (Arkin and Yourvan (1992) PNAS). 89: 7811-7815; Delg.
rave et al. (1993) Protein Engineering 6: 327.
-331).

Anti-MBSPX Antibody The isolated MBSPX protein, or portion or fragment thereof, is
It can be used as an immunogen to generate antibodies that bind MBSPX using standard techniques for polyclonal and monoclonal antibody preparation. The full length MBSPX protein may be used, but alternatively the invention provides antigenic peptide fragments of MBSPX for use as immunogens. MB
The antigenic peptides of SPX are SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16
, 18, 20, 22, or 24 containing at least 8 amino acid residues of the amino acid sequence, and the antibody raised against this peptide forms a specific immune complex with MBSPX. Includes epitope. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues.
Of amino acid residues, and most preferably at least 30 amino acid residues. A preferred epitope comprised in this antigenic peptide is a region of MBSPX located on the surface of this protein, eg a hydrophilic region.

SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, as disclosed herein.
16, 18, 20, 22, or 24 MBSPX protein sequences, or derivatives, fragments, analogs or homologues thereof, can be utilized as immunogens in the production of antibodies that immunospecifically bind to these protein components. The term “antibody” as used herein includes immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, ie, antigen binding sites that specifically bind (immunoreact) with an antigen such as MBSPX. Refers to a molecule. Such antibodies include, without limitation, polyclonal antibodies, monoclonal antibodies, chimeric antibodies, single chain antibodies, _Fab and F _{(ab ') 2} fragments, and _Fab expression libraries. In certain embodiments, antibodies to human MBSPX protein are disclosed. Various procedures known in the art are described in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 2.
It can be used for the production of polyclonal or monoclonal antibodies against 2 or 24 MBSPX protein sequences, or derivatives, fragments, analogs or homologues thereof.

For the production of polyclonal antibodies, various suitable host animals (eg, rabbits, goats, mice or other mammals) are injected with native protein, or synthetic variants thereof, or the aforementioned derivatives. Can be immunized with. Suitable immunogenic preparations can contain, for example, recombinantly expressed MBSPX protein or chemically synthesized MBSPX polypeptide. The preparation may further include an adjuvant. Various adjuvants used to increase the immunological response include, without limitation, Freund's (complete and incomplete) adjuvants, mineral gels (eg, aluminum hydroxide), surfactants (eg, lysolecithin, pluronic). Polyol, polyanion, peptide, oil emulsion,
Dinitrophenol), Bacille Calmette-Guerin
And human adjuvants such as Corynebacterium parvum, or similar immunostimulants. If desired, antibody molecules to MBSPX can be isolated from a mammal (eg, blood) and further purified by well-known techniques, such as protein A chromatography to obtain an IgG fraction.

As used herein, the term “monoclonal antibody” or “monoclonal antibody composition” refers to a population of antibody molecules that contain only one antigen binding site capable of immunoreacting with a particular epitope of MBSPX. Thus, a monoclonal antibody composition typically displays a single binding affinity for a particular MBSPX protein with which it immunoreacts. For the preparation of monoclonal antibodies against a particular MBSPX protein, or derivative, fragment, analog or homologue thereof, any of the techniques provided for the production of antibody molecules by continuous cell line culture can be utilized.
Such techniques are not limited to hybridoma techniques (Kohler & Mil).
Stein, 1975 Nature 256: 495-497).
Trioma technique; human B cell hybridoma technique (Kozbor et al., 1983.
Immunol Today 4:72) and EBV hybridoma technology for producing human monoclonal antibodies (Cole et al., 1985 MONOCL.
ONAL ANTIBODIES AND CANCER THERAPY, A
lan R.L. Liss, Inc. Pp. 77-96)). Human monoclonal antibodies can be utilized in the practice of the present invention and by using human hybridomas (Cote et al., 1983. Proc Natl Acad.
Sci USA 80: 2026-2030) or by transforming human B cells with Epstein-Barr virus in vitro (Co
te et al., 1985 MONOCLONAL ANTIBODIES AND C
ANCER THERAPY, Alan R.A. Liss, Inc. Pp. 77-96). Each of the above citations is incorporated herein by reference in its entirety.

According to the present invention, the technique can be adapted for the production of single chain antibodies specific for MBSPX proteins (see, eg, US Pat. No. 4,946,778).
. In addition, the method can be adapted for the construction of _Fab expression libraries (eg,
Huse et al., 1989 Science 246: 1275-1281 see), MBSPX protein, or derivatives, fragments, to an analog or homologue, allow rapid and effective identification of monoclonal F _ab fragments with the desired specificity To Non-human antibodies can be "humanized" by techniques well known in the art. See, eg, US Pat. No. 5,225,539.
Antibody fragments containing the idiotype to the MBSPX protein can be produced by techniques known in the art, including but not limited to: (i) F _{(ab ') 2} fragments produced by pepsin digestion of antibody molecules; (Ii) F _ab fragments produced by reducing the disulfide bridges of F _{(ab ') 2} fragments; (iii) F _ab fragments and (iv) F produced by treatment of antibody molecules with papain and a reducing agent. _v Contains fragments.

In addition, recombinant anti-MBSPX antibodies, such as chimeric antibodies and humanized monoclonal antibodies that include both human and non-human portions, which can be produced using standard recombinant DNA techniques, can be used according to the invention. Within the range of. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art. This technique uses, for example, the method described below: International Application No. PC
T / US86 / 02269; European Patent Application No. 184,187; European Patent Application No. 171,496; European Patent Application No. 173,494; PCT International Publication No. W
O 86/01533; U.S. Pat. No. 4,816,567; European Patent Application No. 1
25,023; Better et al. (1988) Science 240: 104.
1-1043; Liu et al. (1987) PNAS 84: 3439-3443; L.
iu et al. (1987) J Immunol. 139: 3521-3526; Sun
(1987) PNAS 84: 214-218; Nishimura et al. (19).
87) Cancer Res 47: 999-1005; Wood et al. (1985).
) Nature 314: 446-449; Shaw et al. (1988) J Nat.
Cancer Inst 80: 1553-1559); Morrison.
(1985) Science 229: 1202-1207; Oi et al. (1986).
BioTechniques 4: 214; US Pat. No. 5,225,539; Jones et al. (1986) Nature 321: 552-525; Verh.
Oeyan et al. (1988) Science 239: 1534; and Bei.
dler et al. (1988) J Immunol 141: 4053-4060.

In one embodiment, the methodology for screening antibodies that possess the desired specificity is determined by enzyme-linked immunosorbent assay (ELISA) known in the art.
) And other immunologically mediated techniques.

Anti-MBSPX antibodies can be used in methods known in the art for localization and / or quantification of MBSPX protein (eg, for use in measuring levels of MBSPX protein in a suitable physiological sample). For use in diagnostic methods, for use in protein imaging, etc.).
In certain embodiments, the MBSPX protein, or derivative, fragment, analog or homolog antibody thereof (including the antibody-derived binding domain) is a pharmacologically active compound [hereinbelow, referred to as "therapeutic agent". ]] Is used.

Anti-MBSPX antibodies (eg, monoclonal antibodies) can be used to isolate MBSPX by standard techniques (eg, affinity chromatography or immunoprecipitation). Anti-MBSPX antibodies may facilitate the purification of native MBSPX from cells and recombinantly produced MBSPX expressed in host cells. In addition, anti-MBSPX antibodies can be used to detect MBSPX protein (eg, in cell lysates or cell supernatants) to assess the amount and pattern of MBSPX protein expression. Anti-MBSPX antibodies can be used, for example, to diagnostically monitor protein levels in tissues as part of a clinical trial procedure to determine the efficacy of a given therapeutic regimen. Detection can be facilitated by coupling (ie, physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent substances, luminescent materials, bioluminescent materials and radioactive substances. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, β-galactosidase or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin / biotin and avidin / biotin; Examples of such fluorescent substances are umbelliferone, fluorescein,
Fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin and aequorin. And ¹²⁵ I as an example of a suitable radioactive material.
, ¹³¹ I, ³⁵ S or ³ H.

(MBSPX Recombinant Expression Vector and Host Cell) Another aspect of the present invention relates to a vector, preferably an expression vector, containing a nucleic acid encoding the MBSPX protein, or a derivative, fragment, analog or homolog thereof. As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid linked to it. One type of vector is a "plasmid." This refers to a circular double stranded DNA loop to which additional DNA segments can be ligated. Another type of vector is a viral vector, where additional DNA segments can be ligated into the viral genome.
Certain vectors are capable of autonomous replication in the host cell into which they are introduced (eg, bacterial vectors having a bacterial origin of replication, and episomal mammalian vectors). Other vectors, such as non-episomal mammalian vectors, integrate into the host cell's genome upon introduction into the host cell, and thereby replicate with the host genome. Furthermore, certain vectors are capable of directing the expression of genes to which they are operably linked. Such vectors are referred to herein as "expression vectors." In general, useful expression vectors in recombinant DNA technology are often in the form of plasmids. In the present specification, "plasmid" and "vector" can be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (eg, replication defective retroviruses, adenoviruses, and adeno-associated viruses) that serve equivalent functions.

The recombinant expression vector of the invention comprises a nucleic acid of the invention in a form suitable for expression of the nucleic acid in host cells. This means that the recombinant expression vector comprises one or more regulatory sequences operably linked to the nucleic acid sequence to be expressed, selected on the basis of the host cell to be used for expression. . In the recombinant expression vector,
"Operably linked" allows the nucleotide sequence of interest to be expressed (eg, in an in vitro transcription / translation system or, if the vector is introduced into a host cell, in the host cell). It is intended to be linked in a fashion to regulatory sequences. The term “regulatory sequence” is intended to include promoters, enhancers and other expression control elements (eg, polyadenylation signals). Such regulatory sequences are described, for example, by Goeddel; GENE EXP.
RESSION TECHNOLOGY: METHODS IN ENZYMO
LOGY 185, Academic Press, San Diego, Ca
if. (1990). Regulatory sequences include sequences that direct constitutive expression of nucleotide sequences in many types of host cells, and sequences that direct expression of nucleotide sequences only in particular host cells (eg, tissue-specific regulatory sequences). It will be apparent to those skilled in the art that the design of the expression vector may depend on such factors as the choice of host cell to be transformed, the level of expression of the desired protein, etc. The expression vector of the present invention can be introduced into a host cell, whereby a protein or peptide (including fusion protein or peptide) encoded by the nucleic acids described herein (eg, MBSPX protein, or MBSPX).
Mutated forms, fusion proteins, etc.) can be produced.

The recombinant expression vector of the invention may be used in prokaryotic or eukaryotic cells,
It can be designed for MBSPX expression. For example, MBSPX can be expressed in bacterial cells (eg, E. coli), insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. A suitable host cell is Goed
del; GENE EXPRESSION TECHNOLOGY: METHO
DS IN ENZYMOLOGY 185, Academic Press,
San Diego, Calif. (1990) for further discussion. Alternatively, the recombinant expression vector may include, for example, T7 promoter regulatory sequences and T7
It can be transcribed and translated in vitro using a polymerase.

Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. executed in E. coli. Fusion vectors add a number of amino acids to the protein encoded therein, usually at the amino terminus of recombinant proteins. Such fusion vectors are typically
Useful for three purposes: (1) increasing the expression of the recombinant protein; (2) increasing the solubility of the recombinant protein; and (3) acting as a ligand in affinity purification. Assist in purifying the replacement protein. Often, in a fusion expression vector, a proteolytic cleavage site is introduced at the junction of the fusion moiety, and this recombinant protein allows the recombinant protein to be separated from the fusion moiety after purification of the fusion protein. . Such enzymes, and their cognate recognition sequences, include Factor Xa,
Includes thrombin and enterokinase. As a typical fusion expression vector, glutathione S-transferase (GST), maltose E binding protein, or protein A is fused to the target recombinant protein, respectively.
GEX (Pharmacia Biotech Inc .; Smith and
Johnson (1988) Gene 67: 31-40), pMAL (Ne.
w England Biolabs, Beverly, Mass. ) And p
RIT5 (Pharmacia, Piscataway, NJ) is mentioned.

Appropriate inducible unfused E. An example of an E. coli expression vector is pTrc (Amra
nn et al. (1988) Gene 69: 301-315) and pET 11d (
Studio et al., GENE EXPRESSION TECHNOLOGY:
METHODS IN ENZYMOLOGY 185, Academic P
less, San Diego, Calif. (1990) 60-89).

E. One strategy for maximizing recombinant protein expression in E. coli is to express the protein in a host bacterium with impaired ability to proteolytically cleave the recombinant protein. Gottesman, GENE
EXPRESSION TECHNOLOGY: METHODS IN ENZ
YMOLOGY 185, Academic Press, San Diego
, Calif. (1990) 119-128. Another strategy is that the individual codons for each amino acid are E. to change the nucleic acid sequence of the nucleic acid inserted into the expression vector so that it is the preferentially utilized codon in E. coli (Wada et al. (1992) Nucleic Acids Res. 20).
: 2111-2118). Such nucleic acid sequence alterations of the present invention can be performed using standard DN
A synthesis technique.

[0212] In another embodiment, the MBSPX expression vector is a yeast expression vector. Yeast S. Examples of vectors for expression in S. cerevisiae include pYe
pSec1 (Baldari et al., (1987) EMBO J 6: 229-23.
4), pMFa (Kurjan and Herskowitz, (1982) Ce.
11: 30: 933-943), pJRY88 (Schultz et al., (1987).
) Gene 54: 113-123), pYES2 (Invitrogen C
corporation, San Diego, Calif. ), And picZ
(InVitrogen Corp., San Diego, Calif.).

Alternatively, MBSPX can be expressed in insect cells using a baculovirus expression vector. Baculovirus vectors available for expression of proteins in cultured insect cells (eg, SF9 cells) include pAc series (Sm
ith et al. (1983) Mol Cell Biol 3: 2156-2165).
And pVL series (Lucklow and Summers (1989) Vi
170: 31-39).

In yet another embodiment, the nucleic acids of the invention are expressed in mammalian cells using mammalian expression vectors. An example of a mammalian expression vector is pCDM8
(Seed (1987) Nature 329: 840) and pMT2PC (
Kaufman et al. (1987) EMBO J 6: 187-195). When used in mammalian cells, the expression vector's control functions are often
Provided by the regulatory elements of the virus. For example, commonly used promoters are derived from polyoma, adenovirus 2, cytomegalovirus, and simian virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells, see, eg, Sambrook et al., MOLECUL.
AR CLONING: A LABORATORY MANUAL. Second edition, C
old Spring Harbor Laboratory, Cold Sp
ring Harbor Laboratory Press, Cold Sp
ring Harbor, N.M. Y. , 1989, chapters 16 and 17.

In another embodiment, the recombinant mammalian expression vector can direct the expression of the nucleic acid preferentially in a particular cell type (eg, use the tissue-specific regulatory elements to express the nucleic acid). . Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include albumin promoter (liver-specific; Pinkert et al. (1987) Genes Dev 1: 268-2.
77), lymphoid-specific promoters (Calame and Eaton (1988).
Adv Immunol 43: 235-275), at specific promoters of the T cell receptor (Winoto and Baltimore (1989).
EMBO J 8: 729-733) and in specific promoters of immunoglobulins (Banerji et al. (1983) Cell 33: 729-740;
Queen and Baltimore (1983) Cell 33: 741-7.
48), neuron-specific promoters (eg, neurofilament promoter; Byrne and Rudle (1989) PNAS 86: 5473.
-5477), pancreas-specific promoter (Edlund et al. (1985) Scie.
230: 912-916), as well as mammary gland-specific promoters (eg, milk whey promoter; US Pat. No. 4,873,316 and EP-A-264,166). Developmentally regulated promoters are also included (eg, the murine hox promoter (K
Essel and Gruss (1990) Science 249: 374-3.
79) and the α-fetoprotein promoter (Campes and Tilg)
hman (1989) Genes Dev 3: 537-546).

The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in the antisense orientation. That is, the DNA molecule expresses an RNA molecule that is antisense to MBSPX mRNA (D
Operatively linked to regulatory sequences in a manner that allows (by transcription of NA molecules). The regulatory sequences will be those regulatory sequences (viral promoters and / or enhancers) that are operably linked to the cloned nucleic acid in the antisense orientation that direct the continuous expression of the antisense RNA molecule in various cell types. Regulatory sequences can be selected that direct or direct, eg, constitutive, tissue-specific, or cell-specific expression of antisense RNA. Antisense expression vectors can be in the form of recombinant plasmids, phagemids, or attenuated viruses, where the antisense nucleic acid is produced under the control of high efficiency regulatory regions,
Its activity can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes, see Weintraub et al.
"Antisense RNA as a molecular tool f
or genetic analysis ”, Reviews--Trends
See in Genetics, Volume 1 (1) 1986.

Another aspect of the present invention relates to a host cell into which the recombinant expression vector of the present invention has been introduced. The terms "host cell" and "recombinant host cell" are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell, but to the progeny or potential progeny of such a cell. Such progeny may, in fact, not be identical to the parental cell, since certain modifications may occur in subsequent generations, either due to mutations or environmental effects, but are still herein Within the scope of the term as used in.

The host cell can be any prokaryotic or eukaryotic cell. For example, M
The BSPX protein can be expressed in bacterial cells (eg, E. coli), insect cells, yeast or mammalian cells (eg, Chinese Hamster Ovary cells (CHO) or COS cells). Other suitable host cells are known to those of skill in the art.

Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms “transformation” and “transfection” refer to various art-recognized techniques for introducing exogenous nucleic acid (eg, DNA) into a host cell. As intended, these include calcium phosphate or calcium chloride co-precipitation, DEAE dextran mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells are described by Sambrook et al. (MOLECULAR C
LONING: A LABORATORY MANUAL. Second Edition, Cold
Spring Harbor Laboratory, Cold Spring
Harbor Laboratory Press, Cold Spring
Harbor, N.M. Y. , 1989) and other laboratory manuals.

For the transfection of stable mammalian cells, depending on the expression vector and transfection technique used, only a small proportion of the cells will be exogenous D
It is known that NA can be integrated into its genome. To identify and select for these elements, a gene encoding a selectable marker (eg, resistance to antibiotics) is generally introduced into the host cell along with the gene of interest. Various selectable markers include those that confer resistance to drugs such as G418, hygromycin, and methotrexate. The nucleic acid encoding the selectable marker can be introduced into the host cell on the same vector as the vector encoding MBSPX or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (eg, cells that have incorporated the selectable marker gene will survive while other cells die).

Host cells of the invention (eg, prokaryotic and eukaryotic host cells in culture) can be used to produce (ie, express) MBSPX protein. Accordingly, the invention further provides methods for producing MBSPX proteins using the host cells of the invention. In one embodiment, the method of the invention comprises culturing a host cell of the invention, in which a recombinant expression vector encoding MBSPX has been introduced, in a suitable medium in which the MBSPX protein is produced. The step of performing is included. In another embodiment, the invention further comprises the step of isolating MBSPX from the medium or host cells.

Transgenic Animals The host cells of the invention can also be used to produce nonhuman transgenic animals. For example, in one embodiment, the host cell of the invention is MBSP
A fertilized oocyte or embryonic stem cell into which the X coding sequence has been introduced. Such host cells can then be used to produce non-human transgenic animals with exogenous MBSPX sequences introduced into their genome, or homologous recombinant animals with altered endogenous MBSPX sequences. Such animals are useful for studying MBSPX function and / or activity, and for identifying and / or evaluating modulators of MBSPX activity. As used herein, a "transgenic animal" is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, of which animal One or more cells contain the transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians and the like. A transgene is an exogenous DNA that integrates into the genome of a cell (from which a transgenic animal develops) and remains in the genome of a mature animal, thereby producing one or more cell types of the transgenic animal. Alternatively, it directs the expression of the encoded gene product in the tissue. As used herein,
The “homologous recombinant animal” is a non-human animal, preferably a mammal, more preferably a mouse, in which the endogenous MBSPX gene is the same as the endogenous gene before the development of the animal. Modified by homologous recombination with an exogenous DNA molecule introduced into the animal's cells (eg, the animal's embryonic cells).

The transgenic animals of the present invention have a nucleic acid encoding MBSPX introduced into the male pronucleus of fertilized oocytes by, for example, microinjection, retroviral infection, and the oocytes were pseudopregnant. Female rearing animal (fos)
ter animals). The human MBSPX cDNA sequence of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, or 23 can be introduced as a transgene into the genome of a non-human animal. Alternatively, a non-human homolog of the human MBSPX gene (eg, the mouse MBSPX gene) can be isolated based on hybridization to the human MBSPX cDNA (described further below) and used as a transgene. Intron sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. Tissue-specific regulatory sequence (s) can be used to target MBSPX to specific cells.
It can be operably linked to the MBSPX transgene to direct expression of the protein. Methods for producing transgenic animals, particularly animals such as mice, via embryo manipulation and microinjection are conventional in the art and are described, for example, in US Pat. No. 4,736,866. The same number 4,87
0,009; and 4,873,191; and Hogan 198.
6, MANIPULATING THE MOUSE EMBRYO, Cold
Spring Harbor Laboratory Press, Cold
Spring Harbor, N.M. Y. It is described in. Similar methods are used for the production of other transgenic animals. A transgenic founder animal can be identified based on the presence of the MBSPX transgene in its genome and / or the expression of MBSPX mRNA in the tissues or cells of the animal. The transgenic founder animal can then be used to breed additional animals carrying the transgene. In addition, transgenic animals carrying a transgene encoding MBSPX can be further bred to other transgenic animals carrying other transgenes.

In order to generate a homologous recombinant animal, a vector containing at least a part of the MBSPX gene is prepared. Deletions, additions, or substitutions have been introduced in this gene, thereby altering (eg, functionally disrupting) its MBSPX gene. The MBSPX gene is a human gene (eg, SEQ ID NOs: 1, 3, 5, 7
, 9, 11, 13, 15, 17, 19, 21, or 23)), but more preferably a non-human homologue of the human MBSPX gene. For example, a mouse homologue of the human MBSPX gene of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, or 23 alters the endogenous MBSPX gene in the mouse genome. Can be used to construct an appropriate homologous recombination vector. In one embodiment, the vector is designed such that upon homologous recombination, its endogenous MBSPX gene is functionally disrupted (ie, it no longer encodes a functional protein; also known as a “knockout” vector). Will be).

Alternatively, the vector may be designed such that for homologous recombination, the endogenous MBSPX gene is mutated or otherwise altered, but still encodes a functional protein ( For example, upstream regulatory regions may be altered, thereby altering the expression of the endogenous MBSPX protein). In the homologous recombination vector, the altered portion of the MBSPX gene is flanked by additional nucleic acid of the MBSPX gene at its 5'and 3'ends, and homologous recombination is carried out with the exogenous MBSPX gene carried by the vector. Endogenous MBSPX in stem cells
Allows to happen with genes. The additional flanking MBSPX nucleic acid is
It is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (at both the 5'and 3'ends) are included in the vector. See, for example, Thomas et al. (1987) Cell 51: 503 for a description of homologous recombination vectors. This vector has been introduced (eg, by electroporation) into an embryonic stem cell line and the MBS introduced
Cells in which the PX gene has homologous recombination with the endogenous MBSPX gene are selected (see, eg, Li et al. (1992) Cell 69: 915).

The selected cells are then injected into the blastocyst of an animal (eg, mouse) to form an aggregated chimera. For example, Teratoca from Bradley (1987)
rcinomas and Embryonic Stem Cells: A
Practical Approach, edited by Robertson, IRL, Ox
See ford, pages 113-152. The chimeric embryo can then be transferred to a suitable pseudopregnant female foster animal and the embryo is delivered. Offspring carrying the DNA that has undergone homologous recombination in their germ cells can be used to breed animals,
All cells of this animal contain homologous recombination DNA by germline transmission of the transgene. Methods for constructing homologous recombination vectors and homologous recombinant animals are described further below; Bradley (1991) Curr Opin.
Biotechnol 2: 823-829; PCT International Publication Number: WO90.
/ 11354; WO91 / 01140; WO92 / 0968; and WO / 93.
/ 04169.

In another embodiment, non-human transgenic animals can be produced that contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre / loxP recombinase system of bacteriophage P1. c
For a description of the re / loxP recombinase system, see, eg, Lakso et al.
992) PNAS 89: 6232-6236. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al. (1991) Science 251).
: 1351-1355). If the cre / loxP recombinase system is used to regulate transgene expression, an animal containing the transgene encoding both the Cre recombinase and the selected protein is required. Such animals are, for example, "doubled" by crossing two transgenic animals, one containing the transgene encoding the selected protein and the other containing the transgene encoding the recombinase. It can be provided by the construction of transgenic animals.

A clone of the transgenic non-human animal described herein also contains W
can be produced according to the method described in ilmut et al. (1997) Nature 385: 810-813. Briefly, cells from transgenic animals (
For example, somatic cells) are isolated and derived, exits from the growth cycle, and may enter the G ₀ phase. The quiescent cells are then treated with, for example, the use of electric pulses.
The quiescent cells can be fused to oocytes isolated from the same animal from which they are isolated. The reconstructed oocytes are then cultured, which allows them to develop into morula or undifferentiated embryo cells and then transferred to pseudopregnant female foster animals. The offspring born from this female foster animal is a clone of the animal whose cells (eg, its somatic cells) have been isolated.

Pharmaceutical Compositions MBSPX nucleic acid molecules, MBSPX proteins, and anti-MBSPX antibodies of the invention (also referred to herein as “active compounds”), and derivatives, fragments thereof, Analogs and homologues can be incorporated into pharmaceutical compositions suitable for administration. Such a composition typically comprises a nucleic acid molecule, a protein or antibody, and a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable carrier" means any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents compatible with pharmaceutical administration. And absorption delaying agents and the like.
The use of such media and agents for pharmaceutically active substances is well known in the art. Except to the extent that any conventional vehicle or drug is incompatible with the active compound, its use in the composition is considered. Supplementary active compounds can also be incorporated into the compositions.

A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral (eg, intravenous, intradermal, subcutaneous) administration, oral (
For example, inhalation), transdermal (topical) administration, transmucosal
) Administration, and rectal administration. Solutions or suspensions used for parenteral, intradermal or subcutaneous application may include the following components: water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or others. Diluents such as synthetic solvents; benzyl alcohol or methylparaben; antibacterial agents; ascorbic acid or sodium bisulfite; antioxidants; chelating agents such as ethylenediaminetetraacetic acid; acetate salts; Buffers, such as acid salts or phosphates, and agents for the adjustment of tonicity, such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (wherein water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. . For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cr
emophor EL ^™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be easy to syringability.
It should be fluid to the extent that ty) is present. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example: water, ethanol, polyols (eg glycerol,
Propylene glycol, and liquid polyethylene glycol, etc.) and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, ascorbic acid, thimerosal and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions are prepared by incorporating the required amount of the active compound, eg, MBSPX protein or anti-MBSPX antibody, in a suitable solvent with one or a combination of the ingredients listed above. In some cases, it can be prepared by subsequent filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the method of preparation is vacuum drying and freeze-drying, whereby a powder of the active ingredient and any further desired ingredients from that solution which has already been sterile filtered is obtained. To get

Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash,
Here, the compound in the fluid carrier is applied orally and swallowed and exhaled or swallowed. Pharmaceutically compatible binders, and / or adjuvant materials can be included as part of the composition.
Tablets, pills, capsules, troches, etc. may contain any of the following ingredients or compounds having similar properties: binders (eg microcrystalline cellulose, gum tragacanth or gelatin); excipients (eg starches). Or lactose), disintegrants (eg, alginic acid, Primogel, or corn starch); lubricants (
For example, magnesium stearate or Sterotes; slip agents (gli
dant) (eg colloidal silicon dioxide); a sweetener (eg sucrose or saccharin); or a flavoring agent (eg peppermint, methyl salicylate, or orange flavor).

For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, eg, a gas such as carbon dioxide, or a nebulizer.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example:
For transmucosal administration, surfactants, bile salts, and fusidic acid derivatives can be mentioned. Transmucosal administration can be accomplished by nasal spray or the use of suppositories. For transdermal administration, the active compound is formulated into ointments, ointments, gels or creams generally known in the art.

The compounds are also suppositories for rectal delivery (eg, with conventional suppository bases such as cocoa butter and other glycerides) or rentio.
n) Can be prepared in the form of an enema.

In one embodiment, the active compound is prepared with a carrier that protects the compound against rapid elimination from the body (eg, controlled release formulations),
This includes implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
Methods for the preparation of such formulations will be apparent to those of skill in the art. These materials are also available from Alza Corporation and Nova Pharma.
scientifics, Inc. It is commercially available from and can be obtained. Liposomal suspensions, including liposomes targeted to cells infected with monoclonal antibodies against viral antigens, can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, such as those described in US Pat. No. 4,522,811.

It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically individual units suitable as unitary dosages for the subject to be treated; each unit being associated with a required pharmaceutical carrier. It contains a predetermined amount of active compound calculated to produce the desired therapeutic effect. Details regarding the dosage unit forms of the present invention are determined by the unique characteristics of the active compound and the particular therapeutic effect achieved, as well as the limitations inherent in the art of formulating such active compounds for treatment of individuals. Is done or depends directly on these.

The nucleic acid molecule of the present invention can be inserted into a vector and used as a gene therapy vector. The gene therapy vector is administered to the subject, for example, by intravenous injection, local administration (see US Pat. No. 5,328,470), or stereotactic injection (see US Pat. No. 5,328,470).
For example, see Chen et al. (1994) PNAS 91: 3054-3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can include a sustained release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells (eg, retroviral vectors), the pharmaceutical preparation can include one or more cells that produce the gene delivery system.

The pharmaceutical composition can be included in a container, package, or dispenser together with instructions for administration.

Uses and Methods of the Invention The isolated nucleic acid molecules of the present invention can be used as described further below in MBSPX.
To express proteins (eg, via recombinant expression vectors in host cells for gene therapy applications), to detect gene damage in MBSPX mRNA (eg, in a biological sample) or MBSPX gene, as well as MBSPX activity Can be used to adjust In addition, the MBSPX protein has decreased or aberrant activity as compared to screening for drugs or compounds that modulate MBSPX activity or expression, as well as by insufficient or overproduction of the MBSPX protein, or as compared to the MBSPX wild-type protein. With disorders characterized by the production of MBSPX protein forms having, for example, proliferative disorders such as cancer or preclampsia, immune system disorders and inflammation, neurological disorders, and skin and muscle disorders. Can be used for. Furthermore, the anti-MBSPX antibody of the present invention is
It can be used to detect and isolate the X protein and to modulate MBSPX activity.

The present invention further relates to novel agents identified by the screening assays described above, and their use for treatment as described herein.

Screening Assays The present invention provides candidate or test compounds or agents that bind to modulators, ie, MBSPX proteins, or have a stimulatory or inhibitory effect on, for example, MBSPX expression or MBSPX activity. Methods for identifying (eg, peptides, peptidomimetics, small molecules or other drugs) (also referred to herein as “screening assays”) are provided.

In one embodiment, the invention features an MBSPX protein or polypeptide,
Alternatively, an assay is provided for screening candidate or test compounds that bind to or modulate the activity of the membrane bound form of its biologically active portion. The test compounds of the invention can be obtained using any of a number of approaches in combinatorial library methods known in the art, including: biological libraries; spatially. Accessible parallel solid phase or solution phase libraries; synthetic library methods that require deconvolution; "one bead, one compound" library methods; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches include peptides,
Applicable to small molecule libraries of non-peptide oligomers or compounds (
Lam (1997) Anticancer Drug Des 12: 145)
.

Examples of methods for the synthesis of molecular libraries can be found in the art, for example: DeWitt et al. (1993) Proc Natl Acad.
Sci U. S. A. 90: 6909; Erb et al. (1994) Proc Nat.
l Acad Sci U.I. S. A. 91: 11422; Zuckermann
Et al. (1994) J Med Chem 37: 2678; Cho et al. (1993).
Science 261: 1303; Carrell et al. (1994) Angew.
Chem Int Ed Engl 33: 2059; Carell et al. (19).
94) Angew Chem Int Ed Engl 33: 2061; and Gallop et al. (1994) J Med Chem 37: 1233.

Compound libraries are available in solution (see, eg, Houghten (1992).
BioTechniques 13: 412-421) or on beads (L
am (1991) Nature 354: 82-84) on chip (Fodor)
(1993) Nature 364: 555-556), bacteria (Ladner.
US Pat. No. 5,223,409), spores (Ladner USP'409),
Plasmid (Cull et al. (1992) Proc Natl Acad Sci
USA 89: 1865-1869) or on phage (Scott and Sm.
ith (1990) Science 249: 386-390; Devlin (
(1990) Science 249: 404-406; Cwirla et al. (199).
0) Proc Natl Acad Sci U. S. A. 87: 6378-6
382; Felici (1991) J Mol Biol 222: 301-3.
10; Ladner, supra).

In one embodiment, the assay is a cell-based assay, wherein MB
Cells expressing the membrane-bound form of the SPX protein, or a biologically active portion thereof, on the cell surface are contacted with a test compound, and the test compound is MBSP
The ability to bind the X protein is determined. For example, the cell can be of mammalian origin or a yeast cell. Determining the ability of the test compound to bind to the MBSPX protein can be accomplished, for example, by coupling the test compound with a radioisotope label or an enzyme label to bind the test compound to the MBSPX protein or a biologically active portion thereof. Can be determined by detecting its labeled compound in the complex. For example, test ^{compounds, 125 I, 3 5 S,} 14 C or ³ can be labeled with, either directly or indirectly H,, and its radioactive isotopes, by direct counting of radioemission or scintillation, It can be detected by counting. Alternatively, the test compound can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determining conversion of the appropriate substrate to product. . In one embodiment, the assay involves contacting cells expressing a membrane-bound form of MBSPX protein, or a biologically active portion thereof, on its cell surface with a known compound that binds MBSPX to form an assay mixture. And contacting the assay mixture with a test compound, as well as determining the ability of the test compound to interact with the MBSPX protein, wherein the ability of the test compound to interact with the MBSPX protein is determined. The step of determining is that the test compound is MBSPX, or a biologically active portion thereof,
Determining the ability to bind preferentially as compared to known compounds.

[0248] In another embodiment, the assay is a cell-based assay and MBSP
Contacting a cell expressing a membrane-bound form of the X protein or a biologically active portion thereof on the cell surface with a test compound, as well as the test compound comprising MBS
The step of determining the ability to modulate (eg, stimulate or inhibit) the activity of the PX protein or biologically active portion thereof. This test compound is MBSPX,
Alternatively, determining the ability to modulate the activity of a biologically active portion thereof can be accomplished by, for example, MB
This can be accomplished by determining the ability of the SPX protein to bind to or interact with MBSPX target molecules. As used herein, a "target molecule" is a molecule with which the MBSPX protein naturally binds or interacts, eg, a molecule on the surface of a cell expressing the MBSPX protein, of a second cell. It is a molecule on the surface, a molecule in the extracellular environment, a molecule that associates with the inner surface of the cell membrane, or a cytoplasmic molecule. The MBSPX target molecule is a non-MBS of the present invention.
It can be a PX molecule or a MBSPX protein or polypeptide. In one embodiment, the MBSPX target molecule is a component of a signal transduction pathway that involves an extracellular signal through the cell membrane and into the cell (eg, the compound is a membrane-bound MBS).
It promotes the transmission of signals generated by binding to PX molecules. The target can be, for example, a second intracellular protein having catalytic activity or a protein that facilitates the association of a downstream signaling molecule with MBSPX.

Determining the ability of an MBSPX protein to bind to or interact with an MBSPX target molecule can be accomplished by one of the above methods for determining direct binding. In one embodiment, determining the ability of the MBSPX protein to bind to or interact with the MBSPX target molecule can be accomplished by determining the activity of the target molecule. For example, the activity of this target molecule can be detected by detecting the induction of its target cellular second messenger (ie, intracellular Ca ²⁺ , diacylglycerol, IP _3, etc.), the target's catalytic activity / enzymatic activity. Detecting a reporter gene (a detectable marker (eg,
Luciferase) comprising an MBSPX-responsive regulatory element operably linked to a nucleic acid encoding luciferase) or by detecting a cellular response (eg, cell viability, cell differentiation, or cell proliferation). , Can be determined.

In yet another embodiment, the assay of the present invention is a cell-free assay, M
Contacting the BSPX protein or biologically active portion thereof with a test compound, as well as determining the ability of the test compound to bind the MBSPX protein or biologically active portion thereof. MBS of this test compound
Binding to the PX protein can be determined either directly or indirectly, as described above. In one embodiment, the assay comprises contacting a MBSPX protein or biologically active portion thereof with a known compound that binds MBSPX to form an assay mixture, the assay mixture being contacted with a test compound. And a step of determining the ability of the test compound to interact with the MBSPX protein, wherein the step of determining the ability of the test compound to interact with the MBSPX protein comprises: And determining the ability to bind preferentially to MBSPX or a biologically active portion thereof.

[0251] In another embodiment, the assay is a cell-free assay, wherein the MBSPX protein or biologically active portion thereof is contacted with a test compound, as well as the test compound is an MBSPX protein or biologically active thereof. Determining the ability of the active moiety to modulate (eg, stimulate or inhibit) the activity of the active moiety. Determining the ability of this test compound to modulate the activity of MBSPX is accomplished, for example, by determining the ability of the MBSPX protein to bind an MBSPX target molecule by one of the methods described above for determining direct binding. Can be done. In an alternative embodiment, the determination of the ability of this test compound to modulate the activity of MBSPX is MBSPX.
This can be achieved by determining the ability of the X protein to further regulate the MBSPX target molecule. For example, the catalytic / enzymatic activity of the target molecule on the appropriate substrate can be determined as described above.

In yet another embodiment, the cell-free assay comprises contacting a MBSPX protein or biologically active portion thereof with a known compound that binds MBSPX to form an assay mixture, the assay mixture comprising: The step of contacting with a test compound, as well as determining the ability of this test compound to interact with the MBSPX protein, wherein determining the ability of this test compound to interact with the MBSPX protein is determined by Determining the ability to bind preferentially to a target molecule or to preferentially modulate the activity of that target molecule.

The cell-free assay of the present invention is acceptable for the use of MBSPX, both soluble and membrane bound forms. For cell-free assays that include a membrane-bound form of MBSPX, it may be desirable to utilize a solubilizer so that the membrane-bound form of MBSPX is maintained in solution. Examples of such solubilizers include nonionic surfactants such as n-octyl glucoside, n-dodecyl glucoside, n-dodecyl maltoside, octanoyl-N-methylglucamide, decanoyl-N. -Methylglucamide, Triton® X-100, Triton
(Registered trademark) X-114, Thesit (registered trademark), isotridecyl poly (ethylene glycol ether) _n (Isotridecypoly (ethyl)
ne glycol ether) _n , 3- (3-colamidopropyl) dimethylammonio-1-propanesulfonate (3- (3-cholamidopro)
pyl) dimethylamminiol-1-propane sulfo
(CHAPS), 3- (3-colamidopropyl) dimethylammonio-2-hydroxy-1-propanesulfonate (3- (3-cholamido).
Propyl) dimethylamminiol-2-hydroxy-1--
Propane sulphonate (CHAPSO) or N-dodecyl-N, N-dimethyl-3-ammonio-1-propanesulfonate.

In more than one embodiment of the above assay methods of the invention, MBSPX, or any of its target molecules, is immobilized to facilitate separation of the complex form from the uncomplexed form of one or both of its proteins. And applied to the automation of the assay. The binding of a test compound to MBSPX or the interaction of MBSPX with a target molecule in the presence and absence of a candidate compound is
It can be accomplished in any container suitable for containing these reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes. In one embodiment, a fusion protein may be provided that adds a domain that allows one or both of the proteins to be bound to a matrix. For example, a GST-MBSPX fusion protein or a GST target fusion protein can be prepared using glutathione sepharose beads (Sigma Chemical,
St. (Louis, MO) or glutathione derivatized microtiter plates, which are then combined with the test compound or with the test compound and either non-adsorbed target protein or MBSPX protein, and the mixture is Incubated under conditions that contribute to complex formation (eg, physiological conditions with respect to salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components, in the case of beads the matrix is fixed,
Complexes are determined either directly or indirectly, eg, as described above. Alternatively, the complex can be dissociated from the matrix and the level of MBSPX binding or activity determined using standard techniques.

Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention. For example, either MBSPX or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated MBSPX or target molecules can be prepared from biotin NHS (N-hydroxysuccinimide) using techniques well known in the art (eg, biotinylation kit, Pierce Chemicals, R.
ockford, Ill. ), And streptavidin coated 96-well plates (Pierce Chemical). Alternatively, an antibody that is reactive with MBSPX or the target molecule but does not interfere with the binding of the MBSPX protein to its target molecule can be derivatized to the wells of the plate,
Unbound target or MBSPX can then be trapped in the wells by antibody conjugation. Methods for detecting such complexes include immunodetection of the complex using MBSPX or an antibody reactive with the target molecule, as well as those described above for the GST-immobilized complex, as well as MBSPX or the target. Enzyme-linked assays that rely on the detection of enzyme activity associated with the molecule are included.

In another embodiment, modulators of MBSPX expression are identified in a method of contacting a cell with a candidate compound and determining the expression of MBSPX mRNA or protein in the cell. MBSPX mRN in the presence of candidate compound
A or protein expression level is MBSPX m in the absence of candidate compound.
The expression level of RNA or protein is compared. The candidate compound can then be identified as a modulator of MBSPX expression based on this comparison. For example, if the expression of MBSPX mRNA or protein is greater (statistically significantly greater) in the presence of the candidate compound than in the absence thereof, then the candidate compound is identified as a stimulator of MBSPX mRNA or protein expression. To be done. Alternatively, if the expression of MBSPX mRNA or protein is less in its presence (statistically significantly less) than in the absence of the candidate compound, the candidate compound is identified as an inhibitor of MBSPX mRNA or protein expression. . The expression level of MBSPX mRNA or protein in cells is M
It can be determined by the methods described herein for detecting BSPX mRNA or protein.

In yet another aspect of the invention, MBSPX proteins are used as “bait proteins” in two-hybrid or three-hybrid assays (eg, US Pat. No. 5,283,317; Zervos et al. (1
993) Cell 72: 223-232; Madura et al. (1993) JB.
iol Chem 268: 12046-12054; Bartel et al. (199).
3) BioTechniques 14: 920-924; Iwabuschi.
(1993) Oncogene 8: 1693-1696; and Brent.
WO94 / 10300), binds to or interacts with MBSPX (“MBSPX binding protein” or “MBSPX-bp”),
And other proteins that regulate MBSPX activity can be identified. MB like this
SPX binding proteins also appear to be involved in signal transduction by MBSPX proteins, eg as upstream or downstream elements of the MBSPX pathway.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, this assay utilizes two different DNA constructs. In one construct, the gene encoding MBSPX is D of a known transcription factor (eg, GAL-4).
It is fused to the gene encoding the NA binding domain. In the other construct,
A DNA sequence encoding an unidentified protein ("prey" or "sample") from a library of DNA sequences is fused to a gene encoding the activation domain of a known transcription factor. If the "bait" and "prey" proteins can interact in vivo to form an MBSPX-dependent complex, then the DN of this transcription factor
The A binding domain and activation domain are in close proximity (close MB
SPXimity). Being in this proximity (This MBSPXimity)
Allows transcription of a reporter gene (eg, LacZ) operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and MB
It can be used to obtain a cloned gene that encodes a protein that interacts with SPX.

The present invention further relates to novel agents identified by the screening assays described above and the use of these agents for the treatments described above.

Detection Assays Portions or fragments of the cDNA sequences identified herein (and the corresponding complete gene sequences) can be used in many ways as polynucleotide reagents. For example, these sequences can be used (i) to map each gene on the chromosome; and thus to locate the genetic region associated with the genetic disease; (ii
) Individuals can be identified from minute biological samples (tissue typing); and (ii
i) It may help forensic identification of biological samples. These applications are described in the sections below.

Chromosome Mapping Once a gene sequence (or part of a sequence) has been isolated, this sequence can be used to map the position of the gene on the chromosome. This process is called chromosome mapping. Thus, portions or fragments of the MBSPX sequences described herein can be used to map the position of the MBSPX gene on the chromosome, respectively. Mapping the MBSPX sequences to chromosomes is an important first step in correlating these sequences with genes associated with disease.

Briefly, the MBSPX gene can be mapped to the chromosome by preparing PCR primers (preferably 15-25 bp in length) from the MBSPX sequence. Computer analysis of MBSPX sequences can be used to rapidly select primers that do not span more than one exon in genomic DNA, thus complicating the amplification process. These primers can then be used for PCR screening of somatic cell hybrids containing individual human chromosomes. MBSP
Only hybrids containing the human gene corresponding to the X sequence will yield an amplified fragment.

Somatic cell hybrids are prepared by fusing somatic cells from different mammals (eg, human and mouse cells). As human and mouse cell hybrids grow and divide, they gradually lose human chromosomes in a random order, but retain mouse chromosomes. The use of media in which mouse cells are unable to grow (because they lack certain enzymes), but human cells are able to grow, maintains one human chromosome containing the gene encoding the required enzyme. By using different media, a panel of hybrid cell lines can be established.
Each cell line in the panel contains either a single human chromosome or a small number of human chromosomes and a complete set of mouse chromosomes, which makes it easy to map individual genes to specific human chromosomes (D'Eustachio
(1983) Science 220: 919-924). Somatic cell hybrids containing only fragments of the human chromosome can also be generated by using human chromosomes with translocations and deletions.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning specific sequences to specific chromosomes. Three or more sequences can be assigned per day using one thermal cycler. Designing oligonucleotide primers using the MBSPX sequence results in sublocalization.
Can be achieved with a panel of fragments from a particular chromosome.

Fluorescence in situ hybridization (FISH) of DNA sequences to metaphase chromosome spreads can further be used to provide precise chromosomal location in one step. Chromosome spreads can be performed using cells whose division was blocked in metaphase by chemicals such as colcemid, which disrupts the chromosome spindle. This chromosome can be briefly treated with trypsin and then Giemsa stained. A pattern of light and dark bands develops on each chromosome so that the chromosomes can be individually identified. FISH technology can be used with DNA sequences as short as 500 or 600 bases. However, clones larger than 1,000 bases are more likely to bind to unique chromosomal locations with sufficient signal strength for easy detection. Preferably 1,000 bases, and more preferably 2,000 bases, are sufficient to obtain good results in a reasonable amount of time. For a review of this technology, see Verma et al., HUMAN CHROMOSOMES: A MANUAL.
OF BASIC TECHNIQUES (Pergamon Press,
See New York 1988).

Chromosomal mapping reagents can be used individually to mark a single chromosome or a single site on that chromosome, or a panel of reagents can be multisite and / or
Or it can be used to mark multiple chromosomes. Reagents corresponding to the non-coding regions of the gene are, in fact, preferred for mapping purposes. The coding sequences are conserved within the gene family and therefore the chances of cross-hybridization during chromosomal mapping are likely to increase.

Once a sequence has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. Such data is, for example,
McKusick, MENDELIAN INHERITANCE IN MA
N (Johns Hopkins University Welch Med
(available online through icial library). Then the relationship between genes and diseases that map to the same chromosomal region is:
For example, Egeland et al. (1987) Nature, 325: 783-787.
Can be identified by the linkage analysis (co-inheritance of physically adjacent genes) described in.

In addition, differences in DNA sequences between individuals who are afflicted with a disease associated with the MBSPX gene and individuals who are not afflicted with this disease can be determined. If the mutation is found in some or all of the affected individuals, but not in any of the unaffected individuals, then the mutation is likely a candidate drug for the particular disease.
A comparison of affected and unaffected individuals generally involves structural alterations in chromosomes (eg,
Initially looking for deletions or translocations that are visible from the chromosome spread or are detectable using PCR based on their DNA sequences). Finally, complete sequencing of genes from some individuals is performed to confirm the presence of mutations and distinguish mutations from polymorphisms.

Tissue Typing The MBSPX sequences of the present invention can also be used to identify individuals from small biological samples. In this technique, genomic DNA of an individual is digested with one or more restriction enzymes and probed on Southern blots to generate unique bands for identification. The sequences of the present invention are RFLP (US Pat.
It is useful as an additional DNA marker for the "restriction fragment length polymorphism" described in No. 2,057.

In addition, the sequences of the invention may be used to provide an alternative technique for determining the DNA sequence of each base in a selected portion of the individual's genome. Thus, the MBSPX sequences described herein can be used to prepare two PCR primers from the 5'and 3'ends of the sequences. These primers can then be used to amplify the individual's DNA and sequence it sequentially.

The panel of corresponding DNA sequences from individuals prepared in this way was
Having a unique set of such DNA sequences due to allelic differences,
It may provide unique identification. The sequences of the invention can be used to obtain such discriminating sequences from individuals and tissues. The MBSPX sequences of the present invention uniquely represent a portion of the human genome. Allelic variation can occur to some extent in the coding regions of these sequences, and to a greater extent in non-coding regions. Allelic variation between individual humans occurs about once every 500 bases. The high degree of allelic variation is due to single nucleotide polymorphisms (SNPs), including restriction fragment length polymorphisms (RFLPs).

Each of the sequences described herein is labeled with a standard (as opposed to DNA from an individual).
Can be compared for identification purposes) to some extent. Not so many sequences are required to distinguish individuals, as more polymorphisms occur in non-coding regions. SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 1
The 7, 19, 21, or 23 non-coding sequences may comfortably provide positive individual identification, possibly with a panel of 10-1,000 primers. These primers each yield an amplified non-coding sequence of 100 bases. Putative coding sequence (eg, SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18,
Nucleic acid sequences encoding 20, 22, or 24 amino acid sequences) are used, a more suitable number of primers for positive individual identification is between 500 and
It is 2,000.

Predictive Medicine The present invention also provides diagnostic assays, prognostic assays, drug genomes.
genomics and monitoring clinical trials are used in the field of predictive medicine, where prognosis (prediction) is used for the purpose of prophylactic treatment of individuals. Accordingly, one aspect of the present invention determines the expression of MBSPX protein and / or nucleic acid, and the activity of MBSPX in the context of a biological sample (eg, blood, serum, cells, tissues), thereby causing abnormalities. The determination of whether the individual suffers from the disease or disorder, or is at risk of developing the disorder, in relation to the expression or activity of various MBSPX. The invention also provides a prognostic (or predictive) assay for determining whether an individual is at risk of developing a disorder associated with MBSPX protein, nucleic acid expression or activity. For example, mutations in the gene for MBSPX can be assayed in biological samples. Such an assay may be used for prognostic or predictive purposes, whereby MBSP
Individuals are treated prophylactically prior to the onset of disorders characterized by or associated with the expression or activity of X proteins, nucleic acids.

Another aspect of the invention provides a method for determining the expression of MBSPX protein, nucleic acid or MBSPX activity in an individual, whereby an appropriate therapeutic or prophylactic reagent for that individual ( (Referred to herein as the "drug genome"). A drug genome is a reagent for therapeutic or prophylactic treatment of an individual based on the individual's genotype (eg, the individual's genotype tested to determine the individual's ability to respond to a particular reagent). Allows selection of (eg drug).

Yet another aspect of the invention relates to monitoring the effect of reagents (eg, drugs, compounds) on the expression or activity of MBSPX in clinical trials.

[0276]   These and other reagents are described in further detail in the sections below.

Diagnostic Assays An exemplary method for detecting the presence or absence of MBSPX in a biological sample is to obtain a biological sample from a test subject, and to add the biological sample to MBSPX. Comprising contacting a protein or a nucleic acid (eg, mRNA, genomic DNA) encoding a MBSPX protein with a compound or agent capable of detecting such that the presence of MBSPX is detected in the biological sample. . The agent for detecting MBSPX mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to MBSPX mRNA or genomic DNA. This nucleic acid probe is, for example, a full-length MBSPX nucleic acid (for example, SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15,
17, 19, 21, or 23) or a nucleic acid (for example, at least 15, 30, 50, 100, 250 or 500 nucleotides in length, which is an oligonucleotide of MBSPX mRNA or genomic DNA under stringent conditions. Sufficient nucleic acid) to specifically hybridize with. Other suitable probes for use in the diagnostic assays of the invention are described herein.

The agent for detecting the MBSPX protein is an antibody capable of binding to the MBSPX protein, preferably an antibody having a detectable label. The antibody can be polyclonal or, more preferably, monoclonal. An intact antibody or fragment thereof (eg, Fab or F (a
b ') ₂ ) can be used. The term "labeled" refers to a probe or antibody that couples a detectable substance to the probe or antibody (
That is, by physically linking the probe or antibody, as well as indirectly labeling the probe or antibody by reactivity with another reagent that is directly labeled. Is intended. Examples of indirect labeling include detection of primary antibody with a fluorescently labeled secondary antibody, and end labeling with biotin of a DNA probe so that it can be detected with fluorescently labeled streptavidin. To be The term "biological sample" is intended to include tissues, cells and biological fluids isolated from a subject as well as tissues, cells and fluids present in the subject. That is, the detection method of the present invention can be used to detect MBSPX mRNA, protein or genomic DNA in a biological sample in vitro and in vivo. For example, MBSPX mR
In vitro techniques for detection of NA include Northern hybridizations and in situ hybridizations. In vitro techniques for the detection of MBSPX proteins include enzyme-linked immunosorbent assay (EL
ISA), Western blot, immunoprecipitation and immunofluorescence. MBS
In vitro techniques for detecting PX genomic DNA include Southern hybridizations. In addition, in vivo techniques for detection of MBSPX proteins include introducing into a subject a labeled anti-MBSPX antibody. For example, the antibody can be labeled with a radioactive marker. The presence and location of radioactive markers in a subject can be detected by standard imaging techniques.

[0279] In one embodiment, the biological sample comprises protein molecules from the test subject. Alternatively, the biological sample may include mRNA molecules from the test subject or genomic DNA molecules from the test subject. A preferred biological sample is a peripheral blood leukocyte sample isolated by conventional means from a subject.

[0280] In another embodiment, the method of the present invention further comprises the step of obtaining a control biological sample from a control subject, the control sample being MBSP.
X protein, mRNA or genomic DNA is contacted with a detectable compound or agent, resulting in MBSPX protein, mRNA or genomic D
The presence of NA is detected in the biological sample, and the MBSPX protein, mRNA or genome D in the process and its control sample
Comparing the presence of NA with the presence of MBSPX protein, mRNA or genomic DNA in the test sample.

The present invention also includes a kit for detecting the presence of MBSPX in a biological sample. For example, the kit may comprise: a labeled compound or agent capable of detecting MBSPX protein or mRNA in a biological sample; a means for determining the amount of MBSPX in the sample;
And a means for comparing the standard to the amount of MBSPX in the sample.
The compound or agent can be packaged in a suitable container. The kit may further comprise instructions for using the kit to detect MBSPX proteins or nucleic acids.

Prognostic Assay The diagnostic methods described herein are further utilized to identify a subject having or at risk of developing a disease or disorder associated with aberrant expression or activity of MBSPX. obtain. For example, the assays described herein (eg,
Utilizing the diagnostic assay described above or the assay described below) to identify a subject having or at risk of developing a disorder (eg, cancer or fibrotic disorder) associated with MBSPX protein, nucleic acid expression or activity. You can Alternatively, this prognostic assay may be utilized to identify subjects who have or are at risk of developing a disease or disorder. Accordingly, the invention provides methods for identifying diseases or disorders associated with aberrant expression or activity of MBSPX. Here, the test sample is obtained from the subject and is a MBSPX protein or nucleic acid (eg,
mRNA, genomic DNA), wherein the presence of MBSPX protein or nucleic acid is a diagnostic indicator for a subject having or at risk of developing a disease or disorder associated with aberrant expression or activity of MBSPX. Is. As used herein, "test sample" refers to a biological sample obtained from a subject of interest. For example, the test sample is a biological fluid (eg, serum).
, A cell sample, or a tissue.

Further, using the prognostic assays described herein, a subject can be tested for agents (eg, agonists, antagonists, peptidomimetics, proteins, peptides, nucleic acids, small molecules, or other drug candidates). It may be determined whether or not it can be administered to treat a disease or disorder associated with aberrant expression or activity of MBSPX. For example, using such a method, a subject may have a disorder (eg, cancer or preeclampsia (precl).
ampsia)) may be effectively treated with a drug. Accordingly, the invention provides a method for determining whether a subject can be effectively treated with an agent for a disorder associated with aberrant expression or activity of MBSPX. Here, a test sample is obtained and the MBSPX protein or nucleic acid is detected (eg, where the presence of the MBSPX protein or nucleic acid is for treating a disorder associated with aberrant expression or activity of MBSPX. Is a diagnostic indicator that a drug may be administered to the subject).

The methods of the invention also detect genetic damage in the gene for MBSPX, thereby putting a subject carrying the damaged gene at risk for disorders characterized by aberrant cell proliferation and / or differentiation. It can also be used to determine whether or not. In various embodiments, the method of the invention comprises a genetic damage in a sample of cells from the subject characterized by at least one alteration affecting integrity of a gene encoding a protein of MBSPX, or Detecting the presence or absence of misexpression of the MBSPX gene. For example, such genetic damage can be detected by confirming the presence of at least one of the following: (1) deletion of one or more nucleotides from the MBSPX gene; (2) to the MBSPX gene. Addition of one or more nucleotides; (3)
Substitution of one or more nucleotides of the MBSPX gene, (4) chromosomal rearrangement of the MBSPX gene; (5) alteration in the level of messenger RNA transcripts of the MBSPX gene, (6) abnormal alteration of the MBSPX gene (eg , Genome D
(Abnormal modification of methylation pattern of NA), (7) presence of non-wild type splicing pattern of messenger RNA transcript of MBSPX gene, (8) MBSPX
Non-wild type levels of the protein of (3), (9) allelic deletion of the gene of MBSPX, and (10) inappropriate post-translational modification of the protein of MBSPX. As described herein, there are a number of known assay techniques in the art, which can be used to detect damage in the gene for MBSPX. A preferred biological sample is a peripheral blood leukocyte sample isolated from a subject by conventional means. However, any biological sample containing nucleated cells can be used, including, for example, buccal mucosal cells.

In certain embodiments, detection of damage involves the use of probes / primers in the polymerase chain reaction (PCR) (eg, US Pat. No. 4,683).
, 195 and 4,683,202) (for example, anchor P
CR or RACE PCR) or ligation chain reaction (LCR) (eg L
andegran et al. (1988) Science 241: 1077-1080.
And Nakazawa et al. (1994) PNAS 91: 360-364). The latter may be particularly useful for detecting point mutations in the gene for MBSPX) (Abravaya et al. (1995) Nucl Acids R).
es 23: 675-682). The method comprises collecting a sample of cells from a patient, isolating nucleic acid (eg, genome, mRNA, or both) from cells of the sample, one or more that specifically hybridize to the gene for MBSPX. Contacting the primer with its nucleic acid sample under conditions such that hybridization and amplification of the MBSPX gene (if present), and detecting the presence or absence of an amplification product, or its amplification product May be included and comparing the size to a control sample. It is anticipated that PCR and / or LCR may be desired to be used as a preliminary amplification step with any of the techniques used to detect the mutations described herein.

Alternative amplification methods include: Self-sustaining sequence replication (Guat).
elli et al., 1990, Proc Natl Acad Sci USA 87.
: 1874-1878), transcription amplification system (Kwoh, et al., 1989, Proc N.
atl Acad Sci USA 86: 1173-1177), Q-β replicase (Lizardi et al., 1988, BioTechnology 6: 1).
197), or any other nucleic acid amplification method, followed by detection of the amplified molecule using techniques well known to those of skill in the art. These detection schemes are particularly useful for the detection of nucleic acid molecules when such molecules are present in very low numbers.

In an alternative embodiment, mutations in the gene for MBSPX from sample cells can be identified by alterations in the restriction enzyme cleavage pattern. For example, sample and control DNA is isolated, amplified (if necessary), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. To be done. Differences in fragment length size between sample and control DNA indicate mutations in the sample DNA. Furthermore, the use of sequence-specific ribozymes (eg,
US Pat. No. 5,493,531) can be used to score for the presence of specific mutations by the occurrence or loss of ribozyme cleavage sites.

In another embodiment, the genetic mutation in MBSPX hybridizes sample and control nucleic acids (eg, DNA or RNA) to a high density array containing hundreds or thousands of oligonucleotide probes. (Cronin et al. (1996) Human Mutati)
on 7: 244-255; Kozal et al. (1996) Nature Medi.
cine 2: 753-759). For example, the genetic mutation in MBSPX is
Cronin et al., Can be identified in a two-dimensional array containing photogenerated DNA probes as described above. Briefly, the first probe hybridization array was used to scan through long stretches of DNA in samples and controls to create a linear array of consecutively overlapping probes to detect base changes between their sequences. Can be identified. This step allows the identification of point mutations. This step is followed by a second hybridization array that allows the characterization of specific mutations using a smaller specialized probe array complementary to all detected variants or mutants. is there. Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene.

In yet another embodiment, the MBSPX gene can be sequenced directly using any of a variety of sequencing reactions known in the art, and the sample MBSPX can be sequenced.
Mutations can be detected by comparing the X sequence to the corresponding wild type (control) sequence. Examples of sequencing reactions are Maxim and Gilbert (
1977) PNAS 74: 560 or Sanger (1977) PNAS.
74: 5463, which is based on the technology developed by It is also contemplated that any of a variety of automated sequencing procedures may be utilized when performing diagnostic assays (Naeve et al. (1995) BioTechniques 19).
: 448). These include sequencing by mass spectrometry (eg PCT International Publication No. WO 94/16101; Cohen et al. (1996) Adv Chrom.
atogr 36: 127-162; and Griffin et al. (1993) Ap.
pl Biochem Biotechnol 38: 147-159).

Other methods for detecting mutations in the MBSPX gene include detecting mismatch bases in RNA / RNA or RNA / DNA heteroduplexes using protection from cleavage agents. (Myers et al. (1985
) Science 230: 1242). In general, the art of "mismatch cleavage" uses RNA or DNA containing (labeled) wild-type MBSPX sequences.
Starting with the step of providing a heteroduplex formed by hybridizing with a potential mutant RNA or DNA obtained from a tissue sample. Treating this double-stranded duplex with an agent that cleaves the single-stranded region of the duplex (eg, which is present due to a base pair mismatch between its control and sample strands) To do. For example, RNA / DNA duplexes can be treated with RNase, and DNA / DNA hybrids can be treated with S1 nuclease as opposed to enzymatically digesting its mismatched regions. In other embodiments, either DNA / DNA or RNA / DNA duplexes can be treated with hydroxylamine or osmium tetroxide and piperidine to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then size-separated on a denaturing polyacrylamide gel to determine the site of mutation. For example, Cotton et al. (1988) Proc Natl Acad S.
ci USA 85: 4397; Saleeba et al. (1992) Methods.
See Enzymol 217: 286-295. In one embodiment, the control DNA or RNA can be labeled for detection.

In yet another embodiment, the mismatch cleavage reaction comprises the MBSPX obtained from a sample of cells with one or more proteins that recognize mismatched base pairs in double-stranded DNA (so-called “DNA mismatch repair” enzymes). Used in defined systems to detect and map point mutations in cDNA. For example, E. E. coli mutY enzyme cleaves A at a G / A mismatch and He
Thymidine DNA glycosylase from La cells cleaves T at a G / T mismatch (Hsu et al. (1994) Carcinogenesis 15: 1657-.
1662). In accordance with an exemplary embodiment, the MBSPX sequence (eg, wild type MB
Probes based on SPX sequences) are hybridized to cDNA or other DNA products from test cells. The duplex is treated with a DNA mismatch repair enzyme and its cleavage product (if any) can be detected, such as by electrophoresis protocols. See, eg, US Pat. No. 5,459,039.

In another embodiment, alterations in electrophoretic mobility are used to identify mutations in the MBSPX gene. For example, single-stranded conformational polymorphism (SSCP
) Can be used to detect differences in electrophoretic mobility between mutants and wild-type nucleic acids (Orita et al. (1989) Proc Natl Acad.
Sci USA: 86: 2766, also Cotton (1993) Mutat.
Res 285: 125-144; Hayashi (1992) Genet A.
nal Tech Appl 9: 73-79). Single-stranded DNA fragments of sample and control MBSPX nucleic acids are denatured and regenerated. The secondary structure of single-stranded nucleic acids varies according to sequence, and the resulting changes in electrophoretic mobility can detect even a single base change. The DNA fragment can be labeled or detected with a labeled probe. The sensitivity of the assay is such that the secondary structure is more sensitive to changes in the sequence (DNA
Can be enhanced by using RNA (rather than). In one embodiment, the method of the invention utilizes heteroduplex analysis to separate double-stranded heteroduplex molecules based on changes in electrophoretic mobility (Keen et al. (199.
1) Trends Genet 7: 5).

In yet another embodiment, migration of mutant or wild-type fragments in polyacrylamide gels containing a constant gradient of denaturing agent is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. (1985) Nature
e 313: 495). When DGGE is used as a method of analysis, the DNA is modified to ensure that it is not completely denatured, for example by adding a GC clamp for high melting GC rich DNA of approximately 40 bp by PCR. In a further embodiment, the temperature gradients are control and sample DNA.
Used in place of the denaturant gradient (R
senbaum and Reissner (1987) Biophys Che.
m 265: 12753).

Other techniques for detecting point mutations include, but are not limited to, the following: selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers are
Known mutations can be prepared to be centrally located and then hybridized to the target DNA under conditions that allow hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324). : 163
); Saiki et al. (1989) Proc Natl Acad Sci USA.
86: 6230). Such allele-specific oligonucleotides are labeled with target oligonucleotides to which the oligonucleotide is attached to the hybridizing membrane and labeled.
When A hybridizes, it hybridizes to the PCR amplified target DNA or many different mutations.

Alternatively, allele-specific amplification techniques that rely on selective PCR amplification can be used in conjunction with the present invention. Oligonucleotides used as primers for specific amplification are in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Ac).
ids Res 17: 2437-2448), or may carry the mutation of interest at the 3'-most end of one primer, which may prevent mismatches or reduce polymerase extension under appropriate conditions (Prossner). (1993)
Tibtech 11: 238). Furthermore, introducing a new restriction site in the region of the mutation may be desirable for performing cleavage-based detection (Gasp
arini et al. (1992) Mol Cell Probes 6: 1). In certain embodiments, it is expected that amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc Natl Acad.
Sci USA 88: 189). In such cases, ligation will only occur if there is an exact match at the 3'end of the 5'sequence and by searching for the presence or absence of amplification the presence of a known mutation at a particular site. Allows to detect.

The methods described herein include, for example, at least one of the methods described herein.
It may be carried out by utilizing a pre-packaged diagnostic kit comprising one probe nucleic acid or antibody reagent, for example for diagnosing a patient exhibiting symptoms or familial history of a disease or disorder comprising the MBSPX gene. It can be conveniently used in the clinical setting.

In addition, any cell type or tissue in which MBSPX is expressed, preferably peripheral blood leukocytes, can be utilized in the prognosis assay described herein. However, any biological sample containing nucleated cells can be used, including, for example, buccal mucosal cells.

Pharmacogenomics Factors, or modulators, that have a stimulatory or inhibitory effect on MBSPX activity (eg, MBSPX gene expression) are identified by the screening assays described herein. As such, it can be administered to an individual to treat (prophylactically or therapeutically) a disorder associated with aberrant MBSPX activity, such as cancer or an immune disorder, neuropathy, muscular dystrophy, or epidermolysis bullosa. Combined with such treatment, an individual's pharmacogenomics (ie, a study of the relationship between an individual's genotype and that individual's response to foreign compounds or drugs) is
Can be considered. Differences in the metabolism of therapeutic agents can lead to severe toxicity or therapeutic failure by altering the relationship between dose and blood concentration of the pharmacologically active drug. Therefore, the pharmacogenomics of an individual allows for the selection of effective agents (eg, drugs) for prophylactic or therapeutic treatment based on consideration of the individual's genotype. Such pharmacogenomics can further be used to determine the appropriate dosage and therapeutic agent regimen. Accordingly, MBSPX protein activity, MBSPX nucleic acid expression, or MBSPX gene mutation content in an individual can be determined, thereby selecting an appropriate agent for therapeutic or prophylactic treatment of the individual.

Pharmacogenomics deals with clinically significant hereditary changes in response to drugs due to altered drug properties and aberrant effects in affected individuals. For example, Ei
chelbaum, Clin Exp Pharmacol Physiol,
1996, 23: 983-985 and Linder, Clin Chem, 1.
997, 43: 254-266. In general, two types of pharmacogenomic states can be distinguished. Genetic status changes the way drugs act on the body 1
Is transmitted as one factor (altered drug action) or genetic status is transmitted as one factor that alters how the body acts on the drug (altered drug metabolism). These pharmacogenomic states can occur either as rare defects or as polymorphisms. For example, glucose-6-phosphate dehydrogenase (G
6PD) deficiency is a common hereditary enzymatic disease, the main clinical complications of which are the intake of oxidative drugs (antimalarial agents, sulfonamides, analgesics, nitrofurans) and fava beans (constitution). Later hemolysis.

In an exemplary embodiment, the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action. Drug metabolizing enzymes (eg, N-acetyltransferase 2 (NAT2) and cytochrome P450 enzymes CYP2D6 and C)
Discovery of a genetic polymorphism in YP2C19) indicates that some patients do not get the expected drug effect or show excessive drug response and severe toxicity after taking standard and safe doses of the drug I provided an explanation about that. These polymorphisms are associated with two phenotypes in the population, those with high metabolic capacity (extensive metabol
izer) (EM) and poor metabolic capacity (poor metaboliz)
er) (PM)). The prevalence of PM varies between different populations. For example, the gene encoding CYP2D6 is highly polymorphic, and some mutations have been identified in PM, all leading to the absence of functional CYP2D6. Those with low metabolic capacity for CYP2D6 and CYP2C19 quite often experience exaggerated drug responses and side effects when they receive standard doses. Where the metabolite is the active therapeutic moiety, as demonstrated for the analgesic effect of codeine mediated by its CYP2D6-forming metabolite morphine,
PM shows no therapeutic response. The other extreme does not respond to standard doses,
A person with so-called ultra-rapid metabolism. Molecules that are the basis for ultrarapid metabolism have recently been identified to be due to CYP2D6 gene amplification.

Accordingly, the activity of the MBSPX protein, the expression of the MBSPX nucleic acid, or the mutation content of the MBSPX gene in the individual is determined, thereby providing an appropriate agent for the therapeutic or prophylactic treatment of the individual. You can choose. In addition, pharmacogenomic studies can be used to apply the genotype of polymorphic alleles encoding drug-metabolizing enzymes to the identification of an individual's drug-responsive phenotype. This finding, when applied to dose or drug selection, may avoid adverse reactions or treatment failures, and thus subjects the subject to modulators of MBSPX (eg, the exemplary screening described herein). The therapeutic or prophylactic efficacy may be enhanced when treated with modulators identified by one of the assays.

Monitoring Effects During Clinical Trials Monitoring the effects of agents (eg, drugs, compounds) on MBSPX expression or activity (eg, ability to regulate aberrant cell proliferation and / or differentiation) is not possible. , Can be applied not only in basic drug screening, but also in clinical trials. For example, an agent determined by a screening assay as described herein may have reduced MBSPX gene expression, increased protein levels, or decreased efficacy of upregulating MBSPX activity. , Protein levels, or down-regulated MBSPX activity may be monitored in clinical trials. Alternatively, the agent determined by the screening assay has increased potency of increasing MBSPX gene expression, protein level, or upregulating MBSPX gene expression, protein level, or downregulating the activity of MBSPX. It can be monitored in clinical trials of active subjects. In such clinical trials, the expression or activity of MBSPX and, preferably, other genes involved in, for example, cellular proliferative disorders are "read out", ie immunization of specific cells. It can be used as a marker of response.

For example, but not by way of limitation, a gene containing MBSPX (which is
X-activity (eg, modulated intracellularly by treatment with an agent (eg, compound, drug or small molecule) that modulates a screening assay as described herein) is Can be identified. Thus, to study the effects of agents on cellular proliferative disorders, cells can be isolated and RNA can be prepared and expression of MBSPX and other genes involved in this disorder, eg, in clinical trials. It can be analyzed for levels. The level of gene expression (ie, gene expression pattern) can be determined by Northern blot analysis or RT-PCR, as described herein, or by measuring the amount of protein produced. By one of the methods described in the book,
Alternatively, by measuring the level of activity of MBSPX or other genes,
Can be quantified. In this manner, the gene expression pattern can act as a marker that is indicative of the physiological response of cells to the drug. Thus, the response state can be determined prior to treatment of an individual with the agent, and at various times during treatment.

In one embodiment, the invention is a drug (eg, agonist, antagonist, protein, peptide, peptidomimetic, nucleic acid, small molecule, or other identified by a screening assay described herein). Of drug candidates) for monitoring the efficacy of treatment in a subject, which comprises:
Including the steps of: (i) obtaining a pre-dose sample from the subject prior to administration of the drug; (ii) in this pre-dose sample, MBSPX protein, m
Detecting the level of expression of RNA or genomic DNA; (iii) obtaining one or more post-administration samples from this subject; (iv) MBSPX protein, mRNA, or genomic DNA in the post-administration sample. (V) the level of expression or activity of MBSPX protein, mRNA, or genomic DNA in the pre-administration sample is compared with the level of expression or activity of MBSPX protein, mRNA, or genomic DN in the post-administration sample.
Comparing the level of expression or activity of A; and (vi) thus altering the administration of the drug to this subject. For example, increased doses of this drug
In order to increase the expression or activity of MBSPX to a level higher than that detected (
That is, it may be desirable (to increase the efficacy of this drug). Alternatively, reduced administration of the agent may be desirable to reduce the expression or activity of MBSPX to levels below that detected (ie, to reduce the potency of the agent).

Methods of Treatment The present invention provides prophylactic and therapeutic treatments for subjects who are at (or susceptible to) a disorder associated with aberrant MBSPX expression or activity or who have this disorder. Provide both methods.

Disorders Diseases and disorders characterized by increased levels or biological activity (compared to a subject not suffering from the disease or disorder) antagonize activity (
That is, it can be treated with a therapeutic agent (which reduces or inhibits). Therapeutic agents that antagonize activity can be administered in a therapeutic or prophylactic manner. Therapeutic agents that may be utilized include, but are not limited to, (i) the peptides, or analogs, derivatives, fragments or homologs thereof; (ii) antibodies to the peptides; (iii) encode the peptides. (Iv) antisense nucleic acid and administration of a nucleic acid that is "dysfunctional" (ie, due to a heterologous insertion within the coding sequence of the coding sequence for the peptide) to the endogenous of the peptide by homologous recombination Used to “knock out” a function (eg, Capecchi, 1989, Science 244: 1288-1292).
Or (v) modulators (ie inhibitors, agonists and antagonists (for further peptidomimetics of the invention or peptides of the invention) that alter the interaction between said peptide and its binding partner. Including antibodies specific for))).

Diseases and disorders characterized by decreased levels or biological activity (compared to a subject not afflicted with the disease or disorder) have increased activity (ie, are agonists of the activity). It can be treated with a therapeutic agent. A therapeutic that upregulates activity can be administered in a therapeutic or prophylactic manner. Therapeutic agents that may be utilized include, but are not limited to, the above peptides, or analogs, derivatives, fragments or homologs thereof; or agonists that increase bioavailability.

Increased or decreased levels can be easily detected by quantifying the peptide and / or RNA. This quantification involves obtaining a tissue sample of a patient (eg, from a biopsy tissue) and measuring the RNA level or peptide level, structure and / or activity of the expressed peptide (or mRNA of the peptide) in vitro. By assaying in. Methods well known in the art include, but are not limited to, immunoassays (eg, Western blot analysis, sodium dodecyl sulfate (SDS)).
Polyacrylamide gel electrophoresis followed by immunoprecipitation, by immunocytochemistry, etc.) and / or hybridization assays to detect mRNA expression (eg, Northern assays, dot blots, in situ hybridization, etc.).

Prophylactic Method In one aspect, the invention provides an agent that modulates MBSPX expression or at least one MBSPX activity in a subject for a disease or condition associated with aberrant MBSPX expression or activity in a subject. Methods for preventing by administering to a subject are provided. A subject at risk of developing a disease caused by, or caused by, aberrant MBSPX expression or activity is, for example, by any of the diagnostic or prognostic assays described herein, or a combination thereof. , Can be identified. Administration of the prophylactic agent may be preceded by the onset of symptoms that are characteristic of this MBSPX abnormality so that the disease or disorder is prevented or its progression is delayed. Depending on the type of this MBSPX anomaly, for example,
An MBSPX agonist drug or MBSPX antagonist drug can be used to treat the subject. The appropriate agent can be determined based on the screening assays described herein. The prevention methods of the present invention are further discussed in the following subsections.

Methods of Treatment Another aspect of the invention relates to methods of modulating MBSPX expression or activity for therapeutic purposes. The method of regulation of the invention involves contacting a cell with an agent that regulates one or more of the activities of MBSPX protein activity for that cell. Agents that regulate MBSPX protein activity include nucleic acids or proteins, MBS
It can be an agent as described herein, such as a naturally occurring cognate ligand for a PX protein, peptide, MBSPX peptidomimetic, or other small molecule. In one embodiment, the agent stimulates one or more of MBSPX protein activities. Examples of such stimulatory agents include active MBSPX protein, and nucleic acid molecules encoding MBSPX introduced into the cell. In another embodiment, the agent inhibits one or more of MBSPX protein activities. Examples of such inhibitors include antisense MBS
PX nucleic acid molecules, and anti-MBSPX antibodies. These methods of modulation can be performed in vitro (eg, by culturing the cells with the agent) or in vivo (eg, by administering the agent to a subject). Thus, the invention provides a method of treating an individual afflicted with a disease or disorder characterized by aberrant expression or activity of a MBSPX protein or nucleic acid molecule. In one embodiment, the method comprises MBS
Administering an agent that modulates (eg, upregulates or downregulates) PX expression or activity (eg, an agent identified by the screening assays described herein) or a combination of such agents. Includes. In another embodiment, the method comprises administering an MBSPX protein or nucleic acid molecule as a treatment to compensate for reduced or aberrant MBSPX expression or activity.

Stimulation of MBSPX activity is desirable in situations in which MBSPX is abnormally downregulated, and / or where increased MBSPX activity appears to have a beneficial effect. One example of such a situation is when a subject has a disorder (eg, cancer) characterized by abnormal cell proliferation and / or cell differentiation. Another example of such a situation is when the subject has a pregnancy disorder (eg, preclampsia).

The present invention is not limited in scope by the particular embodiments described herein. Indeed, various modifications of the invention in addition to those described herein will become apparent to those skilled in the art from the foregoing description and accompanying figures. Such modifications are intended to fall within the scope of the appended claims.

The present invention is further illustrated by the following examples, which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application are hereby incorporated by reference.

Disease Pathways Determining Biological Effects of Therapeutic Agents In various embodiments of the invention, suitable in vitro or in vivo assays are utilized to determine the effect of a particular therapeutic agent and its administration on the affected tissue. It is determined whether to indicate the treatment of.

In various specific embodiments, an in vitro assay is performed on a representative cell type involved in a disorder in a patient to determine whether a given therapeutic agent exerts a desired effect on this cell type. You can decide. The compounds used in therapy may be tested in suitable animal model systems before testing in human subjects. These animal model systems include, but are not limited to: rat, mouse, chicken, cow, monkey, rabbit and the like. Similarly, for in vivo testing, any animal model system known in the art can be used prior to administration to human subjects.

Malignant Diseases The proteins mentioned above are involved in the regulation of cell growth. Accordingly, the therapeutic agents of the present invention are useful in the therapeutic or prophylactic treatment of diseases or disorders associated with defective cell hyperproliferation and / or cell proliferation control (eg, cancer, malignant diseases and tumors). . For reviews of such hyperproliferative disorders, see, eg, Fishman.
Et al., 1985, MEDICINE, 2nd edition, J. B. Lippincott C
o. , Philadelphia, PA.

The therapeutic agents of the invention can be assayed for efficacy in treating or preventing malignant diseases and related disorders by any method known in the art. Such assays include, but are not limited to, in vitro assays that utilize transformed cells or cells from a patient's tumor, as well as in vivo assays that use animal models of cancer or malignancy. Potential effective therapeutic agents are, for example, therapeutic agents that inhibit the growth of tumor-derived cells or transformed cells in culture or cause tumor regression in an animal model, as compared to a control. .

In the practice of the present invention, once a malignancy or cancer has been shown to be acceptable for treatment by modulating (ie, inhibiting, antagonizing, or agonizing) activity. Then, the cancer or malignancy can subsequently be treated or prevented by administration of a therapeutic agent that acts to regulate protein function.

(Pre-malignant state) The therapeutic agent of the present invention effective in the treatment or preventive treatment of cancer or malignant disease also treats the pre-malignant state and / or progresses from pre-malignant state to neoplastic state or malignant disease state. It can be administered for preventative treatments. Such prophylactic or therapeutic uses consist of conditions known or suspected of progressing to a preceding neoplasm or cancer (especially consisting of hyperplasia, metaplasia, or most especially dysplasia). (If non-neoplastic cell growth occurs). For a review of such abnormal cell proliferation see, eg, Robbins and Angell, 1976, BAS.
IC PATHOLOGY, 2nd edition, W.I. B. Saunders Co. , Ph
See iladelphia, PA.

Hyperplasia is a form of controlled cell growth involving an increase in cell number in a tissue or organ without significant alteration in cell structure or function. For example, endometrial hyperplasia has often been demonstrated to progress to endometrial cancer. Metaplasia is a form of controlled cell growth in which one type of mature or fully differentiated cell replaces another type of mature cell. Metaplasia can occur in epithelial or connective tissue cells. Dysplasia is generally considered to be a precursor to cancer and is found predominantly in the epithelium. Dysplasia is the most unregulated form of non-neoplastic cell growth and involves loss of individual cell homogeneity and cellular architectural orientation.
Dysplasia characteristically occurs where there is chronic irritation or inflammation and is often found in the cervix, respiratory tract, oral cavity, and gallbladder.

Alternatively, or in addition to the presence of aberrant cell growth characterized as hyperplasia, metaplasia, or dysplasia, a transformed phenotype is demonstrated in a cell sample from a patient, either in vivo or in vitro. Alternatively, the presence of one or more features of the malignant disease phenotype is an indication of the desirability of prophylactic / therapeutic administration of therapeutic agents that have the ability to modulate the activity of the above proteins. Transformed phenotypic characteristics include, but are not limited to: (i) morphological changes; (ii)
Looser, substratum attachment; (iii) loss of intercellular contact inhibition; (iv) anchorage-dependent loss; (v) protease release; (vi) increased glucose transport; (vii) reduced serum requirement; (Vii) expression of fetal antigen; (ix) disappearance of 250 kDa cell surface protein. For example, Richards et al. 1986, MOLECUL
AR PATHOLOGY, W.A. B. Saunders Co, Philade
See lphia, PA.

In certain embodiments of the invention, patients exhibiting one or more of the following predispositions for malignancy are treated by administration of an effective amount of a therapeutic agent: (i) chromosomal translocations associated with malignancy. Loci, such as the Philadelphia chromosome (bcr / abl) for chronic myelogenous leukemia and t (14; 18) for follicular lymphoma)
(Ii) familial polyposis or Gardner's syndrome (a possible precursor of colon cancer); (iii) unidentified monoclonal hypergammaglobulinemia of significant importance (a possible precursor of multiple myeloma); Body); and (iv) cancers or precancerous diseases that exhibit Mendelian (gene) inheritance patterns (eg, familial polyposis of the colon, Gardner's syndrome, hereditary exostoses, multiple endocrine adenomas (polyendocrine).
adenomatosis), Peutz-Jeghers syndrome, neurofibromatosis of von Recklinghausen's disease, medullary thyroid carcinoma with amyloid production and pheochromocytoma,
Retinoblastoma, carotid body tumor, melanoma of the skin, melanoma of the eye, xeroderma pigmentosum,
First-degree relatives of persons with ataxia-telangiectasia, Chediak-Higashi syndrome, Albinism, Fanconi aplastic anemia and Bloom syndrome).

In another embodiment, the Therapeutics of the invention are administered to a human patient to prevent progression of breast, colon, lung, pancreatic, or uterine cancer, or melanoma or sarcoma.

Hyperproliferative Disorders and Dysproliferative Disorders In one embodiment of the invention, the therapeutic agent is in the therapeutic or prophylactic treatment of a hyperproliferative disorder or a benign hyperproliferative disorder. Is administered. The efficacy of the therapeutic agents of the invention in treating or preventing hyperproliferative diseases or disorders can be assayed by any method known in the art. Such assays include in vitro cell proliferation assays, in vitro or in vivo assays using animal models of hyperproliferative diseases or disorders, and the like. A potential effective therapeutic agent may, for example, promote cell growth in culture or result in growth or cell growth in an animal model, as compared to a control.

Certain embodiments of the present invention include cirrhosis of the liver (a condition in which scarring exceeds the normal liver regeneration process); keloids (hyperplasias) that result in a scarring process that impairs normal regeneration. Treatment of plaque scar formation; psoriasis (a common skin condition characterized by overgrowth of the skin and delay in determining proper cell fate); benign tumors; fibrous sac condition and tissue thickening (eg, benign pancreas). Thickening).

Neurodegenerative Disorders MBSPX may be involved in deregulation of cell maturation and apoptosis, both of which are hallmarks of neurodegenerative diseases. Therefore, the therapeutic agent of the present invention (in particular, but not exclusively, a therapeutic agent that modulates (or supplies) the activity of the above-mentioned protein) may be effective in treating or preventing a neurodegenerative disease. The therapeutic agents of the invention that modulate the activity of the above proteins involved in neurodegenerative disorders are assayed for efficacy in treating or preventing such neurodegenerative diseases and disorders by any method known in the art. obtain. Such assays include in vitro assays for the inhibition of regulated cell maturation or apoptosis, or in vivo assays using animal models of neurodegenerative diseases or disorders, or any of the assays described below. Potential effective therapeutic agents, for example but not limited to, promote regulated cell maturation, prevent cell apoptosis in culture, or reduce neurodegeneration in animal models, as compared to controls.

Once a neurodegenerative disease or disorder has been shown to be susceptible to treatment with a modulatory activity, that neurodegenerative disease or disorder may be treated or prevented by administration of a therapeutic agent that modulates the activity. . Such diseases include all degenerative disorders associated with aging, especially osteoarthritis and neurodegenerative disorders.

Disorders Related to Organ Transplantation MBSPX can be associated with disorders related to organ transplantation, including but not limited to organ rejection. The therapeutic agent of the present invention (in particular, a therapeutic agent that regulates (or supplies) activity) can be effective in treating or preventing a disease or disorder associated with organ transplantation. The therapeutic agent of the present invention (in particular, a therapeutic agent that regulates the level or activity of the above-mentioned protein) can be administered by any method known in the art for its efficacy in treating or preventing diseases and disorders associated with such organ transplantation. Can be assayed. Such assays include in vitro assays using cell culture models as described below, or in vivo assays using animal models of organ transplant related diseases and disorders, see, eg, below. Potentially effective therapeutic agents reduce immune rejection response in an animal model as compared to, for example, without limitation, a control.

Thus, once a disease and disorder associated with organ transplantation has been shown to be susceptible to treatment by modulation of activity, such disease or disorder is administered by a therapeutic agent that modulates activity. Can be treated or prevented by.

Cardiovascular Disease MBSPX may be associated with cardiovascular disorders, including atherosclerotic plaque formation. Cardiovascular disease (including cerebral thrombosis or cerebral hemorrhage), ischemic heart disease or ischemic kidney disease, peripheral vascular disease, or other major vascular thrombosis, and other diseases (diabetes mellitus, hypertension, thyroid dysfunction, Cholesterol ester storage disease,
Systemic lupus erythematosus, homocysteinemia (homocysteineemia)
), And familial protein or lipid processing disorders and the like) are associated either directly or indirectly with atherosclerosis. Therefore, the therapeutic agent of the present invention (in particular, the therapeutic agent that regulates (or supplies) activity or formation) may be effective in treating or preventing a disease or disorder associated with atherosclerosis. The therapeutic agent of the present invention (in particular, a therapeutic agent that regulates the level or activity) can be treated by any method known in the art (including the method described below) for efficacy in treating or preventing such diseases and disorders. Can be assayed by.

A wide range of animal and cell culture models exist for the processes involved in atherosclerosis. A limited and non-exclusive list of animal models includes: Knockout mice for early onset atherosclerosis (Kurabayashi and Yazaki, 1996, Int. Ang.
iol. 15: 187-194), a transgenic mouse model of atherosclerosis (Kappel et al., 1994, FASEB J. 8: 583-59).
2), antisense oligonucleotide treatment in animal models (Callow, 19
95, Curr. Opin. Cardiol. 10: 569-576), a transgenic rabbit model for atherosclerosis (Taylor,
1997, Ann. N. Y. Acad. Sci 811: 146-152), an animal model for hypercholesterolemia (Rosenfeld, 1996, Diabet.
es Res. Clin. Pract. 30 (Supplement): 1-11), hyperlipidemic mice (Paigen et al., 1994, Curr. Opin. Lipidol. 5:
258-264), and inhibition of lipoxygenase in animals (Sigal et al., 1994, Ann. NY Acad. Sci. 714: 211-224).
In addition, in vitro cell models include, but are not limited to, monocytes exposed to low density lipoprotein (Frostegard et al., 1
996, Atherosclerosis 121: 93-103), cloned vascular smooth muscle cells (Sutles et al., 1995, Exp. Cell R.
es. 218: 331-338), T cells exposed to chemoattractants derived from endothelial cells (Katz et al., 1994, J. Leukoc. Biol. 55: 567-57.
3), cultured human aortic endothelial cells (Farber et al., 1992, Am.J.
Physiol. 262: H1088-1085), and foam cell culture (L
ibby et al., 1996, Curr Opin Lipidol 7: 330-3.
35). Potentially effective therapeutic agents include, but are not limited to, reducing foam cell formation in a cell culture model or in a hypercholesterolemic mouse model of atherosclerosis, as compared to a control. Reduces plaque formation in atherosclerosis.

Accordingly, once a disease or disorder associated with atherosclerosis has been shown to be susceptible to treatment by modulation of activity or formation, the disease or disorder is treated to modulate activity. It can be treated or prevented by administration of the agent.

Cytokines and Cell Proliferation / Differentiation Activity The MBSPX proteins of the invention have cytokine activity, cell proliferation activity (either inducing or inhibiting), or cell differentiation activity (inducing or inhibiting). ) Or induce the production of other cytokines in a particular cell population. Many protein factors discovered to date, including all known cytokines, show activity in one or more factor-dependent cell proliferation assays, thus these assays provide a convenient confirmation of cytokine activity. To work. The activity of the proteins of the invention is confirmed by any one of a number of conventional factor-dependent cell proliferation assays on cell lines including, but not limited to: 32D, DA2, DA1G, T10, B9. , B9 /
11, BaF3, MC9 / G, M + (preB M +), 2E8, RB5, DA
1, 123, T1165, HT2, CTLL2, TF-1, Mo7e and CM
K.

The activity of the proteins of the invention can be measured, among other methods, by the following methods, including, but not limited to, the assays described below.
Assay for cell or thymocyte proliferation: Current Proto
cols in Immunology, Coligan et al. ed., Greene
Publishing Associates and Wiley-Inte
rscience (Chapter 3 and 7); Takai et al., J Immunol.
137: 3494-3500, 1986; Bertagnoili et al., JI.
mmunol 145: 1706-1712, 1990; Bertagnoll.
i, et al. Cell Immunol 133: 327-341, 1991; Ber.
tagnolli et al., J Immunol 149: 3778-3783,19.
92; Bowman et al., J Immunol 152: 1756-1761,1.
994.

As an assay for cytokine production and / or proliferation of splenocytes, lymph node cells or thymocytes, Kruisbeek and Shevach: Cu
rent Prtocols in Immunology. Coligan
Et al., Vol. 1, pp. 3.12.1-14, John Wiley and Son.
S., Toronto 1994; and Schreiber: Current.
Protocols in Immunology. First edition by Coligan et al.
Volume, 6.8.1-8, John Wiley and Sons, Toron.
to 1994, but is not limited thereto.

Assays for proliferation and differentiation of hematopoietic and lymphopoietic cells include, but are not limited to, those described by: B
ottomly et al .: Current Protocols in Immuno
logy. Edited by Coligan et al., Volume 1, 6.3.1-6.3.12, Joh.
n Wiley and Sons, Toronto 1991; deVrie
s et al., J Exp Med 173: 1205-1121, 1991; More.
au et al., Nature 336: 690-692, 1988; Greenber.
ger et al., Proc Natl Acad Sci U. S. A. 80: 293
1-2938, 1983; Nordan: Current Protocols.
in Immunology. Edited by Coligan et al., Volume 1, 6.6.1-5
P., John Wiley and Sons, Toronto 1991; S
Smith et al., Proc Natl Acad Sci U .; S. A. 83:18
57-1861, 1986; Measurement of human In.
terleukin 11-Bennett et al .: Current Protocol
ols in Immunology. Edited by Coligan et al., Volume 1, 6.15.
． Page 1, John Wiley and Sons, Toronto 1991.
Carletta et al .: Current Protocols in Imm;
unology. Edited by Coligan et al., Vol. 1, pp. 6.13.1, John W.
iley and Sons, Toronto 1991.

Assays for T Cell Clonal Responses to Antigens (Affecting APC-T Cell Interactions by Measuring Proliferation and Cytokine Production, among others,
And to identify proteins that direct the effects of T cells) include, but are not limited to, the assays described below: Current Pro
tocols in Immunology. Edited by Coligan et al., Green
Publishing Associates and Wiley-Int
erscience (chapter 3, chapter 6 and chapter 7); Weinberger et al., Proc Natl Acad Sci USA 77: 6091-6095.
, 1980; Weinberger et al., Eur J Immun 11: 405.
-411, 1981; Takai et al., J Immunol 137: 3494-.
3500, 1986; Takai et al., J Immunol 140: 508-5.
12, 1988.

Immunostimulatory or Immunosuppressive Activity The MBSPX proteins of the invention also exhibit immunostimulatory or immunosuppressive activity, including, but not limited to, those described in the assays herein. obtain. The protein has various immunodeficiencies and disorders (severe combined immunodeficiency (S
(Including CID)), eg, the regulation (up or down) of growth and proliferation of T and / or B lymphocytes, and induction of cytolytic activity of NK cells and other cell populations. obtain. These immunodeficiencies can be hereditary, can be caused by viral (eg, HIV) and bacterial or fungal infections, or can result from autoimmune disorders. More specifically, infectious diseases caused by viral, bacterial, fungal or other infections may be treatable using the proteins of the invention, including HIV, hepatitis virus, herpes. Infections with viruses, mycobacteria, Leishmania spp., Malaria spp., And various fungal infections such as candidiasis. Of course, in this regard, the proteins of the invention may also be useful where boosts to the immune system may be generally desired (ie, in treating cancer).

Autoimmune disorders that can be treated using the proteins of the invention include, for example:
These include: connective tissue disease, multiple sclerosis, systemic lupus erythematosus, rheumatoid arthritis, autoimmune pneumonia, Guyan-Barre syndrome, autoimmune thyroiditis, insulin-dependent diabetes mellitus, myasthenia gravis, versus Host Graft Disease and Autoimmune Inflammatory Eye Disease. Such proteins of the invention may also be useful in treating allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory system disorders. Other conditions for which immunosuppression is desired, including organ transplantation, may also be treatable using the proteins of the invention.

The proteins of the invention may be capable of responding to an immune response in many ways. Down-regulation can be in the form of blocking or blocking an already ongoing immune response, or can include preventing the induction of an immune response. The function of activated T cells can be inhibited by suppressing the T cell response, or by inducing specific tolerance in the T cells, or both. Immunosuppression of T cell responses generally requires continuous exposure of T cells to the inhibitor,
It is an active non-antigen specific process. Tolerance, including non-responsiveness or induction of energy in T cells, is generally antigen-specific and immunosuppressive in that it persists even after cessation of exposure to tolerizing agents. It is identifiable. Operationally, tolerance can be demonstrated by the lack of a T cell response upon re-exposure to a specific antigen in the absence of tolerizing agent.

Down-regulating or preventing one or more antigenic functions, including but not limited to B lymphocyte antigenic functions (such as, but not limited to, B7) (eg, high levels of activated T cells). Interfering with lymphokine synthesis) is useful in the context of tissue, skin and organ transplantation, and in graft versus host disease (GVHD). For example, blocking T cell function should result in reduced tissue destruction in tissue transplants. Typically, in tissue transplantation, graft rejection is initiated through its foreign recognition by T cells, followed by an immune response that destroys the graft. Molecules that inhibit or block the interaction of B7 lymphocyte antigen with its natural ligands on immune cells prior to transplantation (eg, a soluble monomeric form of a peptide having B7-2 activity alone, or another B lymphocyte antigen ( For example, administration of B7-1, B7-3) or a blocking antibody in combination with the monomeric form of the peptide) has the effect of activating the molecule's native molecule on immune cells without the corresponding shift in costimulatory signals. It can lead to binding to the ligand. Blocking B lymphocyte antigen function in such a form prevents cytokine synthesis by immune cells (eg, T cells),
Therefore, it acts as an immunosuppressant. Moreover, lack of costimulation may also be sufficient to activate T cells, thereby inducing tolerance in the subject.
Induction of long-term tolerance by B lymphocyte antigen blocking reagents may avoid the need for repeated administration of these blocking reagents. It may also be necessary to block the function of B lymphocyte antigens to achieve sufficient immunosuppression or tolerance in the subject.

The efficacy of certain blocking reagents in the prevention of organ transplant rejection or GVHD can be assessed using animal models that predict efficacy in humans. Examples of suitable systems that may be used include allogeneic heart transplants in rats and xenogeneic pancreatic islet cell transplants in mice, both of which are described by Lenschow et al.
Science 257: 789-792 (1992) and Turka et al., P.
roc Natl Acad Sci USA, 89: 11102-11105
It has been used to test the immunosuppressive effect of CTLA4Ig fusion proteins in vivo as described in (1992). Furthermore, a mouse model of GVDH (Edited by Paul, Fundamental Immunology, Raven).
(See Press, New York, 1989, pp. 846-847).
Can be used to determine the effect of blocking B lymphocyte antigen function in vivo on the development of the disease.

Blocking antigen function may also be therapeutically useful in the treatment of autoimmune diseases. Many autoimmune diseases are the result of inappropriate activation of T cells that are reactive to self tissues and promote the production of cytokines and autoantibodies involved in the pathology of the disease. Prevention of activation of autoreactive T cells can reduce or eliminate the symptoms of the disease. Administration of a reagent that blocks T cell costimulation by disrupting the B lymphocyte antigen receptor: ligand interaction inhibits T cell activation and may be involved in the disease process of autoantibodies or T cells It can be used to prevent the production of inducible cytokines. In addition, blocking reagents can induce antigen-specific tolerance of autoreactive T cells that can lead to long-term relief of disease. The efficacy of blocking reagents in the prevention or alleviation of autoimmune disorders can be determined using a number of well-characterized animal models of human autoimmune disease.
Examples include mouse experimental autoimmune encephalitis, systemic lupus erythematosus in MRL / lpr / lpr mice or NZB hybrid mice, murine autoimmune collagen arthritis, diabetes mellitus in NOD and BB rats, and mouse experimental myasthenia gravis. Mentioned by Paul (Fundamental)
Immunology, Raven Press, New York, 198.
9, 840-856).

As a means of upregulating the immune response, upregulation of antigen function (preferably B lymphocyte antigen function) may also be useful in therapy. Upregulation of an immune response can be in the form of enhancing an existing immune response or eliciting an early immune response. For example, enhancing the immune response via stimulation of B lymphocyte antigen function can be useful in the case of viral infections. Furthermore, systemic viral diseases such as influenza, colds and encephalitis can be alleviated by systemic administration of stimulated forms of B lymphocyte antigens.

Alternatively, the anti-viral immune response was pulsed with a viral antigen, either depleting T cells from the patient and expressing a peptide of the invention, or with a stimulated form of the soluble peptide of the invention. It can be enhanced in infected patients by co-stimulating the T cells in vitro with APC and reintroducing the in vitro activated T cells into the patient. Another method of enhancing an antiviral immune response is to isolate infected cells from a patient and transfect the infected cells with a nucleic acid encoding a protein of the invention as described herein. The result is that these cells express all or part of this protein on their surface), and retransfect the transfected cells into the patient. Here, the infected cells are capable of delivering costimulatory signals to T cells in vivo, thereby activating T cells.

In another application, upregulation or enhancement of antigen function, preferably B lymphocyte antigen function, may be useful in inducing tumor immunity. Tumor cells (eg, sarcoma, melanoma, lymphoma, leukemia, neuroblastoma, carcinoma) transfected with a nucleic acid encoding at least one peptide of the present invention overcome tumor-specific tolerance in a subject. May be administered to the subject. If desired, tumor cells can be transfected to express the peptide combination. For example, directing the expression of a peptide having B7-2-like activity alone or a combination of peptides having B7-1-like activity and / or B7-3-like activity to tumor cells obtained from a patient Expression vectors can be used to transfect ex vivo. The transfected tumor cells are returned to the patient causing expression of the peptide on the surface of the transfected cells. Alternatively, gene therapy techniques can be used to target tumor cells for transfection in vivo.

The presence of peptides of the invention having the activity of B cell lymphocyte antigens on the surface of tumor cells provides the necessary costimulatory signals for T cells and T cell mediated for transfected tumor cells. Induces an immune response. Furthermore, it lacks MHC class I or MHC class II molecules, or has a sufficient amount of MHC class I or M
Tumor cells that do not re-express HC class II molecules may have MHC class Ia chain proteins and β ₂ microglobulin proteins, or all or part of MHC class IIa chain proteins and MHC class II β chain proteins (eg, cytoplasmic-domain shortening moieties). ) Encoding a nucleic acid encoding MHC class I or MHC class II protein on the cell surface. Expression of appropriate class I or class II MHC in combination with peptides having activity of B lymphocyte antigens (eg, B7-1, B7-2, B7-3) is T cell mediated to transfected tumor cells. Induces an immune response. If necessary, MHC class I such as invariant chain
Genes encoding antisense constructs that block the expression of I-related proteins can also be co-transfected with DNA encoding peptides having the activity of B lymphocyte antigens, promote presentation of tumor-associated antigens and are tumor-specific. Induces immunity. Therefore, induction of a T cell-mediated immune response in a human subject may well overcome tumor-specific tolerance in the subject.

The activity of the proteins of the invention can be measured, inter alia, by the following method: C
CURRENT PROTOCOLS IN IMMUNOLOGY. Colig
edited by an et al., Greene Publishing Publishing Associates an
d Wiley-Interscience (Chapter 3 and Chapter 7); Herrma
nn et al., Proc Natl Acad Sci USA 78: 2488-2.
492, 1981; Herrmann et al., J Immunol 128: 196.
8-1974, 1982; Handa et al., J Immunol 135: 156.
4-1572, 1985: Takai et al., J Immunol 137: 349.
4-3500, 1986; Takai et al., J Immunol 140: 508.
-512, 1988; Herrmann et al., Proc Natl Acad S.
ci USA 78: 2488-2492, 1981; Herrmann et al., J.
Immunol 128: 1968-1974, 1982; Handa et al., J.
Immunol 135: 1564-1572, 1985; Takai et al., J.
Immunol 137: 3494-3500, 1986; Bowman et al.,
J Virology 61: 1992-1998; Takai et al., J Imm.
unol 140: 508-512, 1988; Bertagnolli et al., C.
ell Immunol 133: 327-341, 1991; Brown et al.
Suitable assays for cytotoxicity of thymocytes or splenocytes, including but not limited to those described by J Immunol 153: 3079-3092, 1994.

For T cell-dependent immunoglobulin responses and isotype switching (
In particular, assays that modulate T cell-dependent antibody responses and identify proteins that affect the Th1 / Th2 profile) include: Maliszewski, J.
Immunol 144: 3028-3033, 1990; and Mond.
And Brunswick, CURRENT PROTOCOLS IN IM
MUNOLOGY, edited by Coligan et al., Volume 1, 3.8.1. -3.8.16
, John Wiley and Sons, Toronto 1994, but are not limited thereto.

As a mixed lymphocyte reaction (MLR) assay (particularly an assay that identifies proteins that preferentially generate Th1 and CTL responses), the CURRENT PR
OTOCOLS IN IMMUNOLOGY. Green by Coligan et al.
ne Publishing Associates and Wiley-I
interscience (Chapter 3 and Chapter 7); Takai et al., J Immuno.
1 137: 3494-3500, 1986; Takai et al., J Immuno.
I 140: 508-512, 1988; Bertagnolli et al., J Im.
Munol 149: 3778-3783, 1992, but is not limited thereto.

For dendritic cell-dependent assays, particularly those that identify proteins expressed by dendritic cells that activate naive T cells, see Guery et al., J I.
mmunol 134: 536-544, 1995; Inaba et al., J Exp.
Med 173: 549-559, 1991; Macatonia et al., JI.
mmunol 154: 5071-5079, 1995; Porgador et al.,
J Exp Med 182: 255-260, 1995; Nair et al., JV.
irol 67: 4062-4069, 1993; Huang et al., Science.
e 264: 961-965, 1994; Macatonia et al., J. Am. Exp
Med 169: 1255-1264, 1989; Bhardwaj et al., JC.
lin Investig 94: 797-807, 1994; and Inab.
a, et al., J Exp Med 172: 631-640, 1990, but is not limited thereto.

As an assay for lymphocyte survival / apoptosis, specifically identifying proteins that prevent apoptosis after superantigen induction and proteins that regulate lymphocyte homeostasis, Darzynkiewicz et al., Cytomet.
ry 13: 795-808, 1992; Gorczyca et al., Leukemi.
a 7: 659-670, 1993; Gorczyca et al., Cancer Re.
s 53: 1945-1951, 1993; Itoh et al., Cell 66:23.
3-243, 1991; Zacharchuk, J Immunol 145:
4037-4045, 1990; Zamai et al., Cytometry 14: 8.
91-897, 1993; Gorczyca et al., Internat J Onc.
Ol 1: 639-648, 1992, but is not limited thereto.

Assays for proteins affecting T cell arrest and early stages of development include: Antica et al., Blood 84: 111-117, 1994; Fine et al., Cell Immunol 155: 111-122, 1994; Galy et al., Blood. 85: 2770-2778, 1995; Toki et al., Proc.
Nat Acad Sci USA 88: 7548-7551, 1991, but is not limited thereto.

Hematopoietic Regulatory Activity The MBSPX proteins of the invention may be useful in regulating hematopoiesis and, consequently, in treating myeloid or lymphocytic deficiencies. Peripheral biological activity in support of colony-forming cells or factor-dependent cell lines, in the regulation of hematopoiesis, for example, alone or in combination with other cytokines, growth and proliferation of erythroid progenitor cells. In combination with radiation / chemotherapy to treat various anemias or to stimulate the production of erythroid progenitor cells and / or erythroid cells, for example. Utility for use; eg, supporting growth and proliferation of bone marrow cells (eg, granulocytes and monocytes / macrophages) useful in combination with chemotherapy to prevent or treat myelosuppression as a result Utility (ie, traditional CSF activity); growth and proliferation of megakaryocytes and consequently platelets And / or to allow for the prevention or treatment of various platelet disorders, such as thrombocytopenia, and, in general, for use as an alternative to or benefit from platelet transfusion; and / or above. Can mature into any and all hematopoietic stem cells and, therefore, are associated with various stem cell disorders, such as those commonly treated with transplants, including but not limited to aplastic anemia and paroxysmal nocturnal hemoglobinuria. ), In supporting growth and proliferation of hematopoietic stem cells, and as normal cells or cells engineered for gene therapy, in vivo or ex vivo (ie, bone marrow transplant or peripheral precursors). Cell transplant (combined with allogeneic or xenogeneic), re-stem cell compartment after irradiation / chemotherapy Show utility in be fertilized.

[0355]   The activity of the proteins of the invention may be measured, inter alia, by the following method:   Suitable assays for proliferation and differentiation of various hematopoietic strains are cited above.

Assays for embryonic stem cell differentiation, particularly those that identify proteins that affect embryonic hematopoiesis, are not limited: Johannsson et al., Cell Biol.
15: 141-151, 1995; Keller et al., Molelucar Ce.
ill biology 13: 473-486, 1993; McCla.
Nahan et al., Blood 81: 2903-2915, 1993.

Assays for stem cell survival and differentiation, particularly those that identify proteins that regulate lympho-hematopoiesis, are not limited to: methylcellulose colony formation assay, CULTURE OF HEMATOPOIETIC CELLS. Fres
Hney et al., eds., Vol 265-268, Wiley-Liss, Inc.
New York, N.M. Freshney, M. et al. G. ;
Hirayama et al., Proc Natl Acad Sci USA 89:
5907-5911, 1992; CULTURE OF HEMATOPOIE.
TIC CELLS. Freshney et al., Eds., Vols 23-39, Wil.
ey-Liss, Inc. New York, N.M. Mc in Y 1994
Niece and Brideli; Neben et al., Exp Hematol.
22: 353-359, 1994; CULTURE OF HEMATOPOI.
ETIC CELLS. Freshney et al., Eds., Vol 1-21, Wil.
ey-Liss, Inc. New York, N.M. Pl in Y 1994
oemacher; CULTURE OF HEMATOPOIETIC CE
LLS. Freshney et al., Eds., Vol 163-179, Wiley-L.
iss, Inc. New York, N.M. Spoonc at Y 1994
eret et al .; CULTURE OF HEMATOPOIETIC CELLS
． Freshney et al., Eds., Vol 139-162, Wiley-Liss.
, Inc. New York, N.M. Sutherlan, Y 1994
d).

Tissue Proliferative Activity MBSPX of the present invention may also be used for bone, cartilage, tendon, ligament and / or nerve tissue growth or regeneration, as well as for wound healing and tissue repair and tissue replacement. And may have utility in the treatment of burns, incisions and ulcers.

The proteins of the invention induce cartilage and / or bone growth in situations where bone is not normally formed and have applications in the healing of fractures and cartilage damage or defects in humans and other animals. Such preparations employing the proteins of the invention may have prophylactic use in closed and open fracture reduction and also in improved fixation of artificial joints. De novo osteogenesis induced by osteogenic agents contributes to the repair of congenital, trauma-induced, or tumor-removal-induced craniofacial cranial defects and is also useful in cosmetic surgery.

The proteins of the invention can also be used in the treatment of periodontal disease and in other tooth repair processes. Such agents may provide an environment that triggers osteogenic cells, stimulates the proliferation of osteogenic cells, or induces the differentiation of osteogenic cell precursors. The proteins of the invention may also have osteoporosis, such as by stimulating bone and / or cartilage repair or by blocking inflammation or processes of tissue destruction mediated by inflammatory processes (collagenase activity, osteoclast activity, etc.). Or it may be useful in the treatment of osteoarthritis.

Another category of tissue regeneration activity that may contribute to the proteins of the present invention is tendon / ligament formation. Proteins of the invention that induce the formation of tendon / ligament-like tissue or other tissue in the absence of such tissue formation are found in humans and other animals in tendon or ligament tears, deformities and other tendon or ligament defects. Has application in healing. Such preparations, which employ tendon / ligament-like tissue-inducible proteins, provide prophylactic use in preventing damage to tendon or ligament tissue, and improved fixation of bone or other tissue of tendon or ligament, and It may have application in repairing defects in tendon or ligament tissue. De novo tendon / ligament-like tissue formation induced by the compositions of the present invention contributes to the repair of other tendon or ligament defects of congenital, trauma-inducing, or other origin, and also tendon or ligament attachment or It is useful in cosmetic surgery for repair. The composition of the present invention attracts tendonogenic cells or ligamentogenic cells, stimulates the proliferation of tendonogenic cells or ligamentous cells, or develops tendonogenic cells or precursors of ligamentous cells. An environment may be provided that induces proliferation of tendon / ligament cell or progenitor ex vivo to induce differentiation or to return to in vivo for tissue repair. The compositions of the present invention may also be useful in treating tendinitis, root canal syndrome and other tendon or ligament defects. The composition may also include a suitable matrix and / or sequestrant as a carrier, as is well known in the art.

The proteins of the invention are also for proliferation of neuronal cells and for regeneration of nerve and brain tissue, ie central and peripheral nervous system diseases and disorders, and to neuronal cells or tissues. May be useful for the treatment of mechanical and trauma disorders, including degeneration, death or trauma. More specifically, the protein is associated with diseases of the peripheral nervous system such as peripheral nerve injury, peripheral neuropathy and local neuropathy, as well as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome. It can be used in the treatment of diseases of the central nervous system such as. Additional conditions that may be treated according to the present invention include mechanical and traumatic disorders such as spinal cord disorders, head trauma and cerebrovascular diseases such as stroke.
Peripheral neuropathy resulting from chemotherapy or other medical treatments may also be treatable with the proteins of the invention.

The proteins of the invention also promote better or more rapid closure of non-healing wounds including, but not limited to, pressure ulcers, ulcers associated with vascular failure, surgical or traumatic wounds and the like. Can be useful for.

The proteins of the invention may also include organs (including, for example, pancreas, liver, intestine, kidney, skin, endothelium), muscles (smooth muscle, skeletal muscle or myocardium) and blood vessels (including vascular endothelium).
It is expected that it may be active in the production or regeneration of other tissues, such as tissue, or to promote the growth of cells containing such tissues. Part of the desired effect may be the regeneration of normal tissue by inhibiting or modulating fibrotic scarring. The proteins of the invention may also exhibit angiogenic activity.

The proteins of the invention may also be useful for the protection or regeneration of the intestine and for the treatment of lung or liver fibrosis, reperfusion injury in various tissues, and conditions resulting from systemic cytokine damage. .

The proteins of the invention may also be useful for promoting or inhibiting the differentiation of the above tissues from precursor tissues or cells; or for inhibiting the growth of the above tissues.

The activity of the proteins of the invention may be measured, inter alia, by the following methods: Assays for tissue-generating activity include, but are not limited to, International Patent Publication No. WO 95/16035 (bone). , Cartilage, tendon); International Patent Publication No. WO95 / 05846 (nerve, neuron); International Patent Publication No. WO91
07491 (skin, endothelium).

Assays for wound healing activity include, but are not limited to, the following: Eaglstein and Menz, J. MoI. Invest. Dermat
Ol 71: 382-84 (1978).
r, Epidermal Wound Healing, pp. 71-112 (Ma.
ibach, H .; I. And Rovee, D .; T. Hen), Year Book
Medical Publishers, Inc. , Chicago.

Activin / Inhibin Activity The MBSPX proteins of the invention may also exhibit activin-related activity or inhibin-related activity. Inhibin is characterized by its ability to inhibit the release of follicle stimulating hormone (FSH), while activin is a follicle stimulating hormone (FSH).
It is characterized by its ability to stimulate the release of FSH). Thus, the proteins of the invention, either alone or in heterodimers with members of the inhibin family, as a contraceptive agent based on the ability of inhibin to reduce fertility in female mammals and reduce spermatogenesis in male mammals. Can be useful. Administration of sufficient amounts of other inhibins can induce infertility in these mammals.
Alternatively, the protein of the invention may act as a homodimer or as a heterodimer with other protein subunits of the inhibin b group on the ability of the activin molecule to stimulate FSH release from cells of the anterior pituitary. Based on this, it is useful as a fertility-inducing treatment. See, eg, US Pat. No. 4,798,885. The proteins of the invention may also be useful for facilitating the onset of conception in sexually immature mammals so as to increase the lifetime reproductive efficiency of livestock such as cattle, sheep and pigs.

The activity of the proteins of the invention may be measured, inter alia, by the following methods: Assays for activin / inhibin activity include, but are not limited to, those described below: Vale et al., Endocrinology.
91: 562-572, 1972; Ling et al., Nature 321: 77.
9-782, 1986; Vale et al., Nature 321: 776-779,
1986; Mason et al., Nature 318: 659-663, 1985;
Forage et al., Proc. Natl. Acad. Sci. USA 83:30
91-3095, 1986.

(Chemotaxis / Chemokinesis Activity) The protein of the present invention can be used in mammalian cells (for example, monocytes, fibroblasts, neutrophils,
It may have chemotactic or chemokinetic activity (including acting as a chemokine) on T cells, mast cells, eosinophils, epithelial cells and / or endothelial cells). Chemotaxis and chemokinesis proteins can be used to recruit or attract a desired cell population to a desired site of action. Chemotactic or chemokinesis proteins
In the treatment of wounds and other trauma to tissues, as well as the treatment of local infections,
Provides particular benefits. For example, the attraction of lymphocytes, monocytes or neutrophils to the tumor or site of infection can result in an improved immune response to the tumor or infectious agent.

A protein or peptide has chemotactic activity for a particular population of cells if it can directly or indirectly stimulate the directed orientation or migration of that particular population of cells. Preferably, the protein or peptide has the ability to directly stimulate directed cell migration. Whether a particular protein has chemotactic activity for a population of cells is determined by using such protein or peptide in any known assay for chemotaxis of cells,
It can be easily determined.

[0373]   The activity of the protein of the present invention can be measured, inter alia, by the following method.

Assays for chemotactic activity (identifying proteins that induce or interfere with chemotaxis) are based on the ability of the protein to induce migration across the cell's membrane, as well as the differentiation of one cell population. Assaying the ability of a protein to induce adhesion to a cell population of. Suitable assays for migration and adhesion include, but are not limited to, those described below: CUREN
T PROTOCOLS IN IMMUNOLOGY, Coligan et al.
Chapter 6.12, Measurement of alpha and beta
Chemokines 6.12.1-6.12.28); Taub et al., J.
Clin Invest 95: 1370-1376, 1995; Lind et al.,
APMIS 103: 140-146, 1995; Muller et al., Eur J.
Immunol 25: 1744-1748; Gruberet et al., J Im.
munol 152: 5860-5867, 1994; Johnston et al., J.
Immunol 153: 1762-1768, 1994.

Hemostatic and Thrombolytic Activity The proteins of the invention may also exhibit hemostatic or thrombolytic activity. As a result, such proteins are useful in the treatment of various coagulation disorders, including inherited disorders such as hemophilia, or the treatment of wounds caused by coagulation and trauma, surgery or other causes. Are expected to promote other hemostatic events in. The proteins of the invention are also useful for inhibiting the dissolution or formation of thrombosis and for the treatment and prevention of conditions resulting therefrom (eg, cardiovascular and central nervous system vascular infarctions (eg, stroke)). obtain.

The activity of the proteins of the invention may be measured, inter alia, by the following methods: Assays for hemostasis and thrombolytic activity include, but are not limited to, those described below: Linet et al. J. Clin. Pharmac
ol. 26: 131-140, 1986; Burdick et al., Thrombos.
is Res. 45: 413-419, 1987; Humphrey et al., Fib.
rinolysis 5: 71-79 (1991); Schaub, Prost
aglandins 35: 467-474, 1988.

Receptor / Ligand Activity The proteins of the invention may also demonstrate activity as inhibitors or agonists of receptors, receptor ligands or receptor / ligand interactions. Examples of such receptors and ligands include, but are not limited to, cytokine receptors and their ligands, receptor kinases and their ligands, receptor phosphatases and their ligands receptors and their ligands involved in cell-cell interactions ( Without limitation
Cell adhesion molecules (selectins, integrins and their ligands), and receptor / ligand pairs involved in antigen presentation, antigen recognition and the generation of cellular and humoral immune responses). Receptors and ligands are also useful in screening peptides or small molecule inhibitors for potential related receptor / ligand interactions. Proteins of the invention (without limitation,
(Including fragments of receptors and ligands) may themselves be useful as inhibitors of receptor / ligand interactions.

The activity of the proteins of the invention may be measured, inter alia, by the following methods: Suitable assays of receptor-ligand activity include, but are not limited to, those described below: CURRENT PROTOCOLS IN.
IMMUNOLOGY, J. E. Coligan, A .; M. Kruisbee
k, D. H. Margulies, E .; M. Shevach, W.C. Strobe
r edition, Greene Publishing Publishing Associates and
Wiley-Interscience (Chapter 7.28, Measurementmen
to of Cellular Adhesion underunder static
conditions 7.28.2-7.28.22), Takai et al., Pr.
oc. Natl. Acad. Sci. USA 84: 6864-6868, 19
87; Bierer et al. Exp. Med. 168: 1145 to 1156, 1
988; Rosstein et al. Exp. Med. 169: 149-16
0 1989; Stollenburg et al., J. Am. Immunol. Method
s 175: 59-68, 1994; Stitt et al., Cell 80: 661-.
670, 1995.

Anti-Inflammatory Activity The proteins of the invention may also exhibit anti-inflammatory activity. Anti-inflammatory activity is the chemotaxis of cells involved in the inflammatory process, either by providing stimulation to cells involved in the inflammatory response, by inhibiting or promoting cell-cell interactions (eg cell adhesion). By inhibiting or promoting sex, by inhibiting or promoting cell extravasation, or by stimulating the production of other factors that directly inhibit or enhance the inflammatory response Or can be achieved by suppressing. Proteins exhibiting such activity may be used to treat inflammation conditions, including but not limited to chronic or acute conditions, such as infection-related inflammation (eg, septic shock, sepsis or systemic inflammatory response syndrome (SIRS). )), Ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated fulminant rejection, nephritis, cytokine-induced embryonic injury or chemokine-induced lung injury, inflammatory bowel disease, Crohn's disease, or Including those resulting from overproduction of cytokines such as TNF or IL-1). The proteins of the invention may also be useful for the treatment of anaphylaxis and hypersensitivity to antigenic substances or materials.

Tumor Inhibitory Activity In addition to the activity described above for immunological treatment or prevention of tumors, the proteins of the invention may exhibit other anti-tumor activities. The protein may directly or indirectly (eg, via ADCC) inhibit tumor growth. By acting on tumor tissue or tumor precursor tissue, the protein inhibits tumor growth by inhibiting the formation of tissue necessary to support tumor growth (eg, by inhibiting angiogenesis). It may exhibit its tumor-inhibiting activity by causing the production of other factors, substances or cell types that inhibit or by suppressing, eliminating or inhibiting factors, substances or cell types that promote tumor growth.

Other Activities The proteins of the invention may also exhibit one or more of the following additional activities or effects: of infectious agents, including but not limited to bacteria, viruses, fungi and other parasites. Inhibiting or killing proliferation, infection or function; physical characteristics (including without limitation height, weight, hair color, eye color, skin, fat to lean ratio, or other tissue pigmentation, Or the size or shape of an organ or body part (
(Increasing or decreasing breasts, changes in bone morphology or shape, etc.)) (inhibiting or enhancing); producing biorhythms or circadian cycles or circadian rhythms; conception of male or female subjects Producing ability; metabolism, catabolism, anabolic action, processing, utilization, storage or removal of dietary fats, lipids, proteins, carbohydrates, vitamins, minerals, cofactors or other nutritional factor (s) or nutrient (s) Yielding;
Producing behavioral features (including, but not limited to, appetite, libido, stress, cognition (including cognitive impairment), depression (including depressive disorder) and violence; analgesic effects or other pain reduction Providing an effect; promoting differentiation or proliferation of embryonic stem cells in a lineage other than the hematopoietic lineage; hormonal activity or endocrine activity;
In the case of enzymes, correcting enzyme deficiencies and treating deficiency-related diseases;
Treatment of hyperproliferative disorders (eg, psoriasis); immunoglobulin-like activities (eg, ability to bind antigen or complement); as well as antigens in vaccine compositions, such proteins or other substances or such Ability to elicit an immune response against an entity that cross-reacts with various proteins.

(Example) Example 1.10354784.0.335.S3347a (Molecular cloning of MBSP2) Oligonucleotide primer was added to extracellular 1035478 at residues 26-653.
4.0.335. PCR of DNA segment encoding mature form of S3347a
Designed for amplification. In-frame BglHI was used as the forward primer.
Restriction sites are included, and the reverse primer contains an in-frame XhoI restriction enzyme site. The sequences of the primers are: 10354784 mature form: AGA TCT GAG GCT GCC C
GC ATC ATC TAC CCC CCA GAG (SEQ ID NO: 23) 10354784 Reverse direction: CTC GAG GCG AGC CAC CA
T GGC CCC AGT GCC (SEQ ID NO: 24) PCR reaction was performed in a volume of 50 μl with 5n from human kidney, pituitary and heart tissue.
g cDNA template, 1 μM, 10354784 mature form (Mat F
) Primer and 10354784 Reverse (Rev) primer, 5 μM d
NTP (Clontech Laboratories, Palo Alto
CA) and 1 μl of 50 × Advantage-HF 2 polymerase (C).
lontech Laboratories, Palo Alto CA). The following reaction conditions were used: a) 96 ° C. for 3 minutes b) 96 ° C. for 30 seconds denaturation c) 70 ° C. for 30 seconds, primer annealing. This temperature was gradually reduced by 1 ° C./cycle unit. d) 72 ° C. 1 minute extension b to d repeated 10 times e) 96 ° C. 30 seconds denaturation f) 60 ° C. 30 seconds annealing g) 72 ° C. 3 minutes extension e to g repeated 25 times h) 72 ° C. 5 minutes Final extension All three reactions are approximately 1.8 kb detected by agarose gel electrophoresis.
This resulted in a p-sized amplified product. The kidney product was isolated and pCR2
． 1 vector (Invitrogen Corp., Carlsbad) and sequenced using vector specific primers and the following gene specific primers: 10354784 Sl: TCC GTG CTG TGG CTG AG.
G (SEQ ID NO: 25), 10354784 S2: CCT CAG CCA CAG CAC GG
A (SEQ ID NO: 26), 10354784 S3: ACC TCC AAG ACA GAC TC
A TAT (SEQ ID NO: 27), 10354784 S4: ATA TGA GTC TGT CTT GG
A GGT (SEQ ID NO: 28), 10354784 S5: ACG GCC TCC GAG ACC TC
A (SEQ ID NO: 29), 10354784 S6: TGA GGT CTC GGA GGC CG
T (SEQ ID NO: 30), 10354784 S7: CCA CAG ACA GTG ACA AT
G (SEQ ID NO: 31) and 10354784 S8: CAT TGT CAC TGT CTG TG.
G (SEQ ID NO: 32).

This construct was transformed into pCR2.1-cg10354784.0.335-S334-.
7A. The cloned insert was determined as an ORF encoding a polypeptide having 628 amino acid residues and is shown in Table 3 below. There are 6 nucleotide changes compared to the sequence of clone 10354784.0.335 (SEQ ID NO: 1). These nucleotide changes are due to clone 10354784.
． Three changes were made in the amino acid sequence (shown in Table 4) compared to the polypeptide encoded by 0.335 (SEQ ID NO: 2). The other three nucleotide changes are silent mutations that do not change the amino acid sequence.

[0384]

Table 3 10354784.0.335. DNA sequence analysis of S334-7a

[0385]

Table 4 10354784.0.335. Deduced amino acid sequence of S334-7A As described in the detailed description of the invention, the nucleotide sequence of clone 0354784.0.335 was searched against the GenBank database using the BLASTN search protocol. The BLASTN search is the array 10354784.0.
335 is human CDO mRNA (3986 bp) (GenBank accession number AF0)
It was shown to have 71% identity (450 of 632 nucleotides) to 04841).

A search in the publicly available GenBank database BLASTP revealed that the protein encoded by the related sequence 10354784.0.335 was ACC: O.
35158 rat CDO protein (1256aa) with 50% identity (525
265 of the residues, and ACC: O14631 human CDO (1240
It was shown to have 50% identity with aa) (259 of 518 residues).
CDO is an oncogene, serum, and anchorage regulatory member of the Ig / fibronectin type III repeat family (Kang et al.,
J. Cell Biol. 138 (1), 203-213 (1997)). Based on homology, 10354784.0.335 and 10354784.0.3
35. The S3347A protein as well as each homologous protein or peptide share at least some activity.

Example 2. Preparation of mammalian expression vector pCEP4 / Sec Oligonucleotide primer, pSec-V5-His Forward: CTCGTCCTCGAGGGGTAAGC
CTATCCCTAAC (SEQ ID NO: 33) and pSec-V5-His Reverse direction: CTCGTCGGGCCCCTGATCA
GCGGGTTTTAAAC (SEQ ID NO: 34) was added to pcDNA3.1-V5His (Invitro containing V5 and His6).
gen, Carlsbad, CA) was designed to amplify the fragment from the expression vector. The PCR product was digested with XhoI and ApaI and Igκ
Xh containing leader sequence (Invitrogen, Carlsbad CA)
It was ligated into the oI / ApaI digested pSecTag2B vector. The correct structure of the resulting vector pSecV5His (including the Ig-κ leader and V5-His6 in frame) was confirmed by DNA sequence analysis. Vector pSec
V5His was digested with PmeI and NheI to generate a fragment holding the element in frame. This PmeI-NheI fragment was added to the BamHI / Klenow and NheI treated vector pCEP4 (I
nvitrogen, Carlsbad, CA). The resulting vector was named pCEP4 / Sec and was under the control of the PCMV and / or PT7 promoters, an in-frame Igκ leader, the insertion site of the clone of interest,
Includes V5 and His6. pCEP4 / Sec binds arbitrary proteins to Igκ
An expression vector that enables heterologous protein expression and secretion by fusing the chain signal peptide. Detection and purification of expressed proteins is aided by the presence of V5 epitope tag and 6xHis tag at the C-terminus (Inv
(itrogen, Carlsbad, CA).

Example 3 Expression of hl0354784 in Human Embryonic Kidney 293 Cells The BglII-XhoI fragment containing hl0354784 sequence was cloned into pCR2.
． 1-cg10354784-S334-7A and isolated from vector pC
Expression vector pCEP4 / S subcloned into EP4 / Sec (Example 2)
ec-10354784 was produced. pCEP4 / Sec-1035478 Vector 4 was added to 293 cells using LipofectaminePlus reagent as directed by the manufacturer (Gibco / BRL / Life Technologies, R.
occville, MD). Cell pellets and supernatants were harvested 72 hours after transfection and tested for 10354784 expression by Western blotting using anti-V5 antibody under reducing conditions. FIG. 1 shows that hl0354784 is secreted into the supernatant by 293 cells at about 7
It is shown to be expressed as a polypeptide of multiple sizes with a major product having an apparent molecular weight (Mr) of 0 kDa. This is close to the estimated value of 68794.1 Da.

Example 4 Expression of 20604798 in Human Embryonic Kidney 293 Cells The BglII-XhoI fragment containing h20604798 sequence was cloned into pCR2.
． 1-cg 20604798-S319-2D and isolated from vector pC
Expression vector pCEP4 / S subcloned into EP4 / Sec (Example 2)
ec-20604798 was produced. The pCEP4 / Sec-20604798 vector was added to 293 cells using the LipofectaminePlus reagent as directed by the manufacturer (Gibco / BRL / Life Technologies, M.
Transfected according to D). Cell pellets and supernatants were collected 72 hours post transfection and tested for 20604798 expression by Western blotting using anti-V5 antibody under reducing conditions. FIG. 2 shows 206
04798 shows that Mr is secreted into the supernatant by 293 cells, with the Mr being a weak intensity band at about 62 kDa and two polypeptides of the major product with an Mr at about 53 kDa. The molecular weight standard used was SeeBlue.
Marker (Invitrogen, Carlsbad, CA).

Example 5: Expression of 3207791 in Human Embryonic Kidney 293 Cells The BamHI-XhoI fragment containing 3207791 sequence was cloned into pCR2.1.
-Cg3207791-S320-3E and isolated from the vector pCEP4
/ Sec (Example 2) and cloned into the expression vector pCEP4 / Sec-
3207791 was prepared. pCEP4 / Sec-3207791 vector,
293 cells using LipofectaminePlus reagent using the manufacturer's instructions (Gibco / BRL / Life Technologies, Rockvi.
Ile, MD). Cell pellets and supernatants were collected 72 hours after transfection and tested for h3207791 expression by Western blotting under reducing conditions with anti-V5 antibody. Figure 3
, 3207791 is secreted by the 293 cells into the supernatant, about (apMBSP
Ximately) is shown to be expressed as a polypeptide of multiple sizes with the major product having an Mr of 80 kDa. The molecular weight standard used was SeeB.
lue Marker (Invitrogen, Carlsbad, CA)
Met.

Example 6. Molecular cloning of the mature form of clone 20604798.0.1 (MBSP10) The putative open reading frame clone 20604798.0.1 contains 4
It encodes a secretory protein of 83 amino acid residues. This mature form (residues 34-48
A cDNA encoding (possibly containing 3) was targeted for cloning. Oligonucleotide primers were designed to PCR amplify a DNA segment encoding this polypeptide. The forward primer contains an in-frame BamHI restriction site, and the reverse primer is in-frame XhoI.
Includes restriction sites. The following is the sequence of the primer: 20604798 Forward: CTCGTCGGATCCCTCTCCTCAAC
TCAGCGATGACATCC (SEQ ID NO: 35) and 20604798 Reverse: CTCGTCCTCGAGGTTGGGGGAGA
GAAAGAAGTCC (SEQ ID NO: 36).

PCR reactions were performed in a volume of 50 μl with 5 ng of cDNA template from human pituitary, 1 μM each of 20604798 forward (Forw) and 20604798 reverse primers, 5 μM dNTP (Clontech).
Laboratories, Palo Alto CA) and 1 μl of 50
× Advantage-HF 2 polymerase (Clontech Laboratories)
Attorneys, Palo Alto CA). The reaction conditions used were the same as those described in Example 1.

The major product bands (approximately (apMBSP) detected by agarose gel electrophoresis
Ximately) having a size of 1350 bp) and pCR2
． 1 vector (Invitrogen Corp, Carlsbad). This DNA was sequenced using vector-derived primers and the following gene-specific primers: 20604798 SI: TACAGAATTGAGTCTTTATTG (SEQ ID NO: 37), 20604798 S2: CCAAATAAGACTCAATTCTGTA (SEQ ID NO: 38), 20604798 S3: TCATAGTAGCTAGAGTAGATTAGACATAGTACT. ), 20604798 S4: AGTTGTTAACTTCAGCTACTGA (SEQ ID NO: 40), 20604798 S5: GGTTCTTACTGCTTTCGTGGGG (SEQ ID NO: 41), 20604798 S6: CCCACGAGAAGCAGTAAGAACC (SEQ ID NO: 42).

The cloned construct was cloned into pCR2.1-20604798-S319-
2d. This insert is an ORF that exactly matches the sequence of clone 20604798.0.1 (SEQ ID NO: 19) and was determined to encode a predicted 450 residue polypeptide (SEQ ID NO: 20).

Example 7. Molecular cloning of mature form of clone 3207791.0.128 (MBSP6) The putative open reading frame of clone 3207791.0.128 encodes a 535 amino acid residue secreted protein. The cDNA encoding this putative mature form spanning residues 23-535 was targeted for cloning. Oligonucleotide primers were designed for PCR amplification of DNA sequences.
The forward primer contains an in-frame BamHI restriction site and the reverse primer contains an in-frame XhoI restriction site. The following is the sequence of the primer: 3207791 Forward: CTCGTCGGATCCCGAGTCTGAGACT
GGGCCCATGGAGGG (SEQ ID NO: 43), and 3207791 Reverse direction: CTCGAGGCCCCGGTGGTGGTGGGTG
GTGGCTATGGCTG (SEQ ID NO: 44).

The PCR reaction was performed in a volume of 50 μl with 5 ng of cDNA template from human pituitary, 1 μM of each 20604798 forward primer and 20604798.
Reverse primer, 5 μM dNTP (Clontech Laborator)
, Palo Alto CA) and 1 μl of 50 × Advantag
e-HF 2 polymerase (Clontech Laboratories, P.
alo Alto CA). The reaction conditions used were the same as those described in the examples.

One major amplification product (1500 bp size) was detected by agarose gel electrophoresis. The product was isolated and the pCR2.1 vector (Invitrog
en Corp, Carlsbad). This DNA was sequenced using vector-derived primers and the following gene-specific primers: 3207791 SI: GAAGCCTTCCAGCGGGCTCTG (SEQ ID NO: 45), 3207791 S2: CAGAGGCCCGCTGGAAGGCCTTC (SEQ ID NO: 46), 3207791 S3: GGCTTGGCTGAGCTGG47GG). , 3207791 S4: GTGGCCCAGCTCAGCCAAGCC (SEQ ID NO: 48), 3207791 S5: CGACAGGGGCCCGAGAGACC (SEQ ID NO: 49), 3207791 S6: GGTTCCTTCGGGGCCCTGTAC (SEQ ID NO: 50), 320GA791CTGA: GCATAGCT: 320CA791GCT: GCACGCTGAC. 791 S8: GTAGCTCCTTGGTCAGCTGC (SEQ ID NO: 52).

The cloned construct was cloned into pCR2.1-cg3207791.0.12.
Called 8-pCR2.1-S320-3E. This insert was determined to be the ORF encoding a 513 amino acid polypeptide.

PCR2.1-cg3207791.0.128-pCR2.1-S320-
The nucleotide sequence of the insert in 3E is shown in Table 5. It has two positions (
(Shown in bold), and differs from the clone 3202071.0.128 of the corresponding sequence:

[0400]

[Table 5] pCR2.1cg3207791.0.128-pCR2.1-S320-3
The amino acid sequence of the polypeptide encoded by the insert in E is shown in Table 6. The two nucleotide differences shown in Table 5 translate the two amino acid differences in the polypeptide.

[0401]

[Table 6] Example 8. Real-time expression analysis Quantitative expression of various clones was determined by Perkin-Elmer Biosys.
It was evaluated in about 41 normal samples and about 55 tumor samples by real-time quantitative PCR (TAQMAN®) performed on the tems ABI PRISM® 7700 sequence detection system.

Initially, 96 RNA samples were normalized to β-actin and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). RN
A (total about 50 ng or about 1 ng poly A +) was added to the TAQMAN® Reverse Transcription Reagent Kit (PE Biosystems) according to the manufacturer's protocol.
, Foster City, CA; Catalog No. N808-0234) and random hexamers. Reactions were carried out in 20 μl and incubated for 30 minutes at 48 ° C. Then cDNA (
5 μl) of β-actin and GAPDH according to the manufacturer's protocol
TAQMAN® Assay Reagents (PE Biosystems; Cat # 4310881E and 4310884E, respectively) and TAQM
AN (registered trademark) Universal PCR Master Mix (PE Bios
systems; catalog number 4304447) and transferred to separate plates for TAQMAN® reaction. Reactions were carried out in 25 μl using the following parameters: 50 ° C. for 2 minutes; 95 ° C. for 10 minutes; 95 ° C. for 15 seconds / 60 ° C. for 1 minute (40 cycles). Results are C using a logarithmic scale
Is recorded as a T value (cycle in which a given sample exceeds the threshold level of fluorescence),
The difference in RNA concentration between a given sample and the sample with the lowest CT value was expressed as ΔCT squared. The reciprocal of this RNA difference is then taken and multiplied by 100 to obtain the relative expression percentage. β-actin and G
RNA samples were normalized using the average CT values obtained for APDH. RNA samples that produce the highest CT values require no further dilution,
All other samples according to their β-actin / GAPDH mean CT values
Diluted to this sample.

Normalized RNA (5 μl) was converted to cDNA and the One Step RT-PCR Master Mix Reage according to the manufacturer's instructions.
nts (PE Biosystems; catalog number 4309169) and TAQMAN® using gene specific primers.
Per using probe and primer with the sequence of the target clone as input
Kin Elmer Biosystem's Primer Express
Software package (Macintosh of Apple Computer)
Designed for each assay according to version I) for osh Power PC. The default settings were used for the reaction conditions and the following parameters were set before selecting the primers: primer concentration = 250 nM, primer melting temperature (Tm) range = 58 ° C.-60 ° C., primer optimum Tm = 59 ° C., maximum Primer difference = 2 ° C., probe does not have 5′G, probe Tm must be 10 ° C. higher than primer Tm, amplicon size is 75 bp-100 bp
Is. Selected probes and primers (see below) were labeled with Syn
synthesized by Thegen (Houston, TX, USA). The probe was double purified by HPLC to remove unbound dye and evaluated by mass spectrometry to confirm binding of reporter dye and quencher dye to the 5'and 3'ends of the probe, respectively. did. These final concentrations were as follows: forward primer and reverse primer at 900 nM each and probe at 200 nM.

PCR conditions: Normalized RNA from each tissue and each cell line was subjected to 96-well PCR.
The wells of the plate (Perkin Elmer Biosystems) were spotted. Two probes (multiplexed with SEQX probe (m
singlex TaqManT for PE Biosystems 7700.
5 mM MgCl2, dNTPs using MPCR Master Mix
(DA, G, C, U (1: 1: 1: 2 ratio)), 0.25 U / ml Ampl
iTaq GoldTM (PE Biosystems) and 0.4 U / μl
RNase inhibitor, as well as 0.25 U / μl reverse transcriptase. Reverse transcription was performed for 30 minutes at 48 ° C., then amplification / PC as follows.
R cycles were performed: 95 ° C. for 10 minutes, then 40 cycles of: 95
15 seconds at 60 ° C, 1 minute at 60 ° C.

Using the primer probe set Ag70, clone 17939072.
Expression of 0.47 (MBSP3) was detected in various tissues.

Forward: ACCGTGACACGCGACCATTC (SEQ ID NO: 53) Reverse: GTGTGGGCAGTTGCGGTACC (SEQ ID NO: 54) Probe: Fam-AACTGTGCCCGCCTTCTACGCG-Tam
ra (SEQ ID NO: 55) The results are shown in Table 7. Clone 17939072.0.47 (MBSP3) is expressed in many cancer cell lines, but not in the cognate normal cell line.

[0407]

[Table 7] ca. = Carcinoma, * = established from metastasis met = metastasis s cell var = small cell variant non-s = non-sm = non-small squam = squamous pl. eff = pl effusion = pleural effusion glio = glioma astro = astrocytoma neuro = neuroblastoma.

Example 9. Radiation hybrid mapping identifies chromosomal location of clones of the invention Radiation hybrid mapping using human chromosomal markers was performed on a number of clones described in the invention. The procedure used to obtain these results is
Steen, RG et al. (A Hiht-Density Integrated
Genetic Linkage and Radiation Hybrid
Map of the Laboratory Rat, Genome Re
search 1999 (published online May 21, 1999) Volume 9: A
P1-AP8, 1999). Detailed procedures for RH mapping are described, for example, in Cox et al. (1990) Science 250: 245-.
250; Boehnke et al. (1991) Am J Hum Genet 49.
: 1174-1188; and Walter et al. (1994) Nat Gene.
t 7: 22-28.

Screening a panel of 93 cell clones containing randomized radiation-induced human chromosome fragments in a 96-well plate using PCR primers designed to uniquely identify the clones sought. did. Table 8 provides the results obtained for the three clones of the invention, where these markers span the genes of the invention and the distance in their cR separates these genes.

[0410]

[Table 8] Other Embodiments Certain embodiments have been disclosed herein in detail, but the disclosure is an example for purposes of illustration only and is not intended to be limiting on the scope of the appended claims. Not do. In particular, various substitutions, changes, and modifications may be made to the present invention without departing from the spirit and scope of the invention as defined by the claims of the invention. And others. Accordingly, other aspects, advantages and modifications are within the scope of the above claims.

[Brief description of drawings]

FIG. 1 is a Western blot representation showing expression of proteins secreted by pCEP4 / Sec-10354784-transfected 293 cells.

FIG. 2 is a Western blot representation showing expression of proteins secreted by 293 cells transfected with pCEP4 / Sec-20604798.

FIG. 3 is a Western blot representation showing expression of proteins secreted by 293 cells transfected with pCEP4 / Sec-3207791.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) A61P 11/06 A61P 21/04 4C084 19/02 25/00 4C085 21/04 29/00 101 4H045 25/00 31/04 29/00 101 31/10 31/04 31/12 31/10 31/20 31/12 31/22 31/20 33/02 31/22 33/06 33/02 35/00 33/06 37 / 00 35/00 37/06 37/00 C07K 14/47 37/06 16/18 C07K 14/47 19/00 16/18 C12N 1/15 19/00 1/19 C12N 1/15 1/21 1 / 19 C12P 21/02 C 1/21 21/08 5/06 C12Q 1/02 5/10 1/68 A C12P 21/02 G01N 33/15 Z 21/08 33/50 Z C12Q 1/02 33/53 D 1/68 MG01N 33/15 33/566 33/50 C12N 15/00 ZNAA 33/53 5/00 AE 33/566 A61K 37/02 (31) Priority claim number 09 / 688,598 (32) Priority Date October 12, 2000 (2 000.10.12) (33) Priority claiming country United States (US) (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT , LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM) , KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD , GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, L K, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK , SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Boldodge, Ferench El. United States Connecticut 06473, North Haven, Jansen Lane 22 F-term (reference) 2G045 AA40 BA11 BB50 DA12 DA13 DA14 DA36 FB02 FB03 4B024 AA01 AA11 BA80 CA04 CA07 CA09 CA20 DA03 EA04 FA02 GA13 HA11 HA13 HA14 HA17 QBQ3 QA21 QAQ3 QA21 QAQ2 QAQ4 QA5 QAQ4 QAQ2 QAQ4 QAQ4 QAQ4 QAQ4 QAQ4 QAQ4 QAQ4 QAQ4 QAQ4 QAQ4 QAQI QQ53 QQ61 QQ79 QQ89 QR08 QR32 QR35 QR40 QR42 QR56 QR62 QR72 QR77 QR80 QS16 QS25 QS34 QS36 QX02 4B064 AG01 AG27 CA10 CA19 CA20 CC01 CC24 DA01 DA13 4B065 AA01X AA58X AA72X AA93X AA93Y AB01 AC14 BA02 BA05 BA30 CA24 CA44 CA46 4C084 AA01 AA07 AA13 DC50 NA14 ZA012 ZA592 ZA942 ZA962 ZB082 ZB152 ZB262 ZB332 ZB352 ZB382 4C085 AA14 AA16 BB31 CC22 DD33 DD62 4H045 AA10 AA11 AA20 AA30 BA10 BA41 CA40 DA76 EA20 EA50 FA72 FA74

Claims (40)

[Claims] 1. An isolated polypeptide comprising the following: (a) Maturation of the amino acid sequence given by SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22. Form; (b) a variant of the mature form of the amino acid sequence provided by SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22, wherein in the mature form A variant in which any amino acid is changed to a different amino acid sequence, provided that 15% or less of the amino acid residues in the mature form of the sequence are so changed; (c) SEQ ID NO: 2 4,6,8,10,12,14,16,18,20 and 22; (d) SEQ ID NOs: 2,4,6,8,10,12,14,16,18,20 And the ami given by 22 A variant of an acid sequence, wherein any amino acid in the sequence shown here is changed to a different amino acid sequence, provided that 15% or less of the amino acid residues of this sequence are A polypeptide comprising an amino acid sequence selected from the group consisting of: (e) a fragment of any one of (a) to (d); 2. The polypeptide of claim 1, wherein the polypeptide is of the sequence given by SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22. A polypeptide that is a naturally occurring allelic variant. 3. The polypeptide of claim 2, wherein the variant is a translation product of a single nucleotide polymorphism. 4. The polypeptide according to claim 1, wherein the polypeptide is
Is a variant polypeptide described herein, wherein any amino acid specified in the selected sequence is altered to provide a conservative substitution,
Polypeptide. 5. An isolated nucleic acid molecule, which nucleic acid molecule is provided by: (a) SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22. (B) a variant of the mature form of the amino acid sequence given by SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22, wherein: , Any amino acid in the mature form of the selected sequence is changed to a different amino acid sequence, provided that 15% or less of the amino acid residues in the mature form of the sequence are changed in this way (C) amino acid sequences given by SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22; (d) SEQ ID NOs: 2, 4, 6, 8, 10 , 12, 14, 16, 18, 20 and A variant of the amino acid sequence given by 22, wherein any amino acid shown in the selected sequence is changed to a different amino acid sequence, provided that 15% or less of the amino acid residues in the sequence are (E) a polypeptide comprising the amino acid sequence given by SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 and 22 or the polypeptide, wherein the variant thus modified; A nucleic acid fragment encoding at least a portion of any of the variants, wherein any amino acid of the selected sequence is changed to a different amino acid sequence,
Provided that no more than 10% of the amino acid residues in the mature form of the sequence are altered in this way; and (f) the complement of any of the nucleic acid molecules. A nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide comprising an amino acid sequence. 6. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule comprises the nucleotide sequence of a naturally occurring allelic nucleic acid variant. 7. The nucleic acid molecule of claim 5, which encodes a variant polypeptide, wherein the variant polypeptide has the polypeptide sequence of a naturally occurring polypeptide variant. Nucleic acid molecule. 8. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule comprises a single nucleotide polymorphism encoding the variant polypeptide. 9. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule is: (a) SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19. , And 21; (b) a nucleotide sequence, wherein SEQ ID NOs: 1, 3, 5, 7, 9, 1
One, more than one nucleotide in the nucleotide sequence given by 1, 13, 15, 17, 19, and 21 is changed from the nucleotide given by the selected sequence to a different nucleotide, provided that 15% or less of the nucleotides (C) a nucleic acid fragment of the sequence given by SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21; and (d) ) Nucleic acid fragments, wherein SEQ ID NOs: 1, 3, 5, 7, 9, 1
One, more than one nucleotide in the nucleotide sequence given by 1, 13, 15, 17, 19, and 21 is changed from the nucleotide given by the selected sequence to a different nucleotide, provided that 15% or less of the nucleotides A nucleic acid molecule comprising a nucleotide sequence selected from the group consisting of: 10. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule is SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, and 21.
A nucleic acid molecule that hybridizes under stringent conditions to a nucleotide sequence provided by or a complement of the nucleotide sequence. 11. The nucleic acid molecule of claim 5, wherein the nucleic acid molecule is any nucleotide shown in the coding sequence for the selected nucleotide,
A nucleotide sequence that changes from the sequence provided by the selected sequence to a different nucleotide, provided that no more than 15% of the nucleotides in the selected coding sequence are so changed, A nucleic acid molecule comprising an isolated second polynucleotide that is the complement of the first polynucleotide, or a fragment of any of these. 12. A vector comprising the nucleic acid molecule of claim 11. 13. The vector of claim 12, further comprising a promoter operably linked to the nucleic acid molecule. 14. A cell comprising the vector according to claim 12. 15. A polypeptide that immunospecifically binds to the polypeptide according to claim 1,
antibody. 16. The antibody according to claim 15, wherein the antibody is a monoclonal antibody. 17. The antibody of claim 15, wherein the antibody is a humanized antibody. 18. A method for determining the presence or amount of the polypeptide of claim 1 in a sample, the method comprising: (a) providing the sample; (b) Introducing a sample into an antibody that immunospecifically binds to the polypeptide; and (c) determining the presence or amount of the antibody that binds to the polypeptide, and thereby the presence or amount of the polypeptide in the sample. Determining the. 19. A method for determining the presence or amount of the nucleic acid molecule of claim 5 in a sample, said method comprising: (a) providing said sample; (b) said Introducing a sample into a probe that binds to the nucleic acid molecule; and (c) determining the presence or amount of the probe bound to the nucleic acid molecule and thereby determining the presence or amount of the nucleic acid molecule in the sample. The method comprising the steps of: 20. A method of identifying a factor that binds to the polypeptide of claim 1, comprising the following steps: (a) introducing the polypeptide into the factor; and (b) Determining whether an agent binds to the polypeptide. 21. A method for identifying a potential therapeutic agent for use in treating a pathology, wherein the pathology is aberrant expression of the polypeptide of claim 1. Provided is a cell which is associated with an abnormal physiological interaction, wherein the method expresses the polypeptide of claim 1 (a) and has a property or function attributable to said polypeptide. (B) contacting the cell with a composition comprising a candidate substance; and (c) determining whether the substance alters a property or function attributable to the polypeptide, thereby If the alterations observed in the presence of the substance are not observed when the cells are contacted with a composition lacking the substance, then the substance is identified as a potential therapeutic agent. A method of including. 22. A method for modulating the activity of the polypeptide of claim 1, wherein the method comprises treating a cell sample expressing the polypeptide of claim 1 with the activity of the polypeptide. A method comprising introducing into a compound that binds to said polypeptide in an amount sufficient to modulate. 23. A method of treating or preventing a pathology associated with the polypeptide of claim 1, wherein the method comprises administering to a subject in whom such treatment or prevention is desired. A method comprising administering the polypeptide of claim 1 in an amount sufficient to treat or prevent a pathology. 24. The method of claim 23, wherein the subject is a human. 25. A method of treating or preventing a pathology associated with the polypeptide of claim 1, wherein the method comprises administering to a subject in whom such treatment or prevention is desired. MBSPX in an amount sufficient to treat or prevent pathology
A method comprising the step of administering a nucleic acid. 26. The method of claim 25, wherein the subject is a human. 27. A method of treating or preventing a pathology associated with the polypeptide of claim 1, wherein the method comprises administering to a subject in whom such treatment or prevention is desired. MBSPX in an amount sufficient to treat or prevent pathology
A method comprising the step of administering an antibody. 28. The method of claim 27, wherein the subject is a human. 29. A pharmaceutical composition comprising the polypeptide of claim 1 and a pharmaceutically acceptable carrier. 30. A pharmaceutical composition comprising the nucleic acid molecule of claim 5 and a pharmaceutically acceptable carrier. 31. A pharmaceutical composition comprising the antibody of claim 15 and a pharmaceutically acceptable carrier. 32. A kit comprising the pharmaceutical composition of claim 29 in one or more containers. 33. A kit comprising the pharmaceutical composition of claim 30 in one or more containers. 34. A kit comprising the pharmaceutical composition of claim 31 in one or more containers. 35. A method for screening a modulator of activity or latency to a pathology associated with the polypeptide of claim 1 or a predisposition to said pathology, the method comprising: (a) Administering a test compound to a test animal having an increased risk of pathology associated with the polypeptide of claim 1, wherein the test animal recombinantly expresses the polypeptide of claim 1. (B) a step of measuring the activity of the polypeptide in the test animal after the step of administering the compound of step (a); and (c) an activity of the protein in the test animal, wherein the polypeptide is Comparing the activity of the polypeptide in an untreated control animal, wherein the polyaniline in the test animal relative to the control animal A change in the activity of the peptide is indicative of that the test compound is a latent or predisposed modulator of the pathology associated with the polypeptide of claim 1. 36. The method of claim 35, wherein the test animal expresses a test protein transgene at an increased level relative to a wild-type test animal or under the control of a promoter. A method wherein a recombinant test animal expressing said transgene, wherein said promoter is not the native gene promoter of said transgene. 37. A method for determining the presence or predisposition to a disease associated with altered levels of the polypeptide of claim 1 in a first mammalian subject, the method comprising: a) measuring the expression level of the polypeptide in a sample from the first mammalian subject; and (b) determining the amount of the polypeptide in the sample of step (a) to indicate the presence of the disease. Not known or known to be less susceptible to the disease, the step of comparing with the amount of the polypeptide present in a control sample from a second mammalian subject, wherein: The method comprising the step wherein the change in expression level of the polypeptide in the first subject as compared to the control sample is indicative of the presence or predisposition to the disease. 38. A method for determining the presence or predisposition to a disease associated with altered levels of the nucleic acid molecule of claim 5 in a first mammalian subject, the method comprising: a) measuring the amount of the nucleic acid in a sample from the first mammalian subject; and (b) the amount of the nucleic acid in the sample of step (a) being free of the disease. Is known or is known to be less susceptible to the disease, the step of comparing with the amount of the nucleic acid present in a control sample from a second mammalian subject, wherein: The method comprising the step wherein the change in the level of the nucleic acid in the first subject as compared indicates the presence or predisposition to the disease. 39. A method of treating a pathological condition in a mammal comprising:
The method comprises the step of administering to the mammal a polypeptide in an amount sufficient to ameliorate the pathological condition, wherein the polypeptide is SEQ ID NO: 2, 4, 6, 8,
A method, wherein the polypeptide has an amino acid sequence that is at least 95% identical to a polypeptide comprising the amino acid sequence provided by 10, 12, 14, 16, 18, 20, and 22, or biologically active fragments thereof. 40. A method of treating a pathological condition in a mammal, said method administering to said mammal the antibody of claim 15 in an amount sufficient to ameliorate said pathological condition. A method comprising the step of: