JP2003506070A - Drug target isogenic: polymorphism in 5-hydroxytryptamine receptor 1A gene - Google Patents

Abstract

  (57) [Summary] Polynucleotides have been described that consist of one or more of the three novel single nucleotide polymorphisms in the human 5-hydroxytryptamine receptor 1A gene (HTR1A). Compositions and methods for detecting one or more of these polymorphisms are also disclosed. In addition, various genotypes and haplotypes for the HTR1A gene present in the population have been described.

Description

Detailed Description of the Invention

Related Patent Application This patent application is based on United States provisional application number 60 / 147,7 filed on August 6, 1999.
Claim 11 conveniences. TECHNICAL FIELD OF THE INVENTION The present invention relates to mutations in a gene encoding a pharmaceutically important protein.
In particular, the invention provides variants of the human 5-hydroxytryptamine receptor 1A (HTR1A) gene and methods of identifying which variants of these genes are owned by an individual. BACKGROUND OF THE INVENTION Current methods of identifying agents for the treatment of disease often begin with the identification, cloning, and expression of important target proteins associated with that disease. It is then determined whether an agonist or an antagonist is needed to produce a beneficial effect in patients with the disease. Furthermore, a large number of compounds are tested against target proteins in order to discover new promising drugs. What is desired as a result of this process is a drug that is specific for the target and reduces the incidence of unwanted side effects caused by unintended activity on the target compound.

However, not taken into account in this approach is the natural variability of any population with respect to a particular protein. Target proteins commonly used in drug testing at present are expressed by genes cloned based on an arbitrarily selected population. However, the nucleotide base sequences of a particular gene may differ significantly between individuals. Subtle changes in the main nucleotide base sequence of the gene encoding the target protein will be expressed as important mutations in the expression of the protein and in structure and / or function. It can account for the relatively high degree of uncertainty that arises in treating an individual with a drug designed based on a single representative target. For example, it is well known that certain drugs are often less effective against some individuals than others. Therefore, such individuals and their physicians must weigh the risks of side effects against the benefits of large doses. Furthermore, the variety of information on the biological function or effect of a protein is mixed because different scientists are unknowingly studying different isoforms of the gene encoding the protein. Therefore, information on the type and frequency of genomic mutations that exist for pharmaceutically important proteins is useful.

A single nucleotide variant (single nucleotide polymorphism) in the main nucleotide sequence of a gene is organized into a limited number of combinations that are units of a genetic trait, and is called a haplotype. Therefore, each haplotype contains much more information than the individual unordered polymorphisms. Haplotypes can accurately represent genomic variations on two chromosomes of an individual.

It is well known that many diseases are associated with specific mutations in gene sequences. However, while there are instances where individual polymorphisms act as genetic markers for particular phenotypes, individual polymorphisms may be found in diverse genomic backgrounds. Therefore, there is no definitive relationship between the polymorphism and the site that causes the phenotype (Clark
AG et al. 1998 Am J Hum Genet 63: 595-612; Ulbrecht M et al. 2000 Am J Re
spir Crit Care Med 161: 469-74). Furthermore, markers are predictive in some populations but not in others (Clark AG et al. 1998 supra). In these cases, haplotypes provide excellent genetic markers for phenotype (
Clark AG et al. 1998 above; Ulbrecht M et al. 2000, above; Ruano G & Steph
ens JC Gen Eng News 19 (21), December 1999).

Analyzing the relationship between each observed haplotype and a particular phenotype allows each haplotype to be ranked by statistical predictions for the phenotype. For haplotypes that are said to be strongly associated with the phenotype, other methods are used to confirm false positive correlations to minimize false positive correlations. For a gene that appears to be associated with a particular phenotype, if the observed haplotype for that gene does not show an association with the phenotype of interest, then mutations in that gene are mostly associated with that phenotype. Presumably none (Ruano & Stephens 1999, above). Therefore, information about observed haplotypes and their frequencies in various populations is useful in a variety of research and clinical applications.

One of the possible drug targets for the treatment of neuropsychiatric diseases and Tourette's syndrome is the 5-hydroxytryptamine receptor 1A (HTR1A) gene or substances encoded by it. 5-Hydroxytryptamine receptor 1A (HTR1A) is one of 14 well-known receptors for 5-hydroxytryptamine (5-HT; serotonin), a biohormone that functions as a neurotransmitter, hormone, and mitogen. Is. The serotonergic pathway is believed to be involved in all physiological and behavioral processes including pain sensation, thermoregulation, circulatory function, feeding, aggression and stress response. Abnormal functions in the serotonergic pathway have been associated with neuropsychiatric-related illnesses such as anxiety disorders, depression, substance abuse, and Tourette's syndrome. It is believed that the genetic predisposition to these injuries may involve variability in the gene encoding the 5-HT receptor.

Serotonin receptors belong to the superfamily of G-protein coupled receptors with seven transmembrane domains. The 14 5-HT receptors have been broadly classified based on their molecular biological, pharmacological, biochemical, and physiological properties. The most thoroughly studied to date is HTR1A. The activity of HTR1A is mediated by a G protein that inhibits the activity of adenylate cyclase. The 5HT1A receptor is expressed in a tissue-specific manner primarily in the dorsal and median raphe nuclei, hippocampus, septal nucleus, amygdala, and certain cortical layers. Expression is found in both the presynaptic and postsynaptic membranes of serotonergic neurons. The presynaptic membrane HTR1A is a classical “self receptor” in the raphe nucleus. Presynaptic serotonergic neurons synthesize most of the brain's serotonin. Activation of the HTR1A molecule in these neurons completes the negative feedback loop and suppresses serotonin synthesis, rotation, and release, thus attenuating system-wide serotonergic signals. This important regulatory action provides a target for clinical intervention and has been successfully exploited in developing partial agonists of HTR1A such as anxiolytics, buspirone and gepirone. In addition, HTR1A antagonists are believed to enhance the antidepressant effects of selective serotonin reuptake inhibitors (SSRIs) such as fluoxetine. SSRIs are 5-H
It functions by inhibiting the binding of T to the serotonin transporter in the synaptic cleft and increasing synaptic serotonin levels. In addition, SSRIs potentiate and accelerate their effects by blocking inhibitory presynaptic membrane HTR1A with antagonists.
The postsynaptic HTR1A is found mainly in the limbic region (hippocampus, septum) and cerebral cortex, the region where serotonergic neurons project. Activation of the postsynaptic membrane HTR1A is thought to induce hyperpolarization of postsynaptic neurons through activation of G-protein coupled potassium channels. It results in reduced release of neurotransmitters and reduced frequency of transmission in neurons.

The 5-hydroxytryptamine receptor 1A gene is located on chromosome 5q11.2-q13 (K
obilka et al., Nature. 1987 329: 75-79), which encodes a 422 amino acid protein 1
Contains exons. Although the entire genomic sequence has not yet been disclosed, the HTR1A gene reference sequence can be assembled from independent disclosed sequences. Sequences that overlap at the promoter region and the 5'end of the exon are disclosed. The sequence shown in Figure 1 (GenBank accession number Z11168.1; SEQ ID NO: 1) includes the promoter and its exon 5'end, and the sequence shown in Figure 2 contains ( GenB
ank accession number M83181.1; SEQ ID NO: 2), containing the complete exon. HTR1A
Reference sequences for the genes are shown in Figure 3 (SEQ ID NO: 3; nucleotides 1-784 of GenBank accession number Z11168.1 and nucleotides 1-1938 of GenBank accession number M83181.1). The coding sequence and the reference sequence for the protein are shown in FIG. 4 (SEQ ID
NO: 4) and 5 (SEQ ID NO: 5).

Notable features of the HTR1A gene include the following: It lacks typical TATA box elements present in promoters and instead replaces GC-rich sequences (especially M
There is an extensive run of consensus GGGGC / AGGGG sequences representing AZ and Sp1 transcription factor binding sites (Parks and Shenk, J. Biol. Chem. 271: 4417-4430, 1996). HTR1A
Notable features of the protein sequence (see Figure 4) include the amino-terminal extracellular domain at amino acids (AA) 1-36; AA 37-62, AA 74-98, AA 110-132, AA153-178, AA 1
7 transmembrane domains in 92-217, AA 346-367, and AA 379-403; and AA 40
The carboxy terminal cytoplasmic domain at 4-422 is included.

The polymorphism at the HTR1A locus includes those identified as restriction enzyme fragment length polymorphisms (RFLPs) containing TaqI, RsaI, and SacI RFLPs, or those identified as single nucleotide polymorphisms (SNPs). Have been reported up to. Melmer et al., Genom
ics. 1991 11: 767-769) was used to identify RFLPs for the enzyme TaqI and improve the map location of HTR1A. Furthermore, it was shown that there was a strong linkage between some highly polymorphic markers in the reference population prepared for causality studies on schizophrenia. In a causal relationship study between schizophrenia and serotonin receptors HTR1A and HTR2A,
A positive correlation was found with HTR2A on the long arm of chromosome 13 but not with HTR1A (Inayama et al., Am. J. Med. Genet. 1996 67 : 103
-105). In this study, Warren and others (Warren et al., Hum. Mol. Ge.
RsaI RFLPs for HTR1A identified by C.net. 1: 778, 1992) were used. This RsaI RFLP corresponds to a silent polymorphism, which is a nucleotide polymorphism.
The change from guanine to adenine at 685 (amino acid 8; Figure 4), Xie et al.
(Neuropsychopharmacology 12: 263-268. 1995).
This polymorphism was also reported in the NCBI SNP database as of July 24, 2000 (R
ef SNP # 6354). A third RFLP for the enzyme SacI also correlates with the HTR1A locus (Khan et al., Nucl. Acids Res. 18: 691, 1990), but the SacI site is found in the reference nucleotide sequence. Since it is not, a polymorphic site will probably be found in the flanking regions of the gene. In addition, nucleotide position 943 shown in FIG.
Single nucleotide polymorphisms corresponding to polymorphisms of cytosine or thymine in the human Genic Bi-Allelic Sequences Database
) (HGBase: SNP000002698; Kawanishi et al., Am. J. Med. Genet. 1998. 81:43
4-439) as of July 28, 2000.

Several SNPs have been reported that produce variants in amino acid sequence. Figure 2
The following SNPs shown in Figure 1 cause amino acid variants in the HTR1A protein: a cytosine or thymine polymorphism at nucleotide position 438 that results in a proline or leucine at AA position 16 (Kawanishi et al., 1998. Am. . J. Med
Genet. 81: 434-9); guanine or adenine polymorphisms at nucleotide position 455 resulting in glycine or serine at AA position 22 (Nakhai et al.
., Biochem Biophys. Res. Commun. 210: 530-536 1995); polymorphisms of adenine or guanine at nucleotide position 473 resulting in isoleucine or valine at AA position 28 (Nakhai et al., Supra); Nucleotide position 105
Guanine or thymine [polymorphism] at 0, which produces arginine or leucine at AA220 (Lam et al., Biochem. Biophys. Res. Commun. 219:
853-858, 1996); polymorphisms of cytosine or guanine at nucleotide position 1645 that produce lysine or asparagine at AA420 (Lam et al.,
Above); a polymorphism of guanine or adenine at nucleotide position 1209, AA27
What results in glycine or aspartic acid in 3 (HGBase
: SNP0000002697; July 28, 2000).

Because polymorphisms in the HTR1A gene can affect the expression and function of the encoded protein, it is determined how such polymorphisms are combined in different copies of the gene, and It is useful to determine if a polymorphism is present in the HTR1A gene.

Such information may be useful in studying the biological function of the HTR1A receptor and in agents that target this receptor in the treatment of anxiety disorders and behavioral disorders such as depression.
/ Or useful in identifying antagonists. SUMMARY OF THE INVENTION Accordingly, the present inventors have discovered three novel polymorphic sites within the HTR1A gene. These polymorphic sites (PS) correspond to the following nucleotide positions listed in Figure 3: 996 (PS
1), 1598 (PS5) and 1639 (PS6). Polymorphisms at these sites are cytosine or thymine in PS1, cytosine or thymine in PS5, and cytosine or guanine in PS6. Furthermore, the inventor of the present application was self-identified as belonging to one of four major populations of African descent, Asian, Caucasian, and Spanish / Latin with identification of surrogate nucleotides present at these sites.79 1222 (PS2), 1 previously discovered in a human reference population consisting of
Substitute nucleotides at the 257 (PS3), 1469 (PS4), 1727 (PS7), 1834 (PS8) and 1993 (PS9) sites were also determined. The HTR1A-encoding polynucleotides containing one or more of the novel polymorphic sites reported in this case are useful for studying the expression and biological function of HTR1A and for developing drugs targeting this protein. Is considered to be useful in. In addition, information on polymorphic combinations in the HTR1A gene can be applied in diagnostics and forensics.

Thus, in one embodiment, the present invention provides an isolated polynucleotide containing a nucleotide base sequence that is a polymorphic variant of the reference base sequence of the HTR1A gene or a fragment thereof. The reference base sequence comprises SEQ ID NO: 3 and the polymorphic variant comprises at least one polymorphism selected from the following groups: thymine in PS1, thymine in PS5, guanine in PS6. In a preferred embodiment, the polymorphic variant comprises one or more of the additional polymorphisms selected from the following groups: thymine in PS2, guanine in PS3, adenine in PS4, thymine in PS7, thymine in PS8, Adenine in PS9. A particularly preferred polymorphic variant is the naturally occurring isoform of the HTR1A gene (referred to herein as a “isogenic”). The HTR1A isogenic gene of the present invention comprises the following: cytosine or thymine in PS1, cytosine or thymine in PS2, adenine or guanine in PS3, guanine or adenine in PS4, cytosine or thymine in PS5, cytosine or guanine in PS6, PS7. Cytosine or thymine, guanine or thymine in PS8, and guanine or adenine in PS9. The invention also presents a collection of HTR1A isogenic genes, referred to herein as the HTR1A genome collection.

The HTR1A isogenic gene is defined by the combination and order of these polymorphisms in the isogenic gene, which is referred to herein as the HTR1A haplotype. Therefore, the present invention also relates to the different HTRs found in the above four populations.
You are presenting data on the number of 1A haplotypes. This haplotype data is useful in finding HTR1A haplotypes from individual genotypes for the HTR1A gene, and in determining associations between HTR1A haplotypes and specific characteristics.

In another embodiment, the present invention provides a polynucleotide containing a polymorphic variant having a reference nucleotide sequence of HTR1A cDNA or a fragment thereof. This reference base sequence comprises SEQ ID NO: 4 (FIG. 4) and the polymorphic cDNA comprises at least one polymorphism selected from the following group: thymine at the position corresponding to nucleotide 423, and nucleotide 464. Guanine in the position corresponding to. In a preferred embodiment, the polymorphic variant comprises one or more polymorphisms selected from the following group: thymine at the position corresponding to nucleotide 47, guanine at the position corresponding to nucleotide 82, corresponding to nucleotide 294. At the position corresponding to nucleotide 552, thymine at the position corresponding to nucleotide 552, thymine at the position corresponding to nucleotide 659, and adenine at the position corresponding to nucleotide 818.

Complementary polynucleotides of these HTR1A genomic and cDNA variants are also presented in the present invention.

In another embodiment, the invention provides a recombinant expression vector comprising an expression control element transformed or transfected with the expression vector and one of the polymorphic genomic variants linked to the recombinant host cell. Is presenting. This recombinant vector and host cell can be used for the purpose of expressing HTR1A in connection with protein structure analysis and drug binding studies.

In yet another embodiment, the present invention provides a polypeptide comprising a polymorphic variant of the reference amino acid sequence of HTR1A protein. This reference amino acid sequence is SEQ ID NO: 5 (Figure 5).
This polymorphic variant has the variant amino acid glycine at the position corresponding to amino acid position 155. In certain embodiments, the polymorphic variant also contains at least one variant amino acid selected from: a leucine at the position corresponding to amino acid position 16, a valine at a position corresponding to amino acid position 28. , Leucine at the position corresponding to amino acid position 220, aspartic acid at the position corresponding to amino acid position 273. HTR1A polymorphic variants bind HTR1A-targeted candidate drugs to study the effects of the variants on HTR1A biological activity and to treat neuropsychiatric disorders and Tourette's syndrome. In studying affinity,
It is useful.

The present invention also presents an antibody that recognizes and binds to the above polymorphic HTR1A protein variant. Such antibodies can be used in a variety of diagnostic, prognostic, and therapeutic modalities.

[0021] In another embodiment, the invention provides methods, compositions, and kits for haplotyping and / or genotyping the HTR1A gene in an individual. The method described above uses PS1-PS5 in one or both copies of the HTR1A gene derived from the individual.
And a method for identifying nucleotides or nucleotide pairs present in one or more polymorphic sites selected from PS6. The above composition is
It comprises an oligonucleotide probe and a primer designed to specifically hybridize to one or more target regions containing or adjacent to a polymorphic site. The above-described methods and constructs for establishing an individual's genotype or haplotype at the novel polymorphic site described in this case are
Individuals affected by the expression and function of the HTR1A protein in studying the effects of polymorphisms in the etiology of diseases affected by expression and function of the 1A protein and in studying the efficacy of drugs targeted to HTR1A It is useful in predicting susceptibility to HTR1A and in predicting individual responsiveness to drugs targeted to HTR1A.

In yet another embodiment, the invention presents a method of identifying an association between a genotype or haplotype and a trait. In a preferred embodiment, the characteristics are disease susceptibility, disease intensity, disease stage, and drug responsiveness. Such methods can be applied to the development of diagnostic tests and therapeutic treatments for neuropsychiatric diseases and Tourette's syndrome. The present invention also provides transgenic animals containing one of the HTR1A genomic polymorphic variants described herein, and methods of making such animals. These transgenic animals are used to study the expression of the HTR1A isogenic gene in vivo, to perform in vivo screening and testing for drugs that target the HTR1A protein, and to further treat neuropsychiatric diseases and Tourette's syndrome. It is useful in examining the efficacy of therapeutic agents or compounds in biological systems.

The present invention also provides a computer system for storing and displaying polymorphism data regarding the HTR1A gene. The computer system includes a computer processor, a display, and a database containing polymorphic data. This polymorphism data includes the polymorphisms, genotypes and haplotypes identified for the HTR1A gene in the reference population. In a preferred embodiment, the computer system is capable of displaying HTR1A haplotypes organized according to evolutionary relationships. DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention is based on the discovery of novel variants of the HTR1A gene. As described in more detail below, the present inventors have discovered three novel polymorphic sites by characterizing the HTR1A gene found in genomic DNA isolated from index data stores. . This index data repository contains immortalized cell lines from one chimpanzee and 93 humans. Human individuals included a reference population of 79 unrelated individuals that self-identified as belonging to one of four major populations: Caucasian (22 individuals), African (20 individuals), Asian ( 20), Hispanic / Latin American (17). Whenever possible, the members of this reference population were organized into population subgroups by the ethnologic origin of their four self-identified grandparents or grandmothers, as shown in Table 1 below. In addition, index data storage includes three unrelated indigenous American Indians (from North America, Central America, and South America, respectively), one three-generation Caucasian family (CEPH Utah cohort), and one nib. Includes a generation African American family.

[0024]

[Table 1]

Using the HTR1A genotypes identified in the indexed data store and the methods described in the Examples below, the inventors of the present application also found on each chromosome of most human members of this data store. The haplotype was determined. These genotypes and haplotypes found in this index data store include those shown in Tables 4 and 5, respectively. The polymorphism and haplotype data disclosed in this case are
In studying population diversity, anthropological lineage, diversity at the phenotypic level and the importance of lineage, paternity test, and forensic application, HTR1A genetic mutation and drug responsiveness or morbidity, etc. It is useful in identifying a correlation with the property of.

In the context of this disclosure, unless otherwise indicated, the following terms are defined as follows: allele-a special form of a locus of a gene, distinguished from other forms by its special nucleotide sequence. To be done.

Candidate gene--a gene that is hypothesized to be responsible for a disease, health condition, or response to treatment, or a gene that correlates with one of these.

Gene-A portion of DNA that contains all the information necessary for the controlled biosynthesis of RNA products, including promoters, exons, introns, and other untranslated regions that control expression.

Genotype-A non-topological 5'to 3'base sequence of nucleotide pairs found in one or more polymorphic sites at a set of homologous chromosome loci in an individual.
Genotypes, as used herein, include true genotypes and / or subgenotypes (see below).

True genotype-a non-topological 5'to 3'base sequence of nucleotide pairs found in all known polymorphic sites at a set of homologous loci in a single individual. .

Subgenotype-A non-topological 5'to 3'base sequence of nucleotides found in a subset of known polymorphic sites at a set of homologous loci in a single individual.

[0032]   Genotyping-The process of determining the genotype of an individual.

Haplotype--A 5'to 3'nucleotide sequence of nucleotides found at one or more polymorphic sites at a locus on a single chromosome from a single individual.
As used herein, haplotypes include true haplotypes and / or minor haplotypes (see below).

True Haplotype--A 5'to 3'nucleotide sequence of nucleotides found at all known polymorphic sites at a single chromosomal locus from a single individual.

Minor haplotype--A 5'to 3'nucleotide sequence of nucleotides found in a subset of known polymorphic sites at a single chromosomal locus from a single individual.

Haplotype pair-two haplotypes found for a locus present in a single individual.

Haplotyping-including the use of kindred, molecular techniques, and / or statistical reasoning in the process of determining one or more haplotypes in an individual.

Haplotype data--information about one or more of the following for a particular gene: a list of haplotype pairs present in each individual in a population; a list of different haplotypes in a population; the population or others The frequency of haplotypes in each of the populations, and the known correlation between one or more haplotypes and certain traits.

A special form of a gene encoding an isoform-, mRNA, cDNA or protein, which is distinguished from other forms by its special base sequence and / or structure.

Isogenic--One of the isoforms of a gene found in a population. An isogenic gene includes all of the polymorphisms that exist in that particular isoform of that gene.

Isolation—Applied to biological molecules such as RNA, DNA, oligonucleotides, or proteins, and “isolated” means that the molecule is essentially another biological molecule (nucleic acid, protein, lipid, carbohydrate, Or other substances such as cell debris and growth media). In general, the term "isolated" refers to the absence of any such material, or water, buffers, or salts, unless such material is present in an amount that substantially interferes with the method of the present invention. Does not mean that there is no.

Locus—A locus on a chromosome or DNA molecule that corresponds to a gene or physical or phenotypic trait.

Naturally produced—a subject to which this term applies, such as a naturally occurring polynucleotide or polypeptide, is meant to be isolated from a natural source and not intentionally modified by humans. The term used.

Nucleotide pair-Two nucleotides found at a polymorphic site on two copies of a chromosome from an individual.

Phase identification-used for the nucleotide sequence of two or more polymorphic sites present at a locus, phase identification is the polymorphism on a single copy of that locus This means that the combination of nucleotides present at the site is known.

Polymorphic site (PS) -A site within a locus in which at least two surrogate nucleotide sequences are found in one population. Its maximum frequency is 99%. Polymorphic variant-A gene, mRNA, cDNA, polypeptide, or peptide that has a nucleotide base sequence or amino acid sequence that differs from the reference sequence due to a polymorphism in the gene.

Polymorphism—Variation of nucleotide sequences observed in individuals at polymorphic sites. Polymorphisms include nucleotide substitutions, insertions, deletions, and microsatellites that may or may not result in detectable differences in gene expression or protein function.

Polymorphism data-Information about one or more of the following for a given gene: location of polymorphic sites; sequence variability at those sites; polymorphism in one or more populations. Type frequency; different genotypes and / or haplotypes determined for the gene; frequency of one or more of these genotypes and / or haplotypes in one or more populations; for the gene Known correlations between traits and genotypes and / or haplotypes.

Polymorphic Database-A collection of polymorphic data organized in a systematic or ordered manner, individually accessible electronically or by other means.

Polynucleotide--A nucleic acid molecule consisting of single-stranded RNA or single-stranded DNA, or of complementary double-stranded DNA.

[0051]   Population-A group of individuals who share a common earthly origin.

Reference Population-A group of subjects or individuals predicted to represent the genetic variability found in the general population. In general, the reference population is said to represent the genetic variability in that population at the following levels; at least 85%, preferably at least 90%, more preferably at least 95%, even more preferably at least.
99%.

Single Nucleotide Polymorphism (SNP)-Generally, a specific set of nucleotides observed at a single polymorphic site. Rarely, three to four nucleotides may be found.

Subject—A human individual whose genotype, haplotype, response to treatment, or medical condition is the subject of testing.

[0055]   Treatment-A stimulus that is administered to a subject either medically or surgically.

Phase Unspecific-Used for nucleotide sequences of two or more polymorphic site nucleotide pairs at a locus, phase unspecific being on a single copy of the locus. This means that the combination of nucleotides present at those polymorphic sites is unknown.

The inventor of the present invention has discovered three novel polymorphic sites in the HTR1A gene. These polymorphic sites identified by the inventor are referred to as PS1-PS9 to indicate in which order within the gene they are located (see Table 3 below). The novel polymorphic sites are referred to as PS1-PS5 and PS6.

Accordingly, in one embodiment, the inventor has found that the novel polymorphic site PS1, described in this application,
It shows an isolated polynucleotide containing a polymorphic variant of the HTR1A gene or at least one of PS5 and PS6, or a fragment of the gene. The nucleotide base sequence of the HTR1A gene variant is identical to the reference genomic base sequence for the examined gene portion, as described in the Examples below. However, this HTR1
The nucleotide sequence of the A gene variant consists of nucleotides that differ at one or more of the novel polymorphic sites of PS1, PS5 and PS6, and
Thymine, guanine in PS3, adenine in PS4, thymine in PS7, thymine in PS8, and adenine in PS9, and one or more additional polymorphisms selected from the group consisting of a reference genomic nucleotide sequence and Is different. Similarly, the nucleotide base sequence of a variant fragment of the HTR1A gene is identical to the corresponding portion of the reference base sequence, except that there are different nucleotides at one or more of the novel polymorphic sites described in this case. Is. Therefore, in the present invention, except for the genotyped oligonucleotides described below, the target reference base sequence (or other reported HTR1A base sequence), or the target reference base sequence (or other reported base sequence). HTR1A base sequence), which does not include a polynucleotide containing the same nucleotide base sequence.

For the position of the polymorphism in the mutant gene or the fragment thereof, its nucleotide sequence is represented by SEQ ID
Identified by aligning with NO: 3. The polymorphism is selected from the following group: PS1
Thymine, PS5 thymine, PS6 guanine. In a preferred embodiment, the polymorphic variant comprises a naturally occurring isogenic gene for the HTR1A gene defined by any of the 1-10 haplotypes shown in Table 5 below.

The polymorphic variant of the present invention can be prepared by isolating a clone containing the HTR1A gene obtained from a human genomic library. The clones are also sequenced to identify the nucleotides at the polymorphic sites described herein. Any variant described herein can be made from this clone by in vitro (in vitro) in vivo mutagenesis using well known techniques.

The HTR1A isogenic gene can be released by any method that allows the two copies of the HTR1A gene present in an individual to be separated. This is easily understood by a person skilled in the art,
It may be the same allele or different alleles. Separation methods include targeted in vivo cloning (TIVC) in yeast as described in WO 98/01573, US Patent No. 5,866,404, and co-pending patent application US Application Serial No. 08 / 987,966. Yet another method is described in co-pending patent application US Application Serial No. 08 / 987,966, in which an allele-specific oligonucleotide is used together with primer extension and exonuclease degradation to generate a semi-conjugated DNA target. It is a thing. Yet another method is the single molecule dilution method (SMD) described below: Ruano et al., Proc. Natl. Acad. Sci. 87.
: 6296-6300, 1990; and allele-specific PCR (Ruano et al., 17 Nucleic Acids.
Res. 8392, 1989; Ruano et al., 19 Nucleic Acids Res. 6877-6882, 1991; M
ichalatos-Beloin et al., 24 Nucleic Acids Res. 4841-4843, 1996).

The present invention also presents a genomic collection of HTR1A, which is a collection of HTR1A isogenic genes found in a given population. The population can be any group of at least two individuals, including, but not limited to, a reference population, a population group, a family group, a clinical population, and a homosexual population. The HTR1A genome collection consists of individual HTR1A isogenic genes stored in separate containers such as micro test tubes, in separate tanks such as microtiter dishes. Alternatively, two or more groups of HTR1A isogenic genes within the genome collection may be stored in separate containers. Individual isogenic genes or groups of isogenic genes within a collection of genomes may be stored in a suitable and stable form, including preserving methods in buffer solutions, as DNA precipitates, as lyophilizates, etc. It is not limited to them. A preferred HTR1A genomic collection of the present invention comprises a set of isogenic genes identified by the haplotypes shown in Table 5 below.

The isolated polynucleotide containing the polymorphic variant nucleotide sequence of the present invention is a recombinant expression vector capable of transmitting and expressing the encoded HTR1A protein in a prokaryotic or eukaryotic host cell. It is possible to link to one or more expression control elements in. Examples of expression control elements that can be used include the rack system, the lambda phage operator and promoter region, the yeast promoter,
And promoters derived from vaccinia virus, adenovirus, retrovirus, or SV40, but are not limited thereto. Other control elements include
Suitable leader sequences, stop codons, polyadenylation signals, and other sequences required for proper transcription and subsequent translation of nucleic acids in a given host cell are included, but are not limited to. The exact combination of expression control elements, of course, depends on the host cell used. In addition, the expression vector is generally understood to include any additional elements required for its transfer and subsequent replication in the host cell. Such examples include, but are not limited to, origins of replication and selectable markers. Such expression vectors are commercially available or can be easily prepared using methods well known to those skilled in the art (e.g. F. Ausubel et al., 1987,
in "Current Protocols in Molecular Biology", John Wiley and Sons, New Y
ork, New York). Host cells that can be used to express the variant HTR1A sequences of the present invention include eukaryotic or mammalian cells such as animal, plant, insect, and yeast cells, and are well known in the art. Such cells include, but are not limited to, prokaryotic cells such as E. coli or algae. Recombinant expression vectors can be introduced into host cells using methods well known to those of ordinary skill in the art. These methods include, but are not limited to, microinjection, electroporation, particle bombardment, transduction, transfection with DEAE-dextran, lipofection, calcium phosphate (see for example Sambrook et al. 1989) in "Molecular Cloning. AL
aboratory Manual ", Cold Spring Harbor Press, Plainview, New York). Preferably, a eukaryotic expression vector that functions in eukaryotic cells, and more preferably in mammalian cells is used. Non-limiting examples include vaccinia virus vector, adenovirus vector, herpes virus vector, baculovirus transfer vector. Preferred eukaryotic cell lines include COS cells, CHO cells, HeLa cells, NIH / 3T3 cells, and embryos. Includes stem cells (Thomson,
JA et al., 1998 Science 282: 1145-1147). Particularly preferred host cells are mammalian cells.

As will be readily appreciated by those of skill in the art, expression of polymorphisms in the HTR1A gene differ from each other at polymorphic sites retained in conjugated and processed mRNA molecules.
Produce. . These mRNAs can be used to produce an HTR1A cDNA consisting of a nucleotide sequence that is a polymorphic variant having the HTR1A reference-encoding nucleotide sequence shown in FIG. Therefore, the present invention also represents HTR1A mRNA and the corresponding cDNA. This cDNA consists of a nucleotide base sequence that is identical to SEQ ID NO: 4 (FIG. 4) or its corresponding RNA base sequence. However, this nucleotide base sequence differs from SEQ ID NO: 4 (FIG. 4) or its corresponding RNA base sequence in having one or both polymorphisms selected from the group consisting of: The dots are: thymine at the position corresponding to nucleotide 423, guanine at the position corresponding to nucleotide 464. Further, this cDNA contains thymine at the position corresponding to nucleotide 47, guanine at the position corresponding to nucleotide 82, adenine at the position corresponding to nucleotide 294, thymine at the position corresponding to nucleotide 552, and thymine at the position corresponding to nucleotide 659. , One or both polymorphisms selected from the group consisting of adenine at the position corresponding to nucleotide 818. These mutant mRNA and cDNA fragments are within the scope of the invention if they include the novel polymorphisms described herein. The present invention is based on the HT
The polynucleotides and fragments thereof identified and identified as R1A cDNA are specifically excluded. The polynucleotide containing the nucleotide sequence of the mutant RNA or DNA can be isolated from a biological sample using well-known molecular biology procedures, or can be chemically synthesized.

The genomic and cDNA fragments of the present invention consist of at least one polymorphic site identified herein, are at least 10 nucleotides in length, and may span the full length of the gene. Preferably, the fragments according to the invention are 100 to 3000 nucleotides in length, more preferably 200 to 2000 nucleotides in length, most preferably 500 to 1000 nucleotides in length.

In describing the polymorphic sites identified in this case, reference is made to the significant strand of the gene for convenience. However, as will be appreciated by one of skill in the art, a nucleic acid molecule containing the HTR1A gene can be a complementary double-stranded molecule, and therefore reference to a particular site on the significant strand is complementary. It also refers to the target corresponding site on the anti-chain. Therefore, it is possible to refer to the same polymorphic site in either strand, and the oligonucleotide is designed to hybridize specifically to either strand in the target region containing the polymorphic site. it can. Accordingly, the present invention will also include single-stranded polynucleotides that are complementary to the significant strand of the HTR1A genomic variants described herein.

Polynucleotides consisting of polymorphic gene variants or fragments are useful for therapeutic purposes. For example, if a patient benefits from the expression or enhanced expression of a particular HTR1A protein isoform, the expression vector encoding that isoform can be administered to that patient. The patient may be an individual lacking the HTR1A isogenic gene encoding the isoform, or may already have at least one copy of the isogenic gene.

In other situations, it may be desirable to reduce or prevent expression of certain HTR1A isogenic genes. Expression of the HTR1A isogenic gene can be stopped by converting the target organ, tissue, or cell into the isogenic gene with an expression vector that expresses high levels of untranslated mRNA. Alternatively, transcription can be blocked with its isogenic oligonucleotide directed to a regulatory region (eg, promoter, intron, enhancer, 3'untranslated region). From start site-10
Oligonucleotides targeted to the transcription start site at a distance between and +10 are preferred. Similarly, the inhibition of transcription is based on triplex DNA (reference example: Gee et al. In Huber, BE and BI Carr, Molecular a
nd Immunologic Approaches, Futura Publishing Co., Mt. Kisco, NY, 1994)
Can be performed using an oligonucleotide that forms Anti-strand oligonucleotides can also be designed to block translation of HTR1A mRNA transcribed from a particular isogenic gene. HTR1 transcribed from a specific isogenic gene
The possibility of designing ribozymes that catalyze the cleavage of specific parts of A mRNA was also considered.

The oligonucleotide can be introduced into those target cells or tissues by expression from the vector introduced into the target cells or tissues in vivo or in vitro. Alternatively, the oligonucleotide can be formulated as a drug component for administration to a patient. The oligoribonucleotides and / or oligodeoxynucleotides used as anti-oligonucleotides can be modified to increase stability and half-life. Possible modifications include phosphorothionate or
2'O-methyl bonds, and special base encapsulations such as inosine and keosin, as well as acetyl-, methyl-, thio-, and adenine, cytosine, guanine, thymine and uracil, which are not readily recognized by endogenous nucleases. Modified forms are included, but are not limited to.

The present invention also presents an isolated polypeptide consisting of a polymorphic variant of the reference HTR1A amino acid sequence shown in FIG. The positions of the variant amino acids in the HTR1A polypeptides or fragments described herein are identified by aligning their sequences in Figure 5. The HTR1A protein variant of the invention consists of the same amino acid sequence as SEQ ID NO: 5, except that there is a glycine at the position corresponding to amino acid position 155,
It may consist of one or more variant amino acids selected from the following groups: leucine at the position corresponding to amino acid position 16, valine at the position corresponding to amino acid position 28, corresponding to amino acid position 220. Leucine at position, aspartic acid at the position corresponding to amino acid position 273. The present invention specifically excludes previously identified amino acid sequences for HTR1A, including SEQ ID NO: 5, and amino acid sequences of fragments thereof previously described. HTR1A protein variants included in the present invention include all amino acid sequences having the combination of amino acid variants set forth in Table 2 below based on SEQ ID NO: 5. In a preferred embodiment, the HTR1A protein variants of the invention are encoded by an isogenic gene defined by one of the observed haplotypes shown in Table 5.

[0071]

[Table 2]

The present invention also presents HTR1A peptide variants, which variants are listed in Table 2.
Any fragment of a HTR1A protein variant containing one or more of the amino acids set forth in. HTR1A peptide variants are at least 6 amino acids in length,
It is preferably 6 to 30 amino acids in length, more preferably 10 to 25 amino acids in length, and most preferably 15 to 20 amino acids in length. Such an HTR1
The A peptide variant is useful as an antigen that produces an antibody specific for one of the above HTR1A isoforms. In addition, HTR1A peptide variants are useful in drug screening assays.

The HTR1A mutant protein or peptide of the present invention can be produced by chemical synthesis or by expressing the above mutant HTR1A HTR1A genome and cDNA base sequence. Alternatively, the HTR1A protein mutant can be isolated from a biological sample of an individual who has the HTR1A isogenic gene encoding the mutant protein.
If this sample contains two different HTR1A isoforms (i.e.
If the individual has a different HTR1A isogenic gene), use an antibody that binds to that particular HTR1A isogenic gene but not to any other HTR1A isogenic gene.
A specific HTR1A isogenic gene of the present invention can be isolated by immunoaffinity chromatography.

Expressed or isolated HTR1A proteins are used in this field including Coomassie blue staining, silver staining, and Western blotting using antibodies specific for the isoforms of the HTR1A protein described in detail below. It can be detected using well-known methods. HTR1A mutant proteins are well-known standard protein purification procedures in this field, including fractional precipitation, molecular sieve chromatography, ion exchange chromatography, isoelectric focusing, gel electrophoresis, affinity and immunoaffinity chromatography, etc. (Ausubel et. Al., 1987,
In Current Protocols in Molecular Biology John Wiley and Sons, New York
, New York). In the case of immunoaffinity chromatography, specific antibodies can be used for the polymorphic variant of interest.

The polymorphic variant HTR1A gene of the present invention can also be fused in frame with a heterologous base sequence to encode a chimeric HTR1A protein. Non-HTR1A of chimeric protein
The portion can be recognized by a commercially available antibody. In addition, the chimeric protein also encodes HTR1A and non-HTR1 so that the HTR1A portion is cleaved from the non-HTR1A portion and further purified.
It can also be generated to include a cleavage site between the 1A portions.

Additional examples of the present invention relate to the use of the novel HTR1A protein isoforms in a variety of drug screening assays. Such screening assays are performed to identify agents that bind to all known HTR1A protein isoforms, or specifically to only one or more subsets of these isoforms. . These drugs are derived from chemical substance libraries, peptide libraries and the like. The HTR1A protein or peptide variant may be free in solution or supported in solid form. In one example, PCT application
The method described in WO84 / 03565 can be used to perform high throughput screening of compounds that bind to HTR1A variants. In this method, many assay compounds are synthesized on solid substrates such as plastic pins or other surfaces, contacted with the HTR1A protein of interest and then washed. The bound HTR1A protein is then detected using methods well known in the art.

In another example, the novel HTR1A protein isoforms are used in an assay to measure the binding affinity of one or more candidate agents targeting the HTR1A protein.

In yet another embodiment, the present invention provides antibodies specific and immunoreactive with one or more of the HTR1A variant proteins described herein. These antibodies may be monoclonal or polyclonal in origin. The HTR1A protein or peptide variants used to generate these antibodies are
It may be natural, recombinant, or chemically synthesized using synthetic techniques well known in the art. If the HTR1A protein variant is not large enough to exert antigenicity, it may be conjugated, complexed or covalently bound to a carrier molecule to enhance the antigenicity of the peptide. Examples of carrier molecules are albumin (eg human, bovine, fish, sheep), and keyhole limpet hemocyanin.
(Basic and Clinical Immunology, 1991, Eds. DP Stites, and AI Terr, A
ppleton and Lange, Norwalk Connecticut, San Mateo, California).

In one example, an antibody specific and immunoreactive with one of the novel HTR1A protein isoforms described in the present application can increase the activity of an HTR1A isoform expressed by an individual. It has been administered to the individual for the purpose of neutralizing it. This antibody can be formulated as a drug component containing a pharmaceutically acceptable carrier.

Antibodies specific and immunogenic to one of the novel HTR1A protein isoforms described in the present invention are useful for immunoprecipitating HTR1A protein variants from solution and for polymorphizing HTR1A protein isoforms. It can be used to react western or immunoblots of acrylamide gels on membrane supports or on substrates. In another preferred embodiment, the antibodies are paraffins, either fixed or unfixed on slides or cover glass, for use in immunocytochemical, immunohistochemical and immunofluorescent techniques. , HTR1A protein isoform present in frozen tissue section or in cells is detected.

In yet another embodiment, an antibody specifically immunoreactive with one of the novel HTR1A protein variants described herein detects an immunoassay from a biological sample of this variant. Used in law. In this method, the antibody of the present invention is contacted with a biological sample, and the formation of a complex between the HTR1A protein variant and its antibody is detected. As described, suitable immunoassays include radioimmunoassay, Western blot assay, immunofluorescence assay, enzyme-linked immunosorbent assay (ELISA), chemiluminescence assay,
Includes immunohistochemical and immunocytochemical assays (see eg Principles
and Practice of Immunoassay, 1991, Eds. Christopher P. Price and David J
Neoman, Stockton Press, New York, New York; Current Protocols in Molec
ular Biology, 1987, Eds. Ausubel et al., John Wiley and Sons, New York,
New York). Well-known ELISA standard techniques in this field are described below: (Methods in Immunodiagnosis, 2nd Ed., Eds. Rose and Bigazzi, Joh
n Wiley and Sons, New York 1980; and Campbell et al., 1984, Methods in I
mmunology, WA Benjamin, Inc.). Such assays may be direct, indirect, or highly competitive or low, as described in the current art (see eg Principles and Practice of Immunoassay, 1991, Ed
s. Christopher P. Price and David J. Neoman, Stockton Pres, NY, NY; and
Oellirich, M., 1984, J. Clin. Chem. Clin. Biochem., 22: 895-904). Proteins are isolated from test and biological samples by conventional methods, as described in "Current Protocols in Molecular Biology," above.

Representative antibody molecules used in the detection and therapeutic methods of the present invention include native immunoglobulin molecules, substantially native immunoglobulin molecules, or immunoglobulin molecules containing an antigen binding site. It is a part. Polyclonal or monoclonal antibodies can be generated by methods well known in the art (
Example: Kohler and Milstein, 1975, Nature, 256: 495-497; Campbell Monoclonal
Antibody Technology, the Production and Characterization of Rodent and H
uman Hybridomas, 1985, In: Laboratory Techniques in Biochemistry and Mol
ecular Biology, Eds. Burdon et al., Volume 13, Elsevier Science Publishe
rs, Amsterdam). These antibodies or antigen-binding fragments thereof can also be produced by genetic engineering. Techniques for the expression of both heavy and light chain genes in E. coli are the subject of the PCT patent application with the following Japanese patent application number: WO 901443, WO 901443 and WO
9014424 and in Huse et al., 1989, Science, 246: 1275-1281. These antibodies can also be adapted to the human body (e.g. Queen, C. et al. 1989 Proc. Natl.
Acad. Sci. 86; 10029). The effect of the polymorphisms identified in the present invention on HTR1A expression comprises, by producing recombinant cells and / or organisms, preferably including polymorphic variants of the HTR1A gene. It can be studied by producing recombinant animals. As used herein, "expression" includes, but is not limited to: transcription of a gene into precursor mRNA; splicing and other treatment of precursor mRNA to produce the finished mRNA; mRNA stability; translation of completed mRNA into HTR1A protein (including codon usage and tRNA availability); and glycosylation and / or modification of translated protein when appropriate expression and function are sought .

To make the recombinant cells of the invention, the desired HTR1A isogenic gene is introduced into the recombinant cell in a vector such that the isogenic gene remains extrachromosomal.
In such a situation, the gene will be expressed by the recombinant cell from an extrachromosomal location. In a preferred embodiment, the HTR1A isogenic gene is the endogenous HTR present in the cell.
It has been introduced into the cell so that it will recombine with the 1A gene. For such recombination,
The occurrence of double recombination events is required, which results in the desired HTR1A gene polymorphism. Vectors for gene transfer, both for recombination and extrachromosomal maintenance, are well known in the art, and any suitable vector or vector construct can be used in the present invention. Methods such as electroporation, particle bombardment, calcium phosphate co-precipitation, viral transduction for introducing DNA into cells are well known in the art. Therefore, which method is selected is at the discretion of one skilled in the art. Examples of cells into which the HTR1A isogenic gene can be introduced include, but are not limited to, COS, continuous cultured cells such as NIH / 3T3, and primary or cultured cells of the relevant tissue type. That is, those expressing the HTR1A isogenic gene are preferable. Such recombinant cells can be used to compare the biological activity of different protein variants.

Recombinant organisms expressing the mutant HTR1A gene, ie transgenic animals, are produced using standard procedures well known in the art. Preferably, a construct consisting of the mutant gene is prepared in a non-human animal, in particular at the embryonic stage (i.e.,
It is recommended to introduce into the original species of the animal at the single cell stage, or generally before the 8 cell stage.

A transgenic animal having the construct of the present invention can be produced by several methods well known to those skilled in the art. The first method involves the inclusion of one or more isolation elements, the gene or genes of interest, and other components known in the art to provide a shuttle vector that harbors the isolated gene as a transgene. Involved in transfecting embryos with retroviruses constructed in
Patent No. 5,610,053). The second method involves injecting the direct transgene into the embryo. The third method involves the use of embryonic stem cells. Examples of animals into which the HTR1A isogenic gene can be introduced include, but are not limited to, murine, brown rat, other rodents, and non-human primates (see: "The Introduction of Foreign Genes
into Mice "and the cited references therein, In: Recombinant DNA, Eds.
JD Watson, M. Gilman, J. Witkowski, and M. Zoller; WH Freeman and Co
mpany, New York, pages 254-272). Transgenic animals that consistently express the human HTR1A isogenic gene and produce the human HTR1A protein are used to study various diseases, compounds, and these diseases in order to study diseases related to abnormal HTR1A expression and / or activity. It can be used as a biological model for screening and measuring therapeutic methods for reducing the symptoms or effects of.

An additional embodiment of the present invention relates to pharmaceutical compositions for treating disorders affected by the expression or function of the novel HTR1A isogenic genes described herein. The drug composition consists of the following active materials: a polynucleotide consisting of one of these novel HTR1A isogenic genes; an anti-strand oligonucleotide directed to one of these novel HTR1A isogenic genes, such A polynucleotide encoding a heavy chain oligonucleotide, or another compound that blocks the expression of the HTR1A isogenic gene described herein. Preferably, the composition should contain a therapeutically effective amount of the active material. By therapeutically effective amount is meant that one or more of the symptoms associated with a disorder affected by the expression or function of the novel HTR1A isogenic gene are alleviated or eliminated. This construct also
It comprises a pharmaceutically acceptable carrier, examples of which include, but are not limited to, saline, buffered saline, dextrose, and water. The person skilled in the art will use the most suitable formulation method for this active material, whether it be a polynucleotide, an oligonucleotide, a protein, a peptide or a small molecule antagonist. The pharmaceutical composition may be administered on its own or in combination with at least one other agonist (eg stable compound). Administration of this pharmaceutical composition may be by any number of routes including oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal and intraventricular. Administration includes, but is not limited to, administration, intradermal administration, transdermal administration, subcutaneous administration, intraperitoneal administration, intranasal administration, enteral administration, topical administration, sublingual administration, or rectal administration. For more information on formulation methods and administration, see the latest edition of: Remington's Pharmaceutical Sciences (Maac
k Publishing Co., Easton, PA). The determination of the therapeutically effective dose and / or appropriate route of administration of the active ingredient for any of the constructs will be well within the knowledge of one of ordinary skill in the art. For example, doses can be estimated using cell culture assays or animal models. Animal models can also be used to determine the appropriate concentration range and route of administration. Such information will be used to make dosage and route determinations for administration to humans through these experiments. The exact dosage will be determined by the practitioner, in light of factors related to the patient that requires treatment. These factors include the severity of the disease state, general health, patient age / weight / sex, diet, time and frequency of administration, other medications the patient is taking, and resistance / response to treatment. Are not limited to them.

Information regarding the identification of genotypes and haplotypes for the HTR1A gene in any particular individual, and information regarding the frequency of such genotypes and haplotypes in any particular population may be used in a variety of basic research and clinical applications. Considered useful. Accordingly, the present invention also provides constructs and methods for detecting the novel HTR1A polymorphisms identified herein.

This construct consists of at least one HTR1A genotyped oligonucleotide. In one example, the HTR1A genotyped oligonucleotide is located near one of the novel polymorphic sites described herein or is capable of hybridizing to a target region containing that site. A probe or primer. As used in this case, the term "oligonucleotide" refers to
References are made to polynucleotide molecules having 100 or fewer nucleotides. Preferred oligonucleotides of the present invention are 10 to 35 nucleotides in length. More preferably, the oligonucleotides are 15 to 30 nucleotides in length, and most preferably 20 to 25 nucleotides in length. The oligonucleotide may be composed of any phosphorylation state of ribonucleotides, deoxyribonucleotides, and acyclic nucleotide derivatives, and other functionally equivalent derivatives. Alternatively, the oligonucleotide may have a phosphate-free backbone, which backbone comprises carboxymethyl, acetamide,
Consists of chains such as carbamates, polyamides (peptide nucleic acids (PNA)) (Varma
, R. in Molecular Biology and Biotechnology, A Comprehensive Desk Refere
nce, Ed. R. Meyers, VCH Publishers, Inc. (1995), pages 617-620). Oligonucleotides of the invention can be made by chemical synthesis using suitable methods well known in the art, and can also be removed from biological samples by, for example, restriction enzyme digestion. Oligonucleotides can be labeled according to the techniques well known in the art, and some of them use radioactive labels, fluorescent labels, enzymatic labels, proteins, haptens, antibodies, sequence tags and the like.

The genotyped oligonucleotides of the invention must be capable of specifically hybridizing to the target region of the HTR1A polynucleotide (ie, the HTR1A isogenic gene). As used herein, "specific hybridization" means that the oligonucleotide forms a double-stranded structure in antiparallel to the target region under certain hybridization conditions, except for the target region. Alternatively, if the non-HTR1A polynucleotide is cultured under the same hybridization conditions, the oligonucleotide cannot form such a structure. Preferably, the oligonucleotide specifically hybridizes to the target region under conventional stringent conditions. The person skilled in the art can use the information on the polymorphisms presented in this case, the known sequence information on the HTR1A gene and the usual techniques to
Appropriate oligonucleotide probes and primers for detecting polymorphisms in the 1A gene can be easily designed and used for testing.

A nucleic acid molecule, such as an oligonucleotide or polynucleotide, is such that each one of the nucleotides of one molecule in the molecule is complementary to the nucleotide at the corresponding position of the other nucleotide. "Complete" of another nucleic acid molecule
Alternatively, it is said to be the "completed" complementary sequence. A nucleic acid molecule is sufficiently stable to retain its dual form and, when hybridized to another nucleic acid under conventional mild conditions, is "substantially complementary to that nucleic acid. Is said to be. Conventional hybridization conditions are described, for example, by: Sambrook J. et al., In Molecular Cloning, A Laborator.
^{y Manual, 2 nd Edition, Cold} Spring Harbor Press, Cold Spring Harbor, NY
(1989) and by Haymes, BD et al. In Nucleic Acid Hybridization, A Pract
ical Approach, IRL Press, Washington, DC (1985). Although perfectly complementary oligonucleotides are preferred for detecting polymorphisms, deviations from perfect complementarity mean that the molecule still hybridizes specifically to the target region, even if such deviations occur. If not disturbed, you are considered. For example, an oligonucleotide primer may have a non-complementary fragment at its 5'carbon atom end, as long as the remaining primer is complementary to the target region. Alternatively, a non-complementary nucleotide may be inserted into the oligonucleotide probe or primer as long as it is inserted, as long as the probe or primer is still able to hybridize to the target region.

Preferred genotyping oligonucleotides of the invention are oligonucleotides that react specifically with alleles. As used in this case, an "oligonucleotide that specifically reacts with an allele" refers to an allele of a gene existing in a target region containing a polymorphic site under sufficiently severe conditions. for,
Alternatively, it refers to an oligonucleotide capable of specifically hybridizing to another locus, but not hybridizing to the corresponding region in the other allele (s). As will be appreciated by those of skill in the art, allele specificity will vary depending on a variety of easily optimizable but stringent conditions, including salt and formamide concentrations and temperatures of hybridization and wash steps. Examples of hybridization and wash conditions commonly used with ASO probes are found below: Kogan et al., “Genetic Prediction of Hemophilia A.
”In PCR Protocols, A Guide to Methods and Applications, Academic Press
, 1990 and Ruano et al., 87 Proc. Natl. Acad. Sci. USA 6296-6300, 1990.
Generally, an oligonucleotide that reacts specifically to an allele will be perfectly complementary to one allele but will contain a single mismatch to another allele.

Oligonucleotide probes capable of very differentiating different alleles and reacting specifically to the alleles are such that the center of the oligonucleotide probe is aligned with the polymorphic site of the target region. Probe (e.g. 15-mer)
About the 7th or 8th position, about the 16thmer about the 8th or 9th position, and the 20mer about the 10th or 11th position). A preferred ASO probe for detecting the HTR1A gene polymorphism is selected from the group consisting of the nucleotide base sequences displayed at the 5 ′ to 3 ′ ends consisting of: GGAGCGCCTGAAAGC (SEQ ID NO: 6) and its complementary sequence, GGAGCGCTTGAAAGC. (SEQ ID NO: 7) and its complementary sequence, CGGACCCCATCGACT (SEQ ID NO: 8) and its complementary sequence, CGGACCCTATCGACT (SEQ ID NO: 9) and its complementary sequence, GCCGCTGCGCTCATC (SEQ ID NO: 10) and its complementary sequence , GCCGCTGGGCTCATC (SEQ ID NO: 11) and its complementary sequence.

Allele-specific oligonucleotide primers of the present invention include:
The 3'terminal nucleotide, or preferably the second nucleotide from the 3'terminal, is complementary to only one nucleotide of a particular SNP.
It thus acts as a polymerase-mediated extension primer only if there is an allele containing the nucleotide. The present invention contemplates oligonucleotide primers that are specific for the allele and hybridize to either the coding or non-coding strand. HTR1A
A preferred ASO probe for detecting a genetic polymorphism is selected from the group consisting of the nucleotide nucleotide sequences displayed at the 5 ′ to 3 ′ ends consisting of: GCCCAGGGAGCGCCT (SEQ ID NO: 12); GGAGCAGCTTTCAGG (SEQ ID NO: 13); GCCCAGGGAGCGCTT (SEQ ID NO: 14); GGAGCAGCTTTCAAG (SEQ ID NO: 15); CCATCACGGACCCCA (SEQ ID NO: 16); TCACGTAGTCGATGG (SEQ ID NO: 17); CCATCACGGACCCTA (SEQ ID NO: 18); TCACGTAGTCGATAGG ( SEQ ID NO: 19); CGGCGCGCCGCTGCG (SEQ ID NO: 20); GAGCGAGATGAGCGC (SEQ ID NO: 21); CGGCGCGCCGCTGGG (SEQ ID NO: 22); and GAGCGAGATGAGCCCA (SEQ ID NO: 23). Other genes of the present invention The typed oligonucleotide hybridizes to a target region located one to a few nucleotides below from one of the novel polymorphic sites identified in the present case. Such oligonucleotides are useful in polymerase-mediated extension methods that detect one of the novel polymorphisms described herein. Accordingly, such genotyped oligonucleotides are referred to herein as "primer extension oligonucleotides." In a preferred embodiment, the 3'end of the primer extension oligonucleotide is a deoxynucleotide complementary to the nucleotide immediately adjacent to its polymorphic site. In detecting the HTR1A gene polymorphism by primer extension, a particularly preferred oligonucleotide primer is selected from the group in which the nucleotide base sequence displayed from the 5 ′ end to the 3 ′ end ends with the following sequence: CAGGGAGCGC (SEQ ID NO: 24); GCAGCTTTCA (SEQ ID NO: 25); TCACGGACCC (SEQ ID NO: 26); CGTAGTCGAT (SEQ ID NO: 27); CGCGCCGCTG (SEQ ID NO: 28); and CGAGATGAGC (SEQ ID NO: 29) In some embodiments, a construct includes two or more differently labeled genotyped oligonucleotides to identify nucleotides at two or more polymorphic sites simultaneously. .. In addition, it is also contemplated in the examples that the primer construct contains two or more sets of allele-specific primer pairs, which results in two or more containing one polymorphic site. It is capable of co-targeting and amplification of more regions.

The HTR1A genotyped oligonucleotides of the present invention can also be immobilized or synthesized on a solid surface such as microchips, beads, glass slides (
Reference example: WO 98/20020 and WO 98/20019). Such fixed genotyped oligonucleotides can be used in a variety of polymorphism detection methods including, but not limited to, probe hybridization and polymerase extension assays. The immobilized HTR1A genotyped oligonucleotides of the present invention may also include an ordered sequence of oligonucleotides designed to rapidly screen a DNA sample for the determination of polymorphisms present in multiple genes at the same time. it can.

In yet another embodiment, the present invention presents a kit consisting of at least two genotyped oligonucleotides contained in separate containers. The kit also contains other components, such as hybridization buffers (where the oligonucleotides are used as probes), packaged in separate containers. Alternatively, if the oligonucleotide is used to amplify a target region, this kit
Includes polymerase and reaction buffer in separate containers. These are optimized for polymerase-mediated primer extension such as the PCR method.

The oligonucleotide constructs and kits described above are useful in methods of genotyping and / or haplotyping the HTR1A gene present in an individual. As used herein, the terms "HTR1A genotype" and "HTR1A haplotype" refer to a genotype and / or haplotype present at one or more of the novel polymorphic sites described herein. It is meant to include a nucleotide pair or nucleotides and, optionally, a nucleotide pair or nucleotides present at one or more of the additional polymorphic sites of the HTR1A gene. This additional polymorphic site is the site now known or subsequently discovered as the polymorphic site.

One example of a genotyping method is to isolate a nucleic acid mixture consisting of two copies of the HTR1A gene or a fragment thereof present in an individual from the individual,
To assign the HTR1A genotype to that individual, PS1-P in two copies
It relates to identifying nucleotide pairs at one or more polymorphic sites selected from S5 and PS6. As will be readily appreciated by those skilled in the art, these two "copy" of a gene present in an individual may be the same allele or may be different alleles. There is also. In a preferred embodiment of the genotyping method, the identity of nucleotide pairs at one or more polymorphic sites selected from the group consisting of PS3, PS4 and PS8 is also determined. In a particularly preferred embodiment, the genotyping method consists of identifying the nucleotide pair at each position PS1 to PS9.

Generally, the nucleic acid mixture is isolated from a biological sample taken from an individual, such as a blood sample or a tissue sample. Suitable tissue cells include whole blood, semen, saliva,
Includes tears, urine, fecal material, sweat, oral cavity, skin and hair. The nucleic acid mixture is the genome
It consists of DNA, mRNA, or cDNA, and in the latter two cases, the biological sample is HTR.
It must be obtained from the organ in which the 1A gene is expressed. Furthermore, as will be appreciated by those in the art, mRNA or cDNA is not used to detect polymorphisms located in introns or 5'and 3'untranslated regions. If an HTR1A fragment is isolated, it must contain a polymorphic site to be genotyped.

One example of a haplotyping method is to isolate a nucleic acid molecule consisting of only one of the two copies of the HTR1A gene or a fragment thereof from an individual and assign the HTR1A haplotype to that individual. To identify the nucleotides at one or more polymorphic sites PS1-PS5 and PS6 in that copy. This nucleic acid can be isolated using any method capable of separating two copies of the HTR1A gene or fragment thereof. As an example, one of the methods described above is to produce the HTR1A isogenic gene, with targeted in vivo cloning as the preferred approach. As will be readily appreciated by those of skill in the art, any individual clone will only present haplotype information for one of the two HTR1A gene copies present in an individual. If you want haplotype information for the other copy of the individual, you need to test for additional HTR1A clones. Generally, at least 5 clones need to be tested to obtain a 90% probability of haplotyping both copies of the HTR1A gene in an individual. In one embodiment, the haplotyping method comprises
It also consists of identifying nucleotides at one or more polymorphic sites (PS2, PS3, PS4, PS7 and PS8 and PS9). In a particularly preferred embodiment, PS1 through PS9
The nucleotides at each position up to have been identified.

In a preferred embodiment, the HTR1A haplotype pair for an individual is the H of that individual.
It is determined by identifying the specified base sequence of the phase of nucleotides located at one or more polymorphic sites selected from PS1-PS5 and PS6 present in each copy of the TR1A gene. In a particularly preferred embodiment, the haplotyping method consists of determining the identified nucleotide sequence of the nucleotide phase at each position PS1 to PS9 present in each copy of the HTR1A gene.
If both copies of the gene are haplotyped, it is desirable to put each in a separate container to identify each copy of the gene. However, if the two copies are labeled with different tags, or if they can be distinguished or identified separately, then it may be possible to carry out the identification procedure in the same container. For example, the first and second gene copies are respectively labeled with different first and second fluorescent dyes, and the allele-specific oligonucleotide labeled with the third fluorescent dye is a polymorphic site. When used to measure (group), detecting a combination of the first and third dyes can identify a polymorphism in the first gene copy, and further detect the second and third dyes. Detection of the combination of can identify polymorphisms in the second gene copy.

In both genotyping and haplotyping, the identification of nucleotides (nucleotide pairs) at the polymorphic site (s) is determined by the polymorphic site (1) or both copies of the HTR1A gene, or polymorphic sites directly derived from fragments thereof. This is done by amplifying the target region containing the group (s) and sequencing the amplified region. Only one nucleotide is detected at one polymorphic site in a population that is homozygous for that site, but two different nucleotides are detected if the individual is heterozygous for that site. It will be easily recognized by those skilled in the art. Polymorphisms can be identified by positive type direct method or negative type inference method. For example, if the SNPs are known to be guanine and cytosine in the reference population, the site is either guanine or cytosine for individuals who are homozygous at that site, or If it is heterozygous at that site, it can be positively determined to be both guanine and cytosine. Alternatively, the site can be negatively determined to be not guanine (and thus cytosine / cytosine) or not cytosine (guanine / guanine).

In addition, the identifiability of alleles present at any of the novel polymorphic sites described in this application may be determined by identifying polymorphic sites in linkage disequilibrium with the subject polymorphic site that are not disclosed in this application. It is indirectly determined by genotyping. Two sites are in a linkage disequilibrium when the presence of a particular variant at one site increases the predictability of another variant at the second site. It is said that there is (Ste
vens, JC 1999, Mol. Diag. 4: 309-17). Polymorphic sites in linkage disequilibrium with the currently disclosed polymorphic sites may be located in regions of the gene, or in other genomic regions not studied in this case. Genotyping of polymorphic sites in linkage disequilibrium with the novel polymorphic sites described herein can be performed by any of the methods described above for identifying alleles at the polymorphic site, but not limited thereto. It is not something that will be done.

The target region (s) can be amplified using any oligonucleotide driven amplification method. Such amplification methods include polymerase chain reaction (PCR) (US Patent
No. 4,965,188), ligase chain reaction (LCR) (Barany et al., Proc. Natl. Acad.
Sci. USA 88: 189-193, 1991; WO90 / 01069), oligonucleotide ligation assay (OL
A) (Landegren et al., Science 241: 1077-1080, 1988), but is not limited thereto. An oligonucleotide useful as a primer or a probe in such a method needs to specifically hybridize to a nucleic acid region containing a polymorphic site or adjacent to the polymorphic site. Generally, oligonucleotides are 10 to 35 nucleotides in length, preferably 15 to 3 nucleotides.
Good length of 0 nucleotides. Most preferably, the oligonucleotide is 20 to 2
It should be 5 nucleotides long. The exact lengths of the oligonucleotides will depend on many factors, which will always be considered and implemented by those skilled in the art.

Other known nucleic acid amplification methods, transcription-based amplification systems for amplifying target regions (US Patent No. 5,130,238; EP 329,822; US Patent No. 5,169,766,
WO 89/06700) and isothermal method (Walker et al., Proc. Natl. Acad. Sci. USA 89: 392-
396, 1992) etc. can be used.

Several hybridization-based methods well known in the art can be used to measure polymorphisms in a target region before and after amplification. Typically,
To carry out such a method, oligonucleotides that react specifically with alleles are utilized. Oligonucleotides that react specifically with alleles can be used as separately labeled probe pairs, one of which is a perfect match for one variant of the target sequence. , The other shows perfect agreement for the different variants. In some embodiments, multiple polymorphic sites can be detected at once using a set of oligonucleotides or pairs of oligonucleotides that react specifically with alleles. Preferably, this set of oligonucleotides should have melting points within 5 ° C of each other, more preferably within 2 ° C, when hybridized to each of the polymorphic sites being detected. .

Hybridization of an oligonucleotide that specifically reacts to an allele to a target polynucleotide can be carried out both in solution, and such hybridization can be performed on the oligonucleotide or the target polynucleotide. Either can be covalently or non-covalently immobilized on a solid support. Attachment may be mediated by, for example, antibody-antigen action, poly-L-lysine, streptavidin or avidin-biotin, salt bridge, hydrophobic action, chemical binding, UV cross-linking baking and the like. Oligonucleotides that react specifically with alleles can be synthesized directly on the solid support or can be attached to the solid support after synthesis. Solid supports suitable for use in the detection method of the present invention include substrates made of silicon, glass, plastic, paper and the like. These are, for example, wells (like 96-well plates)
It can be formed into a slide shape, a mucous membrane shape, a fibrous shape, a chip shape, a dish shape, and a bead shape.

The solid support is subjected to a surface treatment, a coating treatment, or a derivatization treatment to promote the immobilization of an oligonucleotide or a target nucleic acid that specifically reacts with an allele.

The genotype or haplotype of the HTR1A gene of an individual may also include nucleic acid samples containing one or both copies of the gene, as described in WO 95/11995, for nucleic acid arrays and nucleic acid subarrays. Can be determined by hybridization. The array contains a series of allele-specific oligonucleotides representing each of the polymorphic sites contained in the genotype or haplotype.

Identification of polymorphisms can also be determined using mismatch detection techniques. Such techniques include riboprobe (Winter et al., Proc. Natl. Acad. Sci. USA 82
: 7575, 1985; Meyers et al., Science 230: 1242, 1985), and proteins that recognize nucleotide mismatches such as E. coli mutS protein (Modrich, P. Ann. Rev. Genet
25: 229-253, 1991), including but not limited to ribonuclease protection methods. Mutant alleles were also identified by single-stranded conformational polymorphism (SSCP) analysis (Ori
ta et al., Genomics 5: 874-879, 1989; Humphries et al., in Molecular Diag
nosis of Genetic Diseases, R. Elles, ed., pp. 321-340, 1996) or denaturing gradient gel electrophoresis (DGGE) (Wartell et al., Nucl. Acids Res. 18: 2699-270).
6, 1990; Sheffield et al., Proc. Natl. Acad. Sci. USA 86: 232-236, 1989).
Can be identified by

Polymorphism (s) can also be identified using the polymerase mediated primer extension method. Such methods are described in the patent and scientific literature and are described in "Geneti
c Bit Analysis "method (WO92 / 15712) and ligase / polymerase mediated genetic bit analysis (US Patent 5,679,524. Related methods are WO91 / 02087, WO90 / 09455, WO95 /
17676, US Patent Nos. 5,302,509, and 5,945,283). Extended primers containing polymorphisms can be detected by mass spectrometry as described in US Patent No. 5,605,798. Another primer extension method is allele-specific PCR (Ruano et al., Nucl. Acids Res. 17: 8392, 1989; Ruano et al.
., Nucl. Acids Res. 19, 6877-6882, 1991; WO 93/22456; Turki et al., J. C.
lin. Invest. 95: 1635-1641, 1995). In addition, multiple polymorphic sites can be tested by amplifying multiple nucleic acid regions with a set of allele-specific primers. It is in the report of Wallace et al. (WO89 / 10414).

In another aspect of the present invention, the HTR1A haplotype pair of an individual is predicted from its HTR1A genotype using information about the haplotype pair known to be present in the reference nucleotide sequence. In the most comprehensive example, the haplotype prediction method identifies the HTR1A genotype for the individual at two or more polymorphic sites selected from PS1-PS5 and PS6, and further contradicts the genotype. Not comprising listing all possible haplotype pairs, also accessing HTR1A haplotype pair data identified in the reference population, and also assigning to the individual haplotype pairs consistent with the data. In one example, the reference haplotype pair comprises the HTR1A haplotype pair shown in Table 4.

[0112] In general, the reference population should consist of a randomly selected population that is representative of the world's major scholarly populations. A preferred reference population for use in this method consists of about equal numbers of Caucasian, African American, Asian and Hispanic Latino population populations, with a minimum number of each group being It was decided based on how rare the haplotype you want to be. For example, if you want to ensure the probability that the incidence in a reference population is p% and you do not miss the haplotypes present in that population, the number of individuals that need to be sampled is 2n.
= log (1-q) / log (1-p), where p and q are represented by fractions.
A preferred reference population is capable of detecting any haplotype whose frequency is at least 10% with a 99% probability, and comprises about 20 unrelated individuals from each of the four populations listed above. A particularly preferred reference population is a three-generation family representing one or more of these four population groups, which serves as a control group to assess the quality of the haplotyping procedure.

In a preferred embodiment, the haplotype frequency data for each scholarly population is
Considered to determine if it is consistent with Hardy-Weinberg equilibrium. Hardy-Weinberg Equilibrium (DL H
artl et al., Principles of Population Genomics, Sinauer Associates (Sund
^{erland, MA), 3 rd Ed} ., 1997) , the frequency H ₁ / H ₂ to discover the haplotype _{pairs, p H -W (H 1 /} H 2) = 2p (H 1) p (H 2) if H ₁ ≠ H ₂ and p _HW (H ₁ / H ₂ ) = p (H ₁ ) p (H ₂ ) if H ₁ =
Assume equal to H ₂ . Statistically significant differences between observed and expected haplotypes include significant inbreeding within populations, strong natural selection pressure on genes, sample bias, and / or errors in genotyping assumptions. , Due to one or more factors. If observed in a scholarly group with a large deviation from the Hardy-Weinberg equilibrium, increase the population size of the group and consider whether the deviation is due to sample bias. If the difference between the sample size and changing haplotype pairs were expected with the observed haplotype pair frequencies even frequency is not decreased, for example, CLASPER System ^TM technology (US Patent
No. 5,866,404), SMD, or allele-specific wide-range PCR (Michalotos-Beloi
N et al., Nucleic Acids Res. 24: 4841-4843, 1996), and consider haplotyping the individual using a direct haplotyping method.

In one embodiment of this method of predicting HTR1A haplotype pairs, the assignment involves the following analyses: First, each possible haplotype pair is compared to a haplotype pair in a reference population. Generally, only one of the haplotype pairs in the reference population matches a possible haplotype pair and that pair is assigned to that individual. Sometimes only one of the haplotypes in the reference individual haplotype pair
A haplotype pair that may match a possible haplotype pair for an individual, in which case this known haplotype and a new haplotype obtained by subtracting this known haplotype from the possible haplotype pair. Are assigned to this individual. In rare cases, neither of the reference population haplotypes match a possible haplotype pair, or multiple reference haplotype pairs may match a possible haplotype pair. In such cases, this individual is preferably treated, for example, with CLASPER System ^™ technology (US
Patent No. 5,866,404), SMD, or allele-specific long-term PCR (Michaloto
haplotyping using a direct molecular haplotyping method such as s-Beloin et al., Nucleic Acids Res. 24: 4841-4843, 1996).

The present invention also provides a method of determining the frequency of HTR1A genotypes or HTR1A haplotypes in a population. This method determines the genotype or haplotype pair for the HTR1A gene present in each member of the population (
These genotypes or haplotypes are PS1-PS5 and PS within the HTR1A gene.
Comprising nucleotide pairs or nucleotides detected at one or more of the 6 polymorphic sites), calculating the frequency with which a particular genotype or haplotype is found in the population. This population can be a reference population, a family population, a homosexual population, a population group, a trait population (e.g., a solid population that exhibits a trait of interest, such as a medical condition or response to treatment). ).

In yet another aspect of the invention, frequency data for HTR1A genotypes and / or haplotypes found in a reference population is provided for a trait and HTR1A genotype and / or H
Used in methods to identify relationships between TR1A haplotypes. The trait is any detectable phenotype, including but not limited to susceptibility or response to therapy. This method involves obtaining data on the frequency of the genotype (group) or haplotype (group) of interest within the reference population and within the population exhibiting the trait. Frequency data for one or both of the reference and trait populations can be obtained by genotyping or haplotyping individual individuals in those populations using one of the methods described above. The haplotype of the trait population is determined directly, or alternatively, as described above,
Determined by a predictive genotype approach to haplotypes. In yet another example, frequency data for a reference population and / or trait population is obtained by accessing previously obtained frequency data. The data is stored in written or electronic form. For example, the frequency data may be in a computer accessible database. Once the frequency data is obtained, the frequencies of the genotype (group) or haplotype (group) of interest are compared in the reference population and / or the trait population. In a preferred embodiment, the frequencies of all genotypes (groups) or haplotypes (groups) observed in the subject population are compared. If the frequency of a particular genotype or haplotype for the HTR1A gene is statistically significantly higher in the trait population than in the reference population,
The trait is predicted to be related to the HTR1A genotype or haplotype. Preferably, the HTR1A genotypes or haplotypes being compared in the trait and reference population are true genotypes and true haplotypes, or subgenotypes and sub-haplotypes derived from these genotypes or haplotypes (Table 4 and Table 5, respectively). (Shown in).

In a preferred embodiment of this method, the trait of interest is, for example, HTR1A.
A clinical response exhibited by a patient for a treatment, such as a response to a drug targeting or a response to a treatment for a medical condition. As used herein, a "medical condition" includes but is not limited to any condition or disease manifested as one or more physical and / or psychological symptoms that is desired to be treated. It also includes, but is not limited to, previously and newly identified diseases and other disorders. As used herein, the term "clinical response" means any or all of the following: quantitative measurement of response, no response, and adverse response (ie, side effects). ).

To deduce the correlation between clinical response to treatment and HTR1A genotype or haplotype, data on the clinical response exhibited by the treated individual population (hereinafter referred to as the “clinical population”) was used. Need to get. This clinical data can be obtained by analyzing the results of previously conducted clinical trials, and / or this clinical data can also be obtained by designing and conducting one or more new clinical trials. Can be obtained. As used herein, the term "clinical trial" refers to any study designed to collect clinical data regarding response to a particular treatment, including Phase I, Phase II, and Phase III. phase
Clinical trials of, but not limited to. Standard methods are used to define patient populations and enroll subjects.

Preferably, the individuals included in the clinical population have already been graded for the presence or absence of the medical condition of interest. This is important if the symptoms presented by the patient may be caused by one or more hidden situations and if the treatment of hidden situations is not the same. An example of this is where a patient has dyspnea, for example due to asthma or respiratory infections. If both sets were treated with asthma medications, a pseudo-population of apparently non-responders with virtually no asthma symptoms would develop. These people will affect the ability to detect correlations between haplotypes and treatment outcomes. Grading for a potential patient population requires standard physical examination or one or two clinical tests. Alternatively, grading a patient may be used in situations where there is a strong correlation between haplotype pairs and disease morbidity or intensity.
Haplotypes may be used.

The therapeutic regimen of interest is administered to each individual in the clinical trial population and each response to that treatment is measured using one or more predetermined criteria. In many cases, it is considered that the clinical trial population will exhibit any response, and that the investigator will determine the number of responder populations (eg low, medium, high) of any response. In addition, the HTR1A gene for each individual in the clinical trial population has been genotyped and / or haplotyped and this treatment is performed before or after treatment.

After obtaining both clinical and polymorphic data, a correlation between individual response and HTR1A genotype or haplotype content is generated. Correlations can be created in several ways. In one method, individuals are grouped by HTR1A genotype or haplotype (haplotype pair) (also called a polymorphic population), and then the average and standard clinical response presented by the members of each polymorphic population. Calculate the deviation value.

These results are then analyzed to determine if the observed variance in clinical response between polymorphic populations is statistically significant. The statistical analysis methods that can be used are described below: LD Fisher and G. vanBelle, “Biostatistics: A
Methodology for the Health Sciences ”, Wiley-Interscience (New York) 199
3. This method of analysis includes a regression calculation of which polymorphic site in the PTGS2 gene has the most significant effect on phenotypic differences. One regression model useful in the present invention is described in the PCT application with the following title: M
ethods for Obtaining and Using Haplotype Data (filed June 26, 2000).

The second method of finding the correlation between HTR1A haplotype content and clinical response uses a predictive model based optimization algorithm that minimizes error. There are many possible optimization algorithms, one of which is the genetic algorithm (R. Jud.
son, “Genetic Algorithms and Their Uses in Chemistry” in Reviews in Co
mputational Chemistry, Vol. 10, pp. 1-73, KB Lipkowitz and DB Boyd
, eds. VCH Publishers, New York, 1997). Other algorithms that can be used are: Simulated annealing (Press et
al., “Numerical Recipes in C: The Art of Scientific Computing”, Cambr
idge University Press (Cambridge) 1992, Chapter 10, Neural Networks (E
. Rich and K. Knight, "Artificial Intelligence", 2 nd Edition (McGraw-H
ill, New York, 1991, Ch. 18), standard gradient inheritance method (Press et al., Chapter 10 above),
Or any other global or local optimization approach (see Judson's theory, above). Preferably, the correlations are found using the genetic algorithm approach described in the PCT application entitled: Methods for Obtaining
and Using Haplotype Data (filed June 26, 2000).

Correlations can also be analyzed using analysis of variance (ANOVA) to determine how much variance in clinical data is explained by a subset of different polymorphic sites within the PTGS2 gene ( Explained in the PCT application with the following title: Metho
ds for Obtaining and Using Haplotype Data (filed June 26, 2000). Use ANOVA to test the hypothesis whether the response variable is caused by or correlated with one or more properties (ie, measurable variables) (Fisher and vanBelle, supra, Chapter 10).

From the analyzes described above, one of ordinary skill in the art could readily generate mathematical models that predict clinical response as a function of HTR1A genotype or haplotype content. Preferably, such a model is validated in one or more follow-up clinical trials designed to test the model.

Identification of the relationship between the clinical response and the genotype or haplotype (or haplotype pair) of the HTR1A gene is the basis for designing diagnostic methods. This allows identification of individuals who respond or do not respond to treatment, or respond at low levels, thus allowing identification of individuals who need higher doses of therapy, ie higher doses of the drug. There are several forms of diagnostic methods: direct DNA testing (ie genotyping or haplotyping one or more of the polymorphic sites of the HTR1A gene), serology, physical examination measurements. The only requirement is that there be a good correlation between the diagnostic test results and the genotype or haplotype of the hidden HTR1A gene, which in turn correlates with its clinical response.
In a preferred embodiment, this diagnostic method uses the predictive haplotype method described above.

Any or all analytical and mathematical operations involved in carrying out the methods of the present invention can be performed by a computer. In addition, the computer can run a program that creates the view (or screen) displayed on the display device, which allows the user to view and analyze very large amounts of information about the HTR1A gene and its genomic variants. Can be interacted with for the purpose. This information includes chromosome location, gene structure, gene family, gene expression data, polymorphism data, gene base sequence data, and population data (eg: ethnologic origin, clinical response to one or more populations). , Genotype, and haplotype data)
Is included. The HTR1A polymorphism data described here may be stored as part of a relational database (eg, an example oracle database or a set of ASCII flat files). These polymorphic data may be stored on the computer's hard drive, or may be stored on a CD ROM or other storage device accessible by one or more computers. For example, these data may be stored in one or more networked beta bases.

The preferred embodiments of the present invention are described in the following examples. Other embodiments within the scope of the present claims will be apparent to those of ordinary skill in the art in view of the specification and practice of the invention as disclosed herein. The claims and spirit of the invention are set forth in the claims that follow the examples, since the intention of the invention is merely an example both in the description and in the examples.

EXAMPLES The examples herein are set forth to illustrate various aspects of carrying out the invention and are not intended to limit the scope of the invention in any way. These examples include
Detailed descriptions of conventional methods utilized, such as those in performing genomic DNA isolation, PCR, and sequencing procedures are not included. Such methods are well known to those of skill in the art and are described in numerous publications (eg Sambrook, Fritsch.
, And Maniatis, "Molecular Cloning: A Laboratory Manual", 2 nd Edition,
Cold Spring Harbor Laboratory Press, USA, (1989)).

Example 1 This example describes the HTR1A gene diversity region test for the purpose of searching for polymorphic sites. Amplification of Target Regions The target regions of the HTR1A gene shown below were amplified using the PCR primer pairs listed below. In this group of target regions, the nucleotide sequences are presented in the direction from the 5'end to the 3'end, and the nucleotide positions are indicated for each region corresponding to the indicated GenBank accession number. Registration number: Z11168 Fragment 1 Forward primer 678-703 AAGAGGCAGAAGAGAGAGAAGAGAGG (SEQ ID NO: 30) Complementary sequence of rear primer 1081-1060 AAGTTTCGGAGGAAGGGAATGC (SEQ ID NO: 31) PCR product 404 nt Registration number: M83181 Fragment 2 Forward primer 215-236 AAAGCTGCTCCTCGGAGATACC (SEQ ID NO: 32) Complementary sequence of backward primer 774-753 CACAGGTGCAAGATGGATGAGG (SEQ ID NO: 33) PCR product 560 nt fragment 3 Forward primer 463-487 CACTACTGGTATCTCCGACGTGACC (SEQ ID NO: 34) Complementary to backward primer 1049-1027 Sequence GGAATATGCGCCCATAGAGAACC (SEQ ID NO: 35) PCR product 587 nt fragment 4 Forward primer 747-767 GCTGCACCTCATCCATCTTGC (SEQ ID NO: 36) Complementary sequence of back primer 1309-1287 AGGCAAGTGCTCTTTGGAGTTGC (SEQ ID NO: 37) PCR product 563 nt fragment 5 Forward primer 1016-1038 CTGCTCATGCTGGTTCTCTATGG (SEQ ID NO: 38) Complementary sequence of rear primer 1584-1563 ACGGGGTTAAGCAGAGAGTTGG (SEQ ID NO: 39) PCR product 569 nt fragment 6 Forward primer 1280-1301 CGAGTGGGCAACTCCAAAG AGC (SEQ ID NO: 40) Complementary sequence of backward primer 1807-1788 AGGGGACCAGGTCTGCAAGC (SEQ ID NO: 41) PCR product 528 nt These primer pairs were isolated from the immortalized cell line for each component of the index data store. It was used in the polymerase chain reaction method containing the prepared genomic DNA. This polymerase chain reaction method was performed under the following conditions: Reaction volume = 20 μl 10 x Advantage 2 polymerase reaction buffer (Clontech) = 2 μl Human genomic DNA 100 ng = 1 μl 10 mM dNTP = 0.4 μl Advantage 2 polymerase Enzyme mix (Clontech) = 0.2 μl Forward primer (10 μM) = 0.4 μl Rear primer (10 μM) = 0.4 μl Water = 15.6 μl Amplification profile: 94 ^o C-2 minutes 1 cycle 94 ^o C-30 seconds 10 cycles 70 ^o C-45 s 72 ^o C-1 min 94 ^o C-30 s 35 cycles 64 ^o C-45 s 72 ^o C-1 min PCR product sequencing PCR products were developed using the protocol developed by the Whitehead Genome Center. , Solid phase reversible immobilization. Details of this protocol can be found at the following website: http://www.genome.wi.mit.edu/sequencing/protocols/pure/SPRI_
pcr.html. Briefly, 5 μl of carboxyl coated magnetic beads (10 mg / ml) and 60 μl
HYB BUFFER (2.5M NaCl / 20% PEG 8000) was added to each PCR reaction mixture (20 μl). The reaction mixture was mixed well and incubated at room temperature (RT) for 10 minutes.
The microtiter plate is placed on the magnet for 2 minutes and the beads are 150 μl of 70% EtO.
Washed twice with H. The beads were air dried for 2 minutes, DNA was eluted with 25 μl of distilled water and incubated for 5 minutes at room temperature (RT). The beads were magnetically separated and the supernatant was removed for testing and sequencing.

Purified PCR products were sequenced in both directions using the primer set described above or the following primer set represented from the 5'end to the 3'end. Registration number: Z11168 Fragment 1 Forward primer 710-729 GAGGGGGAGAGAGGGAAGGA (SEQ ID NO: 42) Complementary sequence of backward primer 1062-1043 TGCAGAGACCCAAGCAGGAA (SEQ ID NO: 43) Registration number: M83181 Fragment 2 Forward primer 267-286 GGGTCTCTGCATTCCCTTCC (SEQ ID NO: 44) Complementary sequence of rear primer 731-712 CGATGAACAGGTCGCAGGTT (SEQ ID NO: 45) Fragment 3 Forward primer 518-537 CTGGGCACGCTCATCTTCTG (SEQ ID NO: 46) Complementary sequence of rear primer 1023-1004 ATGAGCAGCAGCGGGATGTA (SEQ ID NO: 47) ) Fragment 4 Forward primer 789-808 ACAGGTACTGGGCCATCACG (SEQ ID NO: 48) Complementary sequence of backward primer 1279-1260 GTGCACCTCGATCACCTCCA (SEQ ID NO: 49) Fragment 5 Forward primer 1065-1082 GCATCCGCAAGACGGTCA (SEQ ID NO: 50) Rear primer 1548 Complementary sequence of -1529 TTGATTATGGCGCCCAACAG (SEQ ID NO: 51) Fragment 6 Forward primer 1322-1341 GCTGGTCCTACCCCTTGTGC (SEQ ID NO: 52) Complementary sequence of rear primer 1787-1768 CGTGAGCGGAGCAGAGAGAA (SEQ ID NO: 53) Confirmation of polymorphic site Sequence analysis nucleotide sequence for the purpose is, for the purpose of confirmation of the polymorphism present, poly Fred program (Poly
phred program) (Nickerson et al., Nucleic Acids Res. 14: 2745-2751, 1997
) Was used for analysis. The presence of polymorphism was confirmed on both strands. Polymorphism and H
Its position within the TR1A gene is listed in Table 3 below.

[0132]

[Table 3]

Example 2 This example describes the analysis of HTR1A polymorphisms identified in indexed data stores for the purpose of detecting human genotypes and haplotypes. The different genotypes, including these polymorphisms, observed in this reference population are displayed in Table 4 below. The haplotype pairs in this table represent the haplotype combinations determined for that individual using the haplotype induction protocol described below. In Table 4, homozygous positions are indicated by one nucleotide and heterozygous positions by two nucleotides. Nucleotides missing in a given genotype of Table 4 can generally be inferred based on linkage disequilibrium and / or Mendelian inheritance.

[0134]

[Table 4]

Filed April 19, 2000, “A Method and System for Determining Haplotypes from a Collec”
The haplotypes listed in Table 4, as described in the United States provisional patent application entitled "tion of Polymorphisms), are derived from the non-specific genotypes of the phases:
It was estimated using the Clark algorithm (Clark, AG (1990) Mol Bio Evol 7, 111-122). In this method, haplotypes are directly assigned from individuals who are homozygous at all sites and heterozygous at only one of the variable sites. This list of haplotypes is used to deconvolute the non-specific genotypes of the phases in the remaining (multiplied heterozygous) population.

By following this protocol, it was confirmed that the index data pools examined in this case, in turn, contained a population of 10 HTR1A haplotypes as shown in Table 5 below.

[0137]

[Table 5]

In view of the above, in the future some of the advantages of the present invention will be achieved and other advantageous results will be reached.

Various modifications may be made to the above methods and structures without departing from the scope of the present invention, the intent of which is to be included in the above description and It is to be understood that all matters shown in the accompanying figures are to be construed as an explanation and have no limiting meaning.

All references cited herein, including patents and patent applications, are incorporated by reference in their entirety. The discussion of references in this case is intended only to summarize the claims made by the authors and is not an admission that any references contribute to the prior art. Applicant reserves the right to question the accuracy and validity of the cited references.

[Sequence list]

[Brief description of drawings]

FIG. 1 is a partial reference nucleotide sequence for the HTR1A gene (Genbank version number 111
68.1; continuous line; SEQ ID NO: 1 ), where the start and end positions of each region of the encoded nucleotide sequence are shown in parentheses ([or]) at the numerical position below the sequence, The polymorphic sites and polymorphisms identified by the volunteers in the reference population are indicated by the variant nucleotides located below the polymorphic site within its base sequence.

FIG. 2 is a partial reference nucleotide sequence for the HTR1A gene (Genbank version number M831).
81.1; continuous line; SEQ ID NO: 2), where the start and end positions of each region of the encoded base sequence are shown in parentheses ([or]) at the numerical position below the sequence, The polymorphic sites and polymorphisms identified by the volunteers in the reference population are indicated by the variant nucleotides located below the polymorphic site within its base sequence.

FIG. 3 illustrates a reference nucleotide sequence (continuous line; SEQ ID NO: 3) for the HTR1A gene [consecutive], which consists of nucleotides 1-784 of GenBank accession number Z11168.1 and GenB
Ank accession number M83181.1 is followed by nucleotides 1-1938. The start and end positions of each region of the encoded nucleotide sequence are indicated in parentheses ([or]) by the numerical position below the sequence, and the polymorphic sites and polymorphisms identified by the volunteers in the reference population are It is indicated by the variant nucleotide located below the polymorphic site in its base sequence.

FIG. 3 illustrates a reference nucleotide sequence (continuous line; SEQ ID NO: 3) for the HTR1A gene [consecutive], which consists of nucleotides 1-784 of GenBank accession number Z11168.1 and GenB
Ank accession number M83181.1 is followed by nucleotides 1-1938. The start and end positions of each region of the encoded nucleotide sequence are indicated in parentheses ([or]) by the numerical position below the sequence, and the polymorphic sites and polymorphisms identified by the volunteers in the reference population are It is indicated by the variant nucleotide located below the polymorphic site in its base sequence.

FIG. 4 shows a reference nucleotide sequence (continuous line; SEQ ID NO: 4) for HTR1A-encoding nucleotide sequence.
), And the polymorphic sites and polymorphisms identified by the volunteers in the reference population are indicated by the variant nucleotides located below the polymorphic site in its base sequence.

FIG. 5 illustrates a reference amino acid sequence for the HTR1A protein (continuous line; SEQ ID NO: 5), in which the variant amino acids generated by the polymorphism of FIG. Shown below.

[Procedure amendment]

[Submission date] February 20, 2002 (2002.2.20)

[Procedure Amendment 2]

[Document name to be corrected] Drawing

[Name of item to be corrected] Figure 1

[Correction method] Change

[Contents of correction]

[Figure 1]

[Procedure 3]

[Document name to be corrected] Drawing

[Name of item to be corrected] Figure 2

[Correction method] Change

[Contents of correction]

[Fig. 2]

[Procedure amendment 4]

[Document name to be corrected] Drawing

[Name of item to be corrected] Fig. 3A

[Correction method] Change

[Contents of correction]

FIG. 3A

[Procedure Amendment 5]

[Document name to be corrected] Drawing

[Name of item to be corrected] Fig. 4

[Correction method] Change

[Contents of correction]

[Figure 4]

[Procedure correction 6]

[Document name to be corrected] Drawing

[Name of item to be corrected] Figure 5

[Correction method] Change

[Contents of correction]

[Figure 5]

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) G01N 33/15 G01N 33/50 Z 5B075 33/50 G06F 17/30 170F G06F 17/30 170 A61K 48/00 // A61K 38/22 A61P 25/22 48/00 25/30 A61P 25/22 C12N 15/00 ZNAA 25/30 A61K 37/24 (81) Designated country EP (AT, BE, CH, CY, DE, DK) , ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR , NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ , BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR , CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ, NO, NZ, PL, PT, RO, RU, SD, SE , SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW (72) Inventor Nanda Balan, Krishnan United States, Connecticut 06437, Guilford ， Village Pond Road 228 (72) Inventor Stevens, Joel Claiborne United States, Connecticut 06437, Guilford, Clavaburu Lane 46 F-term (reference) 2G045 AA35 DA13 FB02 FB12 4B024 AA01 AA11 BA63 CA04 CA09 HA08 HA09 HA12 HA19 4B063 QA01 QA07 QA12 QA19 Q43 QRQQQQ QR QR QR40 QR41 QR42 QR50 QR55 QR62 QR66 QR72 QR77 QS03 QS10 QS16 QS25 QS34 QX02 4C084 AA06 AA07 AA13 DB01 DB03 NA14 ZA022 ZA052 ZA122 ZC782 4H045 AA10 AA30 BA09 BA54 CA40 DA50 EA20 EA21 U20ND EA54 ND EA54 ND.

Claims (26)

[Claims] 1. An isolated polynucleotide containing one nucleotide base sequence selected from the following group: (a) The first nucleotide sequence is a 5-hydroxytryptamine receptor 1A (HTR1A) gene or its The nucleotide base sequence of the polymorphic variant of the reference nucleotide sequence for the fragment, wherein the reference nucleotide sequence consists of SEQ ID NO: 3 and the polymorphic variant is at least one polymorphism selected from the group consisting of Containing: thymine in PS1, thymine in PS5, guanine in PS6; and (b) a second nucleotide base sequence that is complementary to the first nucleotide base sequence. 2. The isolated polynucleotide according to claim 1, which contains the HTR1A isogenic gene. 3. A DNA molecule, comprising both a first nucleotide base sequence and a second nucleotide base sequence, and further comprising an expression control element capable of being linked to the first nucleotide base sequence. An isolated polynucleotide of. 4. A recombinant organism transformed or transfected with the isolated polynucleotide of claim 1, wherein the organism expresses the HTR1A protein encoded by the first nucleotide sequence. . 5. The recombinant organism according to claim 4, which is a transgenic animal other than human. 6. The isolated polynucleotide according to claim 1, wherein the first nucleotide base sequence is a polymorphic variant of a fragment of the HTR1A gene, and the fragment is one or more selected from the group consisting of: Containing polymorphisms: thymine in PS1, thymine in PS5, guanine in PS6. 7. An isolated polynucleotide comprising a nucleotide base sequence which is a polymorphic variant having a reference nucleotide sequence for HTR1A cDNA or a fragment thereof, wherein the reference nucleotide sequence comprises SEQ ID NO: 4. Contains at least one polymorphism selected from the group consisting of: thymine at the position corresponding to nucleotide 423, guanine at the position corresponding to nucleotide 464. 8. A recombinant organism transformed or transfected with the isolated polynucleotide of claim 7, wherein the organism is a 5-hydroxytryptamine receptor encoded by a polymorphic variant nucleotide sequence. One that expresses the 1A gene (HTR1A) protein. 9. The recombinant organism according to claim 8, which is a transgenic animal other than human. 10. An isolated polypeptide comprising an amino acid sequence of a polymorphic variant having a reference amino acid sequence for HTR1A protein or a fragment thereof, wherein the reference amino acid sequence comprises SEQ ID NO: 5 and the polymorphic variant is Those containing glycine at the position corresponding to amino acid position 155. 11. An isolated antibody which specifically reacts with the isolated polypeptide according to claim 10 and which is immunoreactive with it. 12. The method for screening a drug targeting the isolated polypeptide according to claim 10, wherein the HTR1A polymorphic variant is contacted with a candidate drug to measure the binding activity. 13. A construct containing at least one genotyped oligonucleotide for detecting a polymorphism in the 5-hydroxytryptamine receptor 1A gene (HTR1A) present at a polymorphic site selected from PS1-PS5 and PS6. . 14. The construct according to claim 13, wherein the genotyped nucleotide specifically hybridizes to an allele of the HTR1A gene in the region containing the polymorphic site. What is a reacting oligonucleotide. 15. The construct of claim 14, wherein the oligonucleotide specifically reactive with the allele is SEQ ID NOS: 4-51, a complementary sequence of SEQ ID NOS: 4-51, and SEQ ID NOS: 4-51. Those containing a nucleotide base sequence selected from the group consisting of NOS: 52-147. 16. The construct according to claim 13, wherein the genotyped nucleotide is a primer extension oligonucleotide. 17. Determining the nucleotide pair present at one or more polymorphic sites (PS) selected from PS1-PS 5 and PS6 for two copies of the HTR1A gene present in an individual A method of genotyping the 5-hydroxytryptamine receptor 1A gene (HTR1A) of the individual, which comprises: 18. The method according to claim 17, wherein the determining step includes the following items: (a) a single nucleic acid mixture containing two copies of the HTR1A gene or a fragment thereof present in the individual. (B) amplifying from the nucleic acid mixture a target region containing at least one polymorphic site; (c) a primer extension oligonucleotide directed against one allele of the amplified target region. (D) performing a nucleic acid template-dependent primer extension reaction on the hybridized genotyped oligonucleotide in the presence of at least two different reaction terminators, the terminator Those complementary to alternative nucleotides present at the polymorphic site; and (e) extended genotyping The step of the presence and identification of the terminator in the rubber nucleotides. 19. For one copy of the HTR1A gene present in an individual, determining the nucleotides at one or more polymorphic sites (PS) selected from PS1-PS5 and PS6. A method for haplotyping an individual 5-hydroxytryptamine receptor 1A gene (HTR1A) gene. 20. The method according to claim 19, wherein the determining step includes the following items: (a) Only one of the two copies of the HTR1A gene or a fragment thereof present in the individual is included. Isolating the nucleic acid molecule; (b) amplifying from the nucleic acid molecule a target region containing at least one polymorphic site; (c) introducing a primer extension oligonucleotide into one allele of the amplified target region. And (d) performing a nucleic acid template-dependent primer extension reaction on the hybridized genotyped oligonucleotide in the presence of at least two different reaction terminators, the terminator Is complementary to an alternative nucleotide present at the polymorphic site; and (e) the extension gene The step of the presence and identification of terminators in oligonucleotides. 21. The 5-hydroxytryptamine receptor 1A gene (H
(TR1A) a method for predicting a haplotype pair for a gene, comprising the steps of: (a) the HTR1A gene for that individual at two or more polymorphic sites selected from PS1-PS5 and PS6. Identifying the type; (b) a step listing all possible haplotype pairs consistent with the genotype; (c) accessing data containing the HTR1A haplotype pairs determined in the reference population; And (d) a step of assigning to the individual a haplotype pair that is consistent with the data. 22. A trait and 5-hydroxytryptamine receptor 1A gene (H
TR1A) A method to identify the relationship between at least one genotype or haplotype of a gene, and compare the genotype or haplotype frequency of a certain population exhibiting the trait with the genotype or haplotype frequency of a reference population. The genotype or haplotype comprises a nucleotide pair or nucleotides located at one or more polymorphic sites selected from PS1-PS5 and PS6, and the genotype in the trait population compared to the reference population. Or, when the frequency of haplotypes is higher, the trait is associated with genotype or haplotype. 23. The method according to claim 22, wherein the haplotype is selected from the haplotype numbers 1-10 shown in Table 5. 24. The method according to claim 23, wherein the trait is a clinical response to a drug targeting HTR1A. 25. A computer system for storing or analyzing polymorphism data for 5-hydroxytryptamine receptor 1A gene, comprising the following items:
: (a) Central processing unit (CPU); (b) Communication interface; (c) Display device; (d) Input device; and (e) Database containing polymorphic data; Consists of the indicated genotype and haplotype and the haplotype shown in Table 5. 26. A collection of genomes for the 5-hydroxytryptamine receptor 1A gene, including the HTR1A isogenic gene defined by haplotypes 1-10 displayed in Table 4.