JP2003304874A - Method for examining primary cause of thrombogenesis tendency - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for examining a primary cause of thrombogenesis tendency, and to provide a method for screening a compound useful for treating the thrombogenesis tendency. <P>SOLUTION: The method for examining the primary cause of the thrombogenesis tendency comprises a step for detecting polymorphism of an ADAMTS13 gene which causes reduction of activities of VWF nicking enzyme. The examining method enables the examination of the primary cause or the like of thrombotic thrombocytopenic purpura. The thrombotic thrombocytopenic purpura is an important disease as a side effect caused by administration of an anti-platelet agent preparation. The examination of the primary cause contributes to the improvement of safety o the anti-platelet agent preparation. <P>COPYRIGHT: (C)2004,JPO

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to thrombus formation tendency (thr.
ombophilia) to a method for testing a predisposition.

[0002]

2. Description of the Related Art Thrombotic thrombocytopenic purpura (thrombotic
Thrombocytopenic purpura (TTP) is a syndrome characterized by thrombocytopenia, hemolytic anemia, and perturbed neuropsychiatric disorders. In the past, about 80% of patients died within 3 months and had a poor prognosis. Plasmapheresis has now led to a significant improvement in prognosis.

Recently, a decrease in von Willebrand factor (VWF) cleaving enzyme activity has been reported as the etiology of TTP. That is,
Acquired TTP has been shown to be caused by a decrease in enzyme activity due to the production of IgG type inhibitors for VWF-cleaving enzyme (Furlan M., et al., N.
ew Engl. J. Med. 339,1578-1584,1998; Tsai HM., eta
L., New Engl. J. Med. 339, 1585-1594, 1988). In addition, in the congenital TTP, Upshaw-Schulman syndrome (USS), it was revealed that the VWF-cleaving enzyme is genetically deficient (Kinosh
ita S. et al., Int. J. Hematol. 74, 101-108, 2001).

Furthermore, the gene encoding the VWF cleaving enzyme was found to be ADAMTS13 (Soejima K. et a
L., J Biochem. 130, 475-480, 2001; Zheng X. et al., J.
Biol. Chem. 276, 41059-41063, 2001). Also with USS patients, A
It has been reported that the DAMTS13 gene is associated with abnormalities in splicing and deletion of bases (Levy GG.et.
al. Nature, 413, 488-494, 2001). In this report, ADAMTS1
The presence of SNPs in the three genes has also been revealed. However, no information has been obtained that links SNPs to any disease.

On the other hand, as thrombosis, not only congenital diseases such as USS, but also acquired diseases induced by various factors are known. For example, the administration of antiplatelet drugs
It is known to cause side effects of thrombosis. Ticlopidine hydrochloride is an antiplatelet agent used for the treatment of thrombosis / embolism associated with vascular surgery, ischemic cerebrovascular accident, etc., and improvement of symptoms associated with chronic arterial occlusion. TTP as a side effect
Therefore, administration of the drug requires caution.

Clopitogrel has been developed as an antiplatelet agent with fewer side effects. However, even with such new drugs, the risk of side effects cannot be ignored. Further, if the risk of TTP, which is a side effect, can be predicted, even a drug such as ticlopidine hydrochloride can be safely used.

[0007]

SUMMARY OF THE INVENTION An object of the present invention is to provide a method for examining a predisposition factor for thrombus formation and a screening method for a compound capable of improving the predisposition factor for thrombus formation.

[0008]

[Means for Solving the Problems] The inventors of the present invention believe that the risk of various diseases associated with thrombosis can be predicted or prevented by clarifying the genetic predisposition to thrombus formation tendency. It was For example, TTP, which is a side effect of antiplatelet drugs
However, it was thought that it would be possible to prevent this by knowing in advance the tendency of the patient to receive blood clot formation.

[0009] As a result of extensive search for indicators of the thrombogenic tendency, the association between the polymorphism of the ADAMTS13 gene and the thrombogenic tendency is found. The present invention was completed by clarifying that the tendency of thrombus formation can be examined using the polymorphism of the ADAMTS13 gene as an index. That is, the present invention relates to the following inspection method and screening method. [1] Taking a biological sample from a subject and analyzing the sample
A method for testing a predisposition factor for thrombus formation, which comprises the step of detecting a polymorphism in exon 12 of the ADAMTS13 gene that causes a decrease in the activity of VWF-cleaving enzyme. [2] The polymorphism is 18 in the nucleotide sequence of SEQ ID NO: 1.
The inspection method according to [1], which is a polymorphism at position 67. [3] The polymorphism is in the amino acid sequence of SEQ ID NO: 2,
The test method according to [2], which is a polymorphism in which proline at position 475 is mutated to serine. [4] The polymorphism is 18 in the nucleotide sequence of SEQ ID NO: 1.
The inspection method according to [3], which is substitution of c at position 67 with t. [5] A method for testing a predisposition factor for thrombus formation, which comprises the following steps (a) to (c). 1867 in the nucleotide sequence of SEQ ID NO: 1 in which (a) a step of collecting a biological sample from a subject, (b) any of genomic DNA, mRNA, and amplification products thereof contained in the biological sample Contacting with a probe that hybridizes to a region containing a base sequence in which the base corresponding to position c is replaced by t under hybridizable conditions, and (c)
The test method according to [5], which includes the step [6] of associating the probe hybridization in the step (b) with a thrombus-forming tendency factor [6]. (A ') a step of collecting a biological sample from the subject, (b')
Any of genomic DNA, mRNA, and amplification products thereof contained in a biological sample can be hybridized with a probe which hybridizes to a region corresponding to c at position 1867 in the nucleotide sequence of SEQ ID NO: 1. A step of bringing them into contact with each other under conditions, and a step (c ′) of associating the hybridization of the probe in steps (b) and (b ′) with a thrombogenic tendency, [7] including the following steps (a) to (c): Method for testing predisposition to thrombus formation. (A) a step of collecting a biological sample from a subject; (b) a protein containing an amino acid sequence in which proline at position 475 in the amino acid sequence of SEQ ID NO: 2 is mutated to serine contained in the biological sample; The step of detecting, and (c) the step of associating the presence of a protein in which proline at position 475 is mutated to serine with a thrombogenic tendency, [8] including the following steps (a ′) to (c ′), [7] The inspection method described. (A ') a step of collecting a biological sample from the subject, (b')
A step of detecting a protein having the amino acid sequence set forth in SEQ ID NO: 2 contained in the biological sample, and (c ′) 4
The step of associating the presence of a protein in which the proline at position 75 is mutated to serine and the protein having the amino acid sequence of SEQ ID NO: 2 with a predisposition to thrombus formation

[9] At the 1867th position in the nucleotide sequence of SEQ ID NO: 1.
A test reagent for a predisposition factor for thrombus formation, which comprises a DNA having a nucleotide sequence containing a region corresponding to c, or an oligonucleotide that hybridizes to a complementary strand thereof and has a chain length of at least 15 nucleotides. [10] A DNA consisting of a base sequence containing a region corresponding to c at position 1867 in the base sequence of SEQ ID NO: 1 is P
A test reagent for thrombosis-prone predisposition, comprising a primer set for amplification by the CR method. [11] 475 in the amino acid sequence of SEQ ID NO: 2
A reagent for testing a predisposition factor for thrombus formation, which comprises an antibody that binds to a protein containing an amino acid sequence in which proline at a position is mutated to serine. [12] 475 in the amino acid sequence of SEQ ID NO: 2
An antibody which immunologically distinguishes a protein containing an amino acid sequence in which proline at position is mutated to serine from a protein consisting of the amino acid sequence of SEQ ID NO: 2. [13] A test compound containing the following steps (a) to (d)
A method for evaluating the effect of increasing VWF-cleaving enzyme activity. (A) a step of providing a protein containing an amino acid sequence in which proline at position 475 is mutated to serine in the amino acid sequence of SEQ ID NO: 2 and / or a cell expressing the protein, (b) the protein and / or A step of contacting a test compound with cells, and (c) a step of detecting the VWF-cleaving enzyme activity in the protein and / or cells contacted with the test compound and correlating it with the action of increasing the VWF-cleaving enzyme activity of the test compound [ 14] A method of screening a drug candidate compound which increases the VWF-cleaving enzyme activity of a test compound, which comprises the following steps (1) and (2). (1) VW of a test compound according to the method described in [13]
A step of evaluating an effect of increasing F-cleaving enzyme activity, and a step of selecting a test compound having an effect evaluated in (2) and (1) that is greater than the activity when the test compound is not contacted [15] [ 14] Including the compound selected by the screening method described in [14], including the mutation of proline at position 475 to serine in the amino acid sequence of SEQ ID NO: 2.
VWF cleaving enzyme activity promoter. [16] An antiplatelet pharmaceutical composition containing a compound selected by the screening method according to [14] and a drug that induces a thrombus formation tendency, in which side effects of a thrombus formation tendency are reduced. [17] A polynucleotide containing the protein coding region of the base sequence shown in SEQ ID NO: 3. [18] The protein described in (A) or (B) below. (A) a protein having the amino acid sequence set forth in SEQ ID NO: 4 (B) selected from the amino acid sequences set forth in SEQ ID NO: 4 and including the serine at position 475 and including an amino acid sequence consisting of at least 7 consecutive amino acids protein

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention comprises the steps of collecting a biological sample from a subject and analyzing the sample to detect a polymorphism in exon 12 of the ADAMTS13 gene that causes a decrease in the activity of VWF-cleaving enzyme. The present invention relates to an inspection method for a predisposition factor for thrombus formation.

In the present invention, thrombotic tendency (thromboph
ilia) means that a blood clot is easily formed. In other words, the state in which a blood clot is likely to occur can be said to be a state in which the risk of a disease due to a blood clot is increased. Also, thrombophilic diathesis
Is a constitution that genetically causes thrombus in comparison with a normal human. The predisposition to thrombus formation includes the case where a thrombus is likely to occur under a specific condition. Therefore, there is no difference in thrombus formation tendency under general conditions,
An individual who is at increased risk of thrombus formation with the administration of a particular drug can be said to have a propensity for thrombus formation.

The present inventors have revealed that polymorphisms in specific exons constituting the ADAMTS13 gene determine the predisposition to thrombosis. The structure of the ADAMTS13 gene has already been clarified (GenBank Accession N
o. AB069698). It is also known that a defect in the ADAMTS13 gene is the cause of USS. Furthermore, there are also reports on polymorphisms in the ADAMTS13 gene. For example, Levy has 1, 4,
5, 6, 12, 15, 16, 18, 19, 21, 23,
It was reported that there are SNPs in 24 or 29 exons (Levy GG. Et al. Nature, 413, 488-494, 2001). However, the relationship between these SNPs and the predisposition to thrombus formation is unknown.

In response to these known findings, the present inventors have found that the exon 12 polymorphism is closely associated with thrombus formation tendency. Furthermore, the present inventors have found that exon 1
It was revealed that the polymorphism of 2 had a great influence on the activity of VWF-cleaving enzyme. The activity of VWF-cleaving enzyme is deeply involved in thrombus formation and lysis. That is, the present inventors have confirmed that the polymorphism in exon 12 is an important factor that influences the predisposition to thrombosis in an individual.

The ADAMTS13 gene is a gene having the nucleotide sequence shown in SEQ ID NO: 1. This gene encodes the amino acid sequence set forth in SEQ ID NO: 2. ADAMTS
The 13 genes are thought to be composed of 29 exons in total. The present inventors have found that exon 1
It was revealed that there is a polymorphism in 2 that causes a decrease in the activity of VWF-cleaving enzyme. In the base sequence of SEQ ID NO: 1, the base sequence consisting of 127 bases of 1753-1879 is ADAMT
Corresponds to exon 12 of the S13 gene. The nucleotide sequence forming exon 12 and the amino acid sequence encoded by the nucleotide sequence are shown in FIG. In addition, in FIG.
The polymorphic nucleotide sequence in which c at the 67th position is t and the corresponding codon is serine, and the amino acid sequence are shown.

A polymorphism is generally defined genetically as a change in a certain base in one gene existing at a frequency of 1% or more in the population. However, the “polymorphism” of the present invention is not limited to this definition, and even a base change having a frequency of less than 1% is included in the “polymorphism”. The type of polymorphism in the present invention is not limited. Specifically, for example, single nucleotide polymorphism
(SNPs), or polymorphisms in which several tens of bases are deleted, substituted or inserted can be indicated. Furthermore, the number of polymorphic sites is not particularly limited. Therefore, a plurality of polymorphisms can be targeted for inspection.

The fact that a certain polymorphism reduces the enzymatic activity of VWF-cleaving enzyme means that VWF-cleaving of the expression product of the gene modified form in which a specific base of the nucleotide sequence (wild type) shown in SEQ ID NO: 1 is changed. It can be confirmed by comparing the enzyme activity with the wild type. Substitution, deletion, addition of specific bases,
Alternatively, a method of inserting it to obtain a gene modified body is known. For example, PCR using a primer containing a mutated nucleotide sequence can mutate a specific site of the wild type nucleotide sequence consisting of SEQ ID NO: 1. Alternatively, the effect of polymorphism on VWF-cleaving enzyme activity can also be confirmed by comparing the VWF-cleaving enzyme activity of plasma collected from a subject whose ADAMTS13 genotype is known, with that of a normal subject. .

The gene modified product can be expressed as a protein by incorporating it into an appropriate expression vector. Alternatively, a technique for translating into a protein in vitro has been established. The expression product need not be purified as long as its enzymatic activity can be assessed. Alternatively, the expression product can be tagged to facilitate purification. If the VWF-cleaving enzyme activity of the obtained protein consisting of the amino acid sequence encoded by the gene variant can be examined, the effect of the mutation on the enzyme activity can be evaluated.

Methods for assessing VWF cleaving enzyme activity are known. For example, the method (Kinoshita et a
l., Kinoshita S. et al., Int. J. Hematol. 74, 101-10
8, 2001), the VWF-cleaving enzyme activity can be measured.

In this method, VWF is cleaved in vitro,
It is based on the principle of detecting the fragment with an antibody against VWF. Methods for preparing VWF and its antibody necessary for measurement are known. For example, a method for purifying VWF used in this test is known (Yoshihiro Fujimura, et al., Journal of Japan Society for Thrombosis and Hemostasis, 10 (4): 278-284, 1999). In addition, anti-VWF antibody is commercially available.

The thus identified polymorphism that reduces the activity of the VWF-cleaving enzyme in exon 12 can be used as an index for the predisposition to thrombus formation in the present invention. Exon 12 corresponds to an important region that determines VWF-cleaving enzyme activity. Therefore, VWF in this exon
Polymorphisms that reduce the activity of cleaving enzymes are important indicators of a thrombogenic tendency. ADAMTS shown in SEQ ID NO: 1 is a polymorphism that should be used as an index for the predisposition to thrombus formation in the present invention.
In the nucleotide sequence of 13 genes (wild type), a polymorphism at position 1867 (c) can be shown.

The polymorphism at position 1867 (c) was closely associated with the thrombogenic tendency predisposition. In particular, when c at position 1867 is mutated to t, this mutation is a codon containing position 1867 (proline).
Cause mutated to serine (P475S) (Fig. 1). V
The P475S mutation in the WF-cleaving enzyme leads to a decrease in enzyme activity, resulting in the induction of a thrombogenic tendency. As a result of analysis of ADAMTS13 gene of 364 Japanese people, the genotype was as follows. Therefore, the frequency of T alleles in Japanese is 5.1%. CC: 328 CT: 35 TT: 1

In the present invention, detection of polymorphism includes genotype identification. That is, the present invention relates to an inspection method including a step of analyzing whether a subject is homozygous or heterozygous with respect to the polymorphism serving as the index, and associating the result with a thrombus formation tendency predisposition.

For example, when the polymorphism at position 1867 (c) is used as an index, when the base at this site is t, it is judged that the subject has a predisposition to thrombus formation. For the same subject, as the base at this site
If c is also detected, it can be known that the subject has a wild-type allele. In other words, it can be concluded that this subject has a heterogeneous predisposition to thrombus formation. Such subjects, compared to having a homozygous t,
It is considered that the tendency of thrombus formation is weak. Thus, by clarifying the genotype, the thrombogenic tendency predisposition can be more quantitatively predicted.

In the test method of the present invention, the polymorphism generated in the ADAMTS13 gene can be detected, for example, by directly determining the nucleotide sequence of the ADAMTS13 gene of the subject. Specifically, first, a DNA sample is prepared from a subject. DNA samples include, for example, peripheral blood leukocytes of the subject, liver,
It can be prepared based on chromosomal DNA or RNA extracted from tissues or cells of kidney, adrenal gland, brain, uterus and the like.
Then, the DNA containing the ADAMTS13 gene is isolated. The DNA was isolated by PCR using chromosomal DNA or RNA as a template, using a primer that hybridizes to the ADAMTS13 gene.
Etc. In this method, the base sequence of the isolated DNA is then determined. The base sequence of the isolated DNA can be determined by a method known to those skilled in the art.

In the present method, the determined DNA is then
The nucleotide sequence of is compared with the control. The control in this method refers to the nucleotide sequence of a normal (wild type) ADAMTS13 gene. For example, ADA registered as a wild type in GenBank
It may be compared with the nucleotide sequence of the MTS13 gene (AB069698). As a result of such comparison, when a polymorphism to be used as an index is found in the sequence of the ADAMTS13 gene of the subject, the subject is determined to have a thrombotic tendency.

The test method of the present invention is a DN directly derived from a subject.
In addition to the method of determining the base sequence of A, various methods capable of detecting polymorphism can be used. For example, the detection of polymorphism in the present invention can also be performed by the following method. First, a DNA sample is prepared from a subject. Then, the prepared DNA sample is cleaved with a restriction enzyme. Then, the DNA fragments are separated according to their size.
Then, the size of the detected DNA fragment is compared with that of the control.

In another embodiment, first,
A DNA sample is prepared from a subject. Then, the DNA containing the ADAMTS13 gene is amplified. Furthermore, the amplified DNA is cut with a restriction enzyme. Then, the DNA fragments are separated according to their size. Then, the size of the detected DNA fragment is compared with the control. Such methods include, for example, Restriction Fragment Length Polymorphism.
morphism / RFLP) and PCR-RFLP method. Specifically, DNA generated when there is a mutation at the recognition site of a restriction enzyme or when a restriction enzyme treatment is performed.
If there are base insertions or deletions within the fragment, the size of the fragment produced after restriction enzyme treatment will change as compared to the control. By amplifying the portion containing this mutation by the PCR method and treating with each restriction enzyme, these mutations can be detected as a difference in the mobility of bands after electrophoresis.

Alternatively, the chromosomal DNA is treated with these restriction enzymes and electrophoresed, and then the probe DN of the present invention is used.
The presence or absence of mutation can be detected by performing Southern blotting using A. The restriction enzyme used can be appropriately selected according to each mutation. In this method, in addition to genomic DNA, RNA prepared from a subject can be converted into cDNA with a reverse transcriptase, which can be cleaved as it is with a restriction enzyme and then subjected to Southern blotting. In addition, ADAMTS1 by PCR using this cDNA as a template
It is also possible to amplify the DNA containing the three genes, cut it with a restriction enzyme, and then investigate the difference in mobility.

In yet another method, first, a DNA containing the ADAMTS13 gene prepared from a subject and a substrate on which a nucleotide probe that hybridizes with the DNA is fixed are prepared. Next, the DNA is brought into contact with the substrate. Furthermore, the ADAMTS13 gene polymorphism is detected by detecting the DNA hybridized with the nucleotide probe immobilized on the substrate.

As such a method, the DNA array method (S
NP gene polymorphism strategy, Kenichi Matsubara / Yoshiyuki Sakaki, Nakayama Shoten, p1
28-135). The preparation of a DNA sample containing the ADAMTS13 gene from a subject can be performed by a method well known to those skilled in the art. In a preferred embodiment of the preparation of the DNA sample, for example, peripheral blood leukocytes of a subject, liver, kidney, adrenal gland,
It can be prepared based on chromosomal DNA extracted from tissues or cells such as brain and uterus. Chromosomal DNA to DNA of this method
To prepare a sample, for example, DNA containing the ADAMTS13 gene
Chromosomal DNA using primers that hybridize to
It is also possible to prepare a DNA containing the ADAMTS13 gene by PCR using as a template. If necessary, the prepared DNA sample can be labeled for detection by a method well known to those skilled in the art.

In the present invention, the "substrate" means a plate-shaped material capable of immobilizing nucleotides. In the present invention, nucleotides include oligonucleotides and polynucleotides. The substrate of the present invention is not particularly limited as long as it can immobilize nucleotides, but substrates generally used in DNA array technology can be preferably used. In general, a DNA array is composed of thousands of nucleotides that are densely printed on a substrate. Usually, these DNAs are printed on the surface of a non-porous substrate. The surface layer of the substrate is generally glass, but porous membranes such as nitrocellulose membranes can be used.

In the present invention, an oligonucleotide-based array developed by Affymetrix can be exemplified as a method for immobilizing (arraying) nucleotides. In an array of oligonucleotides, the oligonucleotides are usually synthesized in situ. For example, photoli
thographic technology (Affymetrix) and inkjet for fixing chemicals (Rosetta Inpharmatic
In-situ synthetic methods of oligonucleotides by the technology (s., Inc.) are already known, and any technology can be used for producing the substrate of the present invention.

The nucleotide probe immobilized on the substrate is
There is no particular limitation as long as it can detect a polymorphism in the ADAMTS13 gene. That is, the probe is, for example,
Wild type ADAMTS13 gene or ADAMTS with polymorphism
It is a probe that hybridizes specifically with 13 genes. If specific hybridization is possible, the nucleotide probe is a DN containing the ADAMTS13 gene to be detected.
It does not have to be completely complementary to A, or the ADAMTS13 gene with a polymorphism. The length of the nucleotide probe bound to the substrate in the present invention is usually 10 to 100b when the oligonucleotide is immobilized, and preferably
It is 10 to 50b, more preferably 15 to 25b.

In the present invention, the cDNA sample is then brought into contact with the substrate. By this step, a DNA sample is hybridized with the nucleotide probe. The reaction solution and reaction conditions for hybridization may vary depending on various factors such as the length of the nucleotide probe immobilized on the substrate, but can generally be set by methods well known to those skilled in the art.

In the present invention, the presence / absence of hybridization between the DNA sample and the nucleotide probe immobilized on the substrate is then detected. This detection can be performed, for example, by reading the fluorescence signal with a scanner or the like. In a DNA array, DNA immobilized on a slide glass is generally called a probe, while labeled DNA in a solution is called a target. Therefore, the above nucleotide immobilized on the substrate is referred to as a nucleotide probe in the present specification.

In addition to the above method, an allele specific oligonucleotide (ASO) hybridization method can be used for the purpose of detecting only a mutation at a specific position. When an oligonucleotide containing a nucleotide sequence that is considered to have a mutation is produced and hybridized with this and a sample DNA, the efficiency of hybridization is reduced in the presence of the mutation. It can be detected by Southern blotting or a method utilizing the property of quenching by intercalating a special fluorescent reagent into the hybrid gap.

Detection by the ribonuclease A mismatch cleavage method is also possible. Specifically, a DNA containing the ADAMTS13 gene is amplified by the PCR method or the like, and this is hybridized with a labeled RNA prepared from the ADAMTS13 gene cDNA or the like incorporated in a plasmid vector or the like. Since the hybrid has a single-stranded structure in the portion where the mutation exists, the presence of the mutation can be detected by cleaving this portion with ribonuclease A and detecting this by autoradiography or the like.

Other methods capable of detecting the polymorphism of the present invention include 1) a method by mass spectrometry (Griffin TJ and Smith LM, T
rends Biotechnol . vol.18, pp77-84, (2000)), 2) Taq-Man PCR method (Livak KJ. Genet. Anal. v .
ol.14, pp143-149, (1999), CYP application example: Hiratsuka
M et al., Biol. Pharm. Bull. Vol.23, pp1131-1135,
(2000)), 3) Pyrosequencing method (Ahmadian A et al., Ana
l. Biochem. vol. 280, pp103-110, (2000)), 4) Invader method (Lyamichev V et al., Nat. Bi
otechnol. vol. 17, pp292-296, (1999), "Gene Medicine" vol.4, No.1, pp44-51 and p.
p68-72 (2000)). Various detection methods have been exemplified above, but not limited to these, any method may be used as long as it enables detection of a polymorphism in exon 12 of the ADAMTS13 gene that causes a decrease in VWF-cleaving enzyme activity. it can.

The test method of the present invention can be carried out by analyzing not only DNA but also protein. The polymorphism to be used as an index in the present invention is a polymorphism that causes a decrease in VWF-cleaving enzyme activity. Such polymorphisms usually cause amino acid sequence variations. Therefore, the inspection method of the present invention can be carried out using the mutation of this amino acid sequence as an index. Methods for detecting differences in amino acid sequences are known.

For example, it was already described that the polymorphism at the 1867th base c is a desirable index in the present invention. The base c at position 1867 causes mutation of the amino acid at position 475 corresponding to the codon containing the base from proline to serine by mutation to t. A protein having an amino acid sequence in which the amino acid residue at position 475 resulting from mutation is mutated to serine can be detected by an antibody. This mutant protein and the wild-type protein structurally have a difference of 1 amino acid residue. Methods for obtaining antibodies that discriminate such minute differences are known. For example, a monoclonal antibody that specifically recognizes this region can be obtained by synthesizing an oligopeptide consisting of an amino acid sequence in which the amino acid residue at position 475 is mutated to serine, and using this as an immunogen. Among the obtained monoclonal antibodies, those which do not intersect with the wild-type protein can be selected and used in the test method of the present invention.

Methods for detecting proteins using antibodies are known. For example, the sandwich method can be constructed by combining an antibody having binding activity for both the mutant type and the wild type with an antibody that specifically binds to the mutant type.
More specifically, the index in the present invention can be detected by an ELISA method using the former as a solid phase antibody and the latter as a labeled antibody. A method of labeling an antibody with an enzyme or the like is known.

The genotype can also be detected when the index in the present invention is detected using an antibody. That is, specific antibodies are used for the mutant protein and the wild-type protein, respectively, and when only one of them reacts, it is judged as homo, and when the reaction is observed with both antibodies, it is judged as hetero. You can In the present invention, when a test is performed by analyzing a protein, a blood sample or a cell lysate is used as a biological sample.

The present invention also provides a test agent for testing the predisposition to thrombus formation. That is, the present invention is an oligonucleic acid having a chain length of at least 15 nucleotides, which hybridizes to a DNA consisting of a nucleotide sequence containing a region corresponding to c at position 1867 in the nucleotide sequence set forth in SEQ ID NO: 1 or a complementary strand thereof. It is a test reagent for predisposing thrombus formation, which contains nucleotides. This is used for tests using genetic polymorphism as an index.

The oligonucleotide specifically hybridizes to DNA containing the ADAMTS13 gene.
The term "specifically hybridize" as used herein means ordinary hybridization conditions, preferably stringent hybridization conditions (for example, Sambrook et al., Molecular Cloning, Cold Spring Harbor Lab).
Oratory Press, New York, USA, 2nd edition 1989) means that it does not significantly cross-hybridize with DNAs encoding other proteins. The oligonucleotide does not need to be completely complementary to the base sequence of the ADAMTS13 gene to be detected, as long as specific hybridization is possible.

The oligonucleotide can be used as a probe or primer in the above-described inspection method of the present invention. When the oligonucleotide is used as a primer, its length is usually 15b to 100b, preferably 17b to 30b. Primer is AD containing polymorphic part
There is no particular limitation as long as it can amplify at least a part of the AMTS13 gene. When the above oligonucleotide is used as a probe, the probe is ADAMTS.
DNA corresponding to the region containing base 1867 of 13 genes
There is no particular limitation as long as it specifically hybridizes with. The probe may be a synthetic oligonucleotide and usually has a chain length of at least 15b or longer.

The oligonucleotide of the present invention can be produced, for example, by a commercially available oligonucleotide synthesizer. The probe can also be prepared as a double-stranded DNA fragment obtained by treatment with a restriction enzyme or the like. When the oligonucleotide of the present invention is used as a probe, it is preferably labeled appropriately before use. As a method of labeling, using T4 polynucleotide kinase, a method of labeling by phosphorylating the 5'end of an oligonucleotide with ³² P, and a DNA polymerase such as Klenow enzyme, a random hexamer oligonucleotide, etc. As the primer, a method of incorporating a substrate base labeled with an isotope such as ³² P, a fluorescent dye, or biotin (random prime method etc.) can be exemplified.

Another embodiment of the test agent of the present invention is a test for a predisposition factor for thrombus formation, which comprises a substrate on which a nucleotide probe that hybridizes with a DNA corresponding to a region containing the base at position 1867 of the ADAMTS13 gene is immobilized. It is a medicine. This is used for tests using genetic polymorphism as an index. The method for preparing these is as described above.

Another embodiment of the test agent of the present invention corresponds to the region containing position 1867 of the ADAMTS13 gene.
A reagent for testing a thrombogenic tendency, which comprises a forward primer and a reverse primer designed to amplify DNA. Primer lengths are typically 15bp-100b
p, preferably 17 to 30 bp. The primer is not particularly limited as long as it can amplify at least a part of the ADAMTS13 gene including the polymorphic part.

In the above-mentioned test reagents, in addition to the oligonucleotide which is the active ingredient, for example, sterile water, physiological saline, vegetable oil, surfactants, lipids, solubilizing agents, buffers, protein stabilizers (BSA and gelatin). Etc.), a preservative and the like may be mixed if necessary.

The above-mentioned reagent can also be combined with additional elements used for testing. As such an element, for example, the following can be shown. Negative control Positive control Instructions describing the probe analysis procedure for wild type detection

The test reagent of the present invention can also be constituted by the elements necessary for immunological analysis. That is, the present invention binds to a protein containing an amino acid sequence in which the proline residue at position 475 in the amino acid sequence shown in SEQ ID NO: 2 is mutated to serine, and is a protein consisting of the amino acid sequence shown in SEQ ID NO: 2. The present invention relates to a test reagent for a predisposition factor for thrombus formation, which comprises an antibody that does not cross-react.

The present invention also comprises the amino acid sequence of SEQ ID NO: 2, which binds to a protein containing the amino acid sequence in which the proline residue at position 475 of the amino acid sequence of SEQ ID NO: 2 is mutated to serine. It relates to antibodies that do not cross-react with proteins. In the present invention, that the antibody does not cross-react with the protein consisting of the amino acid sequence of SEQ ID NO: 2 means that this antibody does not substantially react with the wild-type protein. More specifically, for example, when the binding to the wild-type protein is below the detection limit under the same conditions as the binding to the mutant protein is observed, the antibody is substantially free from the wild-type protein. Can be said to not react to.

As described above, such an antibody can be obtained as an immunogen using an oligopeptide containing an amino acid sequence in which the proline residue at position 475 in the amino acid sequence set forth in SEQ ID NO: 2 is mutated to serine. be able to. The immunogen is usually bound to an appropriate carrier protein, and further suspended in an adjuvant to immunize an animal. As the carrier protein, keyhole limpet hemocyanin or the like is used.

When the antibody is a monoclonal antibody, it is possible to screen for a monoclonal antibody which binds to the mutant protein by an ELISA method using an oligopeptide used as an immunogen or a plate on which the mutant protein is immobilized. . Further, the monoclonal antibody of the present invention can be obtained by selecting an antibody that does not cross the wild-type protein from the antibodies having the binding activity to the mutant protein.

The present invention also provides a method for evaluating the action of a test compound, which comprises the following steps (a)-(d), for increasing the enzymatic activity of a VWF-cleaving enzyme whose activity has been reduced by the substitution of a base. . (A) a step of providing a protein containing an amino acid sequence in which proline at position 475 is mutated to serine in the amino acid sequence of SEQ ID NO: 2 and / or a cell expressing the protein, (b) the protein and / or Contacting a test compound with cells, (c) detecting the VWF-cleaving enzyme activity in the protein and / or cells contacted with the test compound, and (d) the protein contacted with the test compound and / or Step of detecting VWF-cleaving enzyme activity in cells and correlating it with the action of increasing VWF-cleaving enzyme activity of a test compound

In the above-mentioned evaluation method, when a difference was found in the enzyme activity detected in step (c) as compared with the control which was not contacted with the test compound, this difference was observed in (a) of the compound. It can be associated with the action of the described proteins on the VWF-cleaving enzyme activity. That is, when the enzyme activity detected in (c) is higher than that in the control as compared with the control, the size thereof has a function of increasing the VWF-cleaving enzyme activity of the protein described in (a) of the compound. Shows the level.

It is also possible to perform the steps (a)-(c) among a plurality of compounds and compare the magnitude of the above-mentioned effects among the compounds. Furthermore, a compound having a larger effect can be identified based on the effect of a specific compound. INDUSTRIAL APPLICABILITY The evaluation method of the present invention is useful as a screening method for a compound that increases the activity of a protein containing an amino acid sequence in which the proline at position 475 in the amino acid sequence of SEQ ID NO: 2 is mutated to serine.

The present invention also relates to a method for screening a drug candidate compound for increasing the VWF-cleaving enzyme activity of a test compound, which comprises the following steps (1) and (2). (1) The VWF-cleaving enzyme activity of a test compound is evaluated by a method of evaluating the action of increasing the enzymatic activity of a VWF-cleaving enzyme whose activity has been reduced by the substitution of a base, of the test compound including the steps (a)-(d) A step of evaluating an increasing effect, and a step of selecting a test compound having a large effect evaluated in (2) and (1) as compared with the activity when the test compound is not contacted

4 in the amino acid sequence of SEQ ID NO: 2
The protein containing the amino acid sequence in which proline at position 75 is mutated to serine is a mutant having a decreased VWF-cleaving enzyme activity, which is brought about by the substitution of bases. The compound having the activity of increasing the enzyme activity of the mutant is useful as a drug for improving the thrombus formation tendency of a patient having a thrombus formation tendency predisposition. The present invention has found that the mutant causes a thrombotic tendency. Therefore, it is a novel finding brought about by the present invention that the treatment of a thrombogenic tendency is realized by controlling the activity of the mutant.

The evaluation method or screening method of the present invention uses the enzymatic activity of VWF-cleaving enzyme as an index. In this method, first, in the amino acid sequence of SEQ ID NO: 2, a test compound is added to a protein that comprises a protein consisting of an amino acid sequence in which proline at position 475 is mutated to serine, and / or cells that express this protein. To contact. The origin of the "cell" used is
Examples include cells derived from humans, monkeys, mice, rats, cows, pigs, dogs, etc., but are not limited to these sources.

As such a cell, a cell into which a gene encoding the above protein has been introduced and the gene is expressed can be used. For example, in the nucleotide sequence of SEQ ID NO: 1, including the coding region,
A cell into which a gene in which the base corresponding to c is substituted with t can be used for the evaluation method or screening method of the present invention. Such a cell can be usually prepared by transforming a host cell with an expression vector into which the gene has been inserted. The expression vector is
It can be produced by general genetic engineering technology.

Alternatively, the protein thus expressed by the transformed cells can be purified and used in the evaluation method or screening method of the present invention. Methods for purifying expression products from transformed cells or culture supernatants thereof are known. First, the transformant is cultured under the condition that the gene encoding the introduced mutant can be expressed. Next, for example, the transformant is crushed in the presence of a protein protective agent such as a protease inhibitor, and the protein is fractionated by salting out or the like. The obtained protein fraction can be purified using a purification technique such as ion exchange chromatography, gel filtration, various affinity chromatography and the like. If a protein with a tag having affinity is added to the mutant protein is expressed, affinity purification using this tag can also be used.

The test compound used in this method is
For example, single compounds such as natural compounds, organic compounds, inorganic compounds, proteins and peptides, as well as compound libraries, expression products of gene libraries, cell extracts, cell culture supernatants, fermentation microbial products, marine organism extracts Products, plant extracts and the like.

VW in which the amino acid residue at position 475 is serine
The “contact” of the test compound with the F-cleaving enzyme variant or the cell expressing the F-cleaving enzyme mutant is usually performed by adding the test compound to the culture medium of cells expressing the gene, but is not limited to this method. For example, when the test compound is a protein, it is possible to “contact” the two by introducing a DNA vector expressing the protein into the cell. In the screening method of the present invention, the activity of the VWF-cleaving enzyme, which is the expression product of the gene, is then measured. The activity of the VWF-cleaving enzyme can be measured, for example, by the method shown in Examples (Kinoshita e
t al., Int. J. Hematol. 74, 101-108, 2001).

Then, a compound that increases the VWF-cleaving enzyme activity is selected as compared with the case of measurement in the absence of the test compound (control).

The present invention also relates to a polynucleotide containing the protein coding region of the nucleotide sequence shown in SEQ ID NO: 3. The polynucleotide of the present invention is useful for producing a protein having the amino acid sequence of SEQ ID NO: 4, or a fragment thereof. Alternatively, it can be used to obtain cells for use in the above evaluation method or screening method.

The present invention further relates to the protein described in (A) or (B) below. (A) a protein having the amino acid sequence set forth in SEQ ID NO: 4 (B) selected from the amino acid sequences set forth in SEQ ID NO: 4 and including the serine at position 475 and including an amino acid sequence consisting of at least 7 consecutive amino acids The protein described in Protein (A) is a DN containing a polymorphism that causes a decrease in VWF-cleaving enzyme activity actually found in humans.
It is a protein encoded by A. This protein is VW
F-cleaving enzyme activity is reduced. With this protein,
A compound having an action of increasing the decreased activity can be selected by the above-mentioned evaluation method or screening method.

The protein (B) is also useful as an immunogen for obtaining an antibody capable of discriminating a wild-type protein from a mutant-type protein. In general, contiguous amino acid sequences of more than 7 amino acids are very unlikely to match between different proteins. Therefore, the protein consisting of at least 7 amino acid residues is useful as an immunogen of an antibody that discriminates a mutant protein.

The compound obtainable by the screening of the present invention is itself useful as a promoter for VWF-cleaving enzyme activity. The compound obtained by the screening method of the present invention can be administered to a subject per se, but it can also be administered by formulating it by a generally known pharmaceutical method. For example, in the case of oral administration, tablets, powders, capsules, suspensions, etc., and in the case of transdermal administration, haptics and the like can be mentioned, but not limited thereto. The administration method is not particularly limited as long as it exhibits a therapeutic effect or a preventive effect, and may be, for example, oral administration, transdermal administration, blood administration by injection, and the like.

When these compounds are DNA, when the DNA is administered in vivo, viral vectors such as retrovirus, adenovirus and Sendai virus, non-viral vectors such as liposomes, or the form of naked DNA Can be used at. The administration method is in v
The ivo method and the ex vivo method can be exemplified.

Alternatively, the compound selected by the screening method of the present invention can be mixed with a drug that may cause a thrombus formation tendency as a side effect to prepare a pharmaceutical preparation with reduced side effects. For example, it has been reported that thrombosis tendencies may appear as a side effect in antiplatelet drugs. More specifically, it has been pointed out that Ticlopidine may cause TTP when administered to patients with a predisposition to thrombus formation. TTP
Is a thrombotic condition caused by the tendency of thrombus formation. Therefore, by compounding the compound obtained by the screening method of the present invention with a drug accompanied by such side effects of thrombus formation, a drug with high safety can be obtained.

The dose of the compound that can be obtained by the screening of the present invention depends on the patient's age, sex, body weight and symptoms, therapeutic effect, administration method, treatment time, or kind of active ingredient contained in the pharmaceutical composition. Usually, 0.1 mg to 500 per adult
It can be administered in the range of mg, preferably in the range of 0.5 to 20 mg. However, since the dose varies depending on various conditions, a dose smaller than the above dose may be sufficient in some cases, and a dose exceeding the above range may be necessary in some cases.

[0073]

[Examples] (1) Nucleotide sequence analysis of exon 12 of ADAMTS13 gene 4 families of patients with thrombotic thrombocytopenic purpura (patient, father,
Genomic DNA was extracted from whole blood of 364 normal mothers and sisters (using Kurabo's automatic nucleic acid purifier NA-3000). All samples were approved by the ethics committee. Using this as a template, two oligonucleotides 5'-TGAGGCC were prepared from the sequence of the intron sandwiching exon 12.
ACACCCACATCTTG-3 '(SEQ ID NO: 5) and 5'-ATGCCAGA
PCR was performed using FastStart Taq DNA polymerase from Roche, using GCCTGAACCACTT-3 '(SEQ ID NO: 6) as a primer. The reaction conditions are 95 ℃ / 4 minutes, (95 ℃ / 30 seconds, 60 ℃ / 30
Second, 72 ° C./1 min) × 30 cycles, 72 ° C./3 min. The nucleotide sequence of the reaction product is the BigD from Applied Biosystems.
It was analyzed by ye Terminator Kit and 3700 DNA Analyzer.

(2) Measurement of VWF-cleaving enzyme activity in plasma Plasma was collected from the above-mentioned family of patients with thrombotic thrombocytopenic purpura by the sodium citrate method. 10 μl of this plasma was added to 10 μg / ml final concentration of purified von Willebrand factor, 10 mM BaCl ₂
And low ionic strength buffer containing urea (1.5 M urea, 5 mM Tris-HC)
l, pH 8.0) 90 μl was added and the mixture was heated at 37 ° C. for 24 hours. Then, SDS agarose electrophoresis was performed, and further transferred to a PVDF membrane by Western blotting. Anti von Willebrand
The von Willebrand factor was visualized by a factor antibody and the degree of cleavage was quantitatively evaluated (Kinoshita et al., Int. J. Hem.
atol.74, 101-108, 2001).

(3) Results As a result of gene analysis of 364 ordinary people, 115th position of exon 12 consisting of 127 base pairs (1867 in total cDNA)
A polymorphism was found in which C at position) was mutated to T. 328 had CC homozygotes and 35 had CT heterozygotes
One had a TT homozygote.

On the other hand, a family of patients with thrombotic thrombocytopenic purpura
The VWF-cleaving enzyme activity of 4 patients was 100% normal plasma, and
Less than 3% (below detection limit), father 5.6%, mother 36%, sister 30% (Kinoshita et al., Int. J. Hematol. 74,101-108,2)
001). As a result of gene analysis, responsible mutations other than exon 12 were found in patients and parents, but in the older sister, C /
The T polymorphism (mutation of proline to serine at position 475) was only found as a heterozygote. Thus, when taken together with the activity, it was revealed that this mutation causes a serious defect in the activity of the VWF-cleaving enzyme. From the above results,
It was shown that about 10% of the general population had a mutation in exon 12 and had a decreased VWF-cleaving enzyme activity.

[0077]

INDUSTRIAL APPLICABILITY The present invention provides a method for examining a predisposition factor for thrombus formation. Since the test method of the present invention uses the polymorphism that causes the change in the enzyme activity of the VWF-cleaving enzyme that causes the thrombus formation tendency as an index, this predisposition can be directly detected. The inspection index in the present invention is
Since it is a gene polymorphism, it can be easily detected using DNA analysis technology. Alternatively, since the polymorphism found by the present inventors is accompanied by a mutation in the amino acid sequence, the predisposition to thrombus formation can be clarified by immunological analysis of the protein.

The predisposition factor for thrombus formation is determined by the nucleotide sequence of the gene,
Being able to test based on structural differences in proteins is a great advantage in practice. For example, it may be possible to measure the activity of VWF-cleaving enzyme and correlate it with a thrombogenic tendency. However, to measure the activity of VWF cleaving enzyme,
A substrate protein and an antibody that recognizes it are required. Therefore, it is not economical to use it as a daily inspection method. Moreover, since the operation is complicated,
It becomes a factor to hinder the spread.

On the other hand, according to the inspection method of the present invention,
The predisposition to thrombus formation can be examined by the difference in the nucleotide sequence of the gene or the structure of the protein. The nucleotide sequence of a gene can be easily and inexpensively analyzed using a DNA chip or PCR method. Alternatively, the difference in protein structure can be analyzed quickly and inexpensively by immunoassay or the like. Thus, by identifying the association between the polymorphism in a specific exon and the thrombogenic tendency, it has become possible to test the thrombotic tendency more easily and inexpensively.

Thrombotic propensity is an important predisposition that underlies various thrombotic disorders. For example, in thrombotic thrombocytopenic purpura, which is caused by administration of an antiplatelet drug, the tendency of the patient to form a thrombus plays a large role in the pathogenesis. However, until now, it was difficult to predict the thrombus formation tendency before administration, because there was no suitable index for the thrombus formation tendency. On the other hand, the index of the present invention can be used to correctly evaluate the thrombogenic tendency, based on the genotype and the amino acid sequence of the VWF-cleaving enzyme protein. Thus, the utility of the present invention, which provided an appropriate indicator of the thrombogenic tendency, is clear.

Further, the present invention provides a method for screening a compound having an action of increasing the enzymatic activity of a VWF cleaving enzyme whose activity has been reduced by mutation. By the screening method of the present invention, it is possible to select a compound that promotes the activity of VWF-cleaving enzyme, which is the cause of the thrombogenic tendency. Such compounds are useful as promoters of VWF-cleaving enzyme activity. Alternatively, the compound selected according to the present invention may be incorporated into an antiplatelet preparation to give a drug with reduced thrombogenic side effects.

[0082]

[Sequence list]                          SEQUENCE LISTING <110> President of National Cardiovascular Center <120> A Method for testing of thrombophilic diathesis <130> NCV-A0201 <140> <141> <160> 2 <170> PatentIn version 2.1 <210> 1 <211> 4933 <212> DNA <213> Homo sapiens <400> 1 aaccacgatg tctttggcac agcctctcat ctgtcagatg ggagcgggga ccccggagag 60 ggagtcagcc gaggtcctgg cattccttgt gaacccccgt ctgtgggttt ctggtccagt 120 gtcccttctc cagattagat ggcttaggcc tcctctaagg gggtgggcgt gcacatccgg 180 agagctgtct ggtgtgcagg actgggctgc aggttaccct gaactgcaac catcttagag 240 caaggcccag cttgcagcag gaggagctgc aggccgccca ccctagccac ggcccctgcc 300 ctggcaggaa gcttccaaga gtaaacactg cctaatcgtc ccgcccagta gtgagcaggc 360 ctgtcccatt ccatactgac cagattccca gtcaccaagg ccccctctca ctccgctcca 420 ctcctcgggc tggctctcct gaggatgcac cagcgtcacc cccgggcaag atgccctccc 480 ctctgtgtgg ccggaatcct tgcctgtggc tttctcctgg gctgctgggg accctcccat 540 ttccagcaga gttgtcttca ggctttggag ccacaggccg tgtcttctta cttgagccct 600 ggtgctccct taaaaggccg ccctccttcc cctggcttcc agaggcagag gcagaggcag 660 aggcgggctg caggcggcat cctacacctg gagctgctgg tggccgtggg ccccgatgtc 720 ttccaggctc accaggagga cacagagcgc tatgtgctca ccaacctcaa catcggggca 780 gaactgcttc gggacccgtc cctgggggct cagtttcggg tgcacctggt gaagatggtc 840 attctgacag agcctgaggg tgctccaaat atcacagcca acctcacctc gtccctgctg 900 agcgtctgtg ggtggagcca gaccatcaac cctgaggacg acacggatcc tggccatgct 960 gacctggtcc tctatatcac taggtttgac ctggagttgc ctgatggtaa ccggcaggtg 1020 cggggcgtca cccagctggg cggtgcctgc tccccaacct ggagctgcct cattaccgag 1080 gacactggct tcgacctggg agtcaccatt gcccatgaga ttgggcacag cttcggcctg 1140 gagcacgacg gcgcgcccgg cagcggctgc ggccccagcg gacacgtgat ggcttcggac 1200 ggcgccgcgc cccgcgccgg cctcgcctgg tccccctgca gccgccggca gctgctgagc 1260 ctgctcagcg caggacgggc gcgctgcgtg tgggacccgc cgcggcctca acccgggtcc 1320 gcggggcacc cgccggatgc gcagcctggc ctctactaca gcgccaacga gcagtgccgc 1380 gtggccttcg gccccaaggc tgtcgcctgc accttcgcca gggagcacct ggatatgtgc 1440 caggccctct cctgccacac agacccgctg gaccaaagca gctgcagccg cctcctcgtt 1500 cctctcctgg atgggacaga atgtggcgtg gagaagtggt gctccaaggg tcgctgccgc 1560 tccctggtgg agctgacccc catagcagca gtgcatgggc gctggtctag ctggggtccc 1620 cgaagtcctt gctcccgctc ctgcggagga ggtgtggtca ccaggaggcg gcagtgcaac 1680 aaccccagac ctgcctttgg ggggcgtgca tgtgttggtg ctgacctcca ggccgagatg 1740 tgcaacactc aggcctgcga gaagacccag ctggagttca tgtcgcaaca gtgcgccagg 1800 accgacggcc agccgctgcg ctcctcccct ggcggcgcct ccttctacca ctggggtgct 1860 gctgtaccac acagccaagg ggatgctctg tgcagacaca tgtgccgggc cattggcgag 1920 agcttcatca tgaagcgtgg agacagcttc ctcgatggga cccggtgtat gccaagtggc 1980 ccccgggagg acgggaccct gagcctgtgt gtgtcgggca gctgcaggac atttggctgt 2040 gatggtagga tggactccca gcaggtatgg gacaggtgcc aggtgtgtgg tggggacaac 2100 agcacgtgca gcccacggaa gggctctttc acagctggca gagcgagaga atatgtcacg 2160 tttctgacag ttacccccaa cctgaccagt gtctacattg ccaaccacag gcctctcttc 2220 acacacttgg cggtgaggat cggagggcgc tatgtcgtgg ctgggaagat gagcatctcc 2280 cctaacacca cctacccctc cctcctggag gatggtcgtg tcgagtacag agtggccctc 2340 accgaggacc ggctgccccg cctggaggag atccgcatct ggggacccct ccaggaagat 2400 gctgacatcc aggtttacag gcggtatggc gaggagtatg gcaacctcac ccgcccagac 2460 atcaccttca cctacttcca gcctaagcca cggcaggcct gggtgtggggccgctgtgcgt 2520 gggccctgct cggtgagctg tggggcaggg ctgcgctggg taaactacag ctgcctggac 2580 caggccagga aggagttggt ggagactgtc cagtgccaag ggagccagca gccaccagcg 2640 tggccagagg cctgcgtgct cgaaccctgc cctccctact gggcggtggg agacttcggc 2700 ccatgcagcg cctcctgtgg gggcggcctg cgggagcggc cagtgcgctg cgtggaggcc 2760 cagggcagcc tcctgaagac attgccccca gcccggtgca gagcaggggc ccagcagcca 2820 gctgtggcgc tggaaacctg caacccccag ccctgccctg ccaggtggga ggtgtcagag 2880 cccagctcat gcacatcagc tggtggagca ggcctggcct tggagaacga gacctgtgtgg 2940 ccaggggcag atggcctgga ggctccagtg actgaggggc ctggctccgt agatgagaag 3000 ctgcctgccc ctgagccctg tgtcgggatg tcatgtcctc caggctgggg ccatctggat 3060 gccacctctg caggggagaa ggctccctcc ccatggggca gcatcaggac gggggctcaa 3120 gctgcacacg tgtggacccc tgcggcaggg tcgtgctccg tctcctgcgg gcgaggtctg 3180 atggagctgc gtttcctgtg catggactct gccctcaggg tgcctgtcca ggaagagctg 3240 tgtggcctgg caagcaagcc tgggagccgg cgggaggtct gccaggctgt cccgtgccct 3300 gctcggtggc agtacaagct ggcggcctgc agcgtgagct gtgggagagg ggtcgtgcgg 3360 aggatcctgt attgtgcccg ggcccatggg gaggacgatg gtgaggagat cctgttggac 3420 acccagtgcc aggggctgcc tcgcccggaa ccccaggagg cctgcagcct ggagccctgc 3480 ccacctaggt ggaaagtcat gtcccttggc ccatgttcgg ccagctgtgg ccttggcact 3540 gctagacgct cggtggcctg tgtgcagctc gaccaaggcc aggacgtgga ggtggacgag 3600 gcggcctgtg cggcgctggt gcggcccgag gccagtgtcc cctgtctcat tgccgactgc 3660 acctaccgct ggcatgttgg cacctggatg gagtgctctg tttcctgtgg ggatggcatc 3720 cagcgccggc gtgacacctg cctcggaccc caggcccagg cgcctgtgcc agctgatttc 3780 tgccagcact tgcccaagcc ggtgactgtg cgtggctgct gggctgggcc ctgtgtggggga 3840 cagggtacgc ccagcctggt gccccacgaa gaagccgctg ctccaggacg gaccacagcc 3900 acccctgctg gtgcctccct ggagtggtcc caggcccggg gcctgctctt ctccccggct 3960 ccccagcctc ggcggctcct gcccgggccc caggaaaact cagtgcagtc cagtgcctgt 4020 ggcaggcagc accttgagcc aacaggaacc attgacatgc gaggcccagg gcaggcagac 4080 tgtgcagtgg ccattgggcg gcccctcggg gaggtggtga ccctccgcgt ccttgagagt 4140 tctctcaact gcagtgcggg ggacatgttg ctgctttggg gccggctcac ctggaggaag 4200 atgtgcagga agctgttgga catgactttc agctccaaga ccaacacgct ggtggtgagg 4260 cagcgctgcg ggcggccagg aggtggggtg ctgctgcggt atgggagcca gcttgctcct 4320 gaaaccttct acagagaatg tgacatgcag ctctttgggc cctggggtga aatcgtgagc 4380 ccctcgctga gtccagccac gagtaatgca gggggctgcc ggctcttcat taatgtggct 4440 ccgcacgcac ggattgccat ccatgccctg gccaccaaca tgggcgctgg gaccgaggga 4500 gccaatgcca gctacatctt gatccgggac acccacagct tgaggaccac agcgttccat 4560 gggcagcagg tgctctactg ggagtcagag agcagccagg ctgagatgga gttcagcgag 4620 ggcttcctga aggctcaggc cagcctgcgg ggccagtact ggaccctcca atcatgggta 4680 ccggagatgc aggaccctca gtcctggaag ggaaaggaag gaacctgagg gtcattgaac 4740 atttgttccg tgtctggcca gccctggagg gttgacccct ggtctcagtg ctttccaatt 4800 cgaacttttt ccaatcttag gtatctactt tagagtcttc tccaatgtcc aaaaggctag 4860 ggggttggag gtggggactc tggaaaagca gcccccattt cctcgggtac caataaataa 4920 aacatgcagg ctg 4933 <210> 2 <211> 1427 <212> PRT <213> Homo sapiens <400> 2 Met His Gln Arg His Pro Arg Ala Arg Cys Pro Pro Leu Cys Val Ala 1 5 10 15 Gly Ile Leu Ala Cys Gly Phe Leu Leu Gly Cys Trp Gly Pro Ser His             20 25 30 Phe Gln Gln Ser Cys Leu Gln Ala Leu Glu Pro Gln Ala Val Ser Ser         35 40 45 Tyr Leu Ser Pro Gly Ala Pro Leu Lys Gly Arg Pro Pro Ser Pro Gly     50 55 60 Phe Gln Arg Gln Arg Gln Arg Gln Arg Arg Ala Ala Gly Gly Ile Leu 65 70 75 80 His Leu Glu Leu Leu Val Ala Val Gly Pro Asp Val Phe Gln Ala His                 85 90 95 Gln Glu Asp Thr Glu Arg Tyr Val Leu Thr Asn Leu Asn Ile Gly Ala             100 105 110 Glu Leu Leu Arg Asp Pro Ser Leu Gly Ala Gln Phe Arg Val His Leu         115 120 125 Val Lys Met Val Ile Leu Thr Glu Pro Glu Gly Ala Pro Asn Ile Thr     130 135 140 Ala Asn Leu Thr Ser Ser Leu Leu Ser Val Cys Gly Trp Ser Gln Thr 145 150 155 160 Ile Asn Pro Glu Asp Asp Thr Asp Pro Gly His Ala Asp Leu Val Leu                 165 170 175 Tyr Ile Thr Arg Phe Asp Leu Glu Leu Pro Asp Gly Asn Arg Gln Val             180 185 190 Arg Gly Val Thr Gln Leu Gly Gly Ala Cys Ser Pro Thr Trp Ser Cys         195 200 205 Leu Ile Thr Glu Asp Thr Gly Phe Asp Leu Gly Val Thr Ile Ala His     210 215 220 Glu Ile Gly His Ser Phe Gly Leu Glu His Asp Gly Ala Pro Gly Ser 225 230 235 240 Gly Cys Gly Pro Ser Gly His Val Met Ala Ser Asp Gly Ala Ala Pro                 245 250 255 Arg Ala Gly Leu Ala Trp Ser Pro Cys Ser Arg Arg Gln Leu Leu Ser             260 265 270 Leu Leu Ser Ala Gly Arg Ala Arg Cys Val Trp Asp Pro Pro Arg Pro         275 280 285 Gln Pro Gly Ser Ala Gly His Pro Pro Asp Ala Gln Pro Gly Leu Tyr     290 295 300 Tyr Ser Ala Asn Glu Gln Cys Arg Val Ala Phe Gly Pro Lys Ala Val 305 310 315 320 Ala Cys Thr Phe Ala Arg Glu His Leu Asp Met Cys Gln Ala Leu Ser                 325 330 335 Cys His Thr Asp Pro Leu Asp Gln Ser Ser Cys Ser Arg Leu Leu Val             340 345 350 Pro Leu Leu Asp Gly Thr Glu Cys Gly Val Glu Lys Trp Cys Ser Lys         355 360 365 Gly Arg Cys Arg Ser Leu Val Glu Leu Thr Pro Ile Ala Ala Val His     370 375 380 Gly Arg Trp Ser Ser Trp Gly Pro Arg Ser Pro Cys Ser Arg Ser Cys 385 390 395 400 Gly Gly Gly Val Val Thr Arg Arg Arg Gln Cys Asn Asn Pro Arg Pro                 405 410 415 Ala Phe Gly Gly Arg Ala Cys Val Gly Ala Asp Leu Gln Ala Glu Met             420 425 430 Cys Asn Thr Gln Ala Cys Glu Lys Thr Gln Leu Glu Phe Met Ser Gln         435 440 445 Gln Cys Ala Arg Thr Asp Gly Gln Pro Leu Arg Ser Ser Pro Gly Gly     450 455 460 Ala Ser Phe Tyr His Trp Gly Ala Ala Val Pro His Ser Gln Gly Asp 465 470 475 480 Ala Leu Cys Arg His Met Cys Arg Ala Ile Gly Glu Ser Phe Ile Met                 485 490 495 Lys Arg Gly Asp Ser Phe Leu Asp Gly Thr Arg Cys Met Pro Ser Gly             500 505 510 Pro Arg Glu Asp Gly Thr Leu Ser Leu Cys Val Ser Gly Ser Cys Arg         515 520 525 Thr Phe Gly Cys Asp Gly Arg Met Asp Ser Gln Gln Val Trp Asp Arg     530 535 540 Cys Gln Val Cys Gly Gly Asp Asn Ser Thr Cys Ser Pro Arg Lys Gly 545 550 555 560 Ser Phe Thr Ala Gly Arg Ala Arg Glu Tyr Val Thr Phe Leu Thr Val                 565 570 575 Thr Pro Asn Leu Thr Ser Val Tyr Ile Ala Asn His Arg Pro Leu Phe             580 585 590 Thr His Leu Ala Val Arg Ile Gly Gly Arg Tyr Val Val Ala Gly Lys         595 600 605 Met Ser Ile Ser Pro Asn Thr Thr Tyr Pro Ser Leu Leu Glu Asp Gly     610 615 620 Arg Val Glu Tyr Arg Val Ala Leu Thr Glu Asp Arg Leu Pro Arg Leu 625 630 635 640 Glu Glu Ile Arg Ile Trp Gly Pro Leu Gln Glu Asp Ala Asp Ile Gln                 645 650 655 Val Tyr Arg Arg Tyr Gly Glu Glu Tyr Gly Asn Leu Thr Arg Pro Asp             660 665 670 Ile Thr Phe Thr Tyr Phe Gln Pro Lys Pro Arg Gln Ala Trp Val Trp         675 680 685 Ala Ala Val Arg Gly Pro Cys Ser Val Ser Cys Gly Ala Gly Leu Arg     690 695 700 Trp Val Asn Tyr Ser Cys Leu Asp Gln Ala Arg Lys Glu Leu Val Glu 705 710 715 720 Thr Val Gln Cys Gln Gly Ser Gln Gln Pro Pro Ala Trp Pro Glu Ala                 725 730 735 Cys Val Leu Glu Pro Cys Pro Pro Tyr Trp Ala Val Gly Asp Phe Gly             740 745 750 Pro Cys Ser Ala Ser Cys Gly Gly Gly Leu Arg Glu Arg Pro Val Arg         755 760 765 Cys Val Glu Ala Gln Gly Ser Leu Leu Lys Thr Leu Pro Pro Ala Arg     770 775 780 Cys Arg Ala Gly Ala Gln Gln Pro Ala Val Ala Leu Glu Thr Cys Asn 785 790 795 800 Pro Gln Pro Cys Pro Ala Arg Trp Glu Val Ser Glu Pro Ser Ser Cys                 805 810 815 Thr Ser Ala Gly Gly Ala Gly Leu Ala Leu Glu Asn Glu Thr Cys Val             820 825 830 Pro Gly Ala Asp Gly Leu Glu Ala Pro Val Thr Glu Gly Pro Gly Ser         835 840 845 Val Asp Glu Lys Leu Pro Ala Pro Glu Pro Cys Val Gly Met Ser Cys     850 855 860 Pro Pro Gly Trp Gly His Leu Asp Ala Thr Ser Ala Gly Glu Lys Ala 865 870 875 880 Pro Ser Pro Trp Gly Ser Ile Arg Thr Gly Ala Gln Ala Ala His Val                 885 890 895 Trp Thr Pro Ala Ala Gly Ser Cys Ser Val Ser Cys Gly Arg Gly Leu             900 905 910 Met Glu Leu Arg Phe Leu Cys Met Asp Ser Ala Leu Arg Val Pro Val         915 920 925 Gln Glu Glu Leu Cys Gly Leu Ala Ser Lys Pro Gly Ser Arg Arg Glu     930 935 940 Val Cys Gln Ala Val Pro Cys Pro Ala Arg Trp Gln Tyr Lys Leu Ala 945 950 955 960 Ala Cys Ser Val Ser Cys Gly Arg Gly Val Val Arg Arg Ile Leu Tyr                 965 970 975 Cys Ala Arg Ala His Gly Glu Asp Asp Gly Glu Glu Ile Leu Leu Asp             980 985 990 Thr Gln Cys Gln Gly Leu Pro Arg Pro Glu Pro Gln Glu Ala Cys Ser         995 1000 1005 Leu Glu Pro Cys Pro Pro Arg Trp Lys Val Met Ser Leu Gly Pro     1010 1015 1020 Cys Ser Ala Ser Cys Gly Leu Gly Thr Ala Arg Arg Ser Val Ala     1025 1030 1035 Cys Val Gln Leu Asp Gln Gly Gln Asp Val Glu Val Asp Glu Ala     1040 1045 1050 Ala Cys Ala Ala Leu Val Arg Pro Glu Ala Ser Val Pro Cys Leu     1055 1060 1065 Ile Ala Asp Cys Thr Tyr Arg Trp His Val Gly Thr Trp Met Glu     1070 1075 1080 Cys Ser Val Ser Cys Gly Asp Gly Ile Gln Arg Arg Arg Asp Thr     1085 1090 1095 Cys Leu Gly Pro Gln Ala Gln Ala Pro Val Pro Ala Asp Phe Cys     1100 1105 1110 Gln His Leu Pro Lys Pro Val Thr Val Arg Gly Cys Trp Ala Gly     1115 1120 1125 Pro Cys Val Gly Gln Gly Thr Pro Ser Leu Val Pro His Glu Glu     1130 1135 1140 Ala Ala Ala Pro Gly Arg Thr Thr Ala Thr Pro Ala Gly Ala Ser     1145 1150 1155 Leu Glu Trp Ser Gln Ala Arg Gly Leu Leu Phe Ser Pro Ala Pro     1160 1165 1170 Gln Pro Arg Arg Leu Leu Pro Gly Pro Gln Glu Asn Ser Val Gln     1175 1180 1185 Ser Ser Ala Cys Gly Arg Gln His Leu Glu Pro Thr Gly Thr Ile     1190 1195 1200 Asp Met Arg Gly Pro Gly Gln Ala Asp Cys Ala Val Ala Ile Gly     1205 1210 1215 Arg Pro Leu Gly Glu Val Val Thr Leu Arg Val Leu Glu Ser Ser     1220 1225 1230 Leu Asn Cys Ser Ala Gly Asp Met Leu Leu Leu Trp Gly Arg Leu     1235 1240 1245 Thr Trp Arg Lys Met Cys Arg Lys Leu Leu Asp Met Thr Phe Ser     1250 1255 1260 Ser Lys Thr Asn Thr Leu Val Val Arg Gln Arg Cys Gly Arg Pro     1265 1270 1275 Gly Gly Gly Val Leu Leu Arg Tyr Gly Ser Gln Leu Ala Pro Glu     1280 1285 1290 Thr Phe Tyr Arg Glu Cys Asp Met Gln Leu Phe Gly Pro Trp Gly     1295 1300 1305 Glu Ile Val Ser Pro Ser Leu Ser Pro Ala Thr Ser Asn Ala Gly     1310 1315 1320 Gly Cys Arg Leu Phe Ile Asn Val Ala Pro His Ala Arg Ile Ala     1325 1330 1335 Ile His Ala Leu Ala Thr Asn Met Gly Ala Gly Thr Glu Gly Ala     1340 1345 1350 Asn Ala Ser Tyr Ile Leu Ile Arg Asp Thr His Ser Leu Arg Thr     1355 1360 1365 Thr Ala Phe His Gly Gln Gln Val Leu Tyr Trp Glu Ser Glu Ser     1370 1375 1380 Ser Gln Ala Glu Met Glu Phe Ser Glu Gly Phe Leu Lys Ala Gln     1385 1390 1395 Ala Ser Leu Arg Gly Gln Tyr Trp Thr Leu Gln Ser Trp Val Pro     1400 1405 1410 Glu Met Gln Asp Pro Gln Ser Trp Lys Gly Lys Glu Gly Thr     1415 1420 1425 <210> 3 <211> 4933 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (445) .. (4728) <400> 3 aaccacgatg tctttggcac agcctctcat ctgtcagatg ggagcgggga ccccggagag 60 ggagtcagcc gaggtcctgg cattccttgt gaacccccgt ctgtgggttt ctggtccagt 120 gtcccttctc cagattagat ggcttaggcc tcctctaagg gggtgggcgt gcacatccgg 180 agagctgtct ggtgtgcagg actgggctgc aggttaccct gaactgcaac catcttagag 240 caaggcccag cttgcagcag gaggagctgc aggccgccca ccctagccac ggcccctgcc 300 ctggcaggaa gcttccaaga gtaaacactg cctaatcgtc ccgcccagta gtgagcaggc 360 ctgtcccatt ccatactgac cagattccca gtcaccaagg ccccctctca ctccgctcca 420 ctcctcgggc tggctctcct gagg atg cac cag cgt cac ccc cgg gca aga 471                            Met His Gln Arg His Pro Arg Ala Arg                            1 5 tgc cct ccc ctc tgt gtg gcc gga atc ctt gcc tgt ggc ttt ctc ctg 519 Cys Pro Pro Leu Cys Val Ala Gly Ile Leu Ala Cys Gly Phe Leu Leu 10 15 20 25 ggc tgc tgg gga ccc tcc cat ttc cag cag agt tgt ctt cag gct ttg 567 Gly Cys Trp Gly Pro Ser His Phe Gln Gln Ser Cys Leu Gln Ala Leu                 30 35 40 gag cca cag gcc gtg tct tct tac ttg agc cct ggt gct ccc tta aaa 615 Glu Pro Gln Ala Val Ser Ser Tyr Leu Ser Pro Gly Ala Pro Leu Lys             45 50 55 ggc cgc cct cct tcc cct ggc ttc cag agg cag agg cag agg cag agg 663 Gly Arg Pro Pro Ser Pro Gly Phe Gln Arg Gln Arg Gln Arg Gln Arg         60 65 70 cgg gct gca ggc ggc atc cta cac ctg gag ctg ctg gtg gcc gtg ggc 711 Arg Ala Ala Gly Gly Ile Leu His Leu Glu Leu Leu Val Ala Val Gly     75 80 85 ccc gat gtc ttc cag gct cac cag gag gac aca gag cgc tat gtg ctc 759 Pro Asp Val Phe Gln Ala His Gln Glu Asp Thr Glu Arg Tyr Val Leu 90 95 100 105 acc aac ctc aac atc ggg gca gaa ctg ctt cgg gac ccg tcc ctg ggg 807 Thr Asn Leu Asn Ile Gly Ala Glu Leu Leu Arg Asp Pro Ser Leu Gly                 110 115 120 gct cag ttt cgg gtg cac ctg gtg aag atg gtc att ctg aca gag cct 855 Ala Gln Phe Arg Val His Leu Val Lys Met Val Ile Leu Thr Glu Pro             125 130 135 gag ggt gct cca aat atc aca gcc aac ctc acc tcg tcc ctg ctg agc 903 Glu Gly Ala Pro Asn Ile Thr Ala Asn Leu Thr Ser Ser Leu Leu Ser         140 145 150 gtc tgt ggg tgg agc cag acc atc aac cct gag gac gac acg gat cct 951 Val Cys Gly Trp Ser Gln Thr Ile Asn Pro Glu Asp Asp Thr Asp Pro     155 160 165 ggc cat gct gac ctg gtc ctc tat atc act agg ttt gac ctg gag ttg 999 Gly His Ala Asp Leu Val Leu Tyr Ile Thr Arg Phe Asp Leu Glu Leu 170 175 180 185 cct gat ggt aac cgg cag gtg cgg ggc gtc acc cag ctg ggc ggt gcc 1047 Pro Asp Gly Asn Arg Gln Val Arg Gly Val Thr Gln Leu Gly Gly Ala                 190 195 200 tgc tcc cca acc tgg agc tgc ctc att acc gag gac act ggc ttc gac 1095 Cys Ser Pro Thr Trp Ser Cys Leu Ile Thr Glu Asp Thr Gly Phe Asp             205 210 215 ctg gga gtc acc att gcc cat gag att ggg cac agc ttc ggc ctg gag 1143 Leu Gly Val Thr Ile Ala His Glu Ile Gly His Ser Phe Gly Leu Glu         220 225 230 cac gac ggc gcg ccc ggc agc ggc tgc ggc ccc agc gga cac gtg atg 1191 His Asp Gly Ala Pro Gly Ser Gly Cys Gly Pro Ser Gly His Val Met     235 240 245 gct tcg gac ggc gcc gcg ccc cgc gcc ggc ctc gcc tgg tcc ccc tgc 1239 Ala Ser Asp Gly Ala Ala Pro Arg Ala Gly Leu Ala Trp Ser Pro Cys 250 255 260 265 agc cgc cgg cag ctg ctg agc ctg ctc agc gca gga cgg gcg cgc tgc 1287 Ser Arg Arg Gln Leu Leu Ser Leu Leu Ser Ala Gly Arg Ala Arg Cys                 270 275 280 gtg tgg gac ccg ccg cgg cct caa ccc ggg tcc gcg ggg cac ccg ccg 1335 Val Trp Asp Pro Pro Arg Pro Gln Pro Gly Ser Ala Gly His Pro Pro             285 290 295 gat gcg cag cct ggc ctc tac tac agc gcc aac gag cag tgc cgc gtg 1383 Asp Ala Gln Pro Gly Leu Tyr Tyr Ser Ala Asn Glu Gln Cys Arg Val         300 305 310 gcc ttc ggc ccc aag gct gtc gcc tgc acc ttc gcc agg gag cac ctg 1431 Ala Phe Gly Pro Lys Ala Val Ala Cys Thr Phe Ala Arg Glu His Leu     315 320 325 gat atg tgc cag gcc ctc tcc tgc cac aca gac ccg ctg gac caa agc 1479 Asp Met Cys Gln Ala Leu Ser Cys His Thr Asp Pro Leu Asp Gln Ser 330 335 340 345 agc tgc agc cgc ctc ctc gtt cct ctc ctg gat ggg aca gaa tgt ggc 1527 Ser Cys Ser Arg Leu Leu Val Pro Leu Leu Asp Gly Thr Glu Cys Gly                 350 355 360 gtg gag aag tgg tgc tcc aag ggt cgc tgc cgc tcc ctg gtg gag ctg 1575 Val Glu Lys Trp Cys Ser Lys Gly Arg Cys Arg Ser Leu Val Glu Leu             365 370 375 acc ccc ata gca gca gtg cat ggg cgc tgg tct agc tgg ggt ccc cga 1623 Thr Pro Ile Ala Ala Val His Gly Arg Trp Ser Ser Trp Gly Pro Arg         380 385 390 agt cct tgc tcc cgc tcc tgc gga gga ggt gtg gtc acc agg agg cgg 1671 Ser Pro Cys Ser Arg Ser Cys Gly Gly Gly Val Val Thr Arg Arg Arg     395 400 405 cag tgc aac aac ccc aga cct gcc ttt ggg ggg cgt gca tgt gtt ggt 1719 Gln Cys Asn Asn Pro Arg Pro Ala Phe Gly Gly Arg Ala Cys Val Gly 410 415 420 425 gct gac ctc cag gcc gag atg tgc aac act cag gcc tgc gag aag acc 1767 Ala Asp Leu Gln Ala Glu Met Cys Asn Thr Gln Ala Cys Glu Lys Thr                 430 435 440 cag ctg gag ttc atg tcg caa cag tgc gcc agg acc gac ggc cag ccg 1815 Gln Leu Glu Phe Met Ser Gln Gln Cys Ala Arg Thr Asp Gly Gln Pro             445 450 455 ctg cgc tcc tcc cct ggc ggc gcc tcc ttc tac cac tgg ggt gct gct 1863 Leu Arg Ser Ser Pro Gly Gly Ala Ser Phe Tyr His Trp Gly Ala Ala         460 465 470 gta tca cac agc caa ggg gat gct ctg tgc aga cac atg tgc cgg gcc 1911 Val Ser His Ser Gln Gly Asp Ala Leu Cys Arg His Met Cys Arg Ala     475 480 485 att ggc gag agc ttc atc atg aag cgt gga gac agc ttc ctc gat ggg 1959 Ile Gly Glu Ser Phe Ile Met Lys Arg Gly Asp Ser Phe Leu Asp Gly 490 495 500 505 acc cgg tgt atg cca agt ggc ccc cgg gag gac ggg acc ctg agc ctg 2007 Thr Arg Cys Met Pro Ser Gly Pro Arg Glu Asp Gly Thr Leu Ser Leu                 510 515 520 tgt gtg tcg ggc agc tgc agg aca ttt ggc tgt gat ggt agg atg gac 2055 Cys Val Ser Gly Ser Cys Arg Thr Phe Gly Cys Asp Gly Arg Met Asp             525 530 535 tcc cag cag gta tgg gac agg tgc cag gtg tgt ggt ggg gac aac agc 2103 Ser Gln Gln Val Trp Asp Arg Cys Gln Val Cys Gly Gly Asp Asn Ser         540 545 550 acg tgc agc cca cgg aag ggc tct ttc aca gct ggc aga gcg aga gaa 2151 Thr Cys Ser Pro Arg Lys Gly Ser Phe Thr Ala Gly Arg Ala Arg Glu     555 560 565 tat gtc acg ttt ctg aca gtt acc ccc aac ctg acc agt gtc tac att 2199 Tyr Val Thr Phe Leu Thr Val Thr Pro Asn Leu Thr Ser Val Tyr Ile 570 575 580 585 gcc aac cac agg cct ctc ttc aca cac ttg gcg gtg agg atc gga ggg 2247 Ala Asn His Arg Pro Leu Phe Thr His Leu Ala Val Arg Ile Gly Gly                 590 595 600 cgc tat gtc gtg gct ggg aag atg agc atc tcc cct aac acc acc tac 2295 Arg Tyr Val Val Ala Gly Lys Met Ser Ile Ser Pro Asn Thr Thr Tyr             605 610 615 ccc tcc ctc ctg gag gat ggt cgt gtc gag tac aga gtg gcc ctc acc 2343 Pro Ser Leu Leu Glu Asp Gly Arg Val Glu Tyr Arg Val Ala Leu Thr         620 625 630 gag gac cgg ctg ccc cgc ctg gag gag atc cgc atc tgg gga ccc ctc 2391 Glu Asp Arg Leu Pro Arg Leu Glu Glu Ile Arg Ile Trp Gly Pro Leu     635 640 645 cag gaa gat gct gac atc cag gtt tac agg cgg tat ggc gag gag tat 2439 Gln Glu Asp Ala Asp Ile Gln Val Tyr Arg Arg Tyr Gly Glu Glu Tyr 650 655 660 665 ggc aac ctc acc cgc cca gac atc acc ttc acc tac ttc cag cct aag 2487 Gly Asn Leu Thr Arg Pro Asp Ile Thr Phe Thr Tyr Phe Gln Pro Lys                 670 675 680 cca cgg cag gcc tgg gtg tgg gcc gct gtg cgt ggg ccc tgc tcg gtg 2535 Pro Arg Gln Ala Trp Val Trp Ala Ala Val Arg Gly Pro Cys Ser Val             685 690 695 agc tgt ggg gca ggg ctg cgc tgg gta aac tac agc tgc ctg gac cag 2583 Ser Cys Gly Ala Gly Leu Arg Trp Val Asn Tyr Ser Cys Gly Leu Asp Gln         700 705 710 gcc agg aag gag ttg gtg gag act gtc cag tgc caa ggg agc cag cag 2631 Ala Arg Lys Glu Leu Val Glu Thr Val Gln Cys Gln Gly Ser Gln Gln     715 720 725 cca cca gcg tgg cca gag gcc tgc gtg ctc gaa ccc tgc cct ccc tac 2679 Pro Pro Ala Trp Pro Glu Ala Cys Val Leu Glu Pro Cys Pro Pro Tyr 730 735 740 745 tgg gcg gtg gga gac ttc ggc cca tgc agc gcc tcc tgt ggg ggc ggc 2727 Trp Ala Val Gly Asp Phe Gly Pro Cys Ser Ala Ser Cys Gly Gly Gly                 750 755 760 ctg cgg gag cgg cca gtg cgc tgc gtg gag gcc cag ggc agc ctc ctg 2775 Leu Arg Glu Arg Pro Val Arg Cys Val Glu Ala Gln Gly Ser Leu Leu             765 770 775 aag aca ttg ccc cca gcc cgg tgc aga gca ggg gcc cag cag cca gct 2823 Lys Thr Leu Pro Pro Ala Arg Cys Arg Ala Gly Ala Gln Gln Pro Ala         780 785 790 gtg gcg ctg gaa acc tgc aac ccc cag ccc tgc cct gcc agg tgg gag 2871 Val Ala Leu Glu Thr Cys Asn Pro Gln Pro Cys Pro Ala Arg Trp Glu     795 800 805 gtg tca gag ccc agc tca tgc aca tca gct ggt gga gca ggc ctg gcc 2919 Val Ser Glu Pro Ser Ser Cys Thr Ser Ala Gly Gly Ala Gly Leu Ala 810 815 820 825 ttg gag aac gag acc tgt gtg cca ggg gca gat ggc ctg gag gct cca 2967 Leu Glu Asn Glu Thr Cys Val Pro Gly Ala Asp Gly Leu Glu Ala Pro                 830 835 840 gtg act gag ggg cct ggc tcc gta gat gag aag ctg cct gcc cct gag 3015 Val Thr Glu Gly Pro Gly Ser Val Asp Glu Lys Leu Pro Ala Pro Glu             845 850 855 ccc tgt gtc ggg atg tca tgt cct cca ggc tgg ggc cat ctg gat gcc 3063 Pro Cys Val Gly Met Ser Cys Pro Pro Gly Trp Gly His Leu Asp Ala         860 865 870 acc tct gca ggg gag aag gct ccc tcc cca tgg ggc agc atc agg acg 3111 Thr Ser Ala Gly Glu Lys Ala Pro Ser Pro Trp Gly Ser Ile Arg Thr     875 880 885 ggg gct caa gct gca cac gtg tgg acc cct gcg gca ggg tcg tgc tcc 3159 Gly Ala Gln Ala Ala His Val Trp Thr Pro Ala Ala Gly Ser Cys Ser 890 895 900 905 gtc tcc tgc ggg cga ggt ctg atg gag ctg cgt ttc ctg tgc atg gac 3207 Val Ser Cys Gly Arg Gly Leu Met Glu Leu Arg Phe Leu Cys Met Asp                 910 915 920 tct gcc ctc agg gtg cct gtc cag gaa gag ctg tgt ggc ctg gca agc 3255 Ser Ala Leu Arg Val Pro Val Gln Glu Glu Leu Cys Gly Leu Ala Ser             925 930 935 aag cct ggg agc cgg cgg gag gtc tgc cag gct gtc ccg tgc cct gct 3303 Lys Pro Gly Ser Arg Arg Glu Val Cys Gln Ala Val Pro Cys Pro Ala         940 945 950 cgg tgg cag tac aag ctg gcg gcc tgc agc gtg agc tgt ggg aga ggg 3351 Arg Trp Gln Tyr Lys Leu Ala Ala Cys Ser Val Ser Cys Gly Arg Gly     955 960 965 gtc gtg cgg agg atc ctg tat tgt gcc cgg gcc cat ggg gag gac gat 3399 Val Val Arg Arg Ile Leu Tyr Cys Ala Arg Ala His Gly Glu Asp Asp 970 975 980 985 ggt gag gag atc ctg ttg gac acc cag tgc cag ggg ctg cct cgc ccg 3447 Gly Glu Glu Ile Leu Leu Asp Thr Gln Cys Gln Gly Leu Pro Arg Pro                 990 995 1000 gaa ccc cag gag gcc tgc agc ctg gag ccc tgc cca cct agg tgg 3492 Glu Pro Gln Glu Ala Cys Ser Leu Glu Pro Cys Pro Pro Arg Trp             1005 1010 1015 aaa gtc atg tcc ctt ggc cca tgt tcg gcc agc tgt ggc ctt ggc 3537 Lys Val Met Ser Leu Gly Pro Cys Ser Ala Ser Cys Gly Leu Gly             1020 1025 1030 act gct aga cgc tcg gtg gcc tgt gtg cag ctc gac caa ggc cag 3582 Thr Ala Arg Arg Ser Val Ala Cys Val Gln Leu Asp Gln Gly Gln             1035 1040 1045 gac gtg gag gtg gac gag gcg gcc tgt gcg gcg ctg gtg cgg ccc 3627 Asp Val Glu Val Asp Glu Ala Ala Cys Ala Ala Leu Val Arg Pro             1050 1055 1060 gag gcc agt gtc ccc tgt ctc att gcc gac tgc acc tac cgc tgg 3672 Glu Ala Ser Val Pro Cys Leu Ile Ala Asp Cys Thr Tyr Arg Trp             1065 1070 1075 cat gtt ggc acc tgg atg gag tgc tct gtt tcc tgt ggg gat ggc 3717 His Val Gly Thr Trp Met Glu Cys Ser Val Ser Cys Gly Asp Gly             1080 1085 1090 atc cag cgc cgg cgt gac acc tgc ctc gga ccc cag gcc cag gcg 3762 Ile Gln Arg Arg Arg Asp Thr Cys Leu Gly Pro Gln Ala Gln Ala             1095 1100 1105 cct gtg cca gct gat ttc tgc cag cac ttg ccc aag ccg gtg act 3807 Pro Val Pro Ala Asp Phe Cys Gln His Leu Pro Lys Pro Val Thr             1110 1115 1120 gtg cgt ggc tgc tgg gct ggg ccc tgt gtg gga cag ggt acg ccc 3852 Val Arg Gly Cys Trp Ala Gly Pro Cys Val Gly Gln Gly Thr Pro             1125 1130 1135 agc ctg gtg ccc cac gaa gaa gcc gct gct cca gga cgg acc aca 3897 Ser Leu Val Pro His Glu Glu Ala Ala Ala Pro Gly Arg Thr Thr             1140 1145 1150 gcc acc cct gct ggt gcc tcc ctg gag tgg tcc cag gcc cgg ggc 3942 Ala Thr Pro Ala Gly Ala Ser Leu Glu Trp Ser Gln Ala Arg Gly             1155 1160 1165 ctg ctc ttc tcc ccg gct ccc cag cct cgg cgg ctc ctg ccc ggg 3987 Leu Leu Phe Ser Pro Ala Pro Gln Pro Arg Arg Leu Leu Pro Gly             1170 1175 1180 ccc cag gaa aac tca gtg cag tcc agt gcc tgt ggc agg cag cac 4032 Pro Gln Glu Asn Ser Val Gln Ser Ser Ala Cys Gly Arg Gln His             1185 1190 1195 ctt gag cca aca gga acc att gac atg cga ggc cca ggg cag gca 4077 Leu Glu Pro Thr Gly Thr Ile Asp Met Arg Gly Pro Gly Gln Ala             1200 1205 1210 gac tgt gca gtg gcc att ggg cgg ccc ctc ggg gag gtg gtg acc 4122 Asp Cys Ala Val Ala Ile Gly Arg Pro Leu Gly Glu Val Val Thr             1215 1220 1225 ctc cgc gtc ctt gag agt tct ctc aac tgc agt gcg ggg gac atg 4167 Leu Arg Val Leu Glu Ser Ser Leu Asn Cys Ser Ala Gly Asp Met             1230 1235 1240 ttg ctg ctt tgg ggc cgg ctc acc tgg agg aag atg tgc agg aag 4212 Leu Leu Leu Trp Gly Arg Leu Thr Trp Arg Lys Met Cys Arg Lys             1245 1250 1255 ctg ttg gac atg act ttc agc tcc aag acc aac acg ctg gtg gtg 4257 Leu Leu Asp Met Thr Phe Ser Ser Lys Thr Asn Thr Leu Val Val             1260 1265 1270 agg cag cgc tgc ggg cgg cca gga ggt ggg gtg ctg ctg cgg tat 4302 Arg Gln Arg Cys Gly Arg Pro Gly Gly Gly Val Leu Leu Arg Tyr             1275 1280 1285 ggg agc cag ctt gct cct gaa acc ttc tac aga gaa tgt gac atg 4347 Gly Ser Gln Leu Ala Pro Glu Thr Phe Tyr Arg Glu Cys Asp Met             1290 1295 1300 cag ctc ttt ggg ccc tgg ggt gaa atc gtg agc ccc tcg ctg agt 4392 Gln Leu Phe Gly Pro Trp Gly Glu Ile Val Ser Pro Ser Leu Ser             1305 1310 1315 cca gcc acg agt aat gca ggg ggc tgc cgg ctc ttc att aat gtg 4437 Pro Ala Thr Ser Asn Ala Gly Gly Cys Arg Leu Phe Ile Asn Val             1320 1325 1330 gct ccg cac gca cgg att gcc atc cat gcc ctg gcc acc aac atg 4482 Ala Pro His Ala Arg Ile Ala Ile His Ala Leu Ala Thr Asn Met             1335 1340 1345 ggc gct ggg acc gag gga gcc aat gcc agc tac atc ttg atc cgg 4527 Gly Ala Gly Thr Glu Gly Ala Asn Ala Ser Tyr Ile Leu Ile Arg             1350 1355 1360 gac acc cac agc ttg agg acc aca gcg ttc cat ggg cag cag gtg 4572 Asp Thr His Ser Leu Arg Thr Thr Ala Phe His Gly Gln Gln Val             1365 1370 1375 ctc tac tgg gag tca gag agc agc cag gct gag atg gag ttc agc 4617 Leu Tyr Trp Glu Ser Glu Ser Ser Gln Ala Glu Met Glu Phe Ser             1380 1385 1390 gag ggc ttc ctg aag gct cag gcc agc ctg cgg ggc cag tac tgg 4662 Glu Gly Phe Leu Lys Ala Gln Ala Ser Leu Arg Gly Gln Tyr Trp             1395 1400 1405 acc ctc caa tca tgg gta ccg gag atg cag gac cct cag tcc tgg 4707 Thr Leu Gln Ser Trp Val Pro Glu Met Gln Asp Pro Gln Ser Trp             1410 1415 1420 aag gga aag gaa gga acc tga gggtcattga acatttgttc cgtgtctggc 4758 Lys Gly Lys Glu Gly Thr             1425 cagccctgga gggttgaccc ctggtctcag tgctttccaa ttcgaacttt ttccaatctt 4818 aggtatctac tttagagtct tctccaatgt ccaaaaggct agggggttgg aggtggggac 4878 tctggaaaag cagcccccat ttcctcgggt accaataaat aaaacatgca ggctg 4933 <210> 4 <211> 1427 <212> PRT <213> Homo sapiens <400> 4 Met His Gln Arg His Pro Arg Ala Arg Cys Pro Pro Leu Cys Val Ala 1 5 10 15 Gly Ile Leu Ala Cys Gly Phe Leu Leu Gly Cys Trp Gly Pro Ser His             20 25 30 Phe Gln Gln Ser Cys Leu Gln Ala Leu Glu Pro Gln Ala Val Ser Ser         35 40 45 Tyr Leu Ser Pro Gly Ala Pro Leu Lys Gly Arg Pro Pro Ser Pro Gly     50 55 60 Phe Gln Arg Gln Arg Gln Arg Gln Arg Arg Ala Ala Gly Gly Ile Leu 65 70 75 80 His Leu Glu Leu Leu Val Ala Val Gly Pro Asp Val Phe Gln Ala His                 85 90 95 Gln Glu Asp Thr Glu Arg Tyr Val Leu Thr Asn Leu Asn Ile Gly Ala             100 105 110 Glu Leu Leu Arg Asp Pro Ser Leu Gly Ala Gln Phe Arg Val His Leu         115 120 125 Val Lys Met Val Ile Leu Thr Glu Pro Glu Gly Ala Pro Asn Ile Thr     130 135 140 Ala Asn Leu Thr Ser Ser Leu Leu Ser Val Cys Gly Trp Ser Gln Thr 145 150 155 160 Ile Asn Pro Glu Asp Asp Thr Asp Pro Gly His Ala Asp Leu Val Leu                 165 170 175 Tyr Ile Thr Arg Phe Asp Leu Glu Leu Pro Asp Gly Asn Arg Gln Val             180 185 190 Arg Gly Val Thr Gln Leu Gly Gly Ala Cys Ser Pro Thr Trp Ser Cys         195 200 205 Leu Ile Thr Glu Asp Thr Gly Phe Asp Leu Gly Val Thr Ile Ala His     210 215 220 Glu Ile Gly His Ser Phe Gly Leu Glu His Asp Gly Ala Pro Gly Ser 225 230 235 240 Gly Cys Gly Pro Ser Gly His Val Met Ala Ser Asp Gly Ala Ala Pro                 245 250 255 Arg Ala Gly Leu Ala Trp Ser Pro Cys Ser Arg Arg Gln Leu Leu Ser             260 265 270 Leu Leu Ser Ala Gly Arg Ala Arg Cys Val Trp Asp Pro Pro Arg Pro         275 280 285 Gln Pro Gly Ser Ala Gly His Pro Pro Asp Ala Gln Pro Gly Leu Tyr     290 295 300 Tyr Ser Ala Asn Glu Gln Cys Arg Val Ala Phe Gly Pro Lys Ala Val 305 310 315 320 Ala Cys Thr Phe Ala Arg Glu His Leu Asp Met Cys Gln Ala Leu Ser                 325 330 335 Cys His Thr Asp Pro Leu Asp Gln Ser Ser Cys Ser Arg Leu Leu Val             340 345 350 Pro Leu Leu Asp Gly Thr Glu Cys Gly Val Glu Lys Trp Cys Ser Lys         355 360 365 Gly Arg Cys Arg Ser Leu Val Glu Leu Thr Pro Ile Ala Ala Val His     370 375 380 Gly Arg Trp Ser Ser Trp Gly Pro Arg Ser Pro Cys Ser Arg Ser Cys 385 390 395 400 Gly Gly Gly Val Val Thr Arg Arg Arg Gln Cys Asn Asn Pro Arg Pro                 405 410 415 Ala Phe Gly Gly Arg Ala Cys Val Gly Ala Asp Leu Gln Ala Glu Met             420 425 430 Cys Asn Thr Gln Ala Cys Glu Lys Thr Gln Leu Glu Phe Met Ser Gln         435 440 445 Gln Cys Ala Arg Thr Asp Gly Gln Pro Leu Arg Ser Ser Pro Gly Gly     450 455 460 Ala Ser Phe Tyr His Trp Gly Ala Ala Val Ser His Ser Gln Gly Asp 465 470 475 480 Ala Leu Cys Arg His Met Cys Arg Ala Ile Gly Glu Ser Phe Ile Met                 485 490 495 Lys Arg Gly Asp Ser Phe Leu Asp Gly Thr Arg Cys Met Pro Ser Gly             500 505 510 Pro Arg Glu Asp Gly Thr Leu Ser Leu Cys Val Ser Gly Ser Cys Arg         515 520 525 Thr Phe Gly Cys Asp Gly Arg Met Asp Ser Gln Gln Val Trp Asp Arg     530 535 540 Cys Gln Val Cys Gly Gly Asp Asn Ser Thr Cys Ser Pro Arg Lys Gly 545 550 555 560 Ser Phe Thr Ala Gly Arg Ala Arg Glu Tyr Val Thr Phe Leu Thr Val                 565 570 575 Thr Pro Asn Leu Thr Ser Val Tyr Ile Ala Asn His Arg Pro Leu Phe             580 585 590 Thr His Leu Ala Val Arg Ile Gly Gly Arg Tyr Val Val Ala Gly Lys         595 600 605 Met Ser Ile Ser Pro Asn Thr Thr Tyr Pro Ser Leu Leu Glu Asp Gly     610 615 620 Arg Val Glu Tyr Arg Val Ala Leu Thr Glu Asp Arg Leu Pro Arg Leu 625 630 635 640 Glu Glu Ile Arg Ile Trp Gly Pro Leu Gln Glu Asp Ala Asp Ile Gln                 645 650 655 Val Tyr Arg Arg Tyr Gly Glu Glu Tyr Gly Asn Leu Thr Arg Pro Asp             660 665 670 Ile Thr Phe Thr Tyr Phe Gln Pro Lys Pro Arg Gln Ala Trp Val Trp         675 680 685 Ala Ala Val Arg Gly Pro Cys Ser Val Ser Cys Gly Ala Gly Leu Arg     690 695 700 Trp Val Asn Tyr Ser Cys Leu Asp Gln Ala Arg Lys Glu Leu Val Glu 705 710 715 720 Thr Val Gln Cys Gln Gly Ser Gln Gln Pro Pro Ala Trp Pro Glu Ala                 725 730 735 Cys Val Leu Glu Pro Cys Pro Pro Tyr Trp Ala Val Gly Asp Phe Gly             740 745 750 Pro Cys Ser Ala Ser Cys Gly Gly Gly Leu Arg Glu Arg Pro Val Arg         755 760 765 Cys Val Glu Ala Gln Gly Ser Leu Leu Lys Thr Leu Pro Pro Ala Arg     770 775 780 Cys Arg Ala Gly Ala Gln Gln Pro Ala Val Ala Leu Glu Thr Cys Asn 785 790 795 800 Pro Gln Pro Cys Pro Ala Arg Trp Glu Val Ser Glu Pro Ser Ser Cys                 805 810 815 Thr Ser Ala Gly Gly Ala Gly Leu Ala Leu Glu Asn Glu Thr Cys Val             820 825 830 Pro Gly Ala Asp Gly Leu Glu Ala Pro Val Thr Glu Gly Pro Gly Ser         835 840 845 Val Asp Glu Lys Leu Pro Ala Pro Glu Pro Cys Val Gly Met Ser Cys     850 855 860 Pro Pro Gly Trp Gly His Leu Asp Ala Thr Ser Ala Gly Glu Lys Ala 865 870 875 880 Pro Ser Pro Trp Gly Ser Ile Arg Thr Gly Ala Gln Ala Ala His Val                 885 890 895 Trp Thr Pro Ala Ala Gly Ser Cys Ser Val Ser Cys Gly Arg Gly Leu             900 905 910 Met Glu Leu Arg Phe Leu Cys Met Asp Ser Ala Leu Arg Val Pro Val         915 920 925 Gln Glu Glu Leu Cys Gly Leu Ala Ser Lys Pro Gly Ser Arg Arg Glu     930 935 940 Val Cys Gln Ala Val Pro Cys Pro Ala Arg Trp Gln Tyr Lys Leu Ala 945 950 955 960 Ala Cys Ser Val Ser Cys Gly Arg Gly Val Val Arg Arg Ile Leu Tyr                 965 970 975 Cys Ala Arg Ala His Gly Glu Asp Asp Gly Glu Glu Ile Leu Leu Asp             980 985 990 Thr Gln Cys Gln Gly Leu Pro Arg Pro Glu Pro Gln Glu Ala Cys Ser         995 1000 1005 Leu Glu Pro Cys Pro Pro Arg Trp Lys Val Met Ser Leu Gly Pro     1010 1015 1020 Cys Ser Ala Ser Cys Gly Leu Gly Thr Ala Arg Arg Ser Val Ala     1025 1030 1035 Cys Val Gln Leu Asp Gln Gly Gln Asp Val Glu Val Asp Glu Ala     1040 1045 1050 Ala Cys Ala Ala Leu Val Arg Pro Glu Ala Ser Val Pro Cys Leu     1055 1060 1065 Ile Ala Asp Cys Thr Tyr Arg Trp His Val Gly Thr Trp Met Glu     1070 1075 1080 Cys Ser Val Ser Cys Gly Asp Gly Ile Gln Arg Arg Arg Asp Thr     1085 1090 1095 Cys Leu Gly Pro Gln Ala Gln Ala Pro Val Pro Ala Asp Phe Cys     1100 1105 1110 Gln His Leu Pro Lys Pro Val Thr Val Arg Gly Cys Trp Ala Gly     1115 1120 1125 Pro Cys Val Gly Gln Gly Thr Pro Ser Leu Val Pro His Glu Glu     1130 1135 1140 Ala Ala Ala Pro Gly Arg Thr Thr Ala Thr Pro Ala Gly Ala Ser     1145 1150 1155 Leu Glu Trp Ser Gln Ala Arg Gly Leu Leu Phe Ser Pro Ala Pro     1160 1165 1170 Gln Pro Arg Arg Leu Leu Pro Gly Pro Gln Glu Asn Ser Val Gln     1175 1180 1185 Ser Ser Ala Cys Gly Arg Gln His Leu Glu Pro Thr Gly Thr Ile     1190 1195 1200 Asp Met Arg Gly Pro Gly Gln Ala Asp Cys Ala Val Ala Ile Gly     1205 1210 1215 Arg Pro Leu Gly Glu Val Val Thr Leu Arg Val Leu Glu Ser Ser     1220 1225 1230 Leu Asn Cys Ser Ala Gly Asp Met Leu Leu Leu Trp Gly Arg Leu     1235 1240 1245 Thr Trp Arg Lys Met Cys Arg Lys Leu Leu Asp Met Thr Phe Ser     1250 1255 1260 Ser Lys Thr Asn Thr Leu Val Val Arg Gln Arg Cys Gly Arg Pro     1265 1270 1275 Gly Gly Gly Val Leu Leu Arg Tyr Gly Ser Gln Leu Ala Pro Glu     1280 1285 1290 Thr Phe Tyr Arg Glu Cys Asp Met Gln Leu Phe Gly Pro Trp Gly     1295 1300 1305 Glu Ile Val Ser Pro Ser Leu Ser Pro Ala Thr Ser Asn Ala Gly     1310 1315 1320 Gly Cys Arg Leu Phe Ile Asn Val Ala Pro His Ala Arg Ile Ala     1325 1330 1335 Ile His Ala Leu Ala Thr Asn Met Gly Ala Gly Thr Glu Gly Ala     1340 1345 1350 Asn Ala Ser Tyr Ile Leu Ile Arg Asp Thr His Ser Leu Arg Thr     1355 1360 1365 Thr Ala Phe His Gly Gln Gln Val Leu Tyr Trp Glu Ser Glu Ser     1370 1375 1380 Ser Gln Ala Glu Met Glu Phe Ser Glu Gly Phe Leu Lys Ala Gln     1385 1390 1395 Ala Ser Leu Arg Gly Gln Tyr Trp Thr Leu Gln Ser Trp Val Pro     1400 1405 1410 Glu Met Gln Asp Pro Gln Ser Trp Lys Gly Lys Glu Gly Thr     1415 1420 1425 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially       synthesized primer sequence <400> 5 tgaggccaca cccacatctt g 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: an artificially       synthesized primer sequence <400> 6 atgccagagc ctgaaccact t 21

[Brief description of drawings]

FIG. 1: 18 in exon 12 of ADAMTS13 gene
The polymorphic base sequence in which c at position 67 is t and the corresponding codon is serine, and the amino acid sequence encoded by the base sequence are shown. The t at the 1867th position is shown in capital letters and marked with an arrow. In addition, the corresponding codon Ser is shown surrounded by a line.

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C12Q 1/02 C12Q 1/37 4H045 1/37 1/68 A 1/68 G01N 33/15 Z G01N 33 / 15 33/50 Z 33/50 33/53 D 33/53 C12N 15/00 ZNAA (72) Inventor Yoshihiro Fujimura 133-1 Sugawaracho, Nara City, Nara Prefecture (72) Yuhei Kono 5-Tsukumodai, Suita City, Osaka Prefecture 10 D46-104 F-term (reference) 2G045 AA40 DA36 FB03 4B024 AA11 BA14 CA04 CA05 CA09 CA11 DA02 EA02 EA04 GA11 GA18 HA03 HA14 4B050 CC01 CC03 DD11 LL03 LL10 4B063 QA01 QA12 QA18 QQ03 QQ20 QQ42 QQ53 QR07 QR08 QR16 QR22 QR32 QR38 QR42 QR55 QR57 QR59 QR62 QR67 QR69 QR77 QR80 QR82 QS12 QS25 QS34 QS39 QX01 4C084 AA01 AA18 MA02 NA14 ZA541 4H045 AA10 AA11 AA30 BA10 CA40 DA75 DA86 DA89 EA50 FA74

Claims (18)

[Claims] 1. A test for a predisposition to thrombus formation, which comprises the step of collecting a biological sample from a subject and analyzing the sample to detect a polymorphism in exon 12 of the ADAMTS13 gene that causes a decrease in the activity of VWF-cleaving enzyme. Method. 2. The test method according to claim 1, wherein the polymorphism is the polymorphism at position 1867 in the nucleotide sequence of SEQ ID NO: 1. 3. The test method according to claim 2, wherein the polymorphism is a polymorphism in which proline at position 475 in the amino acid sequence of SEQ ID NO: 2 is mutated to serine. 4. The test method according to claim 3, wherein the polymorphism is a substitution of c at position 1867 in the base sequence shown in SEQ ID NO: 1. 5. A method for examining a predisposition factor for thrombus formation, which comprises the following steps (a) to (c). 1867 in the nucleotide sequence of SEQ ID NO: 1 in which (a) a step of collecting a biological sample from a subject, (b) any of genomic DNA, mRNA, and amplification products thereof contained in the biological sample Contacting with a probe that hybridizes to a region containing a base sequence in which the base corresponding to position c is replaced by t under hybridizable conditions, and (c)
Step of associating probe hybridization in step (b) with thrombus formation propensity 6. The inspection method according to claim 5, including the following steps (a ′) to (c ′). (A ') a step of collecting a biological sample from the subject, (b')
Any of genomic DNA, mRNA, and amplification products thereof contained in a biological sample can be hybridized with a probe which hybridizes to a region corresponding to c at position 1867 in the nucleotide sequence of SEQ ID NO: 1. Contacting under conditions, and (c ') associating the probe hybridization in steps (b) and (b') with a thrombus-prone predisposition 7. A method for examining a predisposition factor for thrombus formation, which comprises the following steps (a) to (c). (A) a step of collecting a biological sample from a subject; (b) a protein containing an amino acid sequence in which proline at position 475 in the amino acid sequence of SEQ ID NO: 2 is mutated to serine contained in the biological sample; Detecting, and (c) correlating the presence of a protein in which proline at position 475 is mutated to serine with a predisposition to thrombus formation 8. The inspection method according to claim 7, including the following steps (a ′) to (c ′). (A ') a step of collecting a biological sample from the subject, (b')
A step of detecting a protein having the amino acid sequence set forth in SEQ ID NO: 2 contained in the biological sample, and (c ′) 4
The step of associating the presence of a protein in which the proline at position 75 is mutated to serine and the protein having the amino acid sequence of SEQ ID NO: 2 with a predisposition to thrombus formation 9. In the base sequence of SEQ ID NO: 1, 18
DN consisting of a nucleotide sequence containing a region corresponding to c at position 67
A, or its complementary strand, which hybridizes to at least
A test reagent for predisposition to thrombus formation, which comprises an oligonucleotide having a chain length of 15 nucleotides. 10. 1 in the nucleotide sequence of SEQ ID NO: 1
D consisting of a nucleotide sequence containing a region corresponding to c at position 867
A test reagent for predisposition to thrombus formation, comprising a primer set for amplifying NA by PCR. 11. A test reagent for thrombosis-prone predisposition, which comprises an antibody that binds to a protein containing an amino acid sequence in which proline at position 475 in the amino acid sequence of SEQ ID NO: 2 is mutated to serine. 12. A protein containing an amino acid sequence in which proline at position 475 is mutated to serine in the amino acid sequence of SEQ ID NO: 2 is immunologically distinguished from a protein consisting of the amino acid sequence of SEQ ID NO: 2. Antibody to do. 13. A method for evaluating the action of increasing the VWF-cleaving enzyme activity of a test compound, which comprises the following steps (a) to (d). (A) a step of providing a protein containing an amino acid sequence in which proline at position 475 is mutated to serine in the amino acid sequence of SEQ ID NO: 2 and / or a cell expressing the protein, (b) the protein and / or A step of contacting a test compound with cells, and (c) a step of detecting the VWF-cleaving enzyme activity in the protein and / or the cell with which the test compound is contacted, and correlating it with the action of increasing the VWF-cleaving enzyme activity of the test compound 14. A method for screening a drug candidate compound for increasing the VWF-cleaving enzyme activity of a test compound, which comprises the following steps (1) and (2). (1) By the method according to claim 13,
A step of evaluating an effect of increasing VWF-cleaving enzyme activity, and a step of selecting a test compound having a larger effect evaluated in (2) and (1) than the activity when the test compound is not contacted 15. A VWF-cleaving enzyme activity enhancer comprising a mutation of proline at position 475 to serine in the amino acid sequence of SEQ ID NO: 2, which comprises the compound selected by the screening method of claim 14. . 16. An antiplatelet pharmaceutical composition comprising a compound selected by the screening method according to claim 14 and a drug that induces a thrombus formation tendency, in which side effects of a thrombus formation tendency are reduced. 17. A polynucleotide comprising the protein coding region of the nucleotide sequence set forth in SEQ ID NO: 3. 18. The protein according to (A) or (B) below. (A) a protein having the amino acid sequence set forth in SEQ ID NO: 4 (B) selected from the amino acid sequences set forth in SEQ ID NO: 4 and including the serine at position 475 and including an amino acid sequence consisting of at least 7 consecutive amino acids protein