JP2003204784A - Recombinant production of new polyketide - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a genetically engineered cell and a new polyketide and effectively produce both the new and a known polyketides utilizing a recombinant technique. <P>SOLUTION: This cell comprises a nucleic acid encoding a plurality of modules of modular polyketide synthases (PKSs) and introduced thereinto. Each module comprises at least a PKS acyltransferase (AT) activity, a PKS ketoacyl carrier protein synthase (KS) activity and a PKS acyl carrier protein (ACP) activity and the introduced nucleotide sequence encoding the PKS modules is operatively linked to at least one control sequence. Thereby, the cell is capable of producing functional modular PKSs. At least one of the nucleotide sequence encoding the modules corresponding to the functional mudular PKSs or at least one of the control sequence is heterologous to the host cell. <P>COPYRIGHT: (C)2003,JPO

Description

DETAILED DESCRIPTION OF THE INVENTION [0001] TECHNICAL FIELD (Cross-reference of related applications)
Request for US Patent Application filed on December 8, 1993
No. 08 / 164,301, a continuation-in-part application
Patent application No. 08 / 164,301 was filed in September 1993.
U.S. patent application Ser. No. 08 / 123,73, filed on the 20th.
No. 2 continuation application (from this application, U.S. Pat.
Priority is claimed under Article 0).
The entire disclosure is incorporated herein by reference. [0002] BACKGROUND OF THE INVENTION (Technical Field) The present invention generally relates to
It relates to tide and polyketide synthases. More specific
The present invention then employs a novel host-vector system,
It relates to recombinant production of polyketide. BACKGROUND OF THE INVENTION Polyketides are natural products
A large, structurally diverse family. Polykechi
Has a wide range of properties, including antibiotic and pharmacological properties.
Has biological activity. For example, polyketides are
Antibiotics such as cyclin and erythromycin,
Anticancer containing daunomycin
Agents, immunosuppressants (eg, FK506 and Rapamisi
(Rapamycin), as well as veterinary production
Products (eg, monensin and
Represented by avermectin)
It is. Polyketides are present in most types of microorganisms and
Is particularly abundant in actinomycetes, a class of mycelial bacteria.
You. This actinomycete produces various polyketides. [0004] Polyketide synthase (PKS) is a fat
A multifunctional enzyme related to acid synthase (FAS)
You. PKS is an acylthioester (usually acetyl,
Between propionyl, malonyl or methylmalonyl)
Through repeated Claisen condensation (decarboxylation)
Catalyze the biosynthesis of polyketides. Following each condensation,
These are at the β-keto group of the growing polyketide chain.
Reduction circuits including keto reduction, dehydration, and enoyl reduction
Catalyze all, some, or none
This introduces a structural change into the product. Carbon chain
After growing to the characteristic length of each particular product,
Is a synthase by thiolysis or acyl transfer
Is released. Therefore, PKS is a defined polyketide
Consists of a family of enzymes that work together to produce
It is. Contributes to the changes seen in naturally occurring polyketides
Are the genetically programmed chains of each PKS
The choice of length, chain building units, and controlled variation of the reduction circuit
It is. [0005] There are two general classes of PKS.
One class, known as Type I PKS, is Erythro
PKS for macrolides like mycin
expressed. These "complexes" or "modules (m
Odular) "PKS is a multi-function large tank
Including the assembly of protein,
In between, for each step of carbon chain assembly and modification
With a separate set of active sites (Cortes,
J. Et al., Nature (1990) 348: 176; D
onadio, S.M. Et al., Science (1991) 2
52: 675; MacNeil, D .; J. Et al., Gene
(1992) 115: 119). This structural diversity
From changes in the number and type of active sites in PKSs.
Occurs in the class. PKS of this class is 1 of PKS
Number of active sites in the next sequence and clustering and polyke
It shows a one-to-one relationship with the tide skeleton. [0006] A second class of PKS is the type II P
Called KS, by the synthase for aromatic compounds
Be represented. Type II PKS is a single set of anti-
Has an active site that can be used again (Bibbb, M .;
J. EMBO J. et al. (1989) 8: 2727; S
Herman, D .; H. Et al., EMBOJ. (1989)
8: 2717; Fernandez-Moreno,
M. A. J. et al. Biol. Chem. (1992) 2
67: 19278). [0007] Streptomyces is an aromatic poly
Actinomycetes, a mass producer of ketides. To date
In each Streptomyces aromatic PKS studied
Has three open readings in the carbon chain assembly
Requires the product of a frame (ORF). ORF1
Are keto synthase (KS) and acyl transfer
ORF2 encodes the active site of Rase (AT);
Encodes a protein similar to the product of ORF1
Lacks the KS and AT motifs; and ORF3
Encodes another acyl carrier protein (ACP)
I do. [0008] Streptomyces coelic
color is a blue-colored polyketide acti
It produces actinorhodin. A
Cutinorhodin gene cluster (act) is cloned
(Malpartida, F. and Hopwo)
o.d. A. Nature (1984) 309: 4.
62; Malpartida, F .; And Hopwood
d, D. A. Mol. Gen. Genet. (198
6) 205: 66), and completely sequenced (F
ernandez-Moreno, M .; A. J. et al. B
iol. Chem. (1992) 267: 19278;
Hallam, S.M. E. FIG. Et al., Gene (1988) 7
4: 305; Fernandez-Moreno, M .;
A. Et al., Cell (1991) 66: 769; Caba.
llero, J .; Et al., Mol. Gen. Genet.
(1991) 230: 401). This cluster is
PKS enzymes, cyclases and
A series of processes involved in a continuous modification reaction leading to actinorhodin
Regulatory enzymes and proteins involved in the export of this antibiotic
Specifically activates transcription of proteins and this gene cluster
Encodes at least one protein to be converted. Anti
Overall control of biosynthesis of biomaterials, as well as polyketide production
The starting material for synthesis (acetyl-CoA) and elongation material
Ronyl CoA) Other artifacts needed for the supply of units
The gene is located elsewhere in the genome. S. act remains from coelicolor
The gene cluster is S. Actinoro in parvulus
It has been used to produce gin. Malpart
ida, F .; And Hopwood, D .; A. Nat
ure (1984) 309: 462). Bartel et al.
(J. Bacteriol. (1990) 172: 48.
16-4826) has four loci, actI, act
III, actIV and actVII. c
Transformation with oelicolor act gene cluster
S. aloe sapo using galilaeus
Naline (alesaponarin) by recombination
Produced. Contains the basic act gene, but granaticin
(Granaticin), oxytetracycline,
Tetracenomycin
PKS of frenolicin and frenolicin
Hybrid PKS with ACP gene
Designed, these express functional synthases
obtain. Khosla, C et al. Bacteriol.
(1993) 175: 2197-2204. Hopwo
o.d. A. (Nature (1985) 31)
4: 642-644) is a hybrid using recombinant technology.
Describes the production of polyketides. Sherma
n, D. H. (J. Bacteriol. (199)
2) 174: 6184-6190) is a transformer,
S. The corresponding grana from violaceorber
Act PKS inheritance using thycin (gra) gene
Various S. americans lacking different components of the child cluster co
transformation of the elicolor mutant has been reported. However, until now, virtually native
Genetic manipulation that lacks all natural PKS gene clusters
Recombinant production of polyketides using isolated host cells is described.
Not. [0011] SUMMARY OF THE INVENTION The present invention provides a novel polycarbonate
And new polyketides using recombinant technology.
And the efficient production of both known and polyketides.
Make it an issue. [0012] Means for Solving the Problems In one aspect, a book
The invention relates to the polyketide synthase (PKS) gene class
Expression in its native, untransformed state
A genetically modified cell, wherein said genetically modified cell
Introduces virtually all native PKS gene clusters
For cells that lack. In a preferred embodiment, the present invention provides an
A genetically engineered cell, which is a nuclear cell. In a further preferred embodiment, the present invention
Is the genetically engineered cell, which is an actinomycete. In a further preferred embodiment, the present invention
Is an actinomycete belonging to the genus Streptomyces,
Genetically modified cells. In a further preferred embodiment, the present invention
Is Streptomyces coelicolor
The genetically engineered cell is: In a further preferred embodiment, the present invention
Is the all native actinorhodin PKS gene class
Genetically engineered cells that are substantially devoid of protein. In a further preferred embodiment, the present invention
Is the genetically engineered cell equivalent to strain CH999.
Vesicles. In a preferred embodiment, the present invention relates to
Any of the above genetically engineered cells, wherein: (A) encodes a PKS capable of catalyzing the synthesis of a polyketide
A replacement PKS gene cluster; and (b) the PK
One or operably linked to the S gene cluster
A further regulatory sequence, whereby this gene
This gene in the cluster is
Control sequences that can be transcribed and translated at
Replacement PKS gene cluster is the entire PKS gene set
At least one PKS gene or control
The component is a cell that is heterologous to this cell. In a further preferred embodiment, the present invention
Indicates that the substituted PKS gene cluster is a PKS ketosi.
Of Peptide and PKS acyltransferase
The first gene encoding the site (KS / AT), PKS
A second gene encoding a chain length determinant (CLF)
PKS acyl carrier protein (ACP)
Genetically modified cells containing a third gene to be loaded
It is. In a further preferred embodiment, the present invention
Indicates that the replacement PKS gene cluster is
A fourth gene encoding ketoreductase (KR)
The genetically engineered cells. In a further preferred embodiment, the present invention
Indicates that the replacement PKS gene cluster is
Contains a fifth gene encoding cyclase (CYC)
That is, the genetically engineered cells. In a further preferred embodiment, the present invention
Indicates that the replacement PKS gene cluster is
The above, comprising the sixth gene encoding dehydratase;
Genetically modified cells. In a further preferred embodiment, the present invention
Means that the PKS KS / AT gene is actinorhodin
KS / AT gene, granaticin KS / AT gene, te
Tracenomycin KS / AT gene, frenolicin B
KS / AT gene, oxytetracycline KS / A
From the T gene and the glyceusin KS / AT gene
Derived from the PKS KS / AT gene selected from the group
The genetically engineered cells. In a further preferred embodiment, the present invention
Is that the PKS CLF gene is actinorhodin CL
F gene, granaticin CLF gene, tetracenomy
Syn CLF gene, frenolicin B CLF gene,
Xytetracycline CLF gene, and griseus
PKS CL selected from the group consisting of CLF genes
The genetically engineered cells derived from the F gene. In a further preferred embodiment, the present invention
Indicates that the PKS ACP gene is an actinorhodin AC
P gene, granaticin ACP gene, tetracenomy
Syn ACP gene, frenolicin B ACP gene,
Xytetracycline ACP gene, and griseus
PKS AC selected from the group consisting of ACP genes
The genetically engineered cells derived from the P gene. In a further preferred embodiment, the present invention
Indicates that the PKS KR gene is an actinorhodin KR gene.
Gene, granaticin KR gene, tetracenomycin K
R gene, frenolicin B KR gene, oxytetra
Cyclin KR gene and glycesin KR gene
Derived from a PKS KR gene selected from the group consisting of
The genetically engineered cells. In a further preferred embodiment, the present invention
Is that each of the first, second and third genes is
The genetically engineered cells contained in another expression cassette
It is. In a further preferred embodiment, the present invention
Indicates that the other expression cassette is present in a single vector.
The genetically engineered cells. In a further preferred embodiment, the present invention
Means that the other expression cassette is two or more vectors
The genetically engineered cells present in the vector. In a further preferred embodiment, the present invention
Indicates that the replacement gene cluster is a PKS acyltran
First gene encoding spherase (AT), PK
S ketoacyl carrier protein synthase (KS)
Encoding second gene, PKS acyl carrier protein
PKS Keto, a third gene encoding protein (ACP)
PK, a fourth gene encoding reductase (KR)
A fifth gene encoding S dehydratase (DH),
Sixth encoding PKS enoyl reductase (ER)
And a gene encoding thioesterase (TE)
A genetically engineered cell comprising a seventh gene,
You. In a further preferred embodiment, the present invention
Means that the gene is 6-deoxyerythronolide B synth
The above-mentioned genetic manipulations derived from the
Cells. [0033] In one aspect, the present invention provides a recombinant polypeptide.
A method for producing liqutide, comprising: (A) providing a population of any of the above cells; and
And (b) the replacement PKS gene cluster present in this cell
Culture of this population of cells under conditions in which
The method comprising: [0034] In one aspect, the present invention provides a recombinant polypeptide.
A method for producing liqutide, comprising: a. Donor First Part of Replaced PKS Gene Cluster
PKS gene cluster inserted into plasmid and replaced
Inserting the second part of the plasmid into the receptor plasmid.
Here, the first and second parts are completely
Collectively encode the replacement PKS gene cluster,
here: i. This donor plasmid carries the first selectable marker.
Can be replicated at a first permissive temperature, and
Expresses a gene that cannot replicate at room temperature; ii. This receptor plasmid carries a second selectable marker.
Express the encoding gene; and iii. This donor plasmid is used for homologous recombination.
This first part of the replacement PKS gene cluster and this replacement
What happens between this second part of the PKS gene cluster and
So that the DNA region in this receptor plasmid
Contains a region of complementary DNA, which allows for complete replacement
A step in which a gene cluster can be generated; b. The donor plasmid and the acceptor plasmid
To a host cell and the first permissive temperature
And the first and / or the second selection marker
Under conditions that allow the growth of host cells expressing the
Culturing the transformed host cells to produce a first population of cells;
Forming step; c. A second non-permissible temperature and the first and / or
Conditions for growing cells expressing the second selectable marker.
Culturing this first population of cells under a
Producing a population of
Includes a recombinant plasmid containing the S-substituted gene cluster
Including host cells; d. A recombinant plasmid from this second population of cells is
Transformed into the genetically engineered cells,
Producing a genetically modified cell; and e. The transformed, genetically engineered cells are
This replacement PKS gene cluster present in cells
Culturing under the conditions presented, And a method comprising: In a preferred embodiment, the present invention
After the step (c), the first allowable temperature and the second
Conditions for Proliferating Cells Expressing One Selectable Marker
And culturing the second population of cells.
The above method. In a preferred embodiment, the invention relates to
The first and second PKS gene clusters.
The part is the 6-deoxyerythronolide B synthase gene
The above method derived from a child cluster. In a preferred embodiment, the invention relates to
A polyketide produced by any of the methods described above.
You. [0038] In one aspect, the present invention provides a recombinant vector
And the following: (A) D containing the module replacement PKS gene cluster
NA sequence; and (b) operably linked to this DNA sequence.
Control element that is linked to the DNA
The sequence can be transcribed and translated in the host cell, and at least
One of the regulatory elements is heterologous to the nucleotide sequence.
A recombinant vector comprising certain regulatory elements. In a preferred embodiment, the invention relates to
The replacement gene cluster is 6-deoxyerythronori.
The recombinant B, which is
Is a doctor. [0040] In one aspect, the present invention provides
PCK7. In a preferred embodiment, the present invention relates to
A host cell transformed with any of the vectors described above.
You. In one aspect, the present invention provides the following:
Model: [0043] Embedded image The polyketide compound having
And R¹Is selected from the group consisting of hydrogen and lower alkyl.
Selected and R²Is hydrogen, lower alkyl, and lower
Selected from the group consisting of primary alkyl esters, or
R¹And R²Is optionally one to four hydroxyl groups
Or a lower alkylene bridge substituted with a lower alkyl group
Together; R³And R⁵The water independently
Element, halogen, lower alkyl, lower alkoxy, amine
, Lower alkyl mono- or di-substituted amino, and
And nitro; R⁴Is a haloge
, Lower alkyl, lower alkoxy, amino, lower alkyl
From killed mono- or di-substituted amino and nitro
Selected from the group consisting of: R⁶Is halogen, lower alkyl
And -CHR⁷-(CO) R⁸Selected from the group consisting of
Where R⁷And R⁸Is, independently, hydrogen
And lower alkyl; and i
Is a polyketide compound which is 1, 2, or 3
You. In a preferred embodiment, the present invention provides
¹Is lower alkyl; R², R ³, And R⁵But water
Prime; R⁶Is -CHR⁷-(CO) -R⁸Is;
And the compound wherein i is 0. In a preferred embodiment, the present invention provides
¹Is methyl and R⁶Is -CH₂-(CO)-
CH₃The above compound is In a preferred embodiment, the present invention provides
¹And R⁶Is lower alkyl; R², R³, And
And R⁵Is hydrogen; and i is 0
It is. In a preferred embodiment, the invention relates to
¹And R⁶Is methyl. In a preferred embodiment, the present invention provides
¹And R²Are linked together to form a lower alkylene bridge
-CHR⁹-CHR¹⁰Where R⁹and
R^{1 0}Is independently hydrogen, hydroxyl, and lower
The above compound selected from the group consisting of alkyl.
You. In a preferred embodiment, the present invention provides
¹And R²Are linked together to form a lower alkylene bridge
-CH₂The above compound which forms -CHOH-. In a preferred embodiment, the invention relates to
³And R⁵Is hydrogen; and i is 0,
Compound. In a further preferred embodiment, the present invention
Is R⁶Is -CHR⁷-(CO) -R⁸And here
And R⁸Is hydrogen or lower alkyl;
It is. In a further preferred embodiment, the present invention
Is R⁶Is -CH₂-(CO) -CH₃Is the above
It is a compound. In a further preferred embodiment, the present invention
Is R⁶Is a lower alkyl. In a further preferred embodiment, the present invention
Is R⁶Is methyl. In one aspect, the present invention provides the following:
Model: [0057] Embedded image The present invention relates to a polyketide compound having In one aspect, the present invention provides the following:
Model: [0060] Embedded image The present invention relates to a polyketide compound having In one aspect, the present invention provides the following:
Construction: [0063] Embedded image By catalytic cyclization of an enzyme-linked ketide having
Regarding the polyketide compound formed, where R
¹¹Is methyl, -CH₂(CO) CH₃And -CH
₂(CO) CH₂(CO) CH₃Selected from the group consisting of
R¹²Is -SE and -CH₂(CO) -S-
Selected from the group consisting of E;
Polyketide synthase produced by the engineered cells
Represents, R^ThirteenAnd R¹⁴One of which is hydrogen,
And the other is hydroxyl, or R^ThirteenAnd R
¹⁴And polyketide, taken together to represent carbonyl
Compound. In a preferred embodiment, the present invention provides
¹¹Is methyl and R¹²Is -CH₂(CO)
The above compound, which is -SE. In a preferred embodiment, the present invention provides
¹¹Is -CH₂(CO) CH₃And R¹²But
The above compound, which is -SE. In a preferred embodiment, the present invention relates to
¹¹Is -CH₂(CO) CH₃And R¹²But
-CH₂The above compound, which is (CO) -SE. In a preferred embodiment, the present invention provides
¹¹Is -CH₂(CO) CH₂(CO) CH₃And
And R¹²Is -CH₂(CO) -SE, the above
Compound. In a preferred embodiment, the present invention relates to
^ThirteenAnd R¹⁴One of is hydrogen and the other
Is the above compound, wherein is hydroxyl. In a preferred embodiment, the present invention relates to
^ThirteenAnd R¹⁴Together form a carboxyl moiety
And the above compound. In one aspect, the present invention provides the following:
Model: [0072] Embedded image The polyketide compound having
And R²The moieties are independently hydrogen, lower alkyl, and
And lower alkyl esters; R
⁴Is halogen, lower alkyl, lower alkoxy,
, Lower alkyl mono- or di-substituted amino, and
And nitro; and i is 0,
1 or 2, which is a polyketide compound. In a preferred embodiment, the present invention relates to
²Is hydrogen, and i is 0.
You. In one aspect, the present invention provides the following:
Model: [0076] Embedded image The polyketide compound having
And R²The moieties are independently hydrogen, lower alkyl, and
And lower alkyl esters; R
⁴Is halogen, lower alkyl, lower alkoxy,
, Lower alkyl mono- or di-substituted amino, and
And nitro; and i is 0,
1 or 2, which is a polyketide compound. In a preferred embodiment, the present invention relates to
²Is hydrogen, and i is 0.
You. In one aspect, the present invention provides the following:
Model: [0080] Embedded image The polyketide compound having
And R²The moieties are independently hydrogen, lower alkyl, and
And lower alkyl esters; R
⁴Is halogen, lower alkyl, lower alkoxy,
, Lower alkyl mono- or di-substituted amino, and
And nitro; and i is 0,
1 or 2, which is a polyketide compound. In a preferred embodiment, the present invention provides
²Is hydrogen, and i is 0.
You. In one aspect, the present invention provides the following:
Model: [0084] Embedded image A polyketide compound having In one aspect, the present invention provides the following:
Model: [0087] Embedded image A polyketide compound having In one aspect, the present invention provides the following:
Model: [0090] Embedded image And a polyketide compound having [0092] In one aspect, the present invention provides an aromatic polyether
A method for producing ricketides, having the following structure: [0093] Embedded imageCyclizing an enzyme-linked ketide having
Wherein R¹¹Is methyl,-
CH₂(CO) CH₃And -CH₂(CO) CH
₂(CO) CH₃Selected from the group consisting of: R
¹²Is -SE and -CH₂From (CO) -SE
Is selected from the group consisting of:
Represents a polyketide synthase produced by the cells,
R^ThirteenAnd R¹⁴One of which is hydrogen, and the other
Is hydroxyl or R^ThirteenAnd R¹⁴And
Together, they represent a carbonyl, where cyclization is
It is a method induced by ricketide synthase. In a preferred embodiment, the present invention provides
¹¹Is methyl and R¹²Is -CH₂(CO)
The above method, wherein the method is -SE. In a preferred embodiment, the present invention relates to
¹¹Is -CH₂(CO) CH₃And R¹²But
The above method, wherein the method is -SE. In a preferred embodiment, the present invention relates to
¹¹Is -CH₂(CO) CH₃And R¹²But
-CH₂The above method, wherein the method is (CO) -SE. In a preferred embodiment, the present invention provides
¹¹Is -CH₂(CO) CH₂(CO) CH₃And
And R¹²Is -CH₂(CO) -SE, the above
Is the way. In a preferred embodiment, the present invention provides
^ThirteenAnd R¹⁴One of is hydrogen and the other
Is a hydroxyl group. In a preferred embodiment, the present invention relates to
^ThirteenAnd R¹⁴Together form a carboxyl moiety
This is the method described above. [0101] DETAILED DESCRIPTION OF THE INVENTION (Summary of the Invention)
Riketides and new polyketides using recombinant technology
New, which effectively produce both
Provide a regular method. More specifically, the novel host
Use vector systems to catalyze the production of various polyketides
A PKS is also made. Such polyketides are
As a biomaterial, antitumor agent, immunosuppressant, and a wide range of others
Useful for pharmacological purposes. Therefore, in one embodiment, the present invention
Ming is a polyketide synthase (PKS) gene cluster
Expression in its native, untransformed state.
Regarding the genetically engineered cells, the genetically engineered cells
Virtually all native PKS gene clusters are missing
Have been. In another embodiment, the present invention provides a method as described above.
For genetically engineered cells, where the cells are:
(A) encodes a PKS capable of catalyzing the synthesis of a polyketide
The replacement PKS gene cluster; and (b) the PKS gene cluster.
One or operably linked to a KS gene cluster
Is a further regulatory sequence, which
The genes in the offspring cluster are located in this engineered cell.
A control sequence, which can be transcribed and translated at
PKS gene cluster contains the entire PKS gene set
Sometimes at least one PKS gene or regulatory element
The element is different from this cell. In a particularly preferred embodiment, the gene
The manipulated cells are Streptomyces coe
licolor and the cells are substantially native
Complete actinorhodin PKS gene cluster missing
And the replacement PKS gene cluster
Activities of synthase and PKS acyltransferase
First gene encoding sex site (KS / AT), PK
A second gene encoding an S chain length determinant (CLF),
And PKS acyl carrier protein (ACP)
A third gene to be loaded. In another embodiment, the present invention provides
A method for producing a polyketide
Comprises the following steps: (A) providing a population of the above cells; and (b)
The replacement PKS gene cluster present in this cell is expressed
Culturing a population of cells under the conditions to be performed. In still another embodiment, the present invention
Relates to a method for producing recombinant polyketides.
Comprises the following steps: a. Donor First Part of Replaced PKS Gene Cluster
PKS gene cluster inserted into plasmid and replaced
Inserting the second part of the plasmid into the receptor plasmid.
Here, the first and second parts are completely
Collectively encode the replacement PKS gene cluster,
here: i. This donor plasmid carries the first selectable marker.
Can be replicated at a first permissive temperature, and
Expresses a gene that cannot replicate at room temperature; ii. This receptor plasmid carries a second selectable marker.
Express the encoding gene; and iii. This donor plasmid contains a homologous recombination
First part of KS gene cluster and replacement gene class
As may occur with the second part of the receptor
Includes a region of DNA complementary to the DNA region in the plasmid
This produces a complete replacement gene cluster.
Steps that can be performed; b. The donor and acceptor plasmids
Transforming the primary cells and a first permissive temperature;
Host expressing first and / or second selectable marker
Under transformed cell conditions, transform the transformed host cells.
Culturing to produce a first population of cells; c. A second non-permissible temperature and a first and / or second
For growing host cells expressing different selectable markers
Culturing the first population of cells to produce a second collection of cells.
Producing a population of cells, wherein the cells comprise complete PKS
Contains recombinant plasmids containing replacement gene clusters
Including a host cell. d. Claiming recombinant plasmids from the second population of cells
Transfected into the genetically engineered cells of item 1 and transformed;
Producing a genetically modified cell; and e. The transformed, genetically engineered cells can be
In which the substituted PKS gene cluster present in Escherichia coli is expressed
Culturing under conditions. In still another embodiment, the present invention provides
Relates to a polyketide compound having the structural formula (I): [0108] Embedded image Here, R¹Is hydrogen and lower alkyl
And R is selected from the group consisting of²Is hydrogen, lower
Select from the group consisting of alkyl and lower alkyl esters
Or R¹And R²Is one to four hydro
Lower optionally substituted with a xyl group or a lower alkyl group
Forming an alkylene bridge together;³And R⁵Is
Independently hydrogen, halogen, lower alkyl, lower alcohol
Xy, amino, lower alkyl mono- or di-substituted
Selected from the group consisting of mino and nitro; R⁴Is
Halogen, lower alkyl, lower alkoxy, amino, low
Primary alkyl mono- or di-substituted amino and nitro
Selected from the group consisting of: R⁶Is hydrogen, lower alkyl
And -CHR⁷-(CO) R⁸Selected from the group consisting of
Where R⁷And R⁸Is, independently, hydrogen
And lower alkyl; and i
Is 1, 2, or 3. In another embodiment, the present invention provides:
Regarding the novel polyketide having the structure: [0111] Embedded image [0112] Embedded imageIn another embodiment, the present invention provides a method comprising:
Formation by catalytic cyclization of an enzyme-linked ketide having (II)
Regarding the compound polyketide used: [0114] Embedded image Here, R¹¹Is methyl, -CH₂(C
O) CH₃And -CH₂(CO) CH₂(CO) CH
₃Selected from the group consisting of: R¹²Are -SE and
And -CH₂(CO) -SE selected from the group consisting of:
Here, E is produced by the genetically engineered cells.
And R represents a polyketide synthase;^Thirteenand
R¹⁴One is hydrogen and the other is hydroxy
Syl or R^ThirteenAnd R¹⁴Are both Carbo
Represents nil. In yet another embodiment, the present invention
Relates to a method for producing an aromatic polyketide, comprising:
Performs the cyclization of an enzyme-linked ketide having the structure (II)
Cyclization to polyketide synthase
More induced. In a further embodiment, the present invention provides
For a polyketide compound having structural formula (III): [0118] Embedded image Here, R²And R⁴Is defined above
And i is 0, 1 or 2
is there. In another embodiment, the present invention provides a method comprising:
For the polyketide compound having formula (IV): [0121] Embedded image Here, R², R⁴And i are structural formulas
The definition is the same as that for (III). In still another embodiment, the present invention provides
Relates to a polyketide compound having the structural formula (V): [0124] Embedded image Here, R², R⁴And i are structural formulas
The same as defined above for (III)
You. These and other embodiments of the present invention
Given the disclosure in the specification, those skilled in the art can easily make the
Will. (Detailed Description of the Invention)
Chemistry, microbiology, molecular biology and
Utilize conventional methods within the art of recombinant DNA technology.
You. Such techniques are explained fully in the literature.
See, for example, Sambrook et al., Molecular Cl.
oning: A Laboratory Manual
(Latest version); DNA Cloning: A Practi
cal Approach, Volumes I and II (DG
lover edition); Oligonucleotide S
ynthesis (edited by N. Gait, latest edition); Nuc
leic Acid Hybridization
(Edited by B. Hames and S. Higgins, latest
Edition); Transcription and Tran
slation (B. Hames and S. Higgi
ns, latest edition). Regardless of the foregoing or the following,
All publications, patents and patent applications cited in
Is incorporated herein by reference in its entirety.
You. As used herein and in the appended claims.
Singular forms "a", "an" and "the"
Wraps the plural unless the context clearly indicates otherwise.
Include. Therefore, for example, "polyketide (a pol
yketide) ”refers to a mixture of polyketides.
And "polyketide synthase (a polyket).
"ide synthase)" means polyketide
And mixtures of synthases. (A. Definition) In describing the present invention, the following
Terms used and defined as shown below
Is intended. The “substituted PKS gene cluster” is
In the transformed host cell,
Subject to one or more conformance control elements
In some cases, a PKS gene capable of producing functional PKS
Means any set. Functional PKS is polyke
It catalyzes the synthesis of metal. The term "substituted PKS inheritance
“Child cluster” means one or more polyke
Various proteins required to catalyze the production of
Contains genes encoding quality. "Replacement PKS gene class
Stars are all that are found in the corresponding natural cluster
Need not be included. Rather, this gene group
Raster is required to catalyze the production of active polyketides.
It is only necessary to code the required PKS components. So
Therefore, as described further below, this gene
Raster, for example, has 8 genes in their native state
And only three of these genes are active
If necessary to provide liquetide, these three remains
Only the presence of the gene is required. In addition, this cluster
May include a PKS gene from a single species, or
In fact, for example, classes for the synthesis of other polyketides
Specific polynucleotide that is replaced by the corresponding gene from
C with genes from the cluster for the synthesis of tide
It can be an hybrid. Hybrid clusters
From both Ip and Type II PKS
The gene may be included. As described above, type I P
KS encompasses several large multifunctional proteins,
In between, each step of carbon chain assembly and modification
With a separate set of active sites. On the other hand, Thailand
II PKS is a single active site that is used repeatedly.
With a set of These classifications are well known. example
See Hopwood, D .; A. And Khosla,
C. Secondary metabolites: t
hair function and evoluti
on (1992) Wiley Chichester
(Ciba Foundation Symposium
m 171) pp. 88-112; Bibb, M .; J. Et al.,
EMBO J.S. (1989) 8: 2727; Sherm.
an, D .; H. EMBO J. et al. (1989) 8: 2.
717; Fernandez-Moreno, M .; A.
J. et al. Biol. Chem. (1992) 267: 1
9278); Courtes, J .; Et al., Nature (1
990) 348: 176; Donadio, S .; S
science (1991) 252: 675; MacNe.
il, D .; J. Et al., Gene (1992) 115: 11.
9. A hybrid cluster is illustrated here and
And further described below. Included in the gene cluster
The gene does not need to be a native gene, but
These variants or analogs may be used. Mutant or
Analog is one or more of the coding sequences
Can be prepared by deletion, insertion or substitution of nucleotides
You. Techniques for modifying nucleotide sequences (eg,
Mutagenesis is described, for example, in Sambrook et al.
DNA Cloning, Volumes I and II, supra;
Nucleic Acid Hybridizatio
n, described above. The “substituted PKS gene cluster” also
Modifications to core polyketide catalyzed by PKS
Genes, which may include, for example,
For example, hydroxylase, methylase or other alkyla
Enzyme, oxidase, reductase, glycotransfection
Enzyme, lyase, ester synthase or amide
Synthase, and various hydrolases (eg, S
Terases and amidases)
Can be As described further below, replacement genetics
The genes contained in the offspring cluster are located on the same plasmid.
Does not need to be present or is on the same plasmid
Can be controlled by the same or different control sequences
You. "Genetically modified host cells"
Active PKS gene cluster uses recombinant DNA technology
Means a host cell that has been deleted. Souyu
This term does not, however, encompass naturally occurring mutational events.
“Host cells” are prokaryotic microbes cultured as a single cell
Cells from an organism or a eukaryotic cell line,
Receiving a recombinant vector with the PKS gene cluster
It can or has been used as a condition. This
The term refers to the progeny of the original cell that was transfected.
Include. The progeny of a single parent cell may be accidental or intentional
Due to mutation, its morphology or genomic DNA or whole
The DNA complement is not necessarily completely identical to the original parent cell
It is understood that it cannot be obtained. Related properties (eg, desired
Presence of the nucleotide sequence encoding PKS)
Progeny of this parent cell, sufficiently similar to the parent cell to be marked
Are included in this definition and are covered by the above terms
It is. The term “heterologous” means that
When referring to nucleic acid sequences such as sequences and control sequences,
Sequences that would not normally associate with the region of the recombinant construct, and
And / or sequences that do not normally associate with specific cells
You. Therefore, the "heterologous" region of the nucleic acid construct is
Other nuclei not found in natural association with offspring
Identifiable nucleic acids within or bound to acid molecules
Segment. For example, heterogeneous regions of the construct
Found in a state naturally associated with the loading sequence
Include coding sequences flanked by sequences that are not
obtain. Another example of a heterogeneous coding sequence is this code.
Sequence itself (for example, different from the native gene)
(Synthetic sequence with multiple codons)
It is a structure. Similarly, constructs not normally present in the host cell
The host cell transformed with
It is considered a seed. As used herein
Alternatively, an allelic or naturally occurring mutation event is a heterologous D
Does not generate NA. “Coding sequence” or specific PKS
Can be in vitro or in vivo.
And when placed under the control of appropriate regulatory sequences,
Transcribed into peptides (for DNA) and translated
(In the case of mRNA) the nucleic acid sequence. Coding sequence
Borders the 5 '(amino) terminal initiation codon and 3'
Determined by the translation stop codon at the (carboxy) terminus
You. The coding sequence may be prokaryotic or eukaryotic mRNA.
NA-derived cDNA, prokaryotic DNA or eukaryotic DNA
Genomic DNA sequences, and even synthetic DNA sequences
But not limited to these. The transcription termination sequence is
Usually located 3 'of the coding sequence. A “nucleic acid” sequence is a prokaryotic sequence, a eukaryotic mRN.
A, cDNA from eukaryotic mRNA, eukaryotic (eg, mammalian
Classification) Genomic DNA sequence derived from DNA, and synthetic DNA
Even sequences can be included, but are not limited to these. For this
The term also refers to the known base analog of any DNA and RNA.
Include sequences containing logs. These base analogs
Is, for example, 4-acetylcytosine, 8-hydroxy-
N6-methyladenosine, aziridinyl cytosine, pso
Idoisocytosine, 5- (carboxyhydroxylmethyl
L) uracil, 5-fluorouracil, 5-bromoura
Sil, 5-carboxymethylaminomethyl-2-thiou
Lacil, 5-carboxymethylaminomethyluracil,
Dihydrouracil, inosine, N6-isopentenylyl
Denine, 1-methyladenine, 1-methylpseudoura
Syl, 1-methylguanine, 1-methylinosine, 2,
2-dimethylguanine, 2-methyladenine, 2-methyl
Luguanine, 3-methylcytosine, 5-methylcytosine
, N6-methyladenine, 7-methylguanine, 5-
Methylaminomethyluracil, 5-methoxyaminomethyl
Ru-2-thiouracil, β-D-mannosyl cuoshi
(Β-D-mannosylqueosine),
5'-methoxycarbonylmethyluracil, 5-methoxy
Ciuracil, 2-methylthio-N6-isopentenylyl
Denine, uracil-5-oxyacetic acid methyl ester, c
Racyl-5-oxyacetic acid, oxybutoxocin, psoy
Douracil, queosine, 2-
Thiocytosine, 5-methyl-2-thiouracil, 2-thio
Uracil, 4-thiouracil, 5-methyluracil,
N-uracil-5-oxyacetic acid methyl ester, urashi
Le-5-oxyacetic acid, pseudouracil, Cuoshi
, 2-thiocytosine, and 2,6-diaminopurine
But not limited thereto. Transcription termination sequence
Is usually located 3 'of the coding sequence. [0138] DNA "control sequences" refers to promoter sequences.
Sequence, ribosome binding site, polyadenylation signal,
Collection of transcription termination sequence, upstream regulatory domain, enhancer, etc.
Collectively, these are the
Collectively provide transcription and translation of the signaling sequence. Desired
As long as the gene can be transcribed and translated, these regulatory sequences
Need not necessarily be present in the recombinant vector.
No. "Operably linked" refers to the arrangement of elements.
Where the component so described is
They are arranged to perform their normal functions. therefore,
The control sequence operably linked to the coding sequence comprises:
Expression of this coding sequence can be effected. The control array is
As long as they directly affect their expression,
It does not need to be adjacent to a column. So, for example, translated
Not transcribed intervening sequence is a promoter sequence
Between the coding sequence and the promoter
-The sequence is still "operably linked" to the coding sequence.
Have been ". A “selectable marker” is a marker that
A task that can be used to select a population of cells with nom
Mean genetic marker. Examples of selection markers
Is an auxotrophic marker (this marker
Are nutrients or supplements (eg, thymidine, diamino
With or without pimelic acid or biotin)
Selected by ability to grow in minimal medium);
Kerr (this marker allows cells to be the only carbon source
Its ability to grow on minimal media containing appropriate sugars
Or a dye colony containing the appropriate dye or dye substrate.
Selected by the ability of the cells to form cells); and drugs
Substance resistance marker (this marker allows cells to
Or more suitable drugs (eg, tetracycline)
, Ampicillin, kanamycin, streptomycin
Or nalidixic acid)
Selected by ability). “Recombination” refers to the sequence between two DNA molecules.
Reassembly of sections of DNA sequence. "Homologous recombination"
Homologous or complementary nucleotides present in each DNA molecule
Between two DNA molecules that hybridize by sequence
Happens. As used herein, the term “alkyl”
Is a branched or unbranched structure of 1 to 24 carbon atoms
(E.g., methyl, ethyl, n-pro
Pill, isopropyl, n-butyl, isobutyl, t-butyl
Chill, octyl, decyl, tetradecyl, hexadecyl
, Eicosyl, tetraeicosyl, etc.).
Preferred alkyl groups herein are from 1 to 12 carbons
Contains elemental atoms. The term “lower alkyl” refers to
Of 6 carbon atoms, preferably 1 to 4 carbon atoms
Intended for alkyl groups. As used herein, the term “alkyl
Is a difunctional group containing 1 to 24 carbon atoms
Means a saturated branched or unbranched hydrocarbon chain of
This includes, for example, methylene (-CH₂−), Ethylene
(-CH₂-CH₂-), Propylene (-CH₂-CH
₂-CH₂-), 2-methylpropylene [-CH₂-C
H (CH)₃-CH₂-], Hexylene [-(CH₂)
₆−]. “Lower alkylene” means 1
From 6 to 6, more preferably from 1 to 4 carbon atoms.
Means a kylene group. As used herein, the term “alkoxy”
"S" means an atom linked through a single terminal ether bond.
An alkyl group is intended; that is, an "alkoxy" group is
-OR can be defined as where R is as defined above
Alkyl. “Lower alkoxy” groups refer to one to six
, More preferably one containing 1 to 4 carbon atoms.
A lkoxy group is intended. “Halo” or “halogen” refers to fluoro
Intended for b, chloro, bromo or iodo, and
Usually relates to halo substitution of hydrogen atoms in organic compounds. Halo
Of these, chloro and fluoro are generally preferred. "Any" or "arbitrarily" means
The event or situation described may or may not occur
That this event or situation has not occurred.
And examples that do not occur. example
For example, the expression "optionally substituted alkylene" refers to an alkyl
That the ren moiety can be substituted or unsubstituted;
And the specification have unsubstituted alkylene and substitution
Is meant to include both alkylenes. (B. General Method) The core of the present invention is a novel method.
And efficient recombinant production of both known and polyketides.
Discovery of a host-vector system. In particular, the present invention
A gene wherein the naturally occurring PKS gene is substantially deleted
Use the engineered cells. These host cells are
Various PKS gene clusters for production of ricketides
Can be transformed with a recombinant vector encoding Book
The invention provides for the production of large quantities of product at the appropriate stage of the growth cycle.
provide. The polyketide produced in this way is
Depending on the type of polyketide, many diseases may be therapeutic.
It can be used to treat a disease. For example, the method
Some of the polyketides produced are immunosuppressants,
As an antitumor agent, as well as viruses, bacteria and parasites
It finds use for the treatment of infections. Polyketide set
The ability to produce by replacement also depends on PKS and their
Provides powerful tools to characterize the mechanism of action
You. More specifically, recombination of the target polyketide
The host cell for the production is a recombinant PKS gene class.
Derived from any organism capable of hosting
obtain. Therefore, the host cells of the invention can be prokaryotic or
It can be from any eukaryote. But the preferred inn
The main cells are hyphal-type, a large producer of many polyketides
It is constructed from actinomycetes, a class of bacteria.
You. A particularly preferred genus for use with the system of the invention is
Streptomyces. So, for example,
S. ambofaciens, S.A. avermitil
is, S. azureus, S.A. cinnamonen
sis, S.P. coelicolor, S.C. curaco
i, S. erythraeus, S.E. fradiae,
S. galilaeus, S.A. gloussen
s, S.S. hygroscopicus, S .; lived
ans, S.M. parvulus, S.P. peucetiu
s, S.S. rimosus, S .; roseofulvu
s, S.S. thermotolerans, S.M. viol
aceorber et al., a host cell convenient for the present invention.
And among others, S.I. coelicolor is preferred
No. (See, for example, Hopwood, DA and She.
rman, D .; H. Ann. Rev .. Genet. (1
990) 24: 37-66; O'Hagan, D .; Th
e Polyketide Metabolites
(Ellis Horwood Limited, 19
91) Various polyketide producing organisms and their natural
See product description). The cells described above can be prepared using standard techniques (eg, homologous
(By recombination) using naturally occurring cells from this cell
Genetically engineered by deleting the PKS gene
You. (See, for example, Khosla, C. et al., Molec. M.
microbiol. (1992) 6: 3237.
Yo). Illustrated herein are genetically engineered
S. coelicolor host cells. S. coe
Licolor native strains are aromatic polyketides
PK catalyzing the biosynthesis of cutinolodine (structure 3, Fig. 5)
Produce S. The new strain S. coelicolo
r CH999 (FIG. 2C and described in the Examples).
) By homologous recombination. coelicolor
  All natural act clusters from CH1 chromosome are deleted
(Khosla, CM)
olec. Microbiol. (1992) 6:32.
37). This strain lacks the endogenous plasmid and
Colored S. coelicolor antibiotic
Undecylprodigiosin (undecylprodi)
giosin) has a stable mutation that blocks biosynthesis
are doing. [0150] The host cells described above may comprise one or more host cells.
Vector to obtain a functional PK
Collectively code the S sets. This vector contains the PK
Native or hybrid set of S subunits
Combinations or variants thereof may be included. Explained earlier
As shown, the replacement gene cluster
It does not need to match the gene cluster,
Only encoding the necessary PKS components that catalyze production
is necessary. For example, each Str studied to date
In eptomyces aromatic PKS, carbon chain assembly
Li has three open reading frames (ORFs)
Requires the product of ORF1 is a keto synthase
Activity of (KS) and acyltransferase (AT)
Encoding a sex site (KS / AT);
As described, ORF2 is a chain length determinant (CL
F) encodes (protein similar to ORF1 product)
But lacks the KS and AT motifs; and OR
F3 co-locates another acyl carrier protein (ACP)
To load. Some gene clusters also
Ketoreductase (K) involved in cyclization of the polyketide backbone
R) and cyclase. (Three Ps in FIG. 1
(See schematic diagram of KS gene cluster). Only
However, to produce identifiable polyketides, KS /
Only AT, CLF and ACP need to be present
Was found. Therefore, Streptomyce
s-derived aromatic PKS, these three genes
Is one-step, without the other components of the native cluster.
Or more contained in the recombinant vector
A replacement PKS gene cluster may be constructed. Furthermore, the recombinant vector contains a single PKS
May contain genes from the gene cluster, or
Can contain the hybrid substituted PKS gene cluster, eg
For example, this cluster is
The gene is replaced with the corresponding gene from another gene cluster.
Has been replaced. For example, ACP affects product structure
Easily exchange between different synthases without
It has been found that they can be interchanged. Further, the predetermined KR is different
Can recognize and reduce polyketide chains of
You. Accordingly, these genes have been described herein.
Can be freely exchanged in different constructs. Therefore,
Light substitution clusters produce identifiable polyketides
Any of the PKS gene sets that ultimately function to
It can be derived from a combination. Examples of hybrid replacement clusters include 2
One or more act gene clusters, frenoli
Shin (fren), granaticin (gra), tetrase
Nomycin (tcm), 6-methylsalicylic acid (6-m
sas), oxytetracycline (otc), tetra
Cyclin (tet), erythromycin (ery),
Griseusin, Nanaomycin
(Nanamycin), medelmycin (mede
rmycin), daunorubicin (daunorubi)
cin), tyrosine (tylosin), carbomacy
(Carbomycin), spiramycin (spi)
ramycin), avermectin (avermect)
in), monensin, nonactin
(Nonactin), kuramyc (curamyc)
in), rifamycin and
Candicidin synthase inheritance
Clusters with genes derived from offspring clusters
No. (For various PKS discussions,
See Hopwood, D .; A. And Sherman,
D. H. Ann. Rev .. Genet. (1990) 2
4: 37-66; O'Hagan, D .; The Pol
yketide Metabolites (Ellis
  Horwood Limited, 1991).
Let's do it.) More specifically, many hybrid genetics
Child clusters have been constructed herein and these are
And 2, act, fren, tcm and
And components from the gra gene cluster. Go
Some hybrid clusters have coelico
new and known polyketides in lorCH999
Could be functionally expressed (above). But as above
In addition, other hybrid gene clusters are identifiable
For production of polyketides, use the disclosure herein to
It can be easily produced and screened. For example,
Collection of actinomycetes
ORFs 1 and 2 randomly cloned from
A library of homologs can be constructed and identified
Could be screened for different polyketides. Longer
Polyketides also produce PKSs that produce the correct length chains.
A homolog derived from a gene cluster, for example, act,
Place the gra, fren or tcm cyclase gene
By exchange, it could be cyclized. Finally, naturally occurring
Among certain aromatic PKSs, non-acetate starters
-There is a considerable degree of variation in units;
Therefore, these units can also
Can be used to obtain ketides. Further, the recombinant vector is
It may include genes from the PKS gene cluster. That
Such gene clusters are described in more detail below.
You. The recombinant vector having the above-described gene cluster
Is conveniently produced using techniques known in the art.
Can be done. For example, the PKS subunit of interest is PK
Using recombinant methods from organisms expressing the S subunit
Thus, for example, cDNA derived from cells expressing this gene or
Or by screening genomic libraries
Or a vector known to contain this gene
Can be obtained by obtaining this gene from Then
The gene is isolated and standardized using standard techniques.
With the desired PKS subunit. problem
If the gene is already present in the appropriate expression vector,
If it is, for example,
It can be combined in situ as desired. Remains of purpose
Genes are also produced synthetically, rather than cloned.
obtain. The nucleotide sequence is the specific amino acid sequence desired.
Can be designed with the appropriate codons for In general,
Select a codon suitable for the intended host in which the sequence is expressed
Is done. Overlapping oligos prepared by standard methods
The complete sequence is assembled from the nucleotides, and
Assembled into a complete coding sequence. For example,
Edge (1981) Nature 292: 756;
Nambair et al., (1984) Science 22.
3: 1299; Jay et al., (1984) J. Am. Biol.
Chem. 259: 6311. For native PKS subunit sequences
Mutations can be made, and such variants are
Variant works with other PKS subunits
Collectively catalyze the synthesis of obtainable and identifiable polyketides
As long as it can be used instead of the native sequence. That
Such a mutation is, for example, a synthetic oligonucleotide having a mutation.
Prepare otide and perform restriction endonuclease digestion
Used to mutate the gene encoding the PKS subunit
Using the conventional technique by inserting
Live arrays. (For example, Kunkel,
T. A. Proc. Natl. Acad. Sci. US
A (1985) 82: 448; Geisselsode.
et al., BioTechniques (1987) 5: 7.
86). Alternatively, the mutation is a mismatch primer
(Generally 10-20 nucleotides in length).
The primer can be used to bind mismatched duplexes.
Native nucleotide sequence at temperatures below the solution temperature
(Generally cDNA corresponding to RNA sequence)
To This primer has the primer length and
By keeping the base composition within relatively narrow limits, and
Specific production by centering mutant bases
I can do it. Zoller and Smith, Method
sEnzymol. (1983) 100: 468. Plastic
Immer extension is performed using DNA polymerase,
The product is cloned and the primer is
Clones containing the mutated DNA obtained from the isolation of
You. Selection changes as a hybridization probe
This can be done using heterologous primers. This technology also
It can be applied to generate multiple point mutations. For example, D
albie-McFarland et al., Proc. Nat
l. Acad. SciUSA (1982) 79: 640.
See No. 9. PCR mutagenesis also provides the desired mutation.
Will find use. The replacement PKS gene cluster is collectively
The gene sequence to be loaded is determined using a method known to those skilled in the art.
It can be inserted into one or more expression vectors. Departure
The current vector can operate on the desired PKS coding sequence
And a control sequence linked to the function. For use in the present invention
Suitable expression systems for eukaryotic host cells and prokaryotic hosts
Includes systems that function in primary cells. But explained above
Thus, prokaryotic systems are preferred, and in particular, S
Treptomycespp. Is particularly heavy
It is important. The control elements for use in such a system are:
A promoter, optionally containing an operator sequence, and
It contains a bosome binding site. Particularly useful promoters are
P, such as one or more act promoters
Contains control sequences from the KS gene cluster. But,
Galactose, lactose (lac) and maltose
Such as promoters derived from sugar metabolizing enzymes such as
Other bacterial promoters may also be present in the constructs of the invention.
Find use. A further example is tryptophan (tr
p), β-lactamase (bla) promoter system, bac
Biosynthetic enzymes such as Teriophage λPL and T5
Includes promoter sequences from In addition, tac promo
(US Pat. No. 4,551,433).
Synthetic promoters are also not found in nature, but
Functions in host cells. Other regulatory sequences may also be desired,
Regulates the expression of PKS replacement sequences in relation to host cell growth.
Enable clauses. Regulatory sequences are known to those skilled in the art, and
Examples of leverage include gene expression, chemical or physical
(T) in response to a stimulus (including the presence of a modulatory compound)
adjustment to turn on or turn off
Contains an array. Other types of regulatory elements (eg,
Hanser sequence) may also be present in the vector. The selection marker may also be a recombinant expression vector.
May be included within. Useful in selecting transformed cell lines
Yes, and generally cells grow in a suitable selective medium
Phenotype on the transformed cell
Various markers are known, including genes that give So
Markers such as, for example,
Contains genes that confer resistance or sensitivity. Or
Some polyketides are inherently colored and this feature
The signature is a cell that has been successfully transformed with the construct of the present invention.
Native (built-in) markers for selecting vesicles
Offer. The various PKS subunits of interest are
Together with control elements or, for example, control of a single promoter
One or more sets under the control of one cassette
It can be cloned into a replacement vector. PKS Sub Uni
The kit includes other PKS sites, including adjacent restriction sites.
Allows easy deletion and insertion of
As a result, a hybrid PKS can be generated. Such yu
The design of a unique restriction site is known to those skilled in the art, and
As described above, such as site-directed mutagenesis and PCR
Can be achieved using the techniques of Using these techniques, the techniques described herein
New shuttle vector for polyketide production
The normal plasmid pRM5 (FIG. 3 and Example 2) was constructed.
Was. Plasmid pRM5 contains PacI, NsiI and
And KS / AT (ORF) flanked by XbaI restriction sites
1), CLF (ORF2) and ACP (ORF3) P
Contains the act gene encoding the KS subunit. Subordinate
Thus, similar PKS genes encode similar
The (analogous) PKS subunit is present
Act gene can be easily replaced. (For example, parent plastic
Hybrid vector using pRM5 as the sumid
See Example 4 describing the construction). Shuttle plasmid
Also, actKR gene (actIII), cyclase
Gene (actVII), and putative dehydratase
Gene (actIV) and ColEI replicon
(Allows transformation of E. coli), appropriate truncation
Type (truncated) SCP2^*(Low copy number) S
Treptomyces replicon and act class
ActII-ORF4 activator remains from star
Genes (during the transition from growth to stationary phase in vegetative mycelium)
To induce transcription from the act promoter).
pRM5 is a diverse actI / actIII promoter
Have a pair. [0162] The recombinant vector of the present invention is placed in a suitable host.
Methods of introduction are known to those skilled in the art, and are typically
Is CaCl₂Or of a divalent cation and DMSO
And the use of other such agents. DNA is also
Introduced into bacterial cells by electroporation
obtain. Once PKS is expressed, polyketide production
Knee can be identified and isolated using known techniques.
obtain. The polyketide produced is then further characterized
Can be As explained above, the above recombination method
Also, polyketide catalysts with large module PKS
Find usefulness in biosynthesis. For example, 6-deoxye
Lithronolide B synthase (DEBS)
6-deoxyerythronolai, which is a mycin aglycone
Catalyzes the biosynthesis of de B (17). Three openly
Coding frames (eryAI, eryAII, and
eryAIII) encodes a DEBS polypeptide;
And Saccharopolysporeeryth
32 kb in the ery cluster of the raea genome
ing. Each of these genes is called a “module”
It is organized in six repeating units, referred to as: Each model
Joules encode a set of active sites,
The site is responsible for the growth of additional monomers during polyketide biosynthesis.
Catalyzes condensation on the chain. Each module is an acyl tiger
Transferase (AT), β-ketoacyl carrier tan
Protein synthase (KS) and acyl carrier tan
Protein (ACP) and a subset of reducing active sites
(Β-keto reductase (KR), dehydratase (D
H), enoyl reductase (ER)) (FIG. 9).
No. The number of reduction sites in the module is
Corresponding to the degree of β-keto reduction in End of module
The thioesterase (TE) encoded by
It seems to catalyze the formation. EryAI, eryAII and eryA
Large size of III and the presence of multiple active sites
For these genes, using in vivo recombination technology
And in genetically engineered host cells such as CH999
Can be conveniently cloned into a suitable plasmid for expression of
You. As described in Example 5 and summarized in FIG.
Describes a derivative of plasmid pMAK705 (Ham
ilton et al., (1989) J. Am. Bacteriol.
171: 4617), using temperature-sensitive donor plus
Mid (capable of replicating at a first permissive temperature and a second non-permissive
Cannot replicate at temperature) and the receptor plasmid.
Enables ex vivo recombination. Cloned like this
The eryA gene is pRM5 (McDaniel et al.,
(1993) Science 262: 1546)
Give body pCK7. Control plasmid pCK7
f to construct a frameshift mutation in eryAI
I did. pCK7 and pCK7f are E. coli. to coli
ColEI replicons for genetic manipulation in
Shortened SCP2^*(Low copy number) Streptomy
ces replicon. These plasmids are
Various actI / actIII promoter pairs and
And actII-ORF4 (from these promoters)
Necessary for transcription and in vegetative mycelium from anagen
Activators that activate expression during the transition to stationary phase
-Gene). High level expression of the PKS gene
Occurs at the onset of the stationary phase of thread growth; thus, the recombinant strain
Is a metabolite as if it were natural
Ter "polyketides. Synthesized by a large module PKS
Saccharide, β-lactide
Toms, fatty acids, aminoglycosides, terpenoids,
Like bososome peptides, prostanoid hormones, etc.
Other polyketides may be produced as secondary metabolites. Using the above recombinant method, many polyke
Was produced. These compounds have the general structure
Having (I) [0167] Embedded image Where R¹, R², R³, R⁴, R⁵, R
⁶, R⁷, R⁸And i are as defined above.
You. One group of such compounds is here: R¹Is low
Lower alkyl, preferably methyl; R², R³,
And R⁶Is hydrogen; R⁶Is -CHR⁷-(CO)
-R⁸And i is 0. Such compounds
The second group of is here: R¹And R⁶Is a lower alk
R, preferably methyl; R², R³, And R⁵
Is hydrogen; and i is 0. Such a compound
A further third group of objects is here: R¹And R²Is together
To lower alkylene bridge -CHR⁹-CHR¹⁰
Where R⁹And R¹⁰The water independently
Hydrogen, hydroxyl and lower alkyl (e.g., -CH
₂-CHOH-); R³and
R⁵Is hydrogen; R⁶Is -CHR ⁷-(CO) -R
⁸, Where R⁸Is hydrogen or lower alkyl (eg,
If -CH₂-(CO) -CH₃); And i is
0. Specific examples of such compounds include:
Including the following compounds 9, 10 and 11: [0169] Embedded image Other novel polyketides within the scope of the present invention are
Has the following structure: [0171] Embedded image[0172] Embedded image Compounds 9, 10, 11, 12, 13, 1
The preparation of 4, 15 and 16 comprises the use of an enzyme having the structure (II)
This is done by cyclization of the elementally linked polyketide: [0174] Embedded image Here, R¹¹, R¹², R^ThirteenAnd R
¹⁴And E are the same as defined above. This
Examples of compounds such as: R¹¹Is methyl, and
R^{1 2}Is -CH₂A first group which is (CO) -SE; R
¹¹Is -CH₂(CO) CH₃And R¹²But
A second group that is -SE; R¹¹Is -CH₂(CO) C
H₃And R¹²Is -CH₂(CO) -SE
A third group that is; and R¹¹Is -CH₂(CO) CH
₂(CO) CH₃And R¹²Is -CH ₂(C
O) -SE, and a fourth group (of the structure of FIG. 8).
See specific examples). The remaining structure included in the general formula (I),
That is, structures other than 9, 10 and 11 are in the organic chemistry field.
Using conventional organic synthesis methods well known to those skilled in the art,
9, 10 or 11 can be prepared. These methods
Is, for example, H. O. Moden by House
Synthetic Reactions, 2nd edition (M
enlo Park, CA: The Benjamin
/ Cummings Publishing Comp
any, 1972); March, Adva
nounced Organic Chemistry: Re
action, Mechanisms and Str
result 4th edition (New York: Wiley
-Interscience, 1992),
These disclosures are incorporated herein by reference.
You. Typically, as will be appreciated by those skilled in the art, aromatic rings
A simple electrophilic aromatic addition for incorporation of substituents into
Reactions are involved. Structures 12 and 13 are modified in a similar manner.
Can be modified to produce polyketides. These polyketz
Are also intended to be within the scope of the present invention. Further, using the above recombination method, the following
Polyketide compounds having the general formula were produced:
(III) [0178] Embedded image Formula (IV) [0180] Embedded image And the general formula (V) [0182] Embedded image Structural formulas (III), (IV) and (V)
Particularly preferred compounds of the formula are²Is hydrogen, and i
Is 0. C. Experiment The following are implementations of particular embodiments for practicing the present invention.
It is an example. These examples are provided for illustrative purposes only.
Provided to limit the scope of the invention in any case
Not intended to be. Numbers used (eg, amount, temperature, etc.)
Tried to ensure the accuracy of the
Experimental errors and deviations should of course be tolerated. (Materials and Methods) (Bacterial strain, plasmid, and culture conditions) coel
icolor CH999 with all plasmids
Used as host for transformation. Build this strain
This will be described below. DNA manipulation, Escherichi
a coli MC1061. Plasmid
To E. coli ET12567 (dam dcm
hsdS Cm^r) (MacNeil, DJJB)
acteriol. (1988) 170: 5607).
Through S. Before transformation of coelicolor
Non-chilled DNA was generated. E. FIG. coli strain
Was grown under standard conditions. S. coelicolor
Strains were grown on R2YE agar plates (Hopwo
o.d. A. Et al., Genetic manipula
Tion of Streptomyces. A la
Boratory manual. The John I
nnes Foundation: Norwich, 1
985). Manipulation of DNA and microorganisms. Polymerase
Chain reaction (PCR) was recommended by the enzyme manufacturer
Under conditions Taq polymerase (Perkin Elme)
rCetus). Standard in vitro technology
Was used for DNA manipulation (Sambrook
Et al., Molecular Cloning: A Lab
operative manual (latest version)). E. FIG. co
li, Bio-Rad E.I. E. coli pulse device B
io-Rad. Using the protocol provided by
It was transformed. S. coelicolor, the standard
Transformation (Hopwood, DA).
Et al., Genetic manipulation of
Streptomyces. A laboratory
  manual. The John Innes Fo
undation: Norwich, 1985)
Transformants to 500 mg / ml thiostrepton
-Selection using 2 ml of burley. Construction of plasmid containing recombinant PKS
Construction. All plasmids have the pRM5 induction described below.
Conductor. fren PKS gene
PCR with adjacent 5 'and 3' restriction sites
The position of the cloning site of pRM5 (ie,
PacI-NsiI for RF1, ORF2
NsiI-XbaI, and XbaI for ORF3
-PstI). Subcloning
Following sequencing and sequencing, the amplified fragment was
Cloned to the position of the corresponding fragment in M5
To generate a plasmid for transformation. Polyketide production and purification. The first screen
For leaning, all strains are about 30 ml each
Confluence on 10-30 plates containing agar medium
They were grown at 30 ° C. for 6-8 days as entrons.
Need to get enough material for full characterization
As such, additional plates were made. CH999
Can be used to screen for potential polyketides.
It was a positive control. Cut the agar into small pieces,
And ethyl acetate / 1% acetic acid or ethyl acetate: methanol
(4: 1) / 1% acetic acid. Then concentrated
The extract was purified by silica gel (Baker 40 mm) chromatography.
Pass through a chromatography column with ethyl acetate / 1% acetic acid
Flash. Alternatively, extract the Florisil
Column (Fisher Scientific)
And ethyl acetate: ethanol: acetic acid (17: 2:
Eluted in 1). The first yellow fraction is separated from the preparative reverse phase (C
-18) Acetonitrile / column on column (Beckman)
High speed using a 20-60% gradient of water / 1% acetic acid
Further purification by liquid chromatography (HPLC)
did. Monitor absorption at 280 nm and 410 nm
did. In general, the yield of purified product from these strains
About 10 mg / l for Compounds 1 and 2 (FIG. 4)
And 5 mg for compounds 7 and 8 (FIG. 7)
/ L. SEK4 (12) was produced and produced as follows.
And purified. CH999 / pSEK4, 90 agar plates
At 30 ° C for 7 days on a plate (about 34 ml / plate).
Lengthened. Slice the agar and in the presence of 1% acetic acid
With ethyl acetate / methanol (4/1) (3 × 1000 m
Extracted in l). Following removal of the solvent under reduced pressure, 1%
200 ml of ethyl acetate containing acetic acid were added. Sediment
Is filtered off and the solvent is evaporated to dryness
Was. The product mixture is applied to a Florisil column (Fi
she Scientific) and 3%
Elution was performed with ethyl acetate containing acetic acid. First 100m
One fraction was collected and concentrated to 5 ml. Methaneau
1 ml was added and the mixture was kept at 4 ° C. overnight.
The precipitate was collected by filtration and washed with ethyl acetate
850 mg of pure product was obtained. R_f= 0.48
(1% acetic acid in ethyl acetate). NMR fraction for SEK4
Table 4 shows the results of the analysis. FAB HRMS (NBA),
M +^H+, Calculated m / e 319.0818, measured m
/ E 319.0820. SEK15 (13) and SEK15b
CH999 / pSEK15 to produce (16)
Are grown on 90 agar plates and the product is SE
Extracted in the same manner as for K4. Mix the mixture in Florisi
column (ethyl acetate with 5% acetic acid)
Combine product-containing fractions and evaporate to dryness
I let it. The product was purified by preparative C-18 reverse phase HPLC (B
eckman) (mobile phase: acetonitrile in the presence of 1% acetic acid)
(Tril / water = 1/10 to 3/5 gradient)
And further purified. The yield of SEK15 (13) is 250
mg. R _f= 0.41 (1% acetic acid in ethyl acetate
Le). Table 4 shows the results of NMR analysis on SEK4.
You. FAB HRMS (NBA), M + H +, calculated m
/ E 385.923, measured m / e 385.09
20. [1,2-^ThirteenC₂] Acetate supply
Experiment. Each modified NMP medium (Struch, E. et al.
Et al., Mol. Microbiol. (1991) 5: 2.
89) Two 2 liter flasks containing 400 ml
To S. coelicolorCH999 / pRM1
8, CH999 / pSEK4 or CH999 / pSE
Inoculate spores of K15 and in shaker
Incubated at 30 ° C. and 300 rpm. Each frus
[1,2-^ThirteenC₂] Sodium acetate (Aldr
ich) 50 mg was added at 72 and 96 hours
I got it. After 120 hours, the cultures were pooled and two times
Extracted with 500 ml volume of ethyl acetate / 1% acetic acid. Yes
The phase was retained and purified as described above.^ThirteenC
NMR data for CH999 / pRM18 product
About 2-3% increase; 0.5-1% increase for SEK4
In addition, a 1-2% increase is observed for SEK15 and SEK15. NMR spectrum analysis. RM18 (10)
(FIG. 8) was analyzed by Nicolet NT-
All spectra were converted to Varia except for 360
Recorded with nXL-400.^ThirteenContinuous C spectrum
Broadband proton decoupling. RM
For the study of NOE on 18 (10), one-dimensional differences were calculated.
Method (one-dimensional diffusion)
response method) was used. All compounds
To DMSO-d₆(Sigma, 99+ atomic% D)
And compare spectra with solvent as internal standard
did. The hydroxyl resonance is₂O (Aldrich,
99 atomic% D) and check for loss of signal
Identified. [0194] EXAMPLES (Example 1: S. coelicolor CH)
999)). coelicolor host cells
Manipulate genes to remove native act gene clusters
Removed and a host cell designated CH999 is shown in FIG.
Using the strategy shown, S.D. coelicolorCH1
(Khosla, C. Molec. Microbio
l. (1992) 6: 3237).
(CH1 is S. coelicolorB385 (Ru
dd, B. A. M. GeneticsofPigmen
tedSecondaryMetabolitesin
Streptomycescoelicolor (19
78) Doctoral dissertation, University of EastA
nglia, Norwich, England)
T). CH1 is a polyketide antibiotic actinorhodin
Enzymes involved in biosynthesis and secretion (export)
Act gene cluster to be loaded. This cluster
-Indicates several post-PKS biosynthetic genes (cyclization, aromatic
Involved in homologation and subsequent chemical modification (FIG. 2A)
Gene, including the adjacent PKS gene
You. There are also genes that activate act gene transcription
I do. The act gene cluster is described in Khosla, C .;
Et al., Molec. Microbiol. (1992)
6: 3237 using homologous recombination as described in
Deleted from H1. In particular, the plasmid pLRemETs (see FIG.
2B) was constructed with the following features: pBR322
ColEI replicon from pSG5 and temperature sensitivity from pSG5
Replicon (Muth, G et al., Mol. Gen. Ge)
net. (1989) 219: 341), ampicillin.
And thiostrepton resistance markers, and act
2 kb BamHI / Xho from 5 'end of cluster
I fragment, 1.5 kbermE fragment (K
hosla, C.E. Et al., Molec. Microbio
l. (1992) 6: 3237), and the act class
1.9 kb SphI / PstI fragment from the 3 'end of the
Separation cassette including fragment. The 5 'fragment is
BamHI site 1 (Malpartida, F. and
Hopwood, D .; A. Nature (1984) 3
09: 462; Malpartida, F .; And Ho
pwood, D.C. A. Mol. Gen. Genet.
(1986) 205: 66) to the XhoI site downstream
Up to The 3 'fragment has a PstI site 20
Upstream to the SphI site 19.2 (Fe
rnandez-Moreno, M .; A. J. et al. Bi
ol. Chem. (1992) 267: 19278).
The 5 'and 3' fragments (D shaded in FIG. 2)
NA) is the same relative as in the act cluster
Directionally cloned. CH1 is pLRermEt
s. This plasmid was subsequently
Candidate transformation by non-selective streaking at 39 ° C
Saved by the body. Lincomycin resistance, thiostrepto
Is sensitive and cannot produce actinorhodin
Isolate some colonies and Southern Blottin
Checked by bug. One of them is called CH999
did. Example 2 Production of Recombinant Vector pRM5
PRM5 (FIG. 3) expresses PKS on CH999
This was the shuttle plasmid used for that is,
E. FIG. ColE enables genetic manipulation in E. coli
I replicon, appropriate shortened SCP2^*(Low copy
Number) Streptomyces replicon and nutrition
During the transition from the growth phase to the stationary phase, the act promoter
A from the act cluster that induces transcription from
ctII-ORF4 activator gene. FIG.
As shown in pRM5, various actI / ac
It has a tIII promoter pair and simultaneously
The insertion of various engineered PKS genes downstream of the
It has a convenient cloning site for ease of use. pR
M5 is SCP2^*Lacks the par locus;
As a result, this plasmid is slightly unstable (thio
About 2% loss in the absence of strepton). This feature
Indicates that the target phenotype is a mutant PK derived from this plasmid.
To quickly confirm that they can be clearly assigned to S
Intentionally introduced. Recombinant PKS from pRM5
Is good during the transition from logarithmic growth phase to stationary growth phase.
Expressed in good yield. [0197] pRM5 was constructed as follows. pI
A 10.5 kb SphI / HindII from J903
I fragment (SCP2^*Part of the fertility locus and
And multiple origins, and colEI origin of replication and pBR
327-derived β-lactamase gene) (Lydi
ate, D.E. J. Gene (1985) 35: 223).
With the 1.5 kb HindIII / SphItsr gene
This was ligated with the daughter cassette to obtain pRM1. pRM5 is pR
Between the unique HindIII and EcoRI sites of M1
By inserting the following two fragments between
Built: transcription terminator from phage fd (K
hosla, C.E. Et al., Molec. Microbio
l. (1992) 6: 3237).
HindIII / HpaI (blunt) fragments and
And NcoI site (actII-ORF4 activator
(1 kb upstream of the gene) (Hallam, SE et al., G
ene (1988) 74: 305; Fernandez.
-Moreno, M .; A. Et al., Cell (1991) 6
6: 769; Caballero, J .; L. Mol. G
en. Genet. (1991) 230: 401)
The actI-VII-IV gene (Fernandez-
Moreno, M .; A. J. et al. Biol. Chem.
(1992) 267: 19278) PstI section downstream
10kb fragment from act clusters
And The actI promoter (this is the actII promoter)
-Activated by ORF4 gene product)
To enhance the expression of any desired recombinant PKS
To PacI, NsiI, XbaI and PstI
The restriction site for actDN at the position between the cistrons was actDN.
A. pRM5, and all of the components described herein
In all other PKS expression plasmids, ORF1,
Two and three alleles use their own RBS
Cloned between these sites as a processed cassette
Was Particularly, in actinomycetes, most of naturally occurring actinomycetes
Existing aromatic polyketide synthase gene cluster
Then, ORF1 and ORF2 are translationally conjugated. Recombination
In order to facilitate the construction of PKS,
ORF1 and ORF2 alleles are independent (common)
Cloned as a (non-useful) cassette. ac
For tORF1, the following sequence is provided in pRM5:
Was:CCACCGGACGAACCGCATCGAT
TAATTAAGGAGGACCATCATG, where
The underlined sequence corresponds to the DNA upstream from the actI region
However, TTAATTAA is a PacI recognition site,
ATG is thus the start codon of actIORF1.
The following sequence is provided between actORF1 and ORF2
Was: NTGAATGCCATGGAGGAGCCAT
CATG, where TGA and ATG are each O
Stop and start codons for RF1 and ORF2.
ATGCAT is an NsiI recognition site and
(ActDNA: A, other alleles derived from PKS
Substitution of C for A or G in the offspring results in translation uncoupling (t
translational coupling)
Occurs. The following sequence is provided downstream of actORF2
Was: TAATCTAGA, where TAA was the stop codon,
TCTAGA is an XbaI recognition site. to this
XbaI site provided upstream of actORF3
(Khosla, C. et al., Molec. Microbi.
ol. ActORF1 to (1992) 6: 3237)
And ORF2 (provided above) can be fused
Made it work. As control, same as pRM5
Constructs pRM2 lacking any provided sequence
Was done. Translation of ORF1 and ORF2 in pRM2
Conjugate. CH999 / pRM2 and CH999 / p
A comparison of the product profile of RM5 is described herein.
The uncoupling strategy applied to the product distribution or product level
And showed no detectable effects. (Example 3: C transformed with pRM5)
Polyketide) plasmid p produced using H999
RM5 was purchased using standard techniques. coelicolo
Introduced in rCH999. (For example, Sambrook
k, et al., Molecular Cloning: Alabo
ratationManual (latest version)). pRM
CH999 transformed in 5 gave large amounts of tan material
Produced. NMR and mass analysis of the two most abundant products
According to the spectral analysis, aloe saponalin II (2)
(Bartel, PL et al., J. Bacteriol.
(1990) 172: 4816) and its carboxy
Analog, 3,8-dihydroxy-1-methylan
Traquinone-2-carboxylic acid (1) (Cameron,
D. W. Liebigs Ann. Chem. (198
9) 7: 699) (FIG. 4). 2 is non-enzymatic
Decarboxylation (Bartel, PL et al. JB
acteriol. (1990) 172: 4816)
It is estimated to be obtained from 1 more. Compounds 1 and 2
Was present in a molar ratio of about 1: 5. About 100mg mixture
The material could be easily purified from a 1 liter culture. Follow
Thus, the CH999 / pRM5 host vector system is expected
Works as well as a remarkable amount of stable, minimally modified
Only polyketide metabolites were produced. Raw of 1 and 2
Is the proposed pathway for actinorhodin biosynthesis (Bar
tel, P .; L. J. et al. Bacteriol. (199
0) 172: 4816). Both metabolites
Like actinorhodin skeleton, a single case at C-9
Derived from a 16-carbon polyketide with reduction. CH999 was replaced with pSEK4 (actKR residue).
140 bp SphI / SalI fragment in the gene
Is the SphI / SalI fragment from pUC19
(Same as pRM5 except replaced by
When exchanged, the obtained strain is a large amount of aromatic polyketide S
EK4 (12) was produced. The exact structure of this product is
Desoxyerythrolaccin (Bartel, P.L.
J. et al. Bacteriol. (1990) 172: 48
Slightly different from 16). However, 1,2- ^ThirteenC₂
In vivo isotope labeling using labeled acetate
Studies show polyketide skeleton is derived from 8 acetate
It was confirmed that. In addition, this product ¹H spectrum
and^ThirteenThe aromatic region of the CNMR spectrum is similar to 1
It is similar to a similar tricyclic structure.
Lack of keto reduction (see Table 4). Example 4 Hybrid Polyketidesin
Construction and analysis of the enzyme (A. components from act, gra, and tcmPKS
Figure 1. Construction of a hybrid PKS containing
KS / AT and ACP subunits and OR
Actinorhodin (3), granaticin containing F2 product
(4), and tetracenomycin (5) (shown in FIG. 5).
PKS for synthesizing the carbon chain skeleton of
You. actPKS and graPKS also have KR
However, it is lacking in tcmPKS. From each cluster
Corresponding proteins show a high degree of sequence identity
You. The corresponding PKS proteins in the three clusters
The percent identity between qualities is as follows: KS / A
T: act / gra76, act / tcm64, gra
/ Tcm70; CLF: act / gra60, act /
tcm58, gra / tcm54; ACP: act / g
ra60, act / tcm43, gra / tcm44.
actPKS and graPKS reduce keto at C-9
16 identical residues from 8 acetate residues (Figure 6)
Synthesize a carbon skeleton. In contrast, also shown in FIG.
As shown, the tcm polyketide skeleton has an overall carbon chain length of
Different (20 carbons instead of 16 carbons)
And the regiospecificity of the first cyclization is
And in gram carbon 9 instead of between carbon 7 and 12
And between 14. Generation of New Polyketides with Different Ranges of Properties
And solve the phase of programming aromatic PKS
In an effort to clarify, as shown in Table 1,
The smallest series of PKS gene clusters is ac
O from the t, gra, and tcm gene clusters
RF1 (encoding KS / AT subunit), OR
F2 (encoding the CLF subunit), and OR
F3 (encoding ACP subunit) gene product
Various permutations can be used to replace the existing act gene.
And cloned into pRM5. The resulting plasmid
Was used to transform CH999, as described above.
Was. KS / AT, ORF2 product, and PKS
Including various permutations between ACP subunits
PKS (all constructs are also actKR, Cycla
And the product of the product (including the dehydratase gene)
Analysis shows that synthase produces three categories: polyketides
Non-producing group; Compound 1 producing group (small amount
And polyketide 9 (RM20 and RM20)
(FIG. 6).
(Table 1). The structure of 9 is the poly-
Ketide backbone precursor has one keto reduction at C-9 position
From 10 acetate residues. Reduction and Cyclization Pattern of Heterologous Polyketide Chain
To investigate the effect of actKR on
EK15 was also constructed. This is tcmORF1-3
, But lacked actKR. (A of this construct
Deletion in the ctKR gene is due to deletion in pSEK4.
Lost and identical. ) Analysis of CH999 / pSEK15
Is a 20 carbon chain product SEK15 (13)
Identical to Nomycin C or its shunt product
Not, but similar. NMR spectrum analysis
In addition, it was consistent with a completely non-reduced deketide skeleton (see Table 4)
See). All act / gra hybrids are
Putative actinorhodin and granaticin polykety
Compound 1 was produced, consistent with the same structure of the compound. Each place
In some cases, the product from the tcm / act hybrid
If they can be separated, the chain length of the polyketide will be
It was identical to the chain length of the natural product corresponding to the source. this thing
Indicates that ORF2 product but not ACP or KS / AT
It suggests controlling the carbon chain length. In addition, this specification
Hybrids (those lacking KR (C
H999 / pSEK4 and CH999 / pSEK1
All polyketides produced by (except 5) are
(I) KR is keto-reduced since one place was keto-reduced
Is necessary and sufficient to occur; (ii)
Is always reduced to the C-9 position in the final polyketide backbone.
(Counting from the carboxy terminus of the chain); and
(Iii) Non-reduced polyketide is a keto-reduced unfinished polyketide
Rings in several cyclization patterns in the polyketide chain
But the regiochemistry of the first cyclization (regioche
mystry) is how this cyclization is in non-reduced products.
Regardless of what happens to the resulting hydroxyl
It can be concluded that the location is specified. Paraphrase
For example, tcmPKS may contain ketoreductase.
And can be engineered to exhibit novel cyclization specificities. The remarkable feature of RM20 (9) is that the first cyclization
It is a pattern of later cyclization. from the actVII mutant
Mutactin (6) was isolated from the actVII product and its
The tcm homolog of actinorhodin (3) and tetra
Senomycin (5) Second ring in each biosynthesis
(Sherman,
D. H. Tetrahedron (1991) 47:
6029; Summers, R .; G. FIG. J. et al. Bacte
riol. (1992) 174: 1810). RM20
The cyclization pattern of (9) is defined as the act on pRM20 (9).
1 and tetraceno regardless of the presence of the VII gene
Differs from the cyclization pattern of mycin F1. Therefore, act
Cyclase cannot cyclize longer polyketide chains
It is. Unexpectedly, the minimum tcmPKS was simply
The strain included in Germany (CH999 / pSEK33) is shown in FIG.
Two polyketide SEK15 (13) and
And SEK15b (16) in approximately equal amounts
Was. However, compounds (13) and (16) also have CH
999 / pSEK15, compound (16)
An amount of compound (13) greater than the amount of
Released. SEK15b is a novel compound and its structure
The structure was determined by NMR spectrum analysis, [1,2-^ThirteenC₂]vinegar
Of sodium phosphate feeding experiment and mass spectrometry
It was elucidated by the combination.¹H and^ThirteenCNMR results
The result is that SEK15b has a non-reducing anthraquinone moiety and
And a pyrone moiety.
[1,2-^ThirteenC₂] Sodium acetate feeding experiment is SE
That the carbon chain of K15b is derived from 10 acetate units
Proved. Of a sample rich in SEK15b^ThirteenCNMR
The coupling constant calculated from the spectrum is the peak
Assignment was facilitated. Fast atom bombardment (FAB) mass spec
Toll analysis is C₂₀H₁₂O₈381 (M +
H⁺). SEK1 using deuterium exchange
The presence of each hydroxyl in 5b was confirmed. For cyclization in the absence of active cyclase
Available in vivo for unfinished polyketide chains of
To identify the origin, the recombinant S. coelicol
orCH99 / pRM37-produced polykety
(McDaniel et al. (1993), supra).
Was. The biosynthetic enzyme encoded by pRM37 is tc
m keto synthase / acyltransferase (KS /
AT), tcm chain length determinant (CLF), tcm acyl
Carrier protein (ACP) and act ketreda
Kutase (KR). The two new compounds RM20b (14) and
And RM20c (15) (FIG. 8)
Was found in the culture medium of CH999 / pRM37 that produced
Was. The relative amounts of the three compounds recovered were 3: 7: 1
(RM20: RM20b: RM20c). (1
The structures of 4) and (15) are based on mass spectrometry, N
Set of MR spectrum analysis and isotope labeling experiments
Elucidated by combination.¹H and^ThirteenCNMR
The RM20b and RM20c are each
Suggests that it is a diastereomer containing
Was. Optical rotation [α] _D ²⁰Is +2 for RM20b
10.8% (EtOH, 0.55%) and RM20
For c, at + 78.0 ° (EtOH, 0.33%)
It was found to be. [1,2-^ThirteenC₂] Nato acetate
RM20b (and by inference)
RM20c) has 10 acetate units
It was confirmed to be derived from. Deuterium exchange research by RM
Possible hydroxy on both 20b and RM20c
Corresponding to the radical¹Performed to identify HNMR peaks
did. The proton coupling constant is¹HNMR and
It was calculated from the results of a one-dimensional decoupling experiment. Special
The coupling pattern in the high magnetic field region of the spectrum
Surrounds the methine proton of central carbinol
A 5-proton spin system of two methylene groups is shown.
High resolution fast atom bombardment (FAB) mass spectrometry
Is (519.0056) for RM20b (M = C
s⁺) And 387.1070 for RM20c
(M + H⁺), Which gives C₂₀H₁₈O
₈(M + Cs⁺, 519.00056; M + H⁺, 38
7.1080). Based on these data,
Structures (14) and (15) (FIG. 8)
Assigned to M20b and RM20c. [0212]¹H and^ThirteenThe data from CNMR is
Cup between H-9 and the chemical proton on C-8
The ring constant for RM20b or RM20c is
12.1 or 12.2 and 2.5 or respectively
2.2 Hz. On H-9 and C-10
The coupling constant between the gemical proton is Rm
20b or RM20c, respectively, at 9.6 or
Was 9.7, and 5.7 or 5.8 Hz. This
These values are J_{a, a}(J_{9a, 8a}Or J
_{9a, 10a}) And J_{a, e}(J_{9a, 8e}Or J
_{9a, 10e}) Typical for coupling patterns,
And H- at both RM20b and Rm20c.
9 indicates an axial position. In contrast, two
The chemical shift of the C-7 hydroxyl on the molecule of
0b and RM20c, respectively.
And 6.14 ppm. These values are RM20
In b, an act appropriately located with C-7 hydroxyl
A hydrogen bond exists between the sceptor atom and RM20c
Indicates that it does not exist. For such a hydrogen bond
The most likely candidate acceptor atom is the conjugated pyrone
C-13 carbonyl oxygen in the ring system, or isolated
It is a bridging oxygen in the pyrone ring. In the latter case, (14) and
Since it is impossible to distinguish between (15) and
Likely to be. Further, RM20b and RM2
0c^ThirteenBy comparison of CNMR spectra, (1
The largest difference between 4) and (15) is the conjugated pyrone
It is clear that there is a chemical shift of the carbon constituting the ring
(C-11, C-12, C-13, C-14, and
+5.9, -6.1,
+8.9, -7.8, and +2.0 ppm). High magnetic field
And such a pattern of alternating low field shifts
C-7 hydroxyl forms a hydrogen bond to C-13 carbonyl
Can be explained by the fact that Because hydrogen bonding
The current around C-11, C-13, and C-15
Reduces the density of particles, but around C-12 and C-14
This can be expected to increase the electron density of. C
To confirm the assignment of -7 / C-13 hydrogen bond, RM
The exchangeable protons of 20b and RM20c are
Replace with prime (D₂Incubating in the presence of O
And the sample^ThirteenAnalyzed by CNMR.
The C-13 peak in RM20b shows a high magnetic field shift (1.
7 ppm) and what RM20c did not
Is weaker in RM20b when is replaced with deuterium
Can be explained by a non-covalent C-7 / C-13 bond. C
RM2 to form a hydrogen bond with the -13 carbonyl
Ob C-7 hydroxyl does not occupy the equatorial position
I have to. Therefore, C-7 and C-9 hydroxy
Sil is the conjugated ring system in the major isomer (RM20b).
On one side (syn), while they are less
Isomer (RM20c), the opposite side (anti)
It can be inferred. CH999 / pRM15, / pRM35,
And / or no detectable polyketide in pRM36
Was. Therefore, some ORF1-ORF2 combinations
Only is functional. Each subunit has at least one
Functional in two recombinant synthases,
Protein expression / folding problems are unlikely. Substitute
In addition, between the different subunits of these enzyme complexes
Incomplete or suppressed association, or rapidly degraded
Biosynthesis of (failed) short-chain products is a good explanation
is there. (B. from act and fren PKS)
Construction of hybrid PKS containing components of
omyces roseofulvus is frenolisi
B (7) (Iwai, Y et al., J. Antibiot.
(1978) 31: 959) and nanaomycin A.
(8) (Tsuzuki, K. et al., J. Antibio
t. (1986) 39: 1343).
10 kb DNA fragment (hereinafter referred to as fren locus)
), S. Roseofulbus Genome Library
Lee, Bibb, MJ et al., Supra. coe
licor A3 (2) act PKS KS /
DNA encoding AT and KR components is used as a probe
And cloned (Malpartida, F. et al.
Et al., Nature (1987) 325: 818).
(See the structural diagram in FIG. 7). DNA sequence of fren locus
The decisions are as follows: act KS / AT, CLF, ACP, KR,
And a high degree of identity with those encoding cyclase
(Inter alia). To produce novel polyketides, pRM
ORF1, 2, and 3act genes present in 5
Replaced with the corresponding fren gene as shown in Table 2.
did. S. constructed as described above. coelilcolo
rCH999 was transformed with these plasmids.
Was. (Encoding act KR and act cyclase
Genes are also present in each of these genetic constructs.
There. ) Act and tcm PKS as described above
Based on the results from similar experiments used, actKR is
To be able to reduce the products of all functional recombinant PKS
In contrast, the ability of act cyclase to catalyze the second cyclization
May depend on the chain length of the product of fren PKS
As expected. The results summarized in Table 2 show that most of the transformants
But their ability to produce aromatic polyketides
As shown, it showed that functional PKS was expressed.
You. The structural analysis of the main product shows that
Li: Compound 1 (a smaller amount of its decarboxylation by-product
With compound (1) and compound 1, 1
A mixture of 0 and 11 (ratio of about 1: 2: 2) was synthesized.
It can be classified into strains. (A small amount of 2 is also
1 was found in all strains). Compound 1 and
2 was previously known as a natural product and
3, the act subunit as a whole.
Was a metabolite produced by PKS. Compound
Objects 10 and 11 (RM18 and RM18, respectively)
b) is a novel structure,
Isolation as a natural or natural product has been previously reported.
Did not. The structures of 10 and 11 were analyzed by mass spectrometry.
Analysis, NMR spectral analysis, and isotope labeling
It was revealed by a combination of experiments.¹H and^Thirteen
The C spectral assignments were determined using [1,2-^ThirteenC
₂] According to the sodium acetate feeding experiment (described below)
Obtained^ThirteenC-^ThirteenTable 3 with C coupling constant
Shown in The apparent assignment of compound 10 was determined by 1D nuclear
-Hauser effect (NOE) and long-range heteronuclear
Established using interaction (HETCOR) studies. heavy water
By elementary exchange, C-15 of compound 10 and compound 11
The presence of a hydroxyl at C-13 was confirmed. Two
Field desorption mass fraction
By FD-MS, C₁₇H₁₄O₄(282.
2952). The previous study showed that 2 (and 1 by inference)
Polyketide backbone (Bartel, PL et al., JB
acteriol. (1990) 172: 4816)
Repeated condensation of eight acetate residues and once at C-9
Derived from keto reduction. Also, Nanao
The main reason is that mycin (8) is derived from the same carbon chain skeleton.
Can be tensioned. Thus, nanaomycin is S. roseo
product of the fren PKS gene in Fulbus
It is very likely that. The first ring leading to the formation of 1
Regiospecificity is derived from the position of the keto reduction,
In contrast, the regiospecificity of the second cyclization is that of the act cycler
(Zhang, HL, et al., JO
rg. Chem. (1990) 55: 1682). To track the RM18 (10) carbon chain backbone
For example, [1,2-^ThirteenC₂] Invitation using acetate
A feed experiment was performed on CH999 / pRM18,
Subsequently, NMR analysis of the labeled RM18 (10) was performed.
^ThirteenC coupling data (summarized in Table 3)
The polyketide skeleton of 18 (10) has 9 acetate residues
, Followed by possibly non-enzymatic, terminal
Decarboxylation (C-2)^ThirteenC resonance enhanced
Appear as a glet)
You. Furthermore, the absence of the hydroxyl group at the C-9 position indicates that
Suggest that the reduction occurs at this carbon. These two
That two features exist in the putative frenolicin (7) skeleton
As expected, these results indicate that
In addition to the fren PKS gene, the fren PKS gene ro
Contributes to biosynthesis of frenolicin in seofulbus
Suggest that. This is because PK with a slow chain length specificity
Seems to be the first clear example of S. Only
However, unlike the putative skeleton of frenolicin, RM18
The C-17 carbonyl of (10) is not reduced. this
Is a specific ketoreductase derived from pRM18,
Latase, and enoyl reductase (S. rose
in the fren gene cluster in ofofulbus
May reflect the absence of, or in frenolicin
It may reflect different origins of carbon 15-18. First cyclization leading to formation of RM18 (10)
Is guided by the position of the keto reduction;
However, the second cyclization occurs differently than 7 or 1, and
RM20 (9) (tcm PKS described above)
Pattern seen in deketide produced by
And similar. Therefore, as in the case of RM20 (9),
act cyclase catalyzes the second cyclization of the RM18 precursor
And the subsequent cyclization (possibly non-
Enzymatically occurs) unfinished polyketide into aqueous environment
Controlled by the time difference of release of different parts of the chain
Is claimed. CH999 / pRM18 producing 1
(And consider the capabilities of CH999 / pRM34)
And cyclase is fren PKS (KS / AT, CL
F, and ACP)
  with) the possibility of not being obtained can be ruled out. Than
A proper interpretation is that act cyclase requires substrates of different chain lengths.
It is not recognizable. This is also the estimated RM20
This is consistent with the biosynthesis scheme of (9). The hybrid synthase reported in Table 2
Product profile and act and tcm PKS
Comparison with similar hybrids between the components (Table 1)
The hypothesis that the RF2 product is a chain length determinant (CLF)
I support the theory. Compound 9, by cyclization of an enzyme-linked ketide,
The preparation of 10 and 11 is schematically illustrated in FIG. Example 5 Module Polyketide Sinter
Construction and analysis) Recombination module DEBS P
The expression plasmid containing the KS gene is as shown in FIG.
First, the temperature-sensitive "donor" plasmid (ie, the first
Can be replicated at a permissive temperature of and duplicate at a second non-permissive temperature
DNA that cannot be obtained from the plasmid
The "receptor" shuttle vector
Built by importing. Complete eryA gene
PCK7, a shuttle plasmid containing (FIG. 11)
(This was originally cloned from pS1 (Tua
n et al. (1990) Gene 90:21))
I built it. 25.6 kb SphI plasmid from pS1
The fragmentation was performed using pMAK705 (Hamilton et al.,
(1989) J. Am. Bacteriol. 171: 461
Insertion into the SphI site of 7), eryAII, ery
AIII, and donor donor containing the 3 'end of eryAI
PCK6 (Cm^R) Got. This feeling of temperature
Replication of the competent pSC101 derivative occurs at 30 ° C.
Terminate at 4 ° C. The receptor plasmid pCK5 (A
p^R, Tc^R) Is the eryAI start codon (Caffr
ey et al., (1992) FEBS Lett. 304: 2
25) XcmI site close to the beginning of eryAII
12.2 kb eryA fragment, tetrasa
1.4 kb encoding the eculin resistance gene (Tc)
EcoRI-BsmI pBR322 fragment,
And 4.0 kb NotI from the end of eryAIII
-Contains the EcoRI fragment. PacI, Nde
l and the ribosome binding site are defined as ery in pCK5.
Designed with AI start codon. pCK5 induces pRM5
Conductor (McDaniel et al., (1993), supra)
Out). 5 'and 3' homology regions (Figure 10, striped area and
And white area) are 4.1 kb and 4.0 kb, respectively.
kb. MC1061E. coli, pCK5
And pCK6 (Sambrook et al., Supra).
And at 30 ° C. carbenicillin and
Chloramphenicol selection was performed. Then, both
Rasmid (Ap^R, Cm^RColonies with
4 on benicillin and chloramphenicol plates
Re-streaking at 4 ° C. A single between the two plasmids
Only the simultaneous integration formed by the recombination event
Was. Surviving colonies were grown at 30 ° C under selection for carbenicillin.
Breeding at the same time through the second recombination event
A solution was forced. pCK7 recombination
In order to increase the body size, colonies are
Streaked again at 44 ° C. on the plate. The resulting colony
About 20% of the desired phenotype (Ap^R, Tc^S, C
m^S)showed that. The last pCK7 candidate was
Inspection was carried out thoroughly. A control plasmid,
pCK7f including a frame shift error in eryAI,
Constructed in a similar way. pCK7 and pCK7f,
E. FIG. coli ET12567 (MacNeil (19
88) J. et al. Bacteriol. 170: 5607)
The transformed, unmethylated plasmid DN
A, followed by Str using standard protocols.
eptomyces coelicolor CH99
9 (Hopwood et al., (1985) Gen.
etic manipulation of Street
ptomyces. A laboratory man
ual. The John Innes Founda
tion: Norwich). CH999 / pCK7 in R2YE medium
As they grow, microorganisms grow two polyketides (Figure X).
Produced in quantity. Propionate (300
mg / L) of the polyketide product.
The yield increased about two-fold. Propionic acid-1-^ThirteenC supply
Along with experiments, proton and^ThirteenCNMR spectrum component
Analysis confirmed the main product as 6dEB (17).
(> 40 mg / L). A small amount of the product, 8.8a-
Identified as deoxyoleandlide (18) (> 10
mg / L), which is the ratio of propio in the 6dEB biosynthesis pathway.
Derived from acetate start unit instead of nate
It is.^ThirteenC₂According to the sodium acetate feeding experiment, (1
Incorporation of acetate into 8) was confirmed. DEBS
Estimated to be 1, DEBS2, and DEBS3
Three high molecular weight proteins (> 200 kDa) (Caf
Frey et al., (1992) FEBS Lett. 30
4: 225) is also an SDS-polyacrylamide gel
In the crude extract of CH999 / pCK7 by electrophoresis
confirmed. From CH999 / pCK7f, polyke
No product was found. Therefore, novel polyketides and polyketides
Methods for recombinantly producing tide have been disclosed. The present invention
Preferred embodiments are described in some detail,
Variations on the subject matter are defined in the appended claims.
It is reasonable to do this without departing from the spirit and scope of
Understood. [0225] [Table 1] [0226] [Table 2] [0227] [Table 3][0228] [Table 4] [0229] The present invention relates to novel polyketides,
New polyketides and known polyketides
Produce both tides effectively. In particular, various polyke
Produces polyketide synthase, which in turn catalyzes the production of
A new host-vector system used to

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows act, gra, and tcm PK
1 shows the gene clusters for S and cyclase. FIG. coelicolor CH99
9 shows a strategy for making 9. FIG. 2A
S. coelicolor a present in CH1 chromosome
1 shows the structure of the ct gene cluster. FIG. 2B shows pLR
The structure of emEts is shown, and FIG. 2C shows the portion of the CH999 chromosome where the act gene cluster has been deleted. FIG. 3 is a diagram of plasmid pRM5. FIG. 4 shows the formation of aloe saponalin II (2) and its carboxylated analog 3,8-dihydroxy-1-methylanthraquinone-2-carboxylic acid (1) described in Example 3. Are schematically illustrated. FIG. 5 shows the structures of actinorhodin (3), granaticin (4), tetracenomycin (5) and mutactin (6) referred to in Example 4. FIG. 6 shows aloesaponalin II as described in Part A of Example 4 by cyclization of a polyketide precursor.
(2) Schematically illustrates the preparation of its carboxylated analogs 3,8-dihydroxy-1-methylanthraquinone-2-carboxylic acid (1), tetracenomycin (5) and a new compound RM20 (9). FIG. 7 shows frenolicin (7), nanomycin by cyclization of a polyketide precursor.
1 schematically illustrates the preparation of (8) and actinorhodin (3). FIG. 8A illustrates cyclization of a polyketide precursor.
Novel compounds RM20 (9), RM18 (10), RM1
8b (11), SEK4 (12), SEK15 (1
3) shows schematically the preparation of RM20b (14), RM20c (15) and SEK15b (16). FIG. 8B shows cyclization of the polyketide precursor.
Novel compounds RM20 (9), RM18 (10), RM1
8b (11), SEK4 (12), SEK15 (1
3) shows schematically the preparation of RM20b (14), RM20c (15) and SEK15b (16). FIG. 8C shows the cyclization of the polyketide precursor,
Novel compounds RM20 (9), RM18 (10), RM1
8b (11), SEK4 (12), SEK15 (1
3) shows schematically the preparation of RM20b (14), RM20c (15) and SEK15b (16). FIG. 9 shows a gene model for 6-deoxyerythronolide B synthase (DEBS). FIG. 10 shows a strategy for the construction of the recombinant module PKS. FIG. 11 is a diagram of plasmid pCK7.

   ────────────────────────────────────────────────── ─── Continuation of front page    (72) Inventor Cheytan Kosla             United States California 94305,               Stanford, Peter Koots             Circle 132 (72) Inventor David A. Hopwood             UK N2 2H               Norwich, Ensunk Road 244 (72) Inventor Suzanne Evert-Kosra             United States California 94305,               Stanford, Peter Koots             Circle 132 (72) Inventor Robert McDaniel             United States California 94306,               Palo Alto, Number D, A             Luma Street 2891 (72) Inventor Hong Hu             United States California 94305             −5025, Stanford, Stanford             Leeds University, Stouffer             The Third, Chemical Engineer             (No address) (72) Inventor Camilla Kao             United States California 94305,               Stanford, Escondido             Ledge 19A F term (reference) 4B024 AA01 AA11 BA07 BA10 BA80                       CA04 DA05 EA04 FA02 GA11                 4B065 AA50X AB01 AC14 BA02                       CA18 CA24 CA29 CA34 CA44

Claims (1)

Claims 1. A module polyketide synthase (PK)
A cell into which a nucleic acid encoding a plurality of modules of S) has been introduced, wherein each module has at least PKS.
A nucleotide sequence encoding the introduced PKS module, including an acyltransferase (AT) activity, a PKS ketoacyl carrier protein synthase (KS) activity, and a PKS acyl carrier protein (ACP) activity, can operate on at least one control sequence , Whereby the cell produces a functional module PKS, wherein at least one of the nucleotide sequences encoding the module for the functional module PKS
Or at least one of said regulatory sequences is heterologous to said host cell.