JP2003092956A - Animal with insufficient expression of thymidine phosphorylase - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a nonhuman animal with insufficient expression of thymidine phosphorylase useful as a model animal for researches of physiological functions of the thymidine phosphorylase, elucidation of pathophysiology of diseases associated with the thymidine phosphorylase such as thymidine dysbolism and further studies of pharmacokinetics of nucleoside antimetabolites. SOLUTION: This nonhuman animal deficient in functions of a thymidine phosphorylase gene on a chromosome and its offspring are provided. Furthermore, the nonhuman animal deficient in the functions of the thymidine phosphorylase gene and a uridine phosphorylase gene on the chromosome and its offspring are provided.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a non-human animal deficient in nucleoside phosphorylase expression and its progeny.

[0002]

BACKGROUND OF THE INVENTION Pyrimidine nucleoside phosphorylase is an enzyme involved in the biosynthesis and degradation of pyrimidine metabolism, and plays an important role in regulating the in vivo nucleoside pool through the degradation and synthesis of pyrimidine bases in the salvage pathway. . Uridine phosphorylase and thymidine phosphorylase are known as pyrimidine nucleoside phosphorylases in mammals, and both are involved in biosynthesis and degradation of pyrimidine metabolism.

It has been reported that the expression of thymidine phosphorylase is increased in many cancers. In recent years, the present inventors have cloned the thymidine phosphorylase gene, which has been reported as an angiogenic factor PD-. It was found to be the same protein as ECGF, and it was revealed that thymidine phosphorylase and 2-deoxyribose have angiogenic activity. And, it has been reported from many groups that the expression of thymidine phosphorylase and the tumor vascular volume are actually correlated in clinical tumors.

It has also been reported that thymidine phosphorylase is highly expressed in macrophages infiltrating gastric cancer, and that thymidine phosphorylase is more highly expressed in invasive bladder cancer than in superficial ones. Furthermore, in 1999, Nishino reported that deficiency in the activity of thymidine phosphorylase may be a causative factor of mitochondrial encephalomyopathy (MNGIE).

On the other hand, nucleoside antimetabolites, which play an important role in the field of cancer chemotherapy, are known to be inactivated by thymidine or uridine phosphorylase due to their chemical structure, Accurate understanding of the metabolic pattern is required to develop a drug having excellent pharmacological effects and few side effects.

[0006] As described above, since thymidine phosphorylase is considered to have various functions, if thymidine phosphorylase expression-deficient animals are systematically obtained, the involvement of thymidine phosphorylase in each disease is directly confirmed. Therefore, it is useful for elucidating related diseases and also useful for studying physiological functions of thymidine phosphorylase.

[0007]

DISCLOSURE OF THE INVENTION An object of the present invention is to provide a non-human animal deficient in thymidine phosphorylase expression and its progeny that can be used as an experimental animal.

[0008]

In view of such circumstances, the present inventors have conducted various studies on mutations of the thymidine phosphorylase gene, designing of targeting vectors, etc., and as a result, transformants having a substantially non-functional thymidine phosphorylase gene. Successfully produced animals and their offspring. And by further mating thymidine phosphorylase expression deficient non-human animals and uridine phosphorylase expression deficient non-human animals, it was found that non-human animals thymidine phosphorylase gene and uridine phosphorylase gene functions are both deficiently obtained, The present invention has been completed.

That is, the present invention provides a non-human animal deficient in the function of the thymidine phosphorylase gene on the chromosome and its progeny, and a non-human animal deficient in the function of the thymidine phosphorylase gene and uridine phosphorylase gene on the chromosome and its progeny. It is provided.

In recent years, with the development of genetic engineering, it has become possible to artificially manipulate various genes, artificially add exogenous genetic traits, and suppress the expression of genetic traits possessed by organisms. Various transformed animals have been created (Nature, Vol.300, pp.611-615, 16 December 1982).
, Proc.Natl.Acad.Sci.USA Vol.87, pp.7688-7692, Octo
ber 1990). Up to now, an animal deficient in the function of the uridine phosphorylase gene has been produced (Japanese Patent Application Laid-Open No. 20-29200).
No. 01-169684), an animal in which the function of the thymidine phosphorylase gene on the chromosome is deficient, and further, an animal in which both the thymidine phosphorylase gene and the uridine phosphorylase gene are deficient and genetically stable have not been known so far.

[0011]

BEST MODE FOR CARRYING OUT THE INVENTION In the present invention, "the function of the thymidine phosphorylase gene on the chromosome is defective" means
A protein that functions as a thymidine phosphorylase, in which the thymidine phosphorylase gene on the chromosomes of somatic cells and germ cells differs from its original structure due to a partial deletion of its nucleotide sequence or insertion or substitution of another gene. Or a gene product is obtained, the protein does not function as thymidine phosphorylase. Specifically, deletion, insertion or substitution of the nucleotide sequence of the promoter region or coding region And the like, whose functions are disrupted by gene mutations such as That is, "a non-human animal deficient in the function of the thymidine phosphorylase gene on the chromosome",
It means a thymidine phosphorylase expression-deficient animal produced by modifying (manipulating) a thymidine phosphorylase gene (mutant thymidine phosphorylase gene) using a genetic engineering technique.

Here, the "non-human animal" may be any animal other than human having a thymidine phosphorylase gene, but a non-human mammal is preferable. Examples of non-human mammals include cow, pig, sheep, goat,
Rabbits, dogs, cats, guinea pigs, hamsters, mice, rats, etc. are mentioned, but rodents with relatively short ontogeny and biological cycle from the viewpoint of preparation of animal model system for pathological diseases, and easy breeding, especially mice Alternatively, rat is preferable.

For the disruption of the thymidine phosphorylase gene on the chromosome, the method usually used for disrupting the gene on the chromosome can be applied. Specifically, the thymidine phosphorylase gene can be cloned and the A method is used in which the gene function is lost and then the defective gene is returned to the animal so that the function of the gene in the animal and its progeny is lost.

As a method of introducing a gene into an animal, for example, (1) a method of injecting gene DNA into a pronuclear stage embryo of a fertilized egg, (2) a method of infecting an early embryo with a recombinant retrovirus, ( 3) A method of injecting an embryonic stem cell (ES cell) that has undergone homologous recombination into a blastocyst or an 8-cell stage embryo, and the like. In order to obtain the non-human animal of the present invention, any of these is available. Although a method can also be used, the method of gene transfer using ES cells is suitable for disrupting the gene by homologous recombination, and includes a step of introducing the gene into ES cells and a step of producing a chimeric animal. It is preferable because it has the advantage that it can be performed separately.

Therefore, the non-human animal of the present invention can first produce a cell having a mutant thymidine phosphorylase gene (for example, ES cell), and transplant the cell into an animal to produce a chimeric animal. By mating such a chimeric animal with another individual, an animal can be produced in which the mutant thymidine phosphorylase gene is heterozygously or homozygously deleted in all of its constituent cells. Hereinafter, a typical method for producing the non-human animal of the present invention and its progeny will be described in detail.

To obtain a mutant of the thymidine phosphorylase gene (mutant thymidine phosphorylase gene), a part of the nucleotide sequence of the thymidine phosphorylase gene is deleted or another gene is inserted or replaced. The site of deletion, insertion, etc. is not particularly limited as long as a functional gene product is not obtained, and may be any of promoter region, intron region, exon region, etc. It is preferable to mutate at least a part of the promoter region or the coding region in order to delete the gene. Further, another gene such as a reporter gene can be inserted at the deleted, substituted or inserted site. For example, the mouse thymidine phosphorylase gene contains 10 coding exons as shown in FIGS. 1 and 2, and the thymidine phosphorylase protein is encoded over 10 coding exons. Therefore, for the lack of expression ability of the thymidine phosphorylase gene, either one of the individual exons or a part thereof may be deleted, and another gene may be inserted at any of these sites.

As the thymidine phosphorylase gene,
The thymidine phosphorylase gene derived from the genome isolated and extracted from the animal is used. For cloning, for example, the genomic DNA is extracted from the liver of a mouse and the DNA is extracted according to a conventional method.
It can be obtained by preparing a library and then screening this using a partial sequence of DNA, for example, cDNA, which has already been cloned and which codes for thymidine phosphorylase mRNA. The above-mentioned method for artificially mutating the thymidine phosphorylase gene can be performed in vitro by a conventional DNA recombination technique.

Next, a targeting vector for homologous recombination for deleting the function of the thymidine phosphorylase gene is prepared. The targeting vector is designed by deleting a part or all of the chromosome-derived thymidine phosphorylase gene, inserting another base sequence or replacing it with another base sequence, and thymidine-containing upstream and downstream regions surrounding the mutated part. It may be designed to have a nucleotide sequence homologous to the phosphorylase gene.

Further, in this targeting vector, a marker gene such as a neomycin resistance gene (ne) is selected for selecting cells into which the vector has been incorporated or cells in which the desired homologous recombination is likely to occur.
o), herpesvirus thymidine phosphatase gene (HSV-tk), diphtheria toxin A fragment (DT-A) gene, thymidine kinase gene (tk)
It is preferable that a gene usually used for drug selection such as is inserted. For example, the neomycin resistance gene
The neomycin analog G418 is used to allow selection of the target gene. In addition, a marker gene used for negative selection to select and remove target cells, for example, thymidine kinase gene (tk) (using ganciclovir, FIAU, etc. as a selection agent, and selecting and removing non-homologous recombinants depending on its sensitivity), Diphtheria toxin A fragment (DT-A) gene (DT
(A non-homologous recombinant is selectively removed by the diphtheria toxin expressed by -A) and the like can be used together with a marker gene for positive selection such as a neomycin resistance gene (neo).

The preparation of such a targeting vector is
It can be carried out by an ordinary DNA recombination technique, for example, using a cloned thymidine phosphorylase gene, a fragment obtained by cutting this with an appropriate restriction enzyme, or a part of which is amplified by a PCR method or the like. D
The NA fragment or the like may be linked to a fragment containing a linker DNA, a reporter gene, a drug resistance marker gene synthesized by a DNA synthesizer or the like in an appropriate order according to the above design.

Next, the prepared targeting vector for homologous recombination is introduced into an appropriate cell which is usually used for producing a chimeric animal. The cells used here include, for example, egg cells and embryonic stem cells (ES cells), and ES cells are preferable because they have pluripotency capable of differentiating into all kinds of cells in the living body. Also, vector DNA
The method for introducing into cells is a usual method, for example, electroporation, microinjection,
It can be performed by the calcium phosphate method or the like.

ES cells are established from the inner cell mass of the 129 blast mouse blastocyst and proliferate and grow in an undifferentiated state.
It is a culturable cell line and the method of gene transfer using ES cells has been established for mice (Mansour,
SL et al., Nature 336: 348 (1988)). In principle, it is considered that ES cells can be cultured in mammals in general, and research is progressing to establish ES cells not only in mice but also in domestic animals such as J rats, rabbits or pigs, and cows. ing. For animal species in which ES cells are not cultured, or in which a cell line that differentiates into germ cells has not been established, the aforementioned (1) or (2)
The mutant gene may be introduced by the method described above.

By mutating the mutant thymidine phosphorylase gene sequence of the targeting vector by gene homologous recombination
It can be carried out by replacing the thymidine phosphorylase gene on the chromosome of animal cells (for example, ES cells). At this time, the marker gene inserted into the targeting vector DNA is inserted into the thymidine phosphorylase gene of the ES cell genome.

The cells into which the targeting vector has been incorporated are selected by inserting a marker gene such as a drug resistance gene in the vector DNA at the same time and culturing in the presence of a drug for an appropriate period based on the expression of the gene. be able to. Among the selected cells, analysis of cells in which a mutation has occurred due to homologous recombination is carried out by Southern hybridization analysis using a DNA sequence on or near the thymidine phosphorylase gene as a probe or a DNA sequence on a targeting vector and targeting. It can be determined by an analysis by the PCR method using a DNA sequence in a region other than the mouse-derived thymidine phosphorylase gene used as the vector as a primer.

Next, using the cells in which the mutant thymidine phosphorylase locus has been generated, a chimeric animal is produced according to a method generally used for producing a chimeric animal such as an injection method or an assembly method. Specifically, cells that have mutated loci (for example, ES cells) are treated at an appropriate time in the early stage of embryogenesis,
For example, by injecting into an 8-cell stage non-human animal embryo or blastocyst, and transplanting the obtained embryo into the uterus of a pseudopregnant animal,
A chimeric animal composed of cells having a normal thymidine phosphorylase locus and cells having a mutant thymidine phosphorylase locus is obtained. The selection of the strain of the animal from which the host embryo is obtained may be performed according to a conventional method so that the ES cell-derived cells and the host embryo-derived cells can be distinguished by the phenotype such as coat color.

When a part of the germ cells of this chimeric animal has a mutant thymidine phosphorylase locus, all tissues are mutated thymidine phosphorylase from the population obtained by mating the chimeric individual with a normal individual. Individuals composed of cells having a locus (animals that do not express thymidine phosphorylase) can be selected by a method of discriminating hair color or the like.

For example, when a chimeric mouse obtained by using a mouse ES cell of the J1 strain and a host embryo of the C57BL / J strain is crossed with the C57BL / 6J strain, the offspring delivered are reproduction of the chimeric mouse. If the cell is derived from a homologous recombinant ES cell, it exhibits the same wild color as the mouse from which the ES cell is derived (agouti), and if it is derived from the host embryo, the same black color as the mouse from which the host embryo is derived. Present. The expression deficiency of the thymidine phosphorylase gene can be confirmed by performing Southern blotting or PCR after pouring out DNA from the tail after weaning.

Further, if the pups deficient in F1 heterotype expression are crossed with each other, pups deficient in F2 heterotype expression and pups deficient in F2 homotype expression can be obtained. The non-human animals of the present invention include chimeric animals, F1 heterozygous expression-deficient animals and F2 animals.
Although the homozygous expression-deficient animal is included, the F2 homozygous-deficient animal is preferable from the viewpoint of the effect of defective expression of the thymidine phosphorylase gene.

The transformed non-human animal thus obtained is
The expression ability of the thymidine phosphorylase gene on the chromosomes of somatic cells and germ cells is defective, and the defect is genetically stable.

The non-human animal deficient in the functions of the thymidine phosphorylase gene and the uridine phosphorylase gene on the chromosome of the present invention can be produced by mating the above-mentioned thymidine phosphorylase expression deficient animal with uridine phosphorylase expression deficient animal. It can also be produced by mating the progeny of non-human animals deficient in the functions of the obtained thymidine phosphorylase gene and uridine phosphorylase gene. Here, as the uridine phosphorylase expression-deficient animal, for example, a partial DNA sequence of the uridine phosphorylase gene is deleted, or the function of the thymidine phosphorylase gene is deficient by inserting or replacing another gene at any site. And specifically, one in which the function of the gene has been deficient by inserting a neomycin resistance gene in place of the second coding exon of the mouse uridine phosphorylase gene, and the like.
It can be created by modification (manipulation) using the genetic engineering method described in Japanese Patent No. 684.

For example, since expression of uridine phosphorylase is high in the mouse small intestine and it has been reported to have thymidine phosphorylase activity, even if an animal in which only thymidine phosphorylase was knocked out was produced in such an organ, Although the thymidine phosphorylase activity cannot be completely abolished, the animals lacking the functions of the thymidine phosphorylase gene and the uridine phosphorylase gene of the present invention have almost completely deleted thymidine phosphorylase activity as shown in Examples below. . Therefore, by using this, it becomes possible to more efficiently and accurately study the physiological function of thymidine phosphorylase in various tissues and elucidate the pathophysiology of diseases involving thymidine phosphorylase.

[0032]

The present invention will be described in more detail with reference to the following examples. Example 1 Targeting of the mouse thymidine phosphorylase gene
Preparation of vector A high density filter obtained by spotting a genomic library in which the genomic DNA of 129SV mouse ES cells was ligated to a BAC vector on a nylon filter at high density was purchased from Genome Systems. Mouse thymidine phosphorylase gene cDNA (Genbank accession number A
B06274) was used as a probe for high density filter hybridization to obtain two positive clones.
Using this, an SpeI-SpeI fragment of about 11 kb containing the intron of the thymidine phosphorylase gene was obtained.
It was ligated to the GEM-5Zf vector and named S8.

Next, a targeting vector for disrupting the structure of the thymidine phosphorylase gene was prepared. AflII of about 1.6 kb containing the start codon of the thymidine phosphorylase gene and exons 2, 3, and 4
The -ClaI fragment was excised from S8. On the other hand, a neomycin resistance gene (pGK-neo-promoter) was inserted instead. Furthermore, the diphtheria toxin A gene (DT-A) was inserted upstream of the thymidine phosphorylase gene on the 5'side in the direction opposite to the original transcription direction. Upon introduction into ES cells, it was cut with AatII and linearized to obtain a targeting vector (FIG. 1).

Example 2 Thymidine ho of ES cells by introducing DNA for homologous recombination
Deficiency of the suphorylase gene 25 μg of DNA for homologous recombination (TP-neo) was suspended in an electroporation buffer containing 2 × 10 ⁷ mouse ES cells (J1 strain), and the electric field strength (Fiel
d Strength) 400 V / cm, Capacitance
) Gene transfer was performed under the condition of 25 μF. TP-n
eo is 175 μg / ml G418 from 48 hours after introduction
Selective culture was performed at a concentration of (Genetisin, GIBCO BRL).

G418-resistant colonies were transferred to each other using a micropipette 184 hours after the gene transfer.
Transfer to a 96-well microplate containing 0 μl of 0.05% trypsin-HBS-EDTA solution, treat for 5 minutes, and pipette to obtain single cells, divide them in half, and divide into 96-well microplates. Transfer and culture were performed. When the cells were sufficiently grown, they were transferred to a 24-well microplate and further cultured. Half was stored in liquid nitrogen and the other half was used for DNA extraction for recombinant detection by Southern hybridization. Although DNA extraction was performed according to a conventional method, since the number of samples was large, DNA precipitated by treatment with proteinase K and isopropanol was cleaved with NheI and subjected to Southern hybridization. The probe is located further downstream of the 3'side homology region used for the targeting vector (downstream of the SpeI cleavage site) 0.5k
The fragment from b was used. The band obtained by Southern hybridization is about 10 kb in non-homologous recombinant ES cells, but it was expected that the homologous recombination band would be about 15 kb due to the deletion of one NheI cleavage site due to the insertion of the neomycin resistance gene. . In addition, DNA is Nde
In the case of the non-homologous recombinant ES cell which was cleaved with I and subjected to Southern hybridization using the same probe, the size of the non-homologous recombinant ES cell was about 8.5 kb. It could be expected to be about 11 kb due to one deletion (Figs. 1 and 2).

The result of the hybridization was Bio-Im.
It analyzed by age Analyzer BAS2000 (Fuji). Regarding the frequency, 6 out of 150 clones of TP-neo underwent homologous recombination (FIG. 3). We selected cells in which the bands of the mutant locus and the wild-type locus appeared at almost the same intensity, and introduced them into blastocysts.

Example 3 Generation of chimeric mice and defective expression of thymidine phosphorylase
Selection of Mouse Chimera mouse was prepared by the method of Bradley et al.
(1987). Production and analysis of chimeric mice i
n teratocarcinomas and embryonic stem cells; A prac
tical approach.EJ Robertoson ed. (Oxford: IRL p
ress), pp113-151), Gossler's method (Gossler, A., D
oetschman, T., Korn, R., Serfling, E., andKemler,
R. (1986) .Transgenesis by means of blastocyst-der
ived embryonic stem cell lines. Proc. Natl. Acad.
Sci. USA, 83, 9065-9069). C57B
Obtain blastocysts from the oviduct 3.5 days after mating L / 6,
About 7 homologous recombinant ES cells were introduced into the lumen. Return it to the uterus of pseudo-pregnant ICR mouse, and select two mice each with pale black hair, which is considered to have a large contribution of ES cells, among the chimeric mice born from this foster mother. Crossed with / 6.
With regard to the born mouse of agouti color, DNA was extracted from the tail and subjected to Southern hybridization by a conventional method. DNA extraction from the tail is done by Prote
After inaseK treatment, it was extracted with phenol, extracted with chloroform, precipitated with ethanol and dissolved in a TE solution. Mice having a gene locus that had undergone recombination were selected, and the mice were crossed to obtain a homozygous mouse having a mutant thymidine phosphorylase locus.

The DNA of the mouse tail was cut with NheI,
It is located further downstream of the 3'side homology region used for the targeting vector (downstream of the SpeI cleavage site).
When Southern hybridization was carried out using a 5 kb fragment as a probe, bands of 10 kb and 15 kb were shown, and it could be determined that the thymidine phosphorylase of one chromosome was destroyed. When five agouti-colored mice were obtained and analyzed by Southern hybridization, two of them showed bands of 10 kb and 15 kb (FIG. 3). These mice were then crossed alternately. The mouse tail DNA was extracted and purified by a conventional method, and the sequences outside and inside the site where the neomycin resistance gene was inserted.
(TPf: GAGCGCTGTAACCCGACCCT (SEQ ID NO: 1), NE
O: CCGATTCGCAGCGCATCGCC (SEQ ID NO: 2)) or the sequence of the wild-type thymidine phosphorylase gene (T which is present only when the neomycin resistance gene is not inserted).
PR: TATCACCGCGTGCACGAAGTTTC (SEQ ID NO: 3)) was used as a primer for gene amplification. When using the wild-type thymidine phosphorylase gene as a template, 640
It was expected that a 400 bp gene amplification product could be obtained from the bp homologous recombinant. Finally, a mouse showing only the band of the gene amplification product of 400 bp, that is, a mouse having a homozygous mutant thymidine phosphorylase locus could be obtained (FIG. 4). It was found that the born mouse did not appear to be abnormal, and was born in a completely healthy state. TP + / between littermates
Mice with genotypes of +, +/-,-/-are almost 1:
Since they were born at a ratio of 2: 1, it was judged that TP − / − were born in a completely healthy state regardless of the genetic background.

Example 4 In normal and thymidine phosphorylase expression deficient mice
Were examined for thymidine phosphorylase activity for mice with mutant thymidine phosphorylase gene that thymidine phosphorylase activity homo. That is, the small intestine and liver tissue were removed from a mouse deficient in thymidine phosphorylase expression and a non-recombinant mouse having the same gene background as a control (normal), and a 4-fold amount of buffer solution (50 mM Tris-Hcl, 1% TritonX-100, 2 mM PMSF was used. , 0.02%
2-Mercaptoethanol) and homogenize to 200
After centrifugation at 0 g for 30 minutes, the supernatant was used to measure the activity. Thymidine phosphorylase activity was determined by T. En
g Gan et al. (T. Eng Gan et al., A rapid and s
imple radiometric assay for thymidine phosphorylas
e of human peripheral blood cells, Clinica Chimica
The production of [ ³ H] thymine from [ ³ H] thymidine was measured according to Acta 116, 231-236, 1981). The results are shown in Table 1.

[0040]

[Table 1]

As a result, the thymidine phosphorylase activity in the liver was remarkably reduced in the thymidine phosphorylase expression-deficient mouse. On the other hand, the thymidine phosphorylase activity in the small intestine tissue was not different from that in the non-recombinant (normal) mouse. Uridine phosphorylase is expressed in the mouse small intestinal tissue, and it has been confirmed that this has thymidine phosphorylase activity.

Example 5 Liver of normal and thymidine phosphorylase-deficient mice
Expression of Thymidine Phosphorylase mRNA in 2 Normal and thymidine phosphorylase expression-deficient mice each had 2 liver tissues excised, and total RNA was extracted using guanidine thiocyanate and phenol. This RN
Using A, the expression of thymidine phosphorylase was examined by the RT-PCR method. As shown in FIG. 5, the thymidine phosphorylase band was not detected in the mouse deficient in thymidine phosphorylase expression.

Example 6 In normal and thymidine phosphorylase expression deficient mice
Blood thymidine concentration from normal and thymidine phosphorylase expression deficient mice,
Blood was collected, separated into serum, and ice-cooled methanol was added in an amount of 9 times, and the mixture was allowed to stand in ice for 30 minutes to sufficiently precipitate the protein. Then, this is centrifuged, and the resulting supernatant is mixed with 6
After drying in a nitrogen gas stream at 0 ° C, the residue is purified with 20% pure water.
Add 0 μl and filter through a 0.45 μm filter,
Uridine, thymidine and cytidine concentrations were measured by the HPLC method. The results are shown in Table 2.

[0044]

[Table 2]

As shown in Table 2, the thymidine concentration in the serum of the normal mouse was 0.094 nmol / ml, whereas that in the mouse deficient in thymidine phosphorylase expression was 0.32 nmol.
/ ml was shown and about 3-fold increase was observed. Uridine and cytidine concentrations were not changed by knocking out thymidine phosphorylase.

Example 7 Normal mouse and mouse deficient in thymidine phosphorylase expression
Metabolic Dynamics of Nucleoside Anticancer Drugs in Rats Changes in blood levels of nucleoside anticancer drugs due to knockout of the thymidine phosphorylase gene were examined using 5-trifluorothymidine (F ₃ dThd).

F of 10 mg / kg was used for normal mice and mice deficient in thymidine phosphorylase expression (n = 3 each).
₃ dThd was orally administered, blood was sampled with time, separated into serum, and the F ₃ dThd concentration was measured by the HPLC method. The results are shown in Table 3.

[0048]

[Table 3]

As shown in Table 3, when F ₃ dThd was orally administered, the F ₃ dThd concentration in thymidine phosphorylase deficient mice was about 6 times higher than that in the normal case (60
Min) It was proved that the degradation of F ₃ dThd in vivo was suppressed due to the lack of thymidine phosphorylase activity.

Example 8 Generation of thymidine phosphorylase and uridine phosphorylase
Generation and selection of presently deficient mouse Mice obtained by mating the thymidine phosphorylase expression-deficient mouse obtained in Example 3 with the uridine phosphorylase expression-deficient mouse described in JP 2001-169684 A are heterozygous mutant thymidine phosphorylase locus and mutant type. Mice carrying the uridine phosphorylase locus were obtained. For these mice, DNA was extracted from the tail, purified, and then examined for the genotypes of thymidine phosphorylase and uridine phosphorylase. Therefore, gene amplification was carried out using each unique primer. For the thymidine phosphorylase gene, the same primers (T
Pf (SEQ ID NO: 1), Neo (SEQ ID NO: 2), TPr
(SEQ ID NO: 3)) was used for gene amplification. It was expected that a gene amplification product of 640 bp was obtained when the wild-type thymidine phosphorylase gene was used as a template, and that of the mutant type was 400 bp. Regarding the uridine phosphorylase gene, a sequence corresponding to the mutant uridine phosphorylase gene (PGK-3: CCTGAAGAACGAGATCAGC
AGCCTC (SEQ ID NO: 4), UPG-4: AGCTCTTGCTCCTTCGC
CTGCTTGC (SEQ ID NO: 5)) or a sequence (UPG-2: CAAAGCTGAG) corresponding to the wild-type uridine phosphorylase gene.
GCCCAACTGCCATGG (SEQ ID NO: 6), UPG-3: CCTTGGA
Gene amplification was performed using CTTCCATTCACAGCTGCG (SEQ ID NO: 7)) as a primer. When the wild-type uridine phosphorylase gene was used as a template, it was expected that a 210 bp gene amplification product could be obtained with the mutant uridine phosphorylase gene. These mice were further bred to finally give only a 400 bp gene amplification product for the thymidine phosphorylase gene and only a 313 bp gene amplification product for the uridine phosphorylase gene, ie, a homozygous mutant thymidine phosphorylase locus and a mutant type. Mice carrying the uridine phosphorylase locus could be obtained (Fig. 6). It was found that the newborn mice were apparently healthy, and no abnormalities were found.

Example 9 Normal and Thymidine Phosphorylase and Uridine Phosphoryl
Thymidine phosphorylase in mice lacking lacase expression
Activity and Uridine Phosphorylase Activity For mice having a homozygous mutant thymidine phosphorylase gene and a mutant uridine phosphorylase gene, the presence or absence of thymidine phosphorylase activity and uridine phosphorylase activity was examined in the same manner as in Example 4. The results are shown in Table 4.

[0052]

[Table 4]

As a result, the thymidine phosphorylase activity was high in the liver tissue of the wild-type mouse, but the thymidine phosphorylase expression deficient mouse, or the thymidine phosphorylase- and uridine phosphorylase-expressing mouse had almost this activity deleted. The thymidine phosphorylase activity in the small intestine was maintained in thymidine phosphorylase-deficient mice, but was markedly decreased in uridine phosphorylase-deficient mice, and was almost abolished in thymidine phosphorylase- and uridine phosphorylase-expressing mice. It has been reported that the mouse small intestine has high expression of uridine phosphorylase, which has thymidine phosphorylase activity.
Uridine phosphorylase activity was high in the small intestine of wild-type mice, and was almost deleted in uridine phosphorylase-deficient mice, thymidine phosphorylase- and uridine phosphorylase-expressing mice.

Example 10 Normal and thymidine phosphorylase and uridine phosphoryl
Blood Nucleoside Concentrations in Lase-Deficient Mice In the same manner as in Example 6, normal and thymidine phosphorylase and uridine phosphorylase blood nucleoside concentrations were measured. The results are shown in Table 5.

[0055]

[Table 5]

As shown in Table 5, the thymidine concentration in the serum of normal mice was 0.185 nmol / ml, whereas in thymidine phosphorylase / uridine phosphorylase expression-deficient mice, 1.042 nmol / ml resulted in about a 5-fold increase. I was seen. Uridine concentration is 0.588 nmol / m
However, in the mouse deficient in expression of thymidine phosphorylase and uridine phosphorylase, 1.047 nmol
About 2 times increase was seen at / ml. In addition, the deoxyuridine concentration was 0.154 nmol / ml, whereas in mice deficient in thymidine phosphorylase and uridine phosphorylase expression, a 6-fold or more increase was observed at 0.995 nmol / ml.

[0057]

INDUSTRIAL APPLICABILITY According to the present invention, a genetically stable thymidine phosphorylase-deficient animal can be obtained. Such animals are useful as a model animal for studying physiological functions of thymidine phosphorylase, elucidation of pathophysiology of diseases related to thymidine phosphorylase such as abnormal thymidine metabolism, and further for studying pharmacokinetics of nucleoside antimetabolites. .

[0058]

[Sequence list]                           SEQUENCE LISTING <110> Taiho Pharmaceutical Co., LTD.       Misako Haraguchi <120> Animals with insufficient expression of thymidine phosphorylase <130> P04251309 <160> 7 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 gagcgctgta acccgaccct 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 ccgattcgca gcgcatcgcc 20 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <400> 3 tatcaccgcg tgcacgaagt ttc 23 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <400> 4 cctgaagaac gagatcagca gcctc 25 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <400> 5 agctcttgct ccttcgcctg cttgc 25 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <400> 6 caaagctgag gcccaactgc catgg 25 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <400> 7 ccttggactt ccattcacag ctgcg 25

[0059]

[Brief description of drawings]

FIG. 1 is a schematic diagram showing the mouse thymidine phosphorylase gene and its targeting disruption. In the figure, neo indicates the neomycin resistance gene, DT-A indicates the diphtheria toxin A fragment gene, the thick solid line indicates exons, and the thin solid line indicates introns.

FIG. 2 shows the results of genomic Southern hybridization for confirming homologous recombinant ES cells. In the figure, + / + indicates a normal mouse and +/− indicates a heterozygous deficient mouse.

FIG. 3 shows the results of genomic Southern hybridization to confirm homologous recombinant mice.
In the figure, + / + indicates a normal mouse and +/− indicates a heterozygous deficient mouse.

FIG. 4 shows the results of PCR for confirming homologous recombinant mice. In the figure, + / + indicates a normal mouse, + / +
− Indicates a hetero-deficient mouse, and − / − indicates a homo-deficient mouse.

FIG. 5 is a diagram showing the expression level of thymidine phosphorylase in a normal mouse and a mouse deficient in thymidine phosphorylase expression. In the figure, + / + indicates a normal mouse and − / − indicates a homo-deficient mouse.

FIG. 6 shows the results of PCR for confirming homologous recombinant mice. In the figure, + / + indicates a normal mouse, + / +
− Indicates a hetero-deficient mouse, and − / − indicates a homo-deficient mouse.

   ─────────────────────────────────────────────────── ─── Continued front page    (72) Inventor Misako Haraguchi             2-49-11 Higashisakamotomachi, Kagoshima City, Kagoshima Prefecture (72) Inventor Masakazu Fukushima             8-5-202, Honmachi 3-chome, Hanno City, Saitama Prefecture (72) Inventor Shinichi Akiyama             Kagoshima City, Kagoshima City F-term (reference) 4B024 AA01 BA10 CA04 CA07 DA02                       EA04 GA11 HA12

Claims (8)

[Claims] 1. A non-human animal deficient in the function of the thymidine phosphorylase gene on the chromosome and its progeny. 2. The function of the thymidine phosphorylase gene is deficient by deleting a part of the DNA sequence of the thymidine phosphorylase gene or inserting or substituting another gene at any site.
The described non-human animal and its progeny. 3. The non-human animal and its progeny according to claim 2, wherein the other gene is a marker gene. 4. The non-human animal and its progeny according to claim 3, wherein the marker gene is a neomycin resistance gene. 5. The non-human animal according to any one of claims 1 to 4, wherein the neomycin resistance gene is inserted in place of the first to fourth coding exons of the mouse thymidine phosphorylase gene, and the progeny thereof. 6. The non-human animal and its progeny according to any one of claims 1 to 5, which further lacks the function of the uridine phosphorylase gene on the chromosome. 7. The animal according to claim 1, which is a rodent.
The non-human animal and the progeny thereof according to any one of 1. 8. The non-human animal and its progeny according to claim 7, wherein the rodent is a mouse.