JP2003088370A - scFv RECOMBINANT ANTIBODY TO SURFACE ANTIGEN OF SPOROZOIT OF EIMERIA SP. CAUSING AVIAN COCCIDIOSIS - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a DNA encoding a variable region of a heavy chain and a light chain of a new antibody to a surface antigen of a sporozoit of Eimeria sp. causing avian coccidiosis. SOLUTION: The present invention relates to a new scFv recombinant antibody to the surface antigen of the sporozoit of Eimeria sp. causing avian coccidiosis, more particularly a new variable region of the heavy chain and the light chain especially suitable for producing scFv recombinant antibody and a scFv recombinant antibody using the same. The scFv recombinant antibody described in the present invention sufficiently exhibits a function as an antibody, shows excellent tissue permeability because of the small size thereof, can be produced in large amount through a host cell of a prokaryotic cell such as E. coli, and is available for manual immunization of the avian coccidiosis and affinity purification to an eimeria vaccine antigen.

Description

Detailed Description of the Invention

The present invention relates to recombinant antibodies, and more particularly to Eimeeria species which induce avian coccidiosis.
ria sp.) sporozoite surface antigens
It relates to the cFv antibody.

Intestinal parasites belonging to the genus Eimeria, such as Eimeria acervu
avian coccidiosis induced by lina)
sis) is a disease that causes considerable economic losses in the poultry industry. While such development of a therapeutic method or a chemotherapeutic agent through the use of whole parasites have been made to treat the disease, they have a big disadvantage. For example, due to the complex life history of the parasite and the variety of species that infect chickens, the immunization method using the whole parasite exhibits species specificity, and there is a problem that it is not effective among different species (Reynaud, CA et a
l., Eur. J. Immunol. 21: 2661 (1991)). On the other hand, anti-coccidia drugs are expensive and have a problem that drug resistance is developed. Much research has therefore focused on the development of immunomodulation, which is largely dependent on the identification of target antigens that induce a protective immune response by the host immune system and the study of their properties.

Current efforts to develop immunomodulation against coccidiosis include the identification of immunogenic epitopes of the Eimeria parasite that elicit cell-mediated immune responses (Lillehoj, HS et al., Avian Dis. , 44: 4
08-425 (2000)). In general, two types of immunological methods are planned. The first is to utilize a recombinant subunit vaccine derived from a parasite protein that binds to the host cell housing, where the avian coccidia parasite enters the host through epithelial cells on the intestinal surface of the host. This is because (Al-Atar, MA et al., J. Parasitol., 73: 494.
-502 (1987); and Lawn, AM et al., J. Parasitol.,
68: 1117-1123 (1982)). The second method is a manual immunization method using an antibody that interferes with the interaction between host cells and parasites (Sasaki, K. et al., J. Parasitol., 82:82.
-87 (1996)).

A large number of Sporeworm antigens have been identified using mouse antibodies (Speer, CA et al., J. Protozol., 30:54.
8-554 (1983)), these DNAs have been cloned for the development of subunit vaccines (Castle, MD e.
t al., J. Parasitol., 77: 384-390 (1991); and Ko,
C. et al., Mol. Bio. Parasitol., 41: 53-64 (199
0)). However, although a negative opinion has emerged for the efficacy of the antibody and the like (Trout, J. et al., J. Parasitol.,
73: 790-792 (1993)) because the target antigens recognized by immune sera isolated from chickens and mice are different (Jenkins, MC et al., Mol. Bio. Parasito.
L., 25: 155-164 (1987)).

Therefore, from the above aspect, the chicken antibody is more preferable for the identification of the target antigen that induces avian coccidiosis.

Recently, four kinds of chicken monoclonal antibodies (Mabs: 2-1, 5D11, 8C) that recognize Eimeria antigens have been recently used.
3 and 13C8) have been developed (Lillehoj, HS et al.,
Eimeria. Poul. Sci., 73: 1685-1693 (1994) and Sasak
i, K. et al., J. Parasitol., 82: 82-87 (1996)), and their biochemical properties were found. The immunological properties of the antigen recognized by the antibody are currently under investigation. on the other hand,
It has been found that the developed chicken monoclonal antibody recognizes a surface antigen located in the apical complex of Eimeria cervulina, which fact indicates that anti-Eimeria can be used for manual immunization. To show that Mabs are available. However, chicken hybridomas have a problem that they have a low antibody-producing ability, produce non-specific IgM, and have a reduced ability to produce antibodies (Nishinak).
a, S. et al., J. Immunol. Methods., 139: 217-222 (1
991) and Nishinaka, S. et al., J. Vet. Med. Sci., 5
8: 1053-1056 (1996)).

On the other hand, US Pat. No. 4,710,377 discloses an invention relating to a monoclonal antibody against Eimeria sporozoites, and US Pat. No. 5,656,485 discloses an antibody against avian coccidiosis. No. 5,635,181 discloses a recombinant anti-coccidial vaccine, US Pat. No. 4,30.
No. 1,148 discloses anticoccidial drugs.

Throughout this specification, numerous patents and articles are referenced and cited. The disclosures of the cited patent documents and articles are included in the specification in their entireties so that the state of the art to which the present invention belongs and the content of the present invention will be more clearly described.

Accordingly, it is an object of the present invention to provide variable regions of the heavy and light chains of a novel antibody against the surface antigen of Eimeria sp. Sporozoites which induce avian coccidiosis.

Another object of the present invention is to provide a DNA encoding variable regions of the heavy and light chains of a novel antibody against the surface antigen of Eimeria sporozoites which induce avian coccidiosis.

Another object of the present invention is to provide a novel scFv (single chain var) that reacts with the surface antigen of Eimeria sporozoites that induce avian coccidiosis.
iablefragment) antibody.

Another object of the present invention is to provide a DNA encoding a novel scFv against the surface antigen of Eimeria sporozoites which induce avian coccidiosis.

Another object of the present invention is to provide a method for producing a novel scFv against the surface antigen of Eimeria sporozoites which induce avian coccidiosis.

Another object of the present invention is to provide a scFv expression vector for the surface antigen of Eimeria sporozoites which induces avian coccidiosis.

According to one aspect of the present invention, the present invention provides an Eimeria species comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24 and SEQ ID NO: 38 ( Eimeria sp.) Provides the variable region of the heavy chain of the antibody to the surface antigen of the sporozoites.

According to another aspect of the invention, the invention comprises SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32.
And a variable region of the light chain of an antibody to the surface antigen of Eimeria sporozoites comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 40.

The present invention was developed to solve the above-mentioned problems of the prior art, particularly the problems of the method for obtaining an antibody against coccidiosis from a hybridoma cell line. The present inventors have adopted gene recombination technology in order to overcome the limitations of hybridoma technology, and among the characteristics of antibodies, in order for antibody to bind to antigen and exert its function, antigen binding The property that the variable region of the heavy chain and light chain (λ or κ) is essential is utilized.

Therefore, the present inventors have obtained the variable regions of the heavy and light chains of the antibody described in detail in order to produce a recombinant antibody containing the above variable region.

On the other hand, according to another aspect of the present invention, the present invention comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24 and SEQ ID NO: 38. DN encoding variable region of heavy chain of antibody to surface antigen of Eimeria sporozoites
Provide A. Preferably, the DNA sequence has a nucleotide sequence selected from the group consisting of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23 and SEQ ID NO: 37.

According to another aspect of the invention, the invention comprises SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32.
And a DNA encoding the variable region of the light chain of an antibody against the surface antigen of Eimeria sporozoites, which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 40. Preferably, the DNA sequence is SEQ ID NO: 25,
It has a nucleotide sequence selected from the group consisting of SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 39.

The DNAs encoding the variable regions of the heavy and light chains of the antibody to the surface antigen of the Eimeria sporozoites detailed above were obtained by the following basic method: mouse and human. Unlike such mammals, immunoglobulin gene diversity in chickens is mainly manifested by gene conversion (Reyanu
d, CA et al., Cell, 40: 283-291 (1985); Reyanud,
CA et al., Cell, 48: 379-388 (1987); Reyanud,
CA et al., Cell, 59: 171-183 (1989); and Rose,
ME Immune response in parasitic Infections; Immu
nology, Immunopathology, Immunoprophylaxis, CRC Pr
ess, Boca Raton, Florida, p.275 (1987)). More specifically, the upstream pseudovariable site gene (upst
Ream pseudovariable region genes) diversify a single immunoglobulin variable fragment and a joining fragment at each of the heavy and λ-light chain positions (Reyanu
d, CA et al., Cell, 48: 379-388 (1987); Reyanud,
CA et al., Cell, 59: 171-183 (1989); Rose, ME
Immune response in parasitic Infections; Immunolo
gy, Immunopathology, Immunoprophylaxis, CRC Press,
Boca Raton, Florida, p. 275 (1987); and Thompson,
CB et al., Cell, 48: 369-378 (1987)). Furthermore, the sequences of the pseudogenes are highly conserved at the 5'- and 3'-terminal sites, a fact that in murine B cells or hybridomas all variable sites have the same ends. , The gene conversion mechanism in chickens utilizes a pair of primers per heavy chain and λ-light chain to amplify various site genes.

The method for amplifying the above-mentioned gene is carried out by using an ordinary PC.
R method (Saiki, RK, PCR Technology, Principles an
d Applications for DNA Amplification, Erlich, HA
ed., Stockton Press, New York (1989)). The primer of the present invention used in PCR was prepared based on the retention of the terminal sequence of the pseudogene described in detail, and the primer used for amplifying the gene encoding the variable site of the heavy chain is , A pair of primers each containing a base sequence encoding the amino acid sequence set forth in SEQ ID NO: 33 and SEQ ID NO: 34, and more preferably a base encoding the amino acid sequence set forth in SEQ ID NO: 33 of the primer pair. The primer containing the sequence is a primer containing the nucleotide sequence of SEQ ID NO: 1 or a primer containing the complementary sequence thereof, and is SEQ ID NO: 3
The primer containing the base sequence encoding the amino acid sequence described in 4 is a primer containing the base sequence of SEQ ID NO: 2 or a primer containing its complementary sequence.

The primer used for amplifying the gene encoding the variable region of the light chain is preferably a pair of primers each containing a nucleotide sequence encoding the amino acid sequence set forth in SEQ ID NO: 35 and SEQ ID NO: 36. More preferably, the primer containing the base sequence encoding the amino acid sequence set forth in SEQ ID NO: 35 of the primer pair is a primer containing the base sequence set forth in SEQ ID NO: 3, and the amino acid sequence set forth in SEQ ID NO: 36 is The primer encoding the base sequence is a primer containing the base sequence of SEQ ID NO: 4.

Further, the primers usable in the present invention are hybridized with a DNA template.
ion) and includes a base sequence that is non-covalently bound to the DNA template to the extent that it can perform its own function in the DNA amplification reaction. That is, it not only forms Watson / Crick base pairs completely against the DNA template, but also functions as a primer even if there is a part that does not form Watson / Crick base pairs. It contains a primer that has a sufficient binding ability to the DNA template.

According to another aspect of the present invention, the present invention provides (a) an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24 and SEQ ID NO: 38. A variable region of the heavy chain of an antibody to the surface antigen of Eimeria sporozoites comprising; and (b)
The variable region of the light chain of the antibody to the surface antigen of Eimeria sporozoites containing an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 40 is linked. ScFv against surface antigens of Eimeria sporozoites
(Single chain variable fragment) antibody is provided.

According to a preferred embodiment of the present invention, when the variable region of the heavy chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 18, the variable region of the light chain is the amino acid sequence of SEQ ID NO: 26. A polypeptide that includes a sequence.

According to a preferred embodiment of the present invention, when the variable region of the heavy chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 20, the variable region of the light chain is the amino acid sequence of SEQ ID NO: 28. A polypeptide that includes a sequence.

According to another preferred embodiment of the invention,
When the variable region of the heavy chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 22, the variable region of the light chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 30.

When the variable region of the heavy chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 24, the variable region of the light chain is preferably a polypeptide containing the amino acid sequence of SEQ ID NO: 32.

According to a preferred embodiment of the present invention, when the variable region of the heavy chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 38, the variable region of the light chain is the amino acid sequence of SEQ ID NO: 40. A polypeptide that includes a sequence.

According to another variant of the invention, the scF
The v antibody additionally comprises a linker between the variable regions of the heavy and light chains. The linker is a peptide that is commonly used in the art to artificially link the variable regions of the heavy and light chains and stabilize the antigen-binding ability of the scFv antibody (Reference: For example, the GS linker is Huston et al., Methods in Enzymology, 203: 46-8
8 (1991), EK linker is Whitlow, et al., Protein E.
ng., 6: 989 (1993)). The linker is generally composed of glycine and serine amino acids and has a length of 15-18 amino acids.

Therefore, the most preferred combination in the scFv antibody of the present invention is (a) heavy chain of SEQ ID NO: 18-linker-light chain of SEQ ID NO: 26, (b) heavy chain of SEQ ID NO: 20-linker-SEQ ID NO: 28 light chains, (c) SEQ ID NO: 2
2 heavy chain-linker-light chain of SEQ ID NO: 30, heavy chain of (d) SEQ ID NO: 24-linker-light chain of SEQ ID NO: 32 and (e) heavy chain of SEQ ID NO: 38-linker- light chain of SEQ ID NO: 40 It is a chain.

According to another aspect of the present invention, the present invention provides (a) an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24 and SEQ ID NO: 38. A DNA encoding the variable region of the heavy chain of an antibody against the surface antigen of Eimeria sporozoites, including; and (b) a group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 40 D encoding an scFv against an Eimeria sporozoite surface antigen, which is ligated to a DNA encoding a variable region of a light chain of an antibody against an Eimeria sporozoite surface antigen containing an amino acid sequence selected from
Provide NA.

According to a preferred embodiment of the present invention, the DNA encoding the scFv is a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 18 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 26. Are connected.

According to another preferred embodiment of the invention,
The DNA encoding the scFv is formed by ligating the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 20 and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 28.

According to another preferred embodiment of the invention,
The DNA encoding the scFv is formed by ligating the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 22 and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 30.

According to a preferred embodiment of the present invention, the DNA encoding the scFv is a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 24 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 32. Are connected.

According to a preferred embodiment of the present invention, the DNA encoding the scFv is a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 38 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 40. Are connected.

According to a more preferred embodiment of the present invention,
The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 18 is the DNA of SEQ ID NO: 17, the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 20 is the DNA of SEQ ID NO: 17, and the SEQ ID NO: 22.
DNA encoding a polypeptide containing the amino acid sequence of
Is the DNA of SEQ ID NO: 21, the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 24 is the DNA of SEQ ID NO: 23, and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 38 is SEQ ID NO: 37. DNA of

According to a more preferred embodiment of the present invention,
The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 26 is the DNA of SEQ ID NO: 25, the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 28 is the DNA of SEQ ID NO: 27, and the SEQ ID NO: 30.
DNA encoding a polypeptide containing the amino acid sequence of
Is the DNA of SEQ ID NO: 29, the DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 32 is the DNA of SEQ ID NO: 31, and the DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 40 is the sequence It is the DNA of No. 39.

In a modification of the present invention, the DNA encoding the scFv is a DNA encoding a heavy chain variable site.
A DNA sequence encoding a linker is additionally included between the sequence and the DNA sequence encoding the light chain variable region.

According to another aspect of the present invention, the invention provides (a) (i) SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 2.
2, a DNA encoding the variable region of the heavy chain of an antibody against the surface antigen of Eimeria sporozoites comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 24 and SEQ ID NO: 38; and (ii) SEQ ID NO: 26 , SEQ ID NO: 2
8, scFv set comprising DNA encoding the variable region of the light chain of an antibody to the surface antigen of Eimeria sporozoites, which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 40 Cloning the replacement gene into an expression vector;
A surface antigen of an Eimeria sporozoite comprising: (b) transforming a host cell with the expression vector; and (c) expressing the scFv using the transformed host cell and obtaining the scFv. ScFv against
A method for manufacturing the same is provided.

The host cells used in the production method of the present invention can be eukaryotic cells and prokaryotic cells that are commonly used for expression of expression vectors, but preferably E. coli or Bacillus, etc., which are easily commercially available. And when E. coli is used, BMH71-18 or BL21 (D
E) etc. can be used.

According to a preferred embodiment of the present invention, the birds to which the recombinant scFv of the present invention is applied include birds with coccidiosis, such as chickens, ducks, turkeys, quail, pheasants, geese, geese and the like. However, it is not limited to this.

In a preferred embodiment of the present invention, the recombinant antibody of the present invention acts on Eimeria s species.
p.) induces coccidiosis in birds. Eimeria acervulina Eimeria tenella, Eimeria maxima
axima), Eimeria coccidi
a), Eimeria mitis, Eimeria praecox, Eimeria brunetti, Eimeria necatrix, Eimeria necatrix
a mivati) and Eimeria hagani, etc., but are not limited thereto.

On the other hand, Eimeria has a complicated infectious life history, in which the asexual penetrating sporozoite (sporoz) is used.
oites) are formed in the digestive tract of chickens and penetrate into epithelial cells to develop into a multinucleate structure commonly known as schizont. It is therefore an object of the present invention to produce antibodies that act on the surface antigens of Eimeria sporozoites.

According to a preferred embodiment of the present invention, the scFv recombinant gene comprises a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 18 and SEQ ID NO: 2.
DN encoding a polypeptide containing 6 amino acid sequences
A is connected.

According to another preferred embodiment of the invention,
The scFv recombinant gene is formed by ligating a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 20 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 28.

According to another preferred embodiment of the present invention,
The scFv recombinant gene is formed by ligating a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 22 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 30.

According to another preferred embodiment of the invention,
The scFv recombinant gene is formed by ligating a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 24 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 32.

According to another preferred embodiment of the invention,
The scFv recombinant gene is formed by ligating a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 38 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 40.

According to another variant of the invention, the scF
The v recombinant gene is a DN encoding the variable region of the heavy chain.
A linker-encoding sequence is additionally included between A and the DNA encoding the variable region of the light chain. The additional insertion of the linker can be performed by various methods, for example, overlap-extension PCR (Horton, RM et al., Gene, 7) in the process of constructing the scFv recombinant gene.
7: 61-68 (1989)).

According to a more preferred embodiment of the present invention,
The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 18 is the DNA of SEQ ID NO: 17, the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 20 is the DNA of SEQ ID NO: 17, and the SEQ ID NO: 22.
DNA encoding a polypeptide containing the amino acid sequence of
Is the DNA of SEQ ID NO: 21, the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 24 is the DNA of SEQ ID NO: 23, and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 38 is SEQ ID NO: 37. DNA of

According to a more preferred embodiment of the present invention,
The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 26 is the DNA of SEQ ID NO: 25, the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 28 is the DNA of SEQ ID NO: 27, and the SEQ ID NO: 30.
DNA encoding a polypeptide containing the amino acid sequence of
Is the DNA of SEQ ID NO: 29, the DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 32 is the DNA of SEQ ID NO: 31, and the DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 40 is the sequence It is the DNA of No. 39.

In the method of the present invention, the transforming step is carried out by incorporating the expression vector into a host cell. When the host cell is a prokaryotic cell, the transformation method is the CaCl ₂ method (Cohen, SN et al., Pr.
oc. Natl. Acac. Sci USA, 9: 2110-2114 (01973)), Hanahan method (Cohen, SN et al., Proc. Natl. Acac.S
ci USA, 9: 2110-2114 (01973); and Hanahan, D., J.
Mol. Biol., 166: 557-580 (1983)) and electroporation method (Dower, WJ et al., Nucleic. Acids Res., 16: 612).
7-6145 (1988)) and the like. When the host cell is a eukaryotic cell, the microinjection method (Capecchi, M.
R., Cell, 22: 479 (1980)), calcium phosphate precipitation method (Graham, FL et al., Virology, 52: 456 (1)
973)), electroporation (Neumann, E. et al., EMBO J.,
1: 841 (1982)), liposome-mediated infection method (Wong,
TK et al., Gene, 10: 871 (1980)), DEAE-dextrin treatment method (Gopal, Mol. Cell Bio., 5: 1188-119).
0 (1985)) and gene bombardment (Yang et al.,
Proc. Natl. Acad. Sci., 87: 9568-9572 (1990)) and the like, so that the expression vector can be injected into the host cell.

The expression vector injected into the host cell is expressed in the host cell and the scFv antibody of interest can be obtained. According to a preferred embodiment of the present invention, when the expression vector contains a lac promoter, the host cell may be treated with isopropyl-β-D-thiogalactopyranoside (IPTG) to induce gene expression. it can.

According to another aspect of the present invention, the invention provides (a) (i) SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 2.
2, a DNA encoding the variable region of the heavy chain of an antibody against the surface antigen of Eimeria sporozoites comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 24 and SEQ ID NO: 38; and (ii) SEQ ID NO: 26 , SEQ ID NO: 2
8, scFv set comprising DNA encoding the variable region of the light chain of an antibody to the surface antigen of Eimeria sporozoites, which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 40 And (b) a scFv expression vector for the surface antigen of Eimeria sporozoites, which comprises a promoter operably linked to the scFv recombinant gene.

Regarding the contents common to the production method of the present invention described in detail in the vector of the present invention, the description thereof will be omitted to avoid excessive complexity of the specification. For example, in the vector of the present invention, the contents of the scFv recombinant gene, the DNA sequences encoding the variable regions of the heavy and light chains to be used, the linker, and the like are similar to those of the production method of the present invention described in detail. Have.

The scFv expression vector of the present invention is a scF
v In order to facilitate the secretion of the recombinant antibody out of the host cell, preferably a leader region such as pel B, gene III or ompA is additionally included.

Further, the scFv expression vector is preferably fused with another sequence in order to facilitate the purification of the scFv expressed from itself. Fusion sequences include, for example, glutathione-S-transferase (Pharmacia, US
A), maltose binding protein (NEB, USA), FLAG (I
BI, USA) and 6x His (hexahistidine; Quiagen,
USA) and most preferably 6x His, since such additional sequences are non-antigenic and do not interfere with the folding of the variable sites of the protein, ie heavy and light chains. Is. Due to the additional sequences for purification, the host-expressed protein is rapidly and easily purified through affinity chromatography.

According to a preferred embodiment of the invention, the fusion protein expressed by the vector containing said fusion sequence is purified by affinity chromatography. For example, when glutathione-S-transferase is fused, the substrate for this enzyme, glutathione, can be used, and when 6xHis is used, a Ni-NTAHis-bonded resin column (Novagen,
USA), the desired scFv recombinant antibody can be obtained rapidly and easily.

On the other hand, when the scFv expression vector of the present invention uses a prokaryotic cell as a host, it preferably contains a major promoter such as p _L λ promoter, trp promoter, lac promoter, T7 promoter, etc. In the case of, a promoter derived from the genome of mammalian cells (eg, metallothionine promoter) or a promoter derived from mammalian virus (eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV4)
0 promoter, cytomegalovirus promoter and HSV tk promoter).

The expression vector of the present invention is a selectable marker and contains an antibiotic resistance gene that is commonly used in the art, and includes, for example, ampicillin, gentamicin, cabenicillin, chlorampenicol, streptomycin. ), Kanamycin (ka
namycin), geneticin, neomycin
And tetracycline resistance genes, preferably ampicillin or gentamicin resistance genes in view of cost.

Hereinafter, the present invention will be described in more detail through examples. These examples are merely for more specifically explaining the present invention, and the scope of the present invention is not limited to these examples due to the gist of the present invention. Anyone with ordinary knowledge will understand it.

[Example] Experimental materials and methods I.chicken As a reproductive egg, the acquired white leghorn mating
Miscellaneous (SC^R) Fertilized eggs are commercially available
Obtained from Reiser (Hyline International, USA)
And immunize the fertilized egg with parasite immunity in the US state of Maryland.
Parasite Immunobiology Laboratory
And keep in the incubator until 3 weeks of age, then wire
-Maintained in the bottom cage. Chickens have a clean wire bottom case.
Reared in Ji. Experimental chickens are not exposed to specific pathogens
I was careful. Unlimited access to food and drink
I tried to become Noh.

II.Eimeria Aserbrina sporozoites
Preparation of (sporozoites) Eimeria acervulina (# 84 USDA strain, U
S) spore oocytes were collected. Next, Hanks' equilibrium
In the salt solution (Hank's balanced salt solution: HBSS)
0.125% (w / v) trypsin (Sigma, USA) and
In a solution containing 1% trodeoxycholine acid (pH 7.6)
The oocytes at 5% CO for 10 minutes at 41 ° C._Two
Excysting in a thermostat and sporo
I got a zoite. The sporozoites thus obtained
DEAE-Cellulose Column (DE52; Whatman Paper Lt
d., USA) and separated from cell debris using
I got only the zoites.

III.Preparation of sporozoite antigen The sporozoite (10) in phosphate buffer (PBS)
⁹/ ml), freeze-thaw 6 times using dry ice
After carrying out, it was warmed to room temperature. Next, sporozoites
 Microson Ultrasonic Cell Disruptor (Heat System,
USA) and sonicate at 4 ° C to
Ito surface antigen was obtained.

IV.Production of chicken B-cell hybridomas I.Hybridoma cell lines 2-1, 5D11, 8C3 and
And manufacturing of 13C8 Single clone with specificity for coccidial antigen
In order to produce hybridomas that produce antibodies,
The antigen of III above obtained from Eimeria acervulina
After emulsifying with incomplete auxiliary solution of Pro India, the emulsion
Was intramuscularly injected into the SC chicken of I, 6-12 weeks old. same
A second injection using one formulation to give additional immunization
Intravenous injection for 1 week using the above formulation without adjuvant
It was carried out at intervals. Final boosting is cell fusion
It was performed 3 days ago by intravenous injection. Next, the hybrid
Dorma manufacturing is presented by Nishinaka et al.
This method was used as follows (Nishinaka, S.
et al., J. Immunol. Methods., 139: 217-222 (1991); and
And Nishinaka, S. et al., J. Vet. Med. Sci., 58:10
53-1056 (1996)): 3 days after the final immunization.
In addition, the spleen storage single-cell suspension was subjected to a picor-fake density gradient.
Centrifuge at 500 g for 20 minutes at 20 ° C
Got away. Cell fusion by Lillehoj, H.S. et al., Pou
l. Sci., 73: 1685-1693 (1994).
R27H4 non-secretory chicken myeloma cell line (Japan, NKK Co
Nishi of rporation, Biotechnology Development Center
Polyethylene Glycol with (from naka S. Dr.)
The test was performed with a 4000 (Sigma). 10% of fused cells
Fetal serum and hypoxanthine-aminopterin-thymidine
(HAT; Sigma) containing Ibucobs modified Jul
Suspend in Becos medium (IMDM), 96-well microphone
(B) Plated on a culture plate. 2 weeks have passed
After that, enzyme-linked immunosorbent assay (ELISA: Langone, J.J.
 et al., Immunochimical Techniques, Part A. Methods
 in Enzymology, 92, Academic Press (1983))
Sporozoite antigens immobilized on plates (see III above)
Screened the hybrid clone with the obtained one)
I'm sorry A hive that produces the desired monoclonal antibody
Lydoma was irradiated as a feeder cell
Splenocytes (2 x 10⁶/ Well) to limit dilution
And cloned. Hybridoma thus obtained
The cells were designated as "2-1, 5D11, 8C3 and 13C8" respectively.
Named. Hybridoma cell line thus obtained
The criteria for categorizing
Difference, b) difference in antibody secretion and production rate, and c) antigen binding ability
And d) differences in the epitopes recognized within the antigen. Ha
Undiluted culture suspension derived from ibridomas
Used in all experiments.

B.Hybridoma cell line 6D-12-G
10 manufacturing Preparation of CD8 ⁺ cells Spleen warehouses were obtained from 6-8 week old SC chickens of the above-mentioned I and injected with syringe syringes.
Destroy in the HBSS through the screen body with a Langer
It was Histofake 1077 density gradient for single cell suspension
Place on distribution medium (Sigma), 1800 rpm for 20 minutes
Centrifuged at room temperature. Next, the lymphocytes on the boundary surface
Collect with a Pasteur pipette and wash 3 times in HBSS
did. CD8⁺ T cell hybridomas are associated with splenic lymphocytes
R1 / 5 chicken T lymphoma cells (US, Animal and Natural
Resources Institute, Parasite Biology, Epidemiolog
y, obtained from Dr. Lillehoj, Systemic Laboratory)
Polyethylene glycol 4000 fused and obtained, high
Bridoma cells with 10% fetal bovine serum and hypoxanthine
-Aminopterin-thymidine (HAT, Sigma) included
96-well microspheres after resuspending in IMDM
Plated on culture plates. 10-14 days have passed
24-well plates showing growth after
, 10% fetal bovine serum and hypoxane
Grown in IMDM containing Chin-Thymidine
Let When hybridoma cells show aggregating properties, Lillehoj
 et al., Eur. J. Immun. 18: 2059-2065 (1998).
Single claw capable of detecting CD8 antigen by the described method
Antibody, using the antibody
-It was analyzed by cytometry. EPI the stained cells
CS propyl II flow cytometry (Coulter Cooper
ation, Hialeah, Florida). Each
10 for hybridomas^FourOf live cells of
It was CD8⁺The T cell hybridoma is used as a supply cell,
Irradiated spleen cells (2 x 10⁶/ Well)
Cloning with limited thickness (Lillehoj et al., Eu
r. J. Immun. 18: 2059-2065 (1998)). CD8⁺Antigen
The expressing hybridoma cells are allowed to grow and some of the other
Frozen for the experiment.

[0070]Hybridoma cell line 6D-12-G
10 manufacturing CD8⁺Kokushijiu showing binding specificity for lymphocytes
A hybrid that produces a monoclonal antibody against the murine antigen
In order to manufacture the armor, first,
Totally adsorbed on the above-mentioned III antigen obtained from⁸CD8⁺T
Cells were injected intramuscularly into 6-12 week old SC chickens of I above.
It was The total adsorption is IM containing 10% fetal bovine serum
CD8 in 1 ml DM⁺2 lymphocytes and the antigen of III above
After performing constant temperature treatment at 37 ° C for a long time,
Then wash 3 times and then 10⁸CD8⁺T cells to HB
Resuspend with 0.5 ml SS to complete infusion of Pro India
After emulsifying with, the muscle was applied to the 6-12 week-old SC chicken of the above I.
I had an intramuscular injection. Perform a second injection using the same formulation
Immunization and booster immunization with the above formulation without adjuvant
Intravascular injections were given at weekly intervals. Final boosty
Was performed by intravenous injection 3 days before cell fusion.
Next, the production of hybridomas was performed by Nishinaka et al.
Therefore, the method presented was used as follows.
(Nishinaka, S. et al., J. Immunol. Methods., 139:
217-222 (1991); and Nishinaka, S. et al., J. Vet. M.
ed. Sci., 58: 1053-1056 (1996)): Final immunization
3 days after treatment, the spleen storage single cell suspension was ficolled.
-Use the density gradient of Ficoll-Paque
Centrifuge at 500 g for 20 minutes at 20 ° C.
I got it. Cell fusion is performed by Lillehoj, H.S. et al., Poul. Sc
i., 73: 1685-1693 (1994).
27H4 non-secretory chicken myeloma cell line (NKK Corporat, Japan)
ion, Biotechnology Development Center Nishinaka
Polyethylene glycol 4 using S. Dr.)
000 (Sigma). 10% fetal fused cells
Suspended in IMDM containing serum and HAT, 96-
Plated in well microculture plate. Two
After a week has passed, the ELISA method is applied to the plate.
Fixed sporozoite antigen (also obtained in III above)
Hybrid clones were screened. Eye
Hybridomas that produce targeted monoclonal antibodies
Is the splenocytes that have been irradiated as feeder cells
(2 x 10⁶/ Well) to limit dilution and
I learned. The hybridoma cells thus obtained were
Each of them was named "6D-12-G10".

V.Heavy and lambda-light chain variable domain inheritance
Separation and amplification of offspring Total RNA is Trizol^TMReagent (Life Technologies
Inc., USA) by the vendor's protocol
2-1, 5D11, 8C3, 13C8 obtained in IV above and
Purified from 6D-12-G10 hybridoma cells
It was First, 5 mg of purified total RNA was added to DNase I 5
Add knit to prevent genomic DNA contamination and
After resuspending the se-member with water, 50 ng / μl
Oligo (dT)_12-15Mixed with primer. Next
First, heat the mixture to 70 ° C for 10 minutes and leave at 42 ° C.
After incubating for 5 minutes at room temperature, 2 μl of 10x PCR buffer,
25 mM MgCl_Two2 μl, 10 mM dNTPs 1
The reaction mixture containing 1 μl and 2 μl of 0.1 M DTT was added.
It was Then, Superscript II reverse transcriptase 200 uni
And incubate for 50 minutes at 42 ° C.
Finally, heat at 70 ° C for 15 minutes to terminate the reaction.
It was RNase H1μ to remove residual RNA
1 was added and the mixture was thermostatted at 37 ° C. for 20 minutes. R
CDNA 1/10 produced after cleavage of Nase
And used for amplification of the light chain. PCR reaction is Taq
Use DNA polymerase (Promega, USA) to
Performed at: 95 ° C, 4 minutes per cycle; 3 at 95 ° C
0 seconds, 30 seconds at 55 ° C and 1 minute at 72 ° C, 30 cycles
And the final extension reaction at 72 ° C for 7 minutes.

The primers used in the PCR reaction were as follows: the forward primer for the variable region of the heavy chain was 5'-ggaggagacgatgacttcggt-3 ', the reverse primer was 5'-gccgtgacgttggacgagtcc-3', The forward primer for the variable region of the light chain is 5'-taggacggt
cagggttgtccc-3 ', reverse primer is 5'-gcgctgac
It is tcagccgtcctcg-3 '.

The PCR products were separated on a 1% agarose gel and the QiaEXII DNA extraction kit (Qiagen, USA).
It was extracted using. The purified PCR product is pGE
Cloning using MT vector (Promega, USA), Sambrook, J. et al., Molecular Cloning: AL
aboratory Manual. Cold Spring Harbor Laboratory Pre
Transformation into JM109 (Promega) by the method disclosed in ss. Cold Spring Harbor, NY (1991).

The detailed experimental procedure is shown diagrammatically in FIG.

VI.Variable domain cloned
Gene sequencing Use the Qiagen Plasmid Purification Kit to
After preparing the DNA, the big-dye terminator
Eccle Sequence Preparation Kit (PE Applied Biosystem
s, USA) using ABI 377 automatic seek
The sequencer was determined by the answer. CB system with the determined sequence
Germline VH1-JH sequences and V1 _λ-J_λArray
(Reynaud, C.A. et al., Cell, 48: 379-388 (1987);
And Reynaud, C.A. et al., Cell, 59-171-183 (198
9)) and analyzed its characteristics.

VII.Production of recombinant scFv gene I.Recombinant from 2-1 and 5D11 hybridoma cell lines
E scFv gene production 2-1 and 5D11 hybridoma cells obtained above
Using the variable site cDNA of the monoclonal antibody of
Burlap-extension PCR (Horton, R.M. et al., Gene,
77: 61-68 (1989)) to increase recombination of variable sites.
Widened Perform PCR to perform V_L-GS
Tanker-V_H(LH recombination) and V_H-GS linker
-V_L(HL recombination) amplicon was obtained: heavy chain variable region
Position and light chain variable site cDNA 100 ng each
Imma-50pmole and Taq DNA polymerase
(Promega, USA) PCR was performed for 15 cycles using 5 units.
The temperature conditions are 95 ° C for 1 minute and 75 ° C for 4 minutes.
And the final extension reaction was at 72 ° C. for 10 minutes. for
When the primer was a heavy chain in LH recombination,
Is 5'-ggcggaggtggctctggcggtggcggatcggccgtgacgttgga
cgagtcc-3 '(reverse primer) and 5'-ggaggagacga
tgacttcggt-3 '(forward primer), and the
5'-gcgctgactcagccgtcctcg-3 '(reverse ply
) And 5'-agagccacctccgcctgaaccgcctccacctaggac
ggtcagggttgtccc-3 '(forward primer), H
Among L recombination, 5'-gccgtgacgttg when it is a heavy chain
gacgagtcc-3 '(reverse primer) and 5'-agagccacc
tccgcctgaaccgcctccaccggaggagacgatgacttcggt-3 ’(order
Direction primer) and 5'-ggcggagg in the case of a light chain.
tggctctggcggtggcggatcggcgctgactcagccgtcctcg-3 ’
(Reverse direction primer) and 5'-taggacggtcagggttgtccc-
3 '(forward primer).

The PCR amplification product contains a GS linker in addition to the variable site gene. The GS linker is an oligopeptide composed of 15 amino acids including glycine and serine, which links the variable regions of the heavy and light chains to function as an antibody. The amino acid sequence of the GS linker is as follows. : N-ggggsggggsggggs-C

The PCR product was subjected to scFv (single chain variable frag) containing an SfiI or NotI restriction enzyme site.
ments) primer as described above, followed by 1 cycle at 95 ° C. for 4 minutes, 60 ° C. for 1 minute, 72 ° C.
For 30 minutes under conditions of 1 min. Primer used
The nucleotide sequence of is 5'-gtcctcgcaactgc in the case of LH recombination.
ggcccagcc gggccatggccgcgctgactcagccgtcctcg-3 '(reverse primer, underlined is SfiI restriction enzyme site)
And 5'-ggccaccttt gcggccgc ggaggagacgatgacttcggt-
3 '(forward primer, underlined is NotI restriction enzyme site) and 5'-gtcctcgcaa in case of HL recombination.
ctgc ggcccagcc gggccatggccgccgtgacgttggagagtcc-3 '
(Reverse primer, underlined is SfiI restriction enzyme site) and 5'-ggccacctttgcggccgctaggacggtcagggttgtcc
c-3 ′ (forward primer, underlined is NotI restriction enzyme site).

The reamplified product was digested with SfiI and NotI.
(5'PelB leader region and 3'hexa-histidine label after digestion with (Promega, USA) and pU
It was cloned into a scFv expression vector derived from C119 (see: Kim, JK et al., Eur. J. Immuno).
L., 24: 542-548 (1994)). The gene map of the finally prepared expression vector is shown in the attached FIG.

B.6D-12-G10 hybridoma thin
Of recombinant scFv gene from cell line The above V obtained from 6D-12-G10 hybridoma cells
Using the variable site cDNA of the monoclonal antibody of
Burlap-extension PCR (Horton, R.M. et al., Gene,
77: 61-68 (1989)) to amplify recombination at variable sites.
did. PCR is performed as follows:_H -EK
Tanker-V_L Amplification was obtained: cDNA is heavy chain variable
Site and variable region of light chain 100 ng each, primer
50 pmole and Taq DNA polymerase (Promeg
a, USA) 30 cycles of PCR using 5 units
95 ℃, 4 minutes 1 cycle; 55 ℃ 30 seconds, 72 ℃ 1
Min and 95 ° C. 30 seconds 30 cycles; and final extension reaction 7
It was 7 minutes at 2 ° C. The primer used is a heavy chain
In case of 5'-gtcctcgcaactgcggcccagccgggccatggccgccg
tgacgttggacgagtcc-3 '(reverse direction primer, underlined S
fiI restriction enzyme site) and 5'-ttcaccactcccgggt
ttgccgctaccggaagtagagccggaggagacgatgacttcggtcccgtg
gcc-3 '(forward primer), in the case of a light chain
5'-agcggcaaacccgggagtggtgaaggtagcactaaaggtgcgctga
ctcagccgtcctcggtgtcagca-3 '(reverse primer) and
And 5'-ggccacctttgcggccgctaggacggtcagggttgtccc-3 ’
(Forward primer, underlined is NotI restriction enzyme site.
It is).

The PCR amplification product contains an EK linker in addition to the variable site gene. The EK linker is an oligopeptide composed of 18 amino acids including glutamic acid and lysine, which links the variable regions of the heavy and light chains so that the antibody functions. The amino acid sequence of the EK linker was as follows: N-gstsgsgkpgsgedstkg-C

The PCR product was carried out in the same manner as described above using the reverse primer for the heavy chain and the forward primer for the light chain as described above, at 95 ° C. for 1 minute, 75 ° C. for 4 minutes and the final extension reaction at 72 ° C. PCR was carried out for 15 cycles under the condition of 10 minutes.

The reamplified product was digested with SfiI and NotI.
(5'PelB leader region and 3'hexa-histidine label after digestion with (Promega, USA) and pU
It was cloned into an scFv expression vector derived from C119 (see Kim, JK et al., Eur. J. Immuno).
L., 24: 542-548 (1994)). The gene map of the finally prepared expression vector is shown in the attached FIG.

VIII.Expression and purification of scFv antibody Using the vector of VII containing the scFv gene, E.c
oliBMH71-18 (US Texas State University Suther
Dr. E. Sally Ward of Western Medical Center
Purchased from Hanahan method (Kim,
 J.K. et al., Eur. J. Immunol., 24: 542-548 (199
Four)). Transformed cells with 100 μg / ml ampicillin
Contains Sillin (Sigma, USA) and 1% (w / v) glucose
2X TY medium (20 g tryptone, 10 g yeast extract)
Source, 10 g NaCl / L; Difco, USA) overnight
The cells were cultured at 30 ° C. with constant stirring. Then culture
The cells were centrifuged at 3,500 rpm for 10 minutes at room temperature.
Cells were collected and washed once with 2X TY medium
It was Then, the cells were treated with 100 μg / ml ampicillin to 1.0.
mM isopropyl-β-D-thiogalactopyranoside
2X TY medium containing (Gold Biotechnology, USA)
Resuspend again and stir at 180 rpm at 5 ° C for 5
Gene expression was induced for -6 hours. Recombinant scFv antibody
For purification, cells were first collected by centrifugation at 4 ° C.
After that, 250 mM NaCl, 50 mM Tris-HCl,
Ultrasonic within pH 7.5 and 1.0 mg lysozyme (Sigma)
Wave treatment and centrifuge at 10,000 rpm for 30 minutes at 4 ° C.
Separated to remove cell debris. Next, the upper layer liquid is Ni-N.
Applicable to TAHis-bonded resin column (Novagen, USA)
The bound antibody is removed and
Fee process is performed according to the protocol provided by the manufacturer
did. The purified antibody was added to sodium dodecyl sulfate
Crylamide gel electrophoresis (SDS-PAGE) Sample buffer
(0.125M Tris-HCl, pH 6.8, 4% S
DS, 20% glycerol, 10% 2-mercaptoetha
Nol, 0.004% bromophenol blue)
After becoming cloudy and heated at 94 ° C. for 4 minutes, Mini-Prot
15 using an einII electrophoresis device (Bio-Rad, USA)
Electrophoresed on a% SDS polyacrylamide gel. Electric
After the electrophoresis was completed, in 10% acetic acid / 50% methanol
Staining was performed with 0.25% Kumasi Blue.

IX.ELISA Flat 96-well microtiter plate (Costar, US
A) 0.1M sodium carbonate buffer (pH 9.
6) Within 100 μl of Eimeria antigen (10 μg / ml)
Coating overnight at 4 ° C with 0.05% Tween
3 with PBS (pH 7.2) containing 20 (PBS-T)
Washed twice. The wells are then filled with 1% bovine serum albumin
Room with 200 μl of PBS containing (BSA; Sigma) for 1 hour
After blocking with heat, the above in PBS-1% BSA
100 μl of recombinant antibody (100 μg / ml) obtained in VIII
Was added, and a constant temperature treatment was performed at room temperature for 2 hours. Then PBS
-Wash 3 times with -T, PBS-1% BSA 1: 3,
Horseradish peroxidation diluted with 000
Enzyme-conjugated polyhistidine monoclonal antibody (Sigma)
After adding 100 μl / well, incubate at room temperature for 40 minutes
Treated and washed 4 times. The activity of peroxidase is 0.05M
0.01% with phosphate-citrate buffer (pH 5.0)
(W / v) Tetramethylbenzidine (Sigma) 100 μl
It is detected by reacting with_TwoSO_Four5
0 μl, optical density is microtiter plate
It measured at 450 nm using the reader (Bio-Rad).

X.Immunofluorescence A
ssay: IFA) For use with the above II on pre-wash slide glass (Corning, USA)
The designated air-dried sporozoites were treated with recombinant scFv
Incubate for 40 minutes at room temperature with 100 μl of body and add to PBS
And washed 3 times. The slide is then PBS-1% BS
Polyhistidine antibody diluted 1: 3,000 with A.
(Sigma) 100 μl for 40 minutes at room temperature
After washing 4 times with PBS, fluorescein isothiocyanate
Anate (FITC) labeled rabbit anti-mouse IgG (PBS
Dilute 1: 3,000 with -1% BSA) at 100 μl
The sample was subjected to a constant temperature treatment for 40 minutes and washed 3 times with PBS. That
Afterwards, the slides were counterstained with 0.01% Evans blue.
Then, after washing 3 times with PBS, Vectashield mount
Mounting Medium (Vector, USA)
40x magnification lens and Texas Red / FITC dual wavelength lens
The fluorescence microscope (Carl Zeis
s, Germany).

XI.Immunoblot analysis The Eimeria antigen obtained in III above was used as an SDS-PAGE sample.
After resuspending in buffer and heating, SDS-
PAGE was performed. The separated protein is labeled Mini-P.
Immo using rotean II transfer chamber (Bio-Rad)
Transferred to bilon-P membrane (Millipore, USA), 1% non-fat
Block the membrane in PBS with dry milk overnight at 4 ° C.
After king, it was washed twice with PBS-T. Then
Recombinant scFv antibody obtained in VIII above (PBS-1% BS
Dilute with A: 1: 1, 600) for 40 minutes at room temperature
After processing, horseradish peroxidase-complex polyhistidine
For antibody (diluted 1: 3 with PBS-1% BSA)
For 40 minutes. After that, the above-mentioned membrane is PBS-
Wash 5 times with T and 5 times with distilled water, then use Sigma Fast DA
Color development was induced using the B-peroxidase substrate (Sigma).

Experimental results I.Heavy and lambda-light chain variability of chicken monoclonal antibodies.
PCR amplification of the site The PCR amplification product obtained in the above experiment was electrophoresed on an agarose gel.
It was electrophoresed and its size was confirmed (see FIG. 2). Attached
In FIG. 2, A is for the heavy chain,
5D11, 2nd lane is 8C3, 3rd lane is 13
Lanes C8 and 4 relate to the 2-1 hybridoma.
And B is for λ-light chain,
5D11, 6th lane is 8C3, 7th lane is 13
Lanes C8 and 8 are related to the 2-1 hybridoma.
And. As can be seen from FIG. 2,
The size is about 340 bp, which is the size of the λ-light chain DNA.
The length is about 325 bp. Described in the experimental method
Perform a DNase digestion prior to cDNA synthesis so that
Thus eliminating PCR amplification contamination from genomic DNA
It

II.Cloning of chicken heavy and lambda-light chains
Sequence analysis of defined variable sites Hybridoma 2-1, 5D11, 13C8, 8C3 and
And the variable region of the heavy chain isolated from 6D-12-G10
Sequences corresponding to SEQ ID NO: 17, SEQ ID NO: 19,
Shown in SEQ ID NO: 21, SEQ ID NO: 23 and SEQ ID NO: 38, respectively.
The sequence for the variable region of λ-light chain is
No. 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and
And SEQ ID NO: 40, respectively.

In addition, the germline of the CB line V _H 1-
A comparison of the sequences with the JH sequence and the V1 _λ- J _λ sequence is shown in FIG.
a, FIG. 3b, FIG. 3c and FIG. 3d. In FIG. 3a and FIG. 3b, sites showing identity with germline are indicated by dots, and sites without corresponding sequences are indicated by dashes. In FIG. 3c and FIG. 3d, sites showing identity with germline are represented by asterisks (*), and sites without corresponding sequences are represented by colons (:).

Complementarity determinator
ining region: hereinafter referred to as "CDR") and PCR primer sites are shown in the germline sequence, and base substitutions and additions in the λ-light chain are shown in bold and italics, respectively. On the other hand, the framework (FR) and CDR are Kabat, EA et al., Sequences of protein.
s of immunological interest.US Dept. Health and
Human Services, NIH publication No. 91−3242, 5 ^th
ed. (1991).

Through sequence comparisons of the 5 monoclonal antibodies and germline, it was confirmed that the sequence differences were mainly in the CDRs. For example, 15 nucleotides (gctggaagttactat) in CDR1 of λ-light chain of 2-1 clone
The insertion of 15 nucleotides (gatagtgattatgtt) and 6 nucleotides (atttat) of 13C8 and 8C3 CDR3 were also confirmed.
Defects were confirmed with 4 monoclonal antibodies, eg 2
-1 CDR3 has 3 nucleotides (gca) deleted, 13C8 and 8C3 CDR3 has 3 nucleotides (agc) deleted, and 6D-12-G10 V _L cD
Three nucleotides are deleted in CDR3 of NA.

Sequence of variable region of λ-light chain revealed by the present invention and 25 pseudogenes derived from CB strain (pseudogenes; Reyanud, CA et al., Cell,
48: 379-388 (1987)) and other known pseudogenes of chicken lines (Kondo, TH et al., Eur. J. Immunol., 23: 245-2.
49 (1993)) and the gene conversion was confirmed by comparing the sequences, and the results are shown in FIG. For example, CD of 2-1 clone
R1 and CDR2 are ψVλ8, and 5D11 is ψVλ1
4 and ψVλ7, 8C3 from ψV23 and ψV12,
It was confirmed that 13C8 was derived from ψV14 and ψV12 or ψV13. On the other hand, _{VL of} 6D-12-G10
Of the cDNA, a 196 bp site (nucleotide 49-
244) is the same as the pseudogene ψ7.

The gene inversion thus identified was previously published for gene conversion in rearranged variable genes (Lillehoj, HS et al., Avian Dis., 44: 408).
-425 (2000)). The boundaries between donor pseudogenes and germline genes were unclear, and sometimes more than one candidate pseudogene was identified, indicating that multiple gene inversions occurred at one variable site.

The above experimental results show that the difference between the gene cloned according to the present invention and the known germline sequence most similar to the sequence of the above gene is the pseudogene-gene conversion of the _VL gene sequence (Reyanud, CA et al. al., Cell,
48: 379-388 (1987)). In addition, as can be seen from FIG.
Individual single base substitutions have been confirmed, and such a result indicates the possibility of somatic hypermutation.
Of the 16 base substitutions, 8 mutations occurred in CDR and the remaining 8 mutations occurred in FR. Because clusters of point mutations in CDRs (7 out of 8) are found in CDR3, base substitutions in CDR3 are suspected as somatic hypermutations.

The above-mentioned experimental results relate to mature immunoglobulins derived from hybridomas, and it is speculated that more mutations are accumulated in CDR depending on the result of affinity selection of B cells. Sequence comparison and analysis are not described for heavy chains, but this is a pseudogene-
It is not clear for the V _H sequence and the germline D site (Reyanud, CA et al., Ce.
ll, 59: 171-183 (1989); and Rose, ME et al.,
Immune response in parasitic Infections; Immunolo
gy, Immunopathology, CRC Press, Boca Raton, Florid
a, p.275 (1987)). However, as can be seen from FIGS. 3 and 4, the differences in the sequences of the four clones of the present invention and the germ line mainly occurred in the CDRs of the heavy chain.

Although the germline and pseudogene sequences for the White Leghorn system have not been clarified yet, the primer used in the present invention is useful for obtaining a gene for a chicken variable site by PCR. Such a conclusion is also proved by the fact that DNA polymorphisms hardly occur at the 5 ′ and 3 ′ ends of the variable regions of the heavy chain and λ-light chain in many white leghorn strains (Benatar, T. et al., Eur. J.
Immunol., 23: 244 (1993)).

On the other hand, hybridomas 2-1, 5D11,
The amino acid sequences for the variable regions of the heavy chains isolated from 13C8, 8C3 and 6D-12-G10 are SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22 and SEQ ID NO: 2 in the sequence listing.
4 and SEQ ID NO: 39, and the amino acid sequences for the variable region of the λ-light chain are shown in SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 41, respectively. In addition, germline V _{H of} CB line
Sequence comparison with 1-JH sequences and V1 _lambda -J _lambda sequence are shown in Figures 4a and 4b. In FIGS. 4a and 4b, sites showing identity with germline are indicated by dots, sites without corresponding sequences are indicated by dashes, and amino acid sequence of D gene in the heavy chain is indicated by X.

The differences in the amino acid sequences of the cloned gene and the CB line germline seen in FIGS. 4a and 4b are consistent with the results confirmed in FIGS. 3a and 3b, which indicates that the cloned gene and germline Indicates that the differences between the heavy chain and λ-light chain CDRs occur predominantly.

As can be seen from FIG. 4, the four clones of the present invention have very different amino acid sequences of their CDRs. Antigen binding specificity depends on CD of heavy and light chains
As determined primarily by R, the above facts indicate that each clone recognizes another epitope of the Eimeria surface antigen.

In conclusion, all the sequences revealed by the present invention provide sufficient information on gene switching of variable genes rearranged singly in heavy and λ-light chains. Furthermore, gene conversion leading to immunoglobulin gene diversity in chickens further improves the possibility of producing recombinant chicken antibody fragments using the primers of the invention.

III.Cloning of scFv gene and
Manifestation 2-1, 5D11, 1 prepared by the above-mentioned experimental method VII
Size of scFv recombination from 3C8 and 8C3
Was confirmed by cutting with NotI enzyme, and as a result, before cutting
Plasmid size is about 4.0 kb,
Followed by the insert sequence (light chain variable site and heavy chain variable site).
The size of the gene that encodes is about 720-750.
It was confirmed to be bp. Also derived from 6D-12-G10
The scFv recombination was also performed as shown in FIG. 9a.
The size after cutting with tI enzyme is about 4.0 kb.
The size of the non-recombinant plasmid is about 720-750.
It was as large as bp. This is a 6D12HL insertion
It is the difference in size between columns.

Purified scFv obtained through expression in E. coli host cells was 5D11LH, 5D11HL, 2-1L
Approximately 5 per liter of culture in the case of H and 2-1HL
mg, and in the case of 6D12HL, about 7 mg / liter, such a result indicates a water-soluble stable functionality.
It is shown that the cFv chicken antibody has homeostasis in prokaryotic cells, which is the most preferred host for protein expression, and can be obtained in high yield. Eventually, the problems of using hybridoma cells are solved. That is, when hybridoma cells are used, the amount is 0.1 per liter of culture medium.
Although 1 mg or less of the antibody can be obtained, when the antibody is produced using the expression vector of the present invention, it is 50-70 times within a short time.
Double antibody can be obtained.

As can be seen from FIG. 7, the molecular weight of the purified recombinant antibody was about 31 kDa for 5D11LH, 5D11HL and 2-1LH, and the molecular weight for the 2-1HL antibody was about 30 kDa. On the other hand, as can be seen from FIG. 9b, the molecular weight of the purified recombinant antibody 6D12HL was about 31.0 kDa.

IV.Antigen binding properties of scFv antibody 5D cloned and expressed in Experimental Method VIII above
11LH, 5D11HL, 2-1LH and 2-1HLs
The antigen-binding properties of cFv antibody were determined by ELISA, IFA and
Immunoblot analysis was performed and confirmed. You can see from Figure 8
So that the antibodies 2-1LH, 5D11LH and 5D11H
L is for Eimeria acervulina sporozoite antigen
It had a very strong binding activity, but the 2-1HL antibody
It had no binding activity to the melia antigen.

On the other hand, in FIG. 8, the control group is B
It is an SA negative control group, and an asterisk (*) mark indicates a group that is significantly different from the control group. According to the IFA results, the ELISA
Similar to the results, 2-1LH, 5D11LH and 5D11
The HL antibody had a binding activity to the surface antigen of Eimeria acervulina EI.

On the other hand, scFv antibodies are generally prepared in the order of _VH -linker- _VL (HL) (de Haard H, He.
nderikx P., et al., Adv. Drug Deliv. Rev., 31: 5-
31 (1998)), and in the present invention, the LH antibody (5D11LH antibody and 2-1LH antibody) has a better antigen binding ability than the HL antibody. As can be seen from the detailed description and FIG. 8, 2-1HL did not show reactivity with the Eimeria antigen.

Mouse HL recombination was unable to generate functional antibody, which is due to the V _H and V _L N N for antigen binding ability.
Known literature (de Haard H, Henderikx P., et al., Due to the requirement for − and / or C-terminal sites)
Adv. Drug Deliv. Rev., 31: 5-31 (1998); and Pad
lan, EA, Mol. Immunol., 28: 489-489 (1991)) further emphasizes the importance of the results of the invention detailed.

In FIG. 10, which shows the result of immunoblotting against 6D12HL, it can be confirmed that the 17.0 kDa Eimeria cervulina protein is blotted and detected by the 6D12HL antibody. In FIG. 10, the lane 1 is loaded with the sample, and the lane 2 is loaded with the molecular weight marker. In FIG. 11 showing the results of the ELISA experiment for 6D12HL, it can be confirmed that the 6D12HLscFv antibody exhibits a dose-dependent reactivity with the water-soluble antigen of Eimeria ascerbulina sporozoite. IF
According to the A result, 6D is similar to the above ELISA result.
It was confirmed that the 12HL antibody had a binding activity to the Eimeria acervulina EI surface antigen.

As described above, the scFv recombinant antibody prepared according to the present invention has a size of about 31 kDa, that is, about 1/5 of the size of a complete IgG, and has the ability to bind to an antigen. It has the function of. After all, the scFv recombinant antibody of the present invention has excellent tissue penetration properties, and such properties are important factors in light of the penetration properties of Eimeria parasites. Furthermore, since the scFv recombinant antibody of the present invention can be obtained in a large amount through a host of prokaryotic cells such as Escherichia coli, it can be used for passive immunization of avian coccidiosis, and can be used for affinity purification against Eimeria vaccine antigen.

The present invention provides variable regions of the heavy and light chains of a novel antibody against the surface antigen of Eimeria sp. Sporozoites that induce avian coccidiosis, and the DNA encoding them. The present invention also provides a novel scFv (single c) that reacts with the surface antigen of Eimeria sporozoites that induce avian coccidiosis.
hain variable fragment) antibody and D encoding the same
Provide NA. On the other hand, the present invention provides a method for producing a novel scFv against the surface antigen of Eimeria sporozoites that induces avian coccidiosis, and sc used in the method.
An Fv expression vector is provided. The scFv recombinant antibody of the present invention, while sufficiently exerting its function as an antibody, has excellent tissue-penetrating properties due to its small size, and can be obtained in large quantities through a host of prokaryotic cells such as Escherichia coli. It can be used for passive immunization of avian coccidiosis and can be used for affinity purification against Eimeria vaccine antigen.

[Brief description of drawings]

FIG. 1 is a schematic diagram schematically showing a method for cloning a variable site carried out according to an embodiment of the present invention.

FIG. 2 is a photograph showing the result of PCR amplification of a DNA sequence encoding a variable site isolated from a hybridoma cell line.

FIG. 3 is a diagram showing the similarity between the heavy chain base sequence and the germline base sequence of a monoclonal antibody against avian coccidiosis whose base sequence has been determined by the present invention.

FIG. 4 is a diagram showing the similarity between the nucleotide sequence of the λ-light chain of the monoclonal antibody against avian coccidiosis whose nucleotide sequence is determined by the present invention and the germline nucleotide sequence.

FIG. 5 is a diagram showing the similarity between the heavy chain base sequence and the germline base sequence of the monoclonal antibody obtained from hybridoma 6D-12-G10.

FIG. 6 is a diagram showing the similarity between the nucleotide sequence of the λ-light chain and the germline nucleotide sequence of the monoclonal antibody obtained from hybridoma 6D-12-G10.

FIG. 7 is a diagram showing the similarity of amino acid sequences inferred from FIG. 3a.

FIG. 8 is a diagram showing the similarity of amino acid sequences inferred from FIG. 3b.

FIG. 9 shows the gene conversion of pseudogene from the sequence encoding the monoclonal antibody against avian coccidiosis found by the present invention.

FIG. 10 is a gene map showing one embodiment of the expression vector of the present invention.

FIG. 11 is an SDS-PAGE gel photograph showing the molecular weight and the degree of purification of scFv produced by the present invention.

FIG. 12 is a graph showing the results of analyzing the antigen-binding ability of scFv produced by the present invention by ELISA.

FIG. 13 is a gel photograph showing that the scFv recombinant derived from hybridoma 6D-12-G10 was inserted into an expression vector.

FIG. 14 is an SDS-PAGE gel photograph showing purification and molecular weight of 6D12HL in scFv of the present invention.

FIG. 15 is a gel photograph showing a result of immunoblotting of 6D12HL in scFv of the present invention.

FIG. 16 is a graph showing the results of analyzing the antigen binding ability of 6D12HL in scFv of the present invention by ELISA.

[Sequence list] <110> Avicore Biotechnology Institute Inc. <120> Recombinant ScFv Antibodies Specific to Eimeria sp. Responsible          for Coccidiosis <130> Avicore-1 <160> 40 <170> KopatentIn 1.71 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR amplification of heavy chain variable          region <400> 1 ggaggagacg atgacttcgg t 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of heavy chain variable          region <400> 2 gccgtgacgt tggacgagtc c 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR amplification of light chain variable          region <400> 3 taggacggtc agggttgtcc c 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of light chain variable          region <400> 4 gcgctgactc agccgtcctc g 21 <210> 5 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of heavy chain variable          region <400> 5 ggcggaggtg gctctggcgg tggcggatcg gccgtgacgt tggacgagtc c 51 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of heavy chain variable          region <400> 6 ggaggagacg atgacttcgg t 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of light chain variable          region <400> 7 gcgctgactc agccgtcctc g 21 <210> 8 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR amplification of light chain variable          region <400> 8 agagccacct ccgcctgaac cgcctccacc taggacggtc agggttgtcc c 51 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of heavy chain variable          region <400> 9 gccgtgacgt tggacgagtc c 21 <210> 10 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR amplification of heavy chain variable          region <400> 10 agagccacct ccgcctgaac cgcctccacc ggaggagacg atgacttcgg t 51 <210> 11 <211> 51 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of light chain variable          region <400> 11 ggcggaggtg gctctggcgg tggcggatcg gcgctgactc agccgtcctc g 51 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR amplification of light chain variable          region <400> 12 taggacggtc agggttgtcc c 21 <210> 13 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of scFv <400> 13 gtcctcgcaa ctgcggccca gccgggccat ggccgcgctg actcagccgt cctcg 55 <210> 14 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR amplification of scFv <400> 14 ggccaccttt gcggccgcgg aggagacgat gacttcggt 39 <210> 15 <211> 55 <212> DNA <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of scFv <400> 15 gtcctcgcaa ctgcggccca gccgggccat ggccgccgtg acgttggacg agtcc 55 <210> 16 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> forward primer for PCR amplification of scFv <400> 16 ggccaccttt gcggccgcta ggacggtcag ggttgtccc 39 <210> 17 <211> 369 <212> DNA <213> chicken hybridoma cell line 2-1 <220> <221> CDS <222> (1) .. (369) <400> 17 gcc gtg acg ttg gac gag tcc ggg ggc ggc ctc cag acg ccc gga gga 48 Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly   1 5 10 15 gcg ctc agc ctc gtc tgc aag gcc tcc ggg ttc acc ttc agc agc cat 96 Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Thr Phe Ser Ser His              20 25 30 ggc atg atg tgg gtg cga cag acg ccc ggc aag ggg ctg gag tgg gtc 144 Gly Met Met Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu Trp Val          35 40 45 gcg ggt att agc aac act ggt act tac acg tac tac gcg ccg gcg gtg 192 Ala Gly Ile Ser Asn Thr Gly Thr Tyr Thr Tyr Tyr Ala Pro Ala Val      50 55 60 aag ggc cgt gcc acc atc tcg agg gac aac ggg cag agc aca gtg agg 240 Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val Arg  65 70 75 80 ctg cag ctg aac aac ctc agg gct gag gac acc ggc acc tac tac tgc 288 Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr Tyr Cys                  85 90 95 gcc aaa ggt ggt gct tat tgt gct ggt tgt ggt ggt gac atc gac gca 336 Ala Lys Gly Gly Ala Tyr Cys Ala Gly Cys Gly Gly Asp Ile Asp Ala             100 105 110 tgg ggc cac ggg acc gaa gtc atc gtc tcc tcc 369 Trp Gly His Gly Thr Glu Val Ile Val Ser Ser         115 120 <210> 18 <211> 123 <212> PRT <213> chicken hybridoma cell line 2-1 <400> 18 Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly   1 5 10 15 Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Thr Phe Ser Ser His              20 25 30 Gly Met Met Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu Trp Val          35 40 45 Ala Gly Ile Ser Asn Thr Gly Thr Tyr Thr Tyr Tyr Ala Pro Ala Val      50 55 60 Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val Arg  65 70 75 80 Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr Tyr Cys                  85 90 95 Ala Lys Gly Gly Ala Tyr Cys Ala Gly Cys Gly Gly Asp Ile Asp Ala             100 105 110 Trp Gly His Gly Thr Glu Val Ile Val Ser Ser         115 120 <210> 19 <211> 372 <212> DNA <213> chicken hybridoma cell line 5D11 <220> <221> CDS <222> (1) .. (372) <400> 19 gcc gtg acg ttg gac gag tcc ggg ggc ggc ctc cag acg ccc gga gga 48 Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly   1 5 10 15 gcg ctc agc ctc gtc tgc aag gcc tcc ggg ttc gac ttc agc agt tac 96 Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Asp Phe Ser Ser Tyr              20 25 30 gac atg att tgg gtg cga cag gcg ccc ggc aag ggg ctg gaa tac gtc 144 Asp Met Ile Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val          35 40 45 gcg ggt att aga agt gat ggt agt agc ata tac tac ggg gcg gcg gtg 192 Ala Gly Ile Arg Ser Asp Gly Ser Ser Ile Tyr Tyr Gly Ala Ala Val      50 55 60 aag ggc cgt gcc acc atc tcg agg gac aac ggg cag agc act ctg agg 240 Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Leu Arg  65 70 75 80 ctg cag ctg aac aac ctc agg gct gag gac acc ggc acc tat tac tgc 288 Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr Tyr Cys                  85 90 95 gcc aaa agt tct tat ggt agt tgg aga ggt tct act ggt gac atc gac 336 Ala Lys Ser Ser Tyr Gly Ser Trp Arg Gly Ser Thr Gly Asp Ile Asp             100 105 110 gca tgg ggc cac ggg acc gaa gtc atc gtc tcc tcc 372 Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser         115 120 <210> 20 <211> 124 <212> PRT <213> chicken hybridoma cell line 5D11 <400> 20 Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly   1 5 10 15 Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Asp Phe Ser Ser Tyr              20 25 30 Asp Met Ile Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val          35 40 45 Ala Gly Ile Arg Ser Asp Gly Ser Ser Ile Tyr Tyr Gly Ala Ala Val      50 55 60 Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Leu Arg  65 70 75 80 Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Thr Tyr Tyr Cys                  85 90 95 Ala Lys Ser Ser Tyr Gly Ser Trp Arg Gly Ser Thr Gly Asp Ile Asp             100 105 110 Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser         115 120 <210> 21 <211> 372 <212> DNA <213> chicken hybridoma cell line 13C8 <220> <221> CDS <222> (1) .. (372) <400> 21 gcc gtg acg ttg gac gag tcc ggg ggc ggc ctc cag acg ccc gga gga 48 Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly   1 5 10 15 ggg ctc agc ctc gtc tgc aag ggc tcc ggg ctc gac ttc agc agt tat 96 Gly Leu Ser Leu Val Cys Lys Gly Ser Gly Leu Asp Phe Ser Ser Tyr              20 25 30 gcc atg ggt tgg gtg cga cag gca ccc ggc aag ggg ctg gaa ttc gtc 144 Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Val          35 40 45 gcg ggt att aaa aaa aat gat ggt agt tgg aca aac tac gcg ccg gcg 192 Ala Gly Ile Lys Lys Asn Asp Gly Ser Trp Thr Asn Tyr Ala Pro Ala      50 55 60 gtg cag ggc cgt gcc acc atc tcg agg gac aac ggg caa agc aca gtg 240 Val Gln Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val  65 70 75 80 agg ctg cag ctg aac aac ctc agg gct gac gac acc ggc atc tac gtc 288 Arg Leu Gln Leu Asn Asn Leu Arg Ala Asp Asp Thr Gly Ile Tyr Val                  85 90 95 tgc acc aga gat gtt aat agt ggt tac cct gat gct gct gac atc gac 336 Cys Thr Arg Asp Val Asn Ser Gly Tyr Pro Asp Ala Ala Asp Ile Asp             100 105 110 gca tgg ggc cac ggg acc gaa gtc atc gtc tcc tcc 372 Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser         115 120 <210> 22 <211> 124 <212> PRT <213> chicken hybridoma cell line 13C8 <400> 22 Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly   1 5 10 15 Gly Leu Ser Leu Val Cys Lys Gly Ser Gly Leu Asp Phe Ser Ser Tyr              20 25 30 Ala Met Gly Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Phe Val          35 40 45 Ala Gly Ile Lys Lys Asn Asp Gly Ser Trp Thr Asn Tyr Ala Pro Ala      50 55 60 Val Gln Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val  65 70 75 80 Arg Leu Gln Leu Asn Asn Leu Arg Ala Asp Asp Thr Gly Ile Tyr Val                  85 90 95 Cys Thr Arg Asp Val Asn Ser Gly Tyr Pro Asp Ala Ala Asp Ile Asp             100 105 110 Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser         115 120 <210> 23 <211> 375 <212> DNA <213> chicken hybridoma cell line 8C3 <220> <221> CDS <222> (1) .. (375) <400> 23 gcc gtg acg ttg gac gag tcc ggg ggc ggc ctc cag acg ccc gga gga 48 Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly   1 5 10 15 ggg ctc agc ctc gtc tgc aag gcc tcc ggg ttc tct atc ggc ggt tac 96 Gly Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Ser Ile Gly Gly Tyr              20 25 30 atc atg cac tgg gtg cgc cag acg cct gga aag ggg ctg gaa tac gtt 144 Ile Met His Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu Tyr Val          35 40 45 gca ggt att gat gct ggt ggt ggt agc aca tac tac ggg gcg gcg gtg 192 Ala Gly Ile Asp Ala Gly Gly Gly Ser Thr Tyr Tyr Gly Ala Ala Val      50 55 60 cag ggc cgt gcc acc gtc tcg agg gac aac ggg cag agc aca ctg agg 240 Gln Gly Arg Ala Thr Val Ser Arg Asp Asn Gly Gln Ser Thr Leu Arg  65 70 75 80 ctg cag ctg aac aac ctc agg ctg gag gac acc ggc acc tac ttc tgc 288 Leu Gln Leu Asn Asn Leu Arg Leu Glu Asp Thr Gly Thr Tyr Phe Cys                  85 90 95 gcc aaa gct tct cgg tgt ggc tat gat tgg tgt tct gct gat aac atc 336 Ala Lys Ala Ser Arg Cys Gly Tyr Asp Trp Cys Ser Ala Asp Asn Ile             100 105 110 gac gca tgg ggc cac ggg acc gaa gtc atc gtc tcc tcc 375 Asp Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser         115 120 125 <210> 24 <211> 125 <212> PRT <213> chicken hybridoma cell line 8C3 <400> 24 Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Gly   1 5 10 15 Gly Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Ser Ile Gly Gly Tyr              20 25 30 Ile Met His Trp Val Arg Gln Thr Pro Gly Lys Gly Leu Glu Tyr Val          35 40 45 Ala Gly Ile Asp Ala Gly Gly Gly Ser Thr Tyr Tyr Gly Ala Ala Val      50 55 60 Gln Gly Arg Ala Thr Val Ser Arg Asp Asn Gly Gln Ser Thr Leu Arg  65 70 75 80 Leu Gln Leu Asn Asn Leu Arg Leu Glu Asp Thr Gly Thr Tyr Phe Cys                  85 90 95 Ala Lys Ala Ser Arg Cys Gly Tyr Asp Trp Cys Ser Ala Asp Asn Ile             100 105 110 Asp Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser         115 120 125 <210> 25 <211> 324 <212> DNA <213> chicken hybridoma cell line 2-1 <220> <221> CDS <222> (1) .. (324) <400> 25 gcg ctg act cag ccg tcc tcg gtg tca gca aac cca gga gaa acc gtc 48 Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Pro Gly Glu Thr Val   1 5 10 15 aag atc acc tgc tcc ggg ggt ggc agc tac gct gga agt tac tat tat 96 Lys Ile Thr Cys Ser Gly Gly Gly Ser Tyr Ala Gly Ser Tyr Tyr Tyr              20 25 30 ggc tgg tac cag cag aag gca cct gcc agt gcc cct gtc act gtg atc 144 Gly Trp Tyr Gln Gln Lys Ala Pro Ala Ser Ala Pro Val Thr Val Ile          35 40 45 tat gac aac acc aac aga ccc tcg aac atc cct tca cga ttc tcc ggt 192 Tyr Asp Asn Thr Asn Arg Pro Ser Asn Ile Pro Ser Arg Phe Ser Gly      50 55 60 tcc cta tcc ggc tcc aca aac aca tta acc atc act ggg gtc caa gtc 240 Ser Leu Ser Gly Ser Thr Asn Thr Leu Thr Ile Thr Gly Val Gln Val  65 70 75 80 gag gac gag gct gtc tat tac tgt ggg agc ttc gac agc agt tat gtt 288 Glu Asp Glu Ala Val Tyr Tyr Cys Gly Ser Phe Asp Ser Ser Tyr Val                  85 90 95 ggt ata ctt ggg gcc ggg aca acc ctg acc gtc cta 324 Gly Ile Leu Gly Ala Gly Thr Thr Leu Thr Val Leu             100 105 <210> 26 <211> 108 <212> PRT <213> chicken hybridoma cell line 2-1 <400> 26 Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Pro Gly Glu Thr Val   1 5 10 15 Lys Ile Thr Cys Ser Gly Gly Gly Ser Tyr Ala Gly Ser Tyr Tyr Tyr              20 25 30 Gly Trp Tyr Gln Gln Lys Ala Pro Ala Ser Ala Pro Val Thr Val Ile          35 40 45 Tyr Asp Asn Thr Asn Arg Pro Ser Asn Ile Pro Ser Arg Phe Ser Gly      50 55 60 Ser Leu Ser Gly Ser Thr Asn Thr Leu Thr Ile Thr Gly Val Gln Val  65 70 75 80 Glu Asp Glu Ala Val Tyr Tyr Cys Gly Ser Phe Asp Ser Ser Tyr Val                  85 90 95 Gly Ile Leu Gly Ala Gly Thr Thr Leu Thr Val Leu             100 105 <210> 27 <211> 312 <212> DNA <213> chicken hybridoma cell line 5D11 <220> <221> CDS <222> (1) .. (312) <400> 27 gcg ctg act cag ccg tcc tcg gtg tca gca aac ctg gga gaa acc gtc 48 Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Leu Gly Glu Thr Val   1 5 10 15 gaa atc acc tgc tcc ggg ggc agg tat agg tat ggc tgg tat cag cag 96 Glu Ile Thr Cys Ser Gly Gly Arg Tyr Arg Tyr Gly Trp Tyr Gln Gln              20 25 30 aag tca tct ggc agt gcc cct gtc act gtg atc tat gac aac gac aag 144 Lys Ser Ser Gly Ser Ala Pro Val Thr Val Ile Tyr Asp Asn Asp Lys          35 40 45 aga ccc tcg gac atc cct tca cga ttc tcc ggt tcc aaa tcc gac tcc 192 Arg Pro Ser Asp Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Asp Ser      50 55 60 acg ggc aca tta acc atc act ggg gtc caa gcc gag gac gag gct gtc 240 Thr Gly Thr Leu Thr Ile Thr Gly Val Gln Ala Glu Asp Glu Ala Val  65 70 75 80 tat tac tgt ggg aat gca gac aac aat act tac gat cct ata ttt ggg 288 Tyr Tyr Cys Gly Asn Ala Asp Asn Asn Thr Tyr Asp Pro Ile Phe Gly                  85 90 95 gcc ggg aca acc ctg acc gtc cta 312 Ala Gly Thr Thr Leu Thr Val Leu             100 <210> 28 <211> 104 <212> PRT <213> chicken hybridoma cell line 5D11 <400> 28 Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Leu Gly Glu Thr Val   1 5 10 15 Glu Ile Thr Cys Ser Gly Gly Arg Tyr Arg Tyr Gly Trp Tyr Gln Gln              20 25 30 Lys Ser Ser Gly Ser Ala Pro Val Thr Val Ile Tyr Asp Asn Asp Lys          35 40 45 Arg Pro Ser Asp Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Asp Ser      50 55 60 Thr Gly Thr Leu Thr Ile Thr Gly Val Gln Ala Glu Asp Glu Ala Val  65 70 75 80 Tyr Tyr Cys Gly Asn Ala Asp Asn Asn Thr Tyr Asp Pro Ile Phe Gly                  85 90 95 Ala Gly Thr Thr Leu Thr Val Leu             100 <210> 29 <211> 324 <212> DNA <213> chicken hybridoma cell line 13C8 <220> <221> CDS <222> (1) .. (324) <400> 29 gcg ctg act cag ccg tcc tcg gtg tca gca aac ctg gga gga acc gtc 48 Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Leu Gly Gly Thr Val   1 5 10 15 aag atc acc tgc tcc ggg ggc agc tat ggc tat ggc tgg ttc cag cag 96 Lys Ile Thr Cys Ser Gly Gly Ser Tyr Gly Tyr Gly Trp Phe Gln Gln              20 25 30 aag tca cct ggc agt gcc cct gtc cct gtg atc tac tgg aac aac aag 144 Lys Ser Pro Gly Ser Ala Pro Val Pro Val Ile Tyr Trp Asn Asn Lys          35 40 45 aga ccc tcg gac atc cct tca cga ttc tcc ggt tcc aaa tcc ggc tcc 192 Arg Pro Ser Asp Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Gly Ser      50 55 60 aca gcc aca tta acc atc act ggg gtc cga gcc gag gac gag gct gtc 240 Thr Ala Thr Leu Thr Ile Thr Gly Val Arg Ala Glu Asp Glu Ala Val  65 70 75 80 tat tac tgt ggg aat gca gac agc aat act gct gat agt gat tat gtt 288 Tyr Tyr Cys Gly Asn Ala Asp Ser Asn Thr Ala Asp Ser Asp Tyr Val                  85 90 95 ggt ata ttt ggg gcc ggg aca acc ctg acc gtc cta 324 Gly Ile Phe Gly Ala Gly Thr Thr Leu Thr Val Leu             100 105 <210> 30 <211> 108 <212> PRT <213> chicken hybridoma cell line 13C8 <400> 30 Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Leu Gly Gly Thr Val   1 5 10 15 Lys Ile Thr Cys Ser Gly Gly Ser Tyr Gly Tyr Gly Trp Phe Gln Gln              20 25 30 Lys Ser Pro Gly Ser Ala Pro Val Pro Val Ile Tyr Trp Asn Asn Lys          35 40 45 Arg Pro Ser Asp Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Gly Ser      50 55 60 Thr Ala Thr Leu Thr Ile Thr Gly Val Arg Ala Glu Asp Glu Ala Val  65 70 75 80 Tyr Tyr Cys Gly Asn Ala Asp Ser Asn Thr Ala Asp Ser Asp Tyr Val                  85 90 95 Gly Ile Phe Gly Ala Gly Thr Thr Leu Thr Val Leu             100 105 <210> 31 <211> 315 <212> DNA <213> chicken hybridoma cell line 8C3 <220> <221> CDS <222> (1) .. (315) <400> 31 gcg ctg act caa ccg tcc tcg gtg tca gcg atc ccg gga gaa acc gtc 48 Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Ile Pro Gly Glu Thr Val   1 5 10 15 gag atc acc tgc tcc ggg ggt aac aac tac tat ggc tgg tat cag cag 96 Glu Ile Thr Cys Ser Gly Gly Asn Asn Tyr Tyr Gly Trp Tyr Gln Gln              20 25 30 aaa tca cct ggc agt gcc cct gtc act gtg atc tac tac aac aac aag 144 Lys Ser Pro Gly Ser Ala Pro Val Thr Val Ile Tyr Tyr Asn Asn Lys          35 40 45 aga ccc tcg gac atc cct tca cga ttc tcc ggt tcc aaa ccc ggc tcc 192 Arg Pro Ser Asp Ile Pro Ser Arg Phe Ser Gly Ser Lys Pro Gly Ser      50 55 60 aca aac aca tta acc atc act ggg gtc cga gcc gag gac gag gct gtc 240 Thr Asn Thr Leu Thr Ile Thr Gly Val Arg Ala Glu Asp Glu Ala Val  65 70 75 80 tat ttc tgt ggt gcc tgg gaa agt agt cct att tat gtt ggt ata ttt 288 Tyr Phe Cys Gly Ala Trp Glu Ser Ser Pro Ile Tyr Val Gly Ile Phe                  85 90 95 ggg gcc ggg aca acc ctg acc gtc cta 315 Gly Ala Gly Thr Thr Leu Thr Val Leu             100 105 <210> 32 <211> 105 <212> PRT <213> chicken hybridoma cell line 8C3 <400> 32 Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Ile Pro Gly Glu Thr Val   1 5 10 15 Glu Ile Thr Cys Ser Gly Gly Asn Asn Tyr Tyr Gly Trp Tyr Gln Gln              20 25 30 Lys Ser Pro Gly Ser Ala Pro Val Thr Val Ile Tyr Tyr Asn Asn Lys          35 40 45 Arg Pro Ser Asp Ile Pro Ser Arg Phe Ser Gly Ser Lys Pro Gly Ser      50 55 60 Thr Asn Thr Leu Thr Ile Thr Gly Val Arg Ala Glu Asp Glu Ala Val  65 70 75 80 Tyr Phe Cys Gly Ala Trp Glu Ser Ser Pro Ile Tyr Val Gly Ile Phe                  85 90 95 Gly Ala Gly Thr Thr Leu Thr Val Leu             100 105 <210> 33 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of heavy chain variable          region <400> 33 Ala Val Thr Leu Asp Glu Ser   1 5 <210> 34 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> forward primer for PCR amplification of heavy chain variable          region <400> 34 Ser Ser Val Ile Val Glu Thr   1 5 <210> 35 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> reverse primer for PCR amplification of light chain variable          region <400> 35 Ala Leu Thr Gln Pro Ser Ser   1 5 <210> 36 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> forward primer for PCR amplification of light chain variable          region <400> 36 Leu Val Thr Leu Thr Thr Gly   1 5 <210> 37 <211> 381 <212> DNA <213> chicken hybridoma cell line 6D-12-G10 <220> <221> CDS <222> (1) .. (381) <400> 37 gcc gtg acg ttg gac gag tcc ggg ggc ggc ctc cag acg ccc gga aga 48 Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Arg   1 5 10 15 gcg ctc agc ctc gtc tgc aag gcc tcc ggg ttc acc ttc agc agt tat 96 Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Thr Phe Ser Ser Tyr              20 25 30 ggc atg gtc tgg gtg cga cag gcg ccc ggc aag ggg ctg gaa tac gtc 144 Gly Met Val Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val          35 40 45 gct gaa att atc aca act ggt aga gac aca tgg tat ggg acg gcg gtg 192 Ala Glu Ile Ile Thr Thr Gly Arg Asp Thr Trp Tyr Gly Thr Ala Val      50 55 60 aag ggc cgt gcc acc atc tcg agg gac aac ggg cag agt aca gtg agg 240 Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val Arg  65 70 75 80 ctg cag ctg aac aac ctc agg gct gaa gac acc ggc atc tac tac tgc 288 Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Ile Tyr Tyr Cys                  85 90 95 gcc aaa tgc agt tat gag tgt act agt agt tgt tgg ggt tat act gat 336 Ala Lys Cys Ser Tyr Glu Cys Thr Ser Ser Cys Trp Gly Tyr Thr Asp             100 105 110 atg atc gac gca tgg ggc cac ggg acc gaa gtc atc gtc tcc tcc 381 Met Ile Asp Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser         115 120 125 <210> 38 <211> 127 <212> PRT <213> chicken hybridoma cell line 6D-12-G10 <400> 38 Ala Val Thr Leu Asp Glu Ser Gly Gly Gly Leu Gln Thr Pro Gly Arg   1 5 10 15 Ala Leu Ser Leu Val Cys Lys Ala Ser Gly Phe Thr Phe Ser Ser Tyr              20 25 30 Gly Met Val Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val          35 40 45 Ala Glu Ile Ile Thr Thr Gly Arg Asp Thr Trp Tyr Gly Thr Ala Val      50 55 60 Lys Gly Arg Ala Thr Ile Ser Arg Asp Asn Gly Gln Ser Thr Val Arg  65 70 75 80 Leu Gln Leu Asn Asn Leu Arg Ala Glu Asp Thr Gly Ile Tyr Tyr Cys                  85 90 95 Ala Lys Cys Ser Tyr Glu Cys Thr Ser Ser Cys Trp Gly Tyr Thr Asp             100 105 110 Met Ile Asp Ala Trp Gly His Gly Thr Glu Val Ile Val Ser Ser         115 120 125 <210> 39 <211> 312 <212> DNA <213> chicken hybridoma cell line 6D-12-G10 <220> <221> CDS <222> (1) .. (312) <400> 39 gcg ctg act cag ccg tcc tcg gtg tca gca aac ctg gga gga acc gtc 48 Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Leu Gly Gly Thr Val   1 5 10 15 aag atc acc tgc tcc ggg agt agt ggc agc tat ggc tgg tat cag cag 96 Lys Ile Thr Cys Ser Gly Ser Ser Gly Ser Tyr Gly Trp Tyr Gln Gln              20 25 30 aag tca cct ggc agt gcc cct gtc act gtg atc tat tac aac gac aag 144 Lys Ser Pro Gly Ser Ala Pro Val Thr Val Ile Tyr Tyr Asn Asp Lys          35 40 45 aga ccc tcg gac atc cct tca cga ttc tcc ggt tcc aaa tcc ggc tcc 192 Arg Pro Ser Asp Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Gly Ser      50 55 60 acg ggc aca tta acc atc act ggg gtc caa gcc gag gac gag gct gtc 240 Thr Gly Thr Leu Thr Ile Thr Gly Val Gln Ala Glu Asp Glu Ala Val  65 70 75 80 tat ttc tgt gag agt aca gac tac agt agt act gat ata ttt ggg gcc 288 Tyr Phe Cys Glu Ser Thr Asp Tyr Ser Ser Thr Asp Ile Phe Gly Ala                  85 90 95 ggg aca acc ctg acc gtc cta ggt 312 Gly Thr Thr Leu Thr Val Leu Gly             100 <210> 40 <211> 104 <212> PRT <213> chicken hybridoma cell line 6D-12-G10 <400> 40 Ala Leu Thr Gln Pro Ser Ser Val Ser Ala Asn Leu Gly Gly Thr Val   1 5 10 15 Lys Ile Thr Cys Ser Gly Ser Ser Gly Ser Tyr Gly Trp Tyr Gln Gln              20 25 30 Lys Ser Pro Gly Ser Ala Pro Val Thr Val Ile Tyr Tyr Asn Asp Lys          35 40 45 Arg Pro Ser Asp Ile Pro Ser Arg Phe Ser Gly Ser Lys Ser Gly Ser      50 55 60 Thr Gly Thr Leu Thr Ile Thr Gly Val Gln Ala Glu Asp Glu Ala Val  65 70 75 80 Tyr Phe Cys Glu Ser Thr Asp Tyr Ser Ser Thr Asp Ile Phe Gly Ala                  85 90 95 Gly Thr Thr Leu Thr Val Leu Gly             100

─────────────────────────────────────────────────── ─── Continuation of front page (51) Int.Cl. ⁷ Identification code FI theme code (reference) C07K 16/20 C12N 15/00 ZNAA C12P 21/08 A61K 37/02 (72) Inventor Kim Jin-kyu South Korea 641 -773 Kyung Sannando Changwon Si Saling Dong 9 Changwon National University College of Natural Sciences Department of Microbiology (72) Inventor Han Se-yeon South Korea 441-744 Gyeonggi Swanshi Seoul National University of Agriculture and Culture and Agriculture Life Sciences Department of Animal Science and Technology (72) Inventor Song Kidok Korea Republic of the Republic 302-793 Daejeon Metropolitan City Sog Walpyeong 2 Dong Chukong Apartment 202-1102 (72) Inventor Kim Sung Won Republic of Korea 641-773 Kyongsan Nando Changwon Si Salingdong 9 Changwon National University College of Natural Sciences Department of Micro Biology (72) Inventor Min Won Ki Republic of Korea 641-773 Kyung San Nand Chang Won Si Sarong Dong 9 Chang Won National University College of Natural Sciences Department of Micro Biology (72) Son Eun Jong United States Maryland Bertzville, USA Department of Agriculture Animal and Natural Resources Institute New Epidemiology and Systematic Laboratory Parasite Biology (72) Inventor Hyunsung Lillehoge United States Maryland Bertzville US Department of Agriculture Animal and Natural Resources Institute Epidemiology and Systematic Laboratory Parasite Iology (72) Inventor Eric Peter Lillehoge United States Maryland Beltsville US Department of Agriculture Animal and Natural Resources Institute Epidemiology and Systematic Laboratory Parasite Biology F-term (reference) 4B024 AA01 AA11 BA42 CA04 DA06 EA03 EA04 FA02 GA11 HA01 HA03 HA11 4B064 AG27 CA01 CA19 CA20 CC 24 DA01 DA13 4C084 AA02 AA03 AA06 AA07 AA13 BA01 BA02 BA21 CA03 CA53 NA14 ZB381 ZC611 4C085 AA14 CC23 DD62 4H045 AA11 AA20 AA30 BA10 CA21 DA76 EA20 EA50 FA72 FA74

Claims (45)

[Claims] 1. An Eimeria species comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24 and SEQ ID NO: 38.
ria sp.) variable region of the heavy chain of the antibody to the surface antigen of sporozoites. 2. An Eimeria species comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 40.
ria sp.) variable region of the light chain of the antibody to the sporozoite surface antigen. 3. An Eimeria species comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24 and SEQ ID NO: 38.
ria sp.) DNA encoding the variable region of the heavy chain of the antibody to the surface antigen of sporozoites. 4. The method according to claim 3, wherein the DNA has a nucleotide sequence selected from the group consisting of SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23 and SEQ ID NO: 37. DNA. 5. An Eimeria species comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 40.
ria sp.) DNA encoding the variable region of the light chain of the antibody to the sporozoite surface antigen. 6. The method according to claim 5, wherein the DNA has a nucleotide sequence selected from the group consisting of SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 39. DNA. 7. An Eimeria species comprising the following variable regions of a heavy chain and a light chain.
p.) scFv antibody against the surface antigen of sporozoites: (a) an Eimeria species comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24 and SEQ ID NO: 38 ( Eimeria sp.) Variable site of the heavy chain of an antibody to the surface antigen of sporozoites; and (b) selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 40. The variable region of the light chain of an antibody to the surface antigen of an Eimeria sp. Sporozoite containing an amino acid sequence. 8. The variable region of the heavy chain is SEQ ID NO: 18.
8. The Eimeria sp. According to claim 7, wherein the variable region of the light chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 26 when the polypeptide contains the amino acid sequence of Eimeria sp. ScFv antibody against the surface antigen of sporozoites of. 9. The variable region of the heavy chain is SEQ ID NO: 20.
8. The Eimeria sp. According to claim 7, wherein the variable region of the light chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 28 when the polypeptide contains the amino acid sequence of Eimeria sp. ScFv antibody against the surface antigen of sporozoites of. 10. The variable region of the heavy chain is SEQ ID NO: 2.
In the case of a polypeptide containing the amino acid sequence of SEQ ID NO: 2, the variable region of the light chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 30. Eimeria sp. B) scFv antibody against the surface antigen of sporozoites. 11. The variable region of the heavy chain is SEQ ID NO: 2.
4. The Eimeria sp. According to claim 7, wherein the variable region of the light chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 32 when the polypeptide contains the amino acid sequence of 4. B) scFv antibody against the surface antigen of sporozoites. 12. The variable region of the heavy chain is SEQ ID NO: 3.
8. The Eimeria sp. According to claim 7, wherein the variable region of the light chain is a polypeptide containing the amino acid sequence of SEQ ID NO: 40 when the polypeptide contains the amino acid sequence of 8. B) scFv antibody against the surface antigen of sporozoites. 13. The Eimeri species according to claim 7, wherein the scFv antibody further comprises a linker between the variable region of the heavy chain and the variable region of the light chain.
a sp.) sporozoite surface antigen scFv antibody. 14. A scFv against a surface antigen of a sporozoite of Eimeria sp., Which is formed by ligating the DNA encoding the variable site of the heavy chain and the DNA encoding the variable site of the light chain below. DNA: (a) an antibody against the surface antigen of Eimeria sp. Sporozoites, which comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24 and SEQ ID NO: 38. A DNA encoding the variable region of the heavy chain of Escherichia coli; (Eimeria sp.) DNA encoding the variable region of the light chain of an antibody to the surface antigen of sporozoites. 15. The scFv-encoding DNA is a combination of a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 18 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 26. The DNA according to claim 14, which comprises: 16. The scFv-encoding DNA is a combination of a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 20 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 28. The DNA according to claim 14, which comprises: 17. The DNA encoding the scFv comprises a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 22 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 30. The DNA according to claim 14, which comprises: 18. The DNA encoding the scFv is formed by linking a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 24 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 32. The DNA according to claim 14, which comprises: 19. The DNA encoding the scFv is formed by linking a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 38 and a DNA encoding a polypeptide containing the amino acid sequence of SEQ ID NO: 40. The DNA according to claim 14, which comprises: 20. The scFv-encoding DNA further comprises a DNA sequence encoding a linker between the DNA sequence encoding the variable region of the heavy chain and the DNA sequence encoding the variable region of the light chain. Characteristic D
NA. 21. The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 18 is the DNA of SEQ ID NO: 17, and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 20 is the DNA of SEQ ID NO: 17. The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 22 is the DNA of SEQ ID NO: 21, and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 24 is the DNA of SEQ ID NO: 23. Three
DN encoding a polypeptide containing the amino acid sequence of 8
21. The DNA according to claim 14, wherein A is the DNA of SEQ ID NO: 37. 22. The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 26 is the DNA of SEQ ID NO: 25, and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 28 is the DNA of SEQ ID NO: 27. The DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 30 is the DNA of SEQ ID NO: 29, the DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 32 is the DNA of SEQ ID NO: 31, and the sequence The DNA according to any one of claims 14 to 20, wherein the DNA encoding the polypeptide containing the amino acid sequence of No. 40 is the DNA of SEQ ID No. 39.
A. 23. An Eimeria species comprising the steps of:
ria sp.) scFv against surface antigens of sporozoites
Method for producing: (a) (i) SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 2
2, Eimeria species containing an amino acid sequence selected from the group consisting of SEQ ID NO: 24 and SEQ ID NO: 38.
sp.) DNA encoding the variable region of the heavy chain of the antibody to the sporozoite surface antigen; and (ii) a group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 40. Cloning an scFv recombinant gene containing a DNA encoding a variable region of a light chain of an antibody against a surface antigen of an Eimeria sp. Sporozoite containing an amino acid sequence selected from the following: (b) Transforming a host cell with the expression vector; and (c) expressing scFv using the transformed host cell to obtain an scFv. 24. The method for producing scFv according to claim 23, wherein the host cell is a prokaryotic cell. 25. The method for producing scFv according to claim 24, wherein the prokaryotic cell is Escherichia coli. 26. The method for producing scFv according to claim 23, wherein the scFv recombinant gene is a DNA encoding the scFv according to claim 15. 27. The method for producing scFv according to claim 23, wherein the scFv recombinant gene is a DNA encoding the scFv according to claim 16. 28. The method for producing scFv according to claim 23, wherein the scFv recombinant gene is a DNA encoding the scFv according to claim 17. 29. The method for producing scFv according to claim 23, wherein the scFv recombinant gene is a DNA encoding the scFv according to claim 18. 30. The method for producing scFv according to claim 23, wherein the scFv recombinant gene is a DNA encoding the scFv according to claim 19. 31. The scFv recombinant gene further comprises a sequence encoding a linker between the DNA encoding the variable region of the heavy chain and the DNA encoding the variable region of the light chain. Item 31. A method for producing an scFv according to any one of Items 23 to 30. 32. The DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 18 is D of SEQ ID NO: 17.
NA, the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 20 is the DNA of SEQ ID NO: 17, the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 22 is the DNA of SEQ ID NO: 21, The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 24 is the DNA of SEQ ID NO: 23, and the DNA of SEQ ID NO: 38
DNA encoding a polypeptide containing the amino acid sequence of
Is the DNA of SEQ ID NO: 37, The method for producing scFv according to any one of claims 23 to 30, wherein 33. The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 26 is the DNA of SEQ ID NO: 25, and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 28 is the DNA of SEQ ID NO: 27. The DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 30 is the DNA of SEQ ID NO: 29, the DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 32 is the DNA of SEQ ID NO: 31, and the sequence The scF according to any one of claims 23 to 30, wherein the DNA encoding the polypeptide containing the amino acid sequence of No. 40 is the DNA of SEQ ID No. 39.
The manufacturing method of v. 34. A surface antigen of sporozoite of Eimeria sp. Having the following constitution:
cFv expression vector: (a) (i) SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 2
2, Eimeria species containing an amino acid sequence selected from the group consisting of SEQ ID NO: 24 and SEQ ID NO: 38.
sp.) DNA encoding the variable region of the heavy chain of an antibody to the sporozoite surface antigen; and (ii) SEQ ID NO: 2.
6, the variable region of the light chain of the antibody against the surface antigen of Eimeria sp. Sporozoites comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 40. Code D
A scFv recombinant gene containing NA; and (b) a promoter operably linked to the scFv recombinant gene. 35. The scFv expression vector according to claim 34, wherein the scFv recombinant gene is a DNA encoding the scFv according to claim 15. 36. The scFv expression vector according to claim 34, wherein the scFv recombinant gene is a DNA encoding the scFv according to claim 16. 37. The scFv expression vector according to claim 34, wherein the scFv recombinant gene is a DNA encoding the scFv according to claim 17. 38. The scFv expression vector according to claim 34, wherein the scFv recombinant gene is a DNA encoding the scFv according to claim 18. 39. The scFv expression vector according to claim 34, wherein the scFv recombinant gene is a DNA encoding the scFv of claim 19. 40. The scFv recombinant gene further comprises a sequence encoding a linker between the DNA encoding the variable region of the heavy chain and the DNA encoding the variable region of the light chain. Item 40. The scFv expression vector according to any one of Items 34 to 39. 41. The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 18 is the DNA of SEQ ID NO: 17, and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 20 is the DNA of SEQ ID NO: 17. The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 22 is the DNA of SEQ ID NO: 21, and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 24 is the DNA of SEQ ID NO: 23. Three
DN encoding a polypeptide containing the amino acid sequence of 8
40. The scFv expression vector according to claim 34, wherein A is the DNA of SEQ ID NO: 37. 42. The DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 26 is the DNA of SEQ ID NO: 25, and the DNA encoding the polypeptide containing the amino acid sequence of SEQ ID NO: 28 is the DNA of SEQ ID NO: 27. The DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 30 is the DNA of SEQ ID NO: 29, the DNA encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 32 is the DNA of SEQ ID NO: 31, and the sequence The scF according to any one of claims 34 to 39, wherein the DNA encoding the polypeptide containing the amino acid sequence of No. 40 is the DNA of SEQ ID No. 39.
v Expression vector. 43. The scFv expression vector is the sc
DNA having a leader region upstream of Fv recombinant gene
40. 39 to 39, further comprising an array.
The scFv expression vector according to any one of 1. 44. The promoters are p _L ^λ promoter, trp promoter, lac promoter and T
35. The scFv expression vector according to claim 34, wherein the scFv expression vector is selected from the group consisting of 7 promoters. 45. The scFv expression vector is the sc
Downstream of the Fv recombinant gene, glutathione S-transferase, maltose binding protein, FLAG or 6xH
The scFv expression vector according to claim 34, further comprising a DNA sequence encoding is.