JP2003040853A - Method for producing guanidine derivative containing amido group and for salt thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for producing a guanidine derivative containing an amido group or salt thereof industrially advantageously and simply. SOLUTION: In this method for producing a guanidine derivative containing an amido group represented by general formula (II) (R<1> and R<2> are each hydrogen atom, a 1-4C straight-chain or branched-chain alkyl group or alkenyl group and may be the same or different; R<3> is a 1-22C straight-chain or branched-chain alkyl group or alkenyl group; A is a 1-10C straight-chain or branched-chain alkylene group or alkenylene group), the guanidine derivative containing an amido group represented by general formula (I) is reacted with a fatty acid halide or a fatty acid ester.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a method for producing an amide group-containing guanidine derivative and a salt thereof, and more particularly, to a simple and inexpensive amide group-containing guanidine derivative and a salt thereof without a complicated synthetic method. Regarding how we can provide.

[0002]

2. Description of the Related Art Compounds having a guanidine group are used in various fields such as pharmaceuticals, agricultural chemicals, bactericides, insecticides, useful metal scavengers and chelating agents. Among them, amide group-containing guanidine derivatives are disclosed in JP-A-2-24361.
4, JP-A-4-49221, JP-A-4-4.
As described in Japanese Patent No. 9222, an interface having superior performance as compared with a general-purpose quaternary ammonium type cationic surfactant and imparting excellent flexibility and moisturizing properties to hair and a good feeling of finish. It is used as an activator.

Although the amide group-containing guanidine derivative has already been known and used, it has not always been a simple production method. For example, in JP-A-6-312972, monoamidoamine derived from diamine is heated under reduced pressure, heated under nitrogen bubbling, or stored under a carbon dioxide-free atmosphere, and then guanidyl with cyanamide, S-methylisothiourea or the like. A method for producing an amide group-containing guanidine derivative or a salt thereof is disclosed, which is characterized in that the amide group-containing guanidine derivative and the salt are removed by means such as crystallization.

However, in the present production method, not only is the reaction process complicated in multiple steps, but also a high degree of reaction control in order to minimize and remove by-produced dicyanamide, bisamide, urea derivatives and the like, A refining step is essential, and it is not a simple manufacturing method that is industrially advantageous and sufficiently satisfactory. Against this background, it has been desired to develop a method for industrially advantageous and convenient production of a useful compound, an amide group-containing guanidine derivative.

[0005]

SUMMARY OF THE INVENTION It is an object of the present invention to provide a method for producing a highly pure amide group-containing guanidine derivative or a salt thereof by an industrially advantageous and convenient synthetic route.

[0006]

Means for Solving the Problems That is, as a result of intensive studies conducted by the present inventors under these circumstances, an amide group-containing guanidine derivative can be simply and easily obtained by reacting an amino group-containing guanidine derivative with a fatty acid halide or a fatty acid ester. The inventors have found that it can be manufactured and have conceived the present invention.

That is, the present invention is as follows.

(1) The following general formula (I)

[Chemical 3] (In the general formula (I), R ¹ and R ² are a hydrogen atom or a carbon number 1
To 4 linear or branched alkyl or alkenyl groups, which may be the same or different. A is a linear or branched alkylene group having 1 to 10 carbon atoms or an alkenylene group. ) The amino group-containing guanidine derivative represented by the formula (1) is reacted with a fatty acid halide or a fatty acid ester, and the following general formula (II)

[Chemical 4] (In the general formula (II), R ¹ and R ^{2 each} represent a hydrogen atom or a carbon number of 1 to 1.
4 straight or branched chain alkyl or alkenyl groups, which may be the same or different. R ³ is a linear or branched alkyl group or alkenyl group having 1 to 22 carbon atoms. A is a linear or branched alkylene group having 1 to 10 carbon atoms or an alkenylene group. ) A method for producing an amide group-containing guanidine derivative represented by:

(2) In the general formula (II), R ³
Is a linear or branched alkyl group or alkenyl group having 7 to 17 carbon atoms, and the above (1)
The method for producing an amide group-containing guanidine derivative as described in 1.

(3) The amino group-containing guanidine derivative represented by the general formula (I) is 4-aminobutylguanidine, which is the above (1) or (2).
The method for producing an amide group-containing guanidine derivative as described in 1.

(4) The 4-aminobutylguanidine is obtained by decarboxylation of arginine using arginine decarboxylase, and the amide group-containing guanidine derivative according to the above (3) is produced. Method.

(5) The amide group according to (4) above, wherein the arginine decarboxylase is an arginine decarboxylase produced by a recombinant in which the arginine decarboxylase gene is amplified and expressed. A method for producing a guanidine derivative containing the same.

(6) The method for producing an amide group-containing guanidine derivative according to (5) above, wherein the arginine decarboxylase gene is an Escherichia coli-derived adi gene.

(7) The recombinant is FERM-BP
7931 is the method for producing an amide group-containing guanidine derivative according to the above (5) or (6).

(8) In the conversion reaction of arginine to 4-aminobutylguanidine, the pH of the reaction system is adjusted to pH.
The above (4) to (7) characterized by controlling to less than 6
7. The method for producing an amide group-containing guanidine derivative according to any one of 1.

(9) The amide group according to any one of the above (1) to (8), characterized in that the amino group-containing guanidine derivative represented by the general formula (I) is reacted with a fatty acid halide. A method for producing a guanidine derivative containing the same.

(10) The amino group-containing guanidine derivative represented by the general formula (I) is reacted with a fatty acid halide in water or a mixed solvent of water and an organic solvent. The method for producing an amide group-containing guanidine derivative as described in 1.

(11) An amide group-containing guanidine derivative characterized by neutralizing a solution of the amide group-containing guanidine derivative produced by the method described in any one of (1) to (10) above. Method for producing salt.

[0019]

BEST MODE FOR CARRYING OUT THE INVENTION The reaction in the method for producing an amide group-containing guanidine derivative of the present invention is represented by the following reaction formula.

[0020]

[Chemical 5] (R ¹ and R ² are a hydrogen atom, a linear or branched alkyl group or an alkenyl group having 1 to 4 carbon atoms, and may be the same or different. R ³ is a direct alkyl group having 1 to 22 carbon atoms. A chain or branched alkyl group or alkenyl group, A is a linear or branched alkylene group or alkenylene group having 1 to 10 carbon atoms, and X represents a halogen or an ester group.)

The method for producing an amide group-containing guanidine derivative of the present invention will be described below in the order of [I] starting material [A] fatty acid halide and fatty acid ester [B] amino group-containing guanidine derivative [II] reaction conditions. A detailed description will be given with reference.

[I] Starting Material [A] Fatty Acid Halide and Fatty Acid Ester The amide group-containing guanidine derivative of the present invention is obtained by reacting an amino group-containing guanidine derivative with a fatty acid halide or a fatty acid ester. In the present invention, either the fatty acid halide or the fatty acid ester may be reacted with the amino group-containing guanidine derivative,
A fatty acid halide is preferably used because the reaction proceeds under milder reaction conditions.

The fatty acid halide used in the present invention has an acyl moiety containing a linear or branched alkyl group or alkenyl group having 1 to 22 carbon atoms.

Specific examples of the fatty acid halide include acetyl halide, propionic acid halide, butyric acid halide, isobutyric acid halide, caproic acid halide, octanoic acid halide, capric acid halide, lauric acid halide, myristic acid halide, palmitic acid halide, stearin. Examples thereof include acid halides, isostearic acid halides, oleic acid halides, linoleic acid halides, linolenic acid halides, arachidonic acid halides, behenic acid halides, coconut oil fatty acid halides, palm oil fatty acid halides and beef tallow fatty acid halides. In the present invention, the carbon number is 7 to 1.
A fatty acid halide having an acyl moiety containing a linear or branched alkyl group or an alkenyl group of 7 is preferable, and a fatty acid halide having an acyl moiety containing a linear or branched alkyl group or an alkenyl group having 10 to 15 carbon atoms is preferable. More preferred is a fatty acid halide having an acyl moiety containing a linear alkyl group having 11 carbon atoms, and most preferred. Particularly, fatty acid chloride is preferable. These can be used alone or in combination of two or more.

The fatty acid ester used in the present invention has an acyl moiety containing a linear or branched alkyl group or alkenyl group having 1 to 22 carbon atoms. Specific examples of the fatty acid ester include acetic acid, propionic acid, butyric acid, isobutyric acid, caproic acid, octanoic acid, capric acid, lauric acid, myristic acid, palmitic acid, stearic acid, isostearic acid, oleic acid, linoleic acid, linolenic acid. , Arachidonic acid, behenic acid, coconut oil,
Examples thereof include methyl, ethyl or isopropyl esters such as palm oil and beef tallow, and triglyceryl esters. In the present invention, a fatty acid ester having an acyl moiety containing a linear or branched alkyl group or alkenyl group having 7 to 17 carbon atoms is preferable, and 11 to 1 carbon atoms are preferred.
A fatty acid ester having an acyl moiety containing a linear or branched alkyl group or alkenyl group of 5 is more preferable, and a fatty acid ester having an acyl moiety containing a linear alkyl group having 11 carbon atoms is most preferable. In particular, methyl ester is preferable. These can be used alone or in combination of two or more.

[B] Amino group-containing guanidine derivative The amino group-containing guanidine derivative used in the present invention is
Enzyme reaction as described in Can. J. Chem. 1982.60, 2810-2820 or Z.PHYSIOL.CHEM. 1910.68.170-1
As described in 72, it can be synthesized by a known method such as a chemical reaction and can be represented by the following general formula (I).

[0027]

[Chemical 6]

In the general formula (I), R ¹ and R ² are a hydrogen atom or a linear or branched alkyl group or alkenyl group having 1 to 4 carbon atoms, which may be the same or different. R ¹ and R ² are preferably hydrogen atoms.

A is a linear or branched alkylene group having 1 to 10 carbon atoms or an alkenylene group. A is
It is preferably a straight-chain alkylene group and has 2 to 6 carbon atoms.
Is more preferably a straight chain alkylene group, and particularly preferably a straight chain alkylene group having 4 carbon atoms.

Specific examples of the amino group-containing guanidine include 2-aminoethylguanidine, 3-aminopropylguanidine, 4-aminobutylguanidine, 5-aminopentylguanidine, 6-aminohexylguanidine,
Examples include 8-aminooctylguanidine, 10-aminodecylguanidine, and the like. These can be used alone or in combination of two or more. Among them, 4-aminobutylguanidine (agmatine) is the most preferable because it can be relatively easily produced by decarboxylating arginine, which is one of the amino acids, using arginine decarboxylase produced by a microorganism.

The method for producing 4-aminobutylguanidine from arginine using arginine decarboxylase will be described below.

Arginine decarboxylase produced by a microorganism is known to produce 4-aminobutylguanidine using arginine, which is one of the amino acids, as a substrate, as shown in the following reaction formula. Has been.

[0033]

[Chemical 7]

Such arginine decarboxylase (Argini
Examples of microorganisms that produce ne decarboxylase include E. c
oli and other genus Escherichia and Salmonella
(J. Bacteriol., 177, 4097-4104 (1995)), plant (Mol.Ge
n.Genet., 224, 431-436 (1990), Plant Physiol., 100,
146-152 (1992), Plant Physiol., 103, 829-834 (199
3), Plant Cell Physiol., 35, 1245-1249 (1994)) are known. In the present invention, the arginine decarboxylase can be obtained from these known arginine decarboxylase-producing bacteria without particular limitation.

In the present invention, it is more preferable to use a recombinant in which the arginine decarboxylase gene is amplified and expressed, or an arginine decarboxylase or an arginine decarboxylase-containing product obtained from the recombinant. .

In order to increase the expression level of the arginine decarboxylase gene, the regulatory region of the arginine decarboxylase gene may be improved. The regulatory region is improved by, for example, inserting a new strong promoter, strengthening the promoter by introducing a mutation into the promoter, controlling the expression level of repressor protein or the like that binds to the regulatory region, etc. To increase the transcription amount of the arginine decarboxylase gene located downstream.

In order to increase the expression level of the arginine decarboxylase gene, it is preferable to connect the arginine decarboxylase gene to a multi-copy type vector to prepare a recombinant DNA, and allow the microorganism to retain the recombinant DNA. . For inducing a microorganism having an increased expression level of the arginine decarboxylase gene, for example, E. based on known genetic information of arginine decarboxylase-producing bacteria such as E. coli.
Alymerase chain reaction) method is used to amplify and acquire the required gene region, and mount it on a vector such as a plasmid.
Transform host cells.

FIG. 1 is a flow chart of a process for producing a recombinant in which the arginine decarboxylase gene is amplified and expressed. First, a DNA encoding the arginine decarboxylase of the present invention is prepared (step S1). Next, the prepared arginine decarboxylase gene is ligated to vector DNA to prepare a recombinant DNA (step S2), and the recombinant DNA is used to transform a host cell to prepare a transformant.
(Step S3). Then, the transformant is cultured in a medium to generate and accumulate arginine decarboxylase in the medium and / or cells (step S4). Then, it progresses to step S5 and a large amount of arginine decarboxylase is produced by collect | recovering and refine | purifying the produced arginine decarboxylase. Further, a large amount of 4-aminobutylguanidine is produced by decarboxylating arginine using the medium in which the arginine decarboxylase produced in step S5 or the arginine decarboxylase of step S4 is accumulated (step S6). .

Here, a recombinant in which an arginine decarboxylase gene is amplified and expressed by recombinant DNA technology, or an arginine decarboxylase or an arginine decarboxylase-containing product obtained from the recombinant is used to The method for producing aminobutylguanidine will be described in detail in the following order. (1) Preparation of arginine decarboxylase gene (2) Preparation of recombinant DNA (3) Preparation of recombinant (4) Production and accumulation of arginine decarboxylase (5) Production of 4-aminobutylguanidine

(1) Preparation of arginine decarboxylase gene The arginine decarboxylase gene was prepared from E. E. coli and other genus Escherichia and Salmonella (J. Bacteriol.,
177, 4097-4104 (1995)), plants (Mol. Gen. Genet., 224,
431-436 (1990), Plant Physiol., 100, 146-152 (199
2), Plant Physiol., 103, 829-834 (1993), Plant Cell
Physiol., 35, 1245-1249 (1994)) and other known microorganisms that produce arginine decarboxylase, and can be obtained without particular limitation.

In particular, E. In E. coli, there are known two types of enzymes, an inducible enzyme (gene name is adi) and a non-inducible enzyme (gene name is speA). adi is urgently induced and expressed when the microbial survival environment is exposed to extremely acidic conditions, that is, when acid stress occurs, and decarboxylates arginine to produce basic 4-aminobutylguanidine. Then, it is understood that it is a mechanism that measures neutralization and temporarily escapes from the crisis of survival (J. Bac
teriol., 177, 4097-4104 (1995), Appl.Environ.Microb
iol., 62, 3094-3100 (1996), J. Bacteriol., 181, 3525
-3535 (1999)).

Regarding speA, speA which forms an operon as speAB and encodes an enzyme that produces 4-aminobutylguanidine and carbon dioxide from arginine and speB that encodes an enzyme that produces putrescine and urea from 4-aminobutylguanidine are used. It is known to exist (J. Bacteriol., 174, 758-764 (1992)). This enzyme system is non-inducible and is understood to be a metabolic pathway necessary for the biosynthesis of polyamines such as putrescine and spermidine for microorganisms together with ornithine decarboxylase that produces putrescine by decarboxylation from ornithine (Proc. Na
tl.Acad.Sci.USA, 80, 5181-5184 (1983), J. Bacteri
ol., 173, 3615-3621 (1991), Int. J. Biochem., 26, 991.
-1001 (1994), J. Bacteriol., 180, 4278-4286 (1998), M
icrobiology, 145, 301-307 (1999)). The enzymatic properties and gene structure of arginine decarboxylase encoded by speA and agmatinase encoded by speB have also been studied in detail (J. Biol. Chem., 248, 1).
687-1695 (1973), Methods Enzymol., 94, 117-121 (198
3), Gene, 30, 129-136 (1984), J. Bacteriol., 172,
4631-4640 (1990)). In particular, regarding this enzyme system and the ornithine decarboxylase system, mutant strains with deletion of the ornithine decarboxylase gene and deletion of the agmatinase gene (speB) have been prepared in order to analyze the physiological function of polyamines in microorganisms. (J. Bacteriol., 101, 725-730 (197
0), J. Biol. Chem., 254, 12419-12426 (1979), Biochem.
J., 234, 617-622 (1986), Proc.Natl.Acad.Sci.USA,
84, 4423-4427 (1987)). Deletion of both enzymes seems to affect the growth of microorganisms, but not lethal,
The physiological function of polyamines in microorganisms has not been clarified yet (J. Bacteriol., 101, 731-737 (1970), J. Bac
teriol., 113, 271-277 (1973), Adv. Polyamine Res.,
4, 495-506 (1983), J. Bacteriol., 163, 522-527 (198
Five)). However, amines such as 4-aminobutylguanidine are known to be volatile on the alkaline side, irritating to the skin and mucous membranes, and absorbed into the body through the skin and mucous membranes. Although its toxicity to microorganisms is not clear, amines are alkaline and are considered to be lethal to microorganisms at high concentrations without neutralization.

In the present invention, E. coli is used as the arginine decarboxylase gene. It is particularly preferable to use the adi gene derived from E. coli. speA is also a gene encoding arginine decarboxylase, but arginine decarboxylase encoded by adi (J. Biol. Chem., 243, 1671-1677 (1
968)) is more preferable than arginine decarboxylase (J. Biol. Chem., 248, 1687-1695 (1973)) encoded by speA.
It has advantages such as high specific activity.

To obtain the arginine decarboxylase gene, for example, E. Adi, which is a gene encoding arginine decarboxylase, may be cloned from the chromosomal DNA of E. coli K12 W3110 strain (ATCC27325) using the PCR method. Specifically, a DNA molecule of about 30 base pairs is synthesized from a known adi gene base sequence, and this is used as a probe to transform E. coli. col
It may be isolated from the i-chromosome gene library. The chromosomal DNA used at this time was E. Any strain may be used as long as it is derived from E. coli.

A method for synthesizing the DNA molecule is described in Tetrahedro
n Letters, 22, 1859 (1981). Also,
Using an Applied Biosystems synthesizer, the D
NA molecules can be synthesized. The DNA molecule is E. coli
The full-length adi gene derived from E. It can be used as a probe when isolated from the E. coli chromosomal gene library, and can be used as a probe. adi gene derived from E. coli
It can be used as a primer for amplification by the R method.

Regarding the operation of the PCR method, White, TJ
et al., Trends Genet. 5, 185 (1989) and the like. For a method for preparing chromosomal DNA and a method for isolating a target DNA molecule from a gene library using the DNA molecule as a probe, see Molecula.
r Cloning, 2nd edition, Cold Spring Harbor press (1
989) etc.

The adi gene used in the present invention also includes variants due to genetic polymorphism and the like. The genetic polymorphism is a phenomenon in which the amino acid sequence of a protein is partially changed due to a natural mutation in a gene.

Further, in order to increase the activity of arginine decarboxylase, a mutation may be introduced into the structural gene itself of arginine decarboxylase to increase the activity of the enzyme itself.

In order to make a mutation in a gene, a site-directed mutagenesis method (Kramer, W. and Frits, HJ, Methods Enzymo) is used.
l., 154, 350 (1987)), recombinant PCR method (PC
R Technology, Stockton Press (1989)), a method for chemically synthesizing a specific portion of DNA, a method for treating the gene with hydroxyamine, a treatment of a strain carrying the gene with ultraviolet irradiation, or a chemistry such as nitrosoguanidine or nitrite. There is a method of drug treatment.

(2) Preparation of Recombinant DNA The recombinant DNA in the present invention means the above-mentioned arginine decarboxylase gene (adi etc.) as a passenger.
It is one connected to a vector of plasmid or phage DNA.

Here, the vector is preferably a so-called multi-copy type, and is a plasmid having a replication origin derived from Col E1, such as pUC type plasmid or pUC type plasmid.
Examples include BR322-based plasmids and derivatives thereof. Here, the "derivative" means a base substitution, deletion,
It means a plasmid modified by insertion, addition, inversion, or the like. In addition, the modification here means
It also includes mutation treatment by a mutagen or UV irradiation, or modification by natural mutation. Besides these, transposons (Berg, DE and Berg, CM, Bio / Technol.,
1, 417 (1983)) and Mu phage (JP-A-2-10998).
No. 5) can also be used. It is also possible to increase the copy number by incorporating the gene into the chromosome by a method using a homologous recombination plasmid or the like.

At that time, in order to efficiently express the useful gene, a lac promoter, a trp promoter,
It is preferable to use tac promoter, trc promoter, PL promoter, and other promoters that function in microorganisms.

In order to increase the production, it is preferable to connect a terminator, which is a transcription termination sequence, downstream of the protein gene. Examples of this terminator include T7 terminator, fd phage terminator, T4 terminator, tetracycline resistance gene terminator, Escherichia coli trpA gene terminator, and the like. Alternatively, the amount of gene transcription may be increased by newly introducing an enhancer.

In order to select transformants, the vector preferably has a marker such as an ampicillin resistance gene. Examples of such a plasmid include pUC system (Takara Shuzo Co., Ltd.) and pPROK system ( Clontech), pKK233-2 (Clontech), and other expression vectors having a strong promoter are commercially available.

(3) Preparation of Recombinant In order to induce a recombinant in which the expression level of the arginine decarboxylase gene was increased, the arginine decarboxylase gene (adi etc.) was connected to a plasmid or phage DNA vector. The recombinant DNA is introduced into a host cell and transformed.

As a host cell to be transformed, a microorganism expressing a gene encoding arginine decarboxylase,
For example, bacterial cells, actinomycetes cells, yeast cells, mold cells,
Plant cells, animal cells and the like can be used. Preferably Escherichia coli, more preferably Escherichia coli, particularly preferably E. coli. competent cell such as E. coli JM109
Is used.

A host cell is transformed with the above-mentioned recombinant DNA. For the methods of transformation and selection of transformants, see Molecular Cloning, 2nd edition, Cold S.
The method described in pring Harbor press (1989) etc. can be applied.

(4) Generation and accumulation of arginine decarboxylase Arginine decarboxylase gene obtained by the above method
A recombinant transformed with a recombinant DNA containing (adi, etc.) is cultured to produce and accumulate the target enzyme. A method for culturing a recombinant having acquired high expression ability of arginine decarboxylase gene will be described below.

The medium used is often LB medium (Bact
o-tryptone 1%, Yeast extract 0.5%, NaCl 1%, Glu
cose 0.1%, pH 7.0) is used, but a normal medium containing a carbon source, a nitrogen source, inorganic ions and, if necessary, other organic components may be used.

Examples of the carbon source include glucose, lactose, galactose, fructose, arabinose, maltose, xylose, trehalose, sugars such as ribose and starch hydrolysates, alcohols such as glycerol, mannitol and sorbitol, gluconic acid and fumaric acid. Organic acids such as citric acid and succinic acid can be used.

As the nitrogen source, inorganic ammonium salts such as ammonium sulfate, ammonium chloride and ammonium phosphate, organic nitrogen such as soybean hydrolysate, ammonia gas, ammonia water and the like can be used. As the organic micronutrients, it is desirable to contain required amounts of various amino acids, vitamins such as vitamin B6, nucleic acids such as RNA, yeast extract and the like in appropriate amounts.

In addition to these, small amounts of calcium phosphate, magnesium sulfate, iron ions, manganese ions, etc. are added.

The culture is preferably carried out under aerobic conditions for about 12 to 72 hours, and it is preferable to control the culture temperature to 20 to 45 ° C. and the culture pH to 5 to 8. For pH adjustment, inorganic or organic acidic or alkaline substances,
Further, ammonia gas or the like can be used.

In the recombinant, when the expression level of arginine decarboxylase exceeds 10% of intracellular protein,
Arginine decarboxylase may form granules (inclusion body) and the arginine decarboxylase activity may decrease, but by culturing the recombinant at 30 ° C or lower, granule formation can be suppressed. .

The separation and recovery of the bacterial cells from the culture solution and the preparation of the enzyme solution can usually be carried out by combining centrifugation, ultrasonic disruption, ion exchange resin method, precipitation method and other known methods.

(5) Production of 4-aminobutylguanidine In the production of 4-aminobutylguanidine of the present invention, arginine decarboxylase produced and accumulated by a recombinant in which the arginine decarboxylase gene is amplified and expressed is used. To enzymatically decarboxylate L-Arginine.

The method for causing arginine decarboxylase to act on L-arginine is not particularly limited. For example, while culturing a recombinant in which the arginine decarboxylase gene is amplified and expressed, L-arginine is directly added to the culture solution. The cells may be added or cells separated from the culture medium, washed cells, etc. may be used. Further, the treated product obtained by crushing or lysing the bacterial cells may be used as it is, or arginine decarboxylase may be recovered from the treated product of the bacterial cells and used as a crude enzyme solution. The decarboxylase may be purified and used. That is, as long as the fraction has arginine decarboxylase activity, it is possible to use the enzyme and all the enzyme-containing products. Here, the “enzyme-containing material” may be any as long as it contains the enzyme, and specifically, culture, cultured bacterial cells, washed bacterial cells, processed bacterial cells obtained by crushing or lysing bacterial cells, crude enzyme. Liquid, purified enzyme, etc. From the viewpoint of simplifying the process and reducing the production cost of 4-aminobutylguanidine, the method of directly adding the substrate to the culture medium and carrying out the reaction is most preferable.

When L-arginine is directly added to the culture solution to promote the 4-aminobutylguanidine production reaction while culturing the recombinant in which the arginine decarboxylase gene is amplified and expressed, the reaction is allowed to stand. Or gently stir. The reaction temperature is 10 ° C to 60 ° C, preferably 2
5 ° C to 45 ° C, pH 3 to 8, preferably pH 4.5
It is better to control to ~ 6. Further, it is preferable to add pyridoxal phosphate, which is a coenzyme, to the reaction. The substrate L-Arginine may be added as long as the reaction continues, and if necessary, the reaction can be performed for the required amount and time.

When the 4-aminobutylguanidine-forming reaction is carried out using the crude enzyme solution, the cultured cells are recovered by centrifugation or the like, and then the cells are crushed or lysed to obtain a crude enzyme solution containing arginine decarboxylase. Adjust. Ultrasonic disruption, French press disruption, glass bead disruption and the like can be used for cell disruption, and when lysing, egg white lysozyme, peptidase treatment or a combination thereof is used. When the 4-aminobutylguanidine-forming reaction is carried out using the purified enzyme solution, the crude enzyme solution for decarboxylation of arginine is further purified by a technique such as ordinary precipitation, filtration and column chromatography. In this case, a purification method using an antibody of arginine decarboxylase can also be used.

When the crude enzyme solution of arginine decarboxylase or the purified enzyme is used to proceed the 4-aminobutylguanidine-forming reaction, the substrate L-Arginin (L-Arginin) is used.
e) and the reaction solution containing the crude enzyme solution or the purified enzyme at 10 ° C to
60 ° C, preferably 25 ° C to 45 ° C, pH 3-8,
The reaction is preferably carried out while controlling the pH to 4.5-6. It is preferable to add pyridoxal phosphate, which is a coenzyme, to the reaction. Substrate L-arginine (L-Arg
Inine) may be added as long as the reaction continues, and if necessary, the reaction can be performed for the required amount and time.

To separate and recover solid insoluble components such as solids from the enzyme reaction solution containing 4-aminobutylguanidine, centrifugation, precipitation method, filtration method, ion exchange resin method,
It can be carried out by combining a membrane separation method and other known methods. The clarified solution containing 4-aminobutylguanidine is subjected to an impurity selection step using an adsorbent such as activated carbon treatment, or is used as it is. If the concentration of 4-aminobutylguanidine is too low, concentrate the solution to a concentrated solution or adjust the pH with a mineral acid or the like and then concentrate and crystallize to obtain a mineral acid salt according to the type of the mineral acid used. get.

[II] Reaction Conditions The method for producing the amide group-containing guanidine derivative of the present invention is as follows:
It can be carried out by adding a fatty acid halide and / or a fatty acid ester under basic conditions to a system in which an amino group-containing guanidine derivative is dissolved or dispersed in a reaction solvent.

[0073]

[Chemical 8] (R ¹ and R ² are a hydrogen atom, a linear or branched alkyl group or an alkenyl group having 1 to 4 carbon atoms, and may be the same or different. R ³ is a direct alkyl group having 1 to 22 carbon atoms. A chain or branched alkyl or alkenyl group, A is a linear or branched alkylene group or alkenylene group having 1 to 10 carbon atoms, X is halogen,
Alternatively, it represents an ester group. )

When the fatty acid halide is used, it is preferable to use water or a mixed solvent of water and an organic solvent such as acetone, ethanol, methanol, t-butanol or isopropanol as a reaction solvent. When a fatty acid ester is used, a mixed solvent of an organic solvent such as acetone, ethanol, methanol, t-butanol, and isopropanol and water may be used, or the reaction may be performed without a solvent.

In a system prepared by dissolving or dispersing an amino group-containing guanidine derivative in a reaction solvent, an inorganic base such as sodium hydroxide, potassium hydroxide, calcium hydroxide or barium hydroxide, triethanolamine, triethylamine, etc. Add an organic base such as pyridine,
The fatty acid halide is added under basic conditions, preferably in the range of pH 9.5 to 12.5 to allow the reaction to proceed. At this time, the fatty acid halide can be added all at once, but it is preferable to add the fatty acid halide dropwise to control the pH of the system. The dropping method and the dropping time are not particularly limited, but from the viewpoint of production efficiency, it is performed in the range of 0.1 to 3 hours. When a fatty acid halide is reacted, the temperature of the system is 0 ° C. to 80 ° C. in order to prevent decomposition of the fatty acid halide.
It is preferable to control at 0 ° C, preferably 0 ° C to 50 ° C.

When a fatty acid ester is reacted,
Since the reaction is less likely to proceed as compared with a fatty acid halide, a fatty acid ester is added to the amino group-containing guanidine derivative and the temperature of the system is 60 to 200 ° C. without solvent, preferably 80 to
It is preferable to control the reaction at 150 ° C. to carry out the reaction.

When the formed amide group-containing guanidine derivative is precipitated outside the system after the reaction, it can be collected by filtering and washing. In this case, it is easy to imagine that unreacted amino group-containing guanidine derivative remains or fatty acid salt generated by decomposition of fatty acid halide is by-produced in the system, but it is relatively easy to wash with water etc. Can be removed. Of course, it is also possible to distill off the solvent water or organic solvent after the reaction is completed and purify the residue according to a conventional method such as crystallization.

As shown in the following formula, the amide group-containing guanidine derivative obtained by this production method may be used as a salt, if necessary.

[0079]

[Chemical 9]

When the amide group-containing guanidine derivative is used as a salt, a solution of the amide group-containing guanidine derivative is
Inorganic acids such as hydrochloric acid, sulfuric acid, phosphoric acid, acetic acid, glutamic acid,
Aspartic acid, gluconic acid, pyrrolidonecarboxylic acid,
It can be neutralized with an organic acid such as ascorbic acid, lactic acid, fatty acid, or acylglutamic acid before use. It is also possible to use it in a non-neutralized state for cosmetics, pharmaceuticals, and other purposes, and to neutralize it appropriately when formulating an aqueous solution, an emulsion or the like.

[0081]

The present invention will be described in more detail with reference to the following examples, but the present invention is not limited thereto.

Example 1 Production of lauroylamidobutylguanidine (1) Production of 4-aminobutylguanidine "a" in the Gene Data Bank
GACCATGGCTAAAGTTATTAA created based on the information searched using "di" as a keyword
TTGTTGAAAG (SEQ ID NO: 1) and CCGGATTC
CACGCCTTCAGCCGGAATATAGTG (SEQ ID NO: 2) 30mer and 28mer both-end primers and Pyrobest
PCR method using DNA Polymerase (Takara Shuzo) (94
C., 30 sec, 55.degree. C., 1 min, 72.degree. C., 2 min, 30 cycles, Gene Amp PCR System Model9600 (manufactured by Perkin-Elmer)), and an adi structural gene region of about 2 covering ATG and SD-ATG and a translation termination codon. .3
The kb fragment was amplified and NcoI and Ba
After digestion with mHI, it was inserted into the NcoI site and BamHI site of pTrc99A (Pharmacia). This expression plasmid is named pTrcadi1 (FIG. 2).

The PCR primer has N in SEQ ID NO: 1.
The BamHI site is designed for each of the coI site and SEQ ID NO: 2. Also cloned adi
Is expressed under the control of the trc promoter in the pTrc99A vector and translated into arginine decarboxylase.

In addition, E. coli was obtained using this plasmid pTrcadi1. E. coli JM109 transformed recombinant 5
LB liquid medium containing 0 mg / L ampicillin and 10 mg / L pyridoxine (Bacto-tryptone 1%, Yeast extrac
t 0.5%, NaCl 1%, Glucose 0.1%, pH
7.0), 10 mM arginine (manufactured by Ajinomoto Co., Inc.), and 1 mM IPTG (isopropyl-1-thio-β
-D-galactoside) was added to induce expression, and after culturing for about 16 hours, 4 ml of broth cells were collected. These cells were suspended in 0.4 ml of 0.2 M sodium acetate buffer containing 1% L-Arginine.HCl and 0.02% pyridoxal phosphate, and incubated at 37 ° C for 1 hour. The reaction solution is centrifuged to remove the bacteria, and the supernatant is subjected to HPLC.
As a result of the analysis, 4-aminobutylguanidine was produced at a conversion rate of almost 100% by the pTrcadi1 / JM109 bacterial cell method. E. coli AJ13839, which is pTrcadi1 / JM109, was designated as FERM-P18285 on April 2, 2001 by the National Institute of Advanced Industrial Science and Technology, Patent Microorganism Depositary Center (1-6, 1-chome, East 1-chome, Tsukuba, Ibaraki, Japan). Deposited in 2002
It was transferred to a deposit under the Budapest Treaty as FERM BP-7931 on February 28, 2012.

0.52 g of 98% sulfuric acid was added to 600 ml of an enzyme reaction solution containing 43.8 g of 4-aminobutylguanidine obtained by the above method to adjust to weak acidity, and then heat sterilization / aggregation was performed at 120 ° C. for 10 minutes. It was After the heat-treated liquid was cooled to room temperature, it was sterilized by centrifugation. The supernatant thus obtained and water were added to the bacterial cell cake, reslurryed, and then centrifuged to obtain a supernatant, which was combined to obtain 1000 ml of a sterilized solution containing 42.8 g of 4-aminobutylguanidine. After adding 0.43 ml of 50% benzalkonium chloride aqueous solution to this disinfectant solution and mixing them well to perform protein aggregation, activated carbon 2.14 g
Was added to adsorb excess benzalkonium chloride. The flocculated material and activated carbon were filtered to obtain 970 ml of a clear liquid containing 38.5 g of 4-aminobutylguanidine. Further, this liquid was concentrated to 640 ml to obtain a 6% aqueous solution of 4-aminobutylguanidine.

(2) Preparation of lauroylamidobutylguanidine 4-aminobutylguanidine sulfate solution (52.7 g, 0.23 mol) was obtained by concentrating and drying the 4-aminobutylguanidine aqueous solution prepared by the method (1). 180g of water and 110g of 2-propanol were added, and the pH of the system was adjusted with 27% aqueous sodium hydroxide solution.
Was adjusted to 11.0 and the temperature was adjusted to 10 ° C. 50.3 g (0.23 mol) of lauroyl chloride was added dropwise to the system over 30 minutes. On this occasion,
The temperature of the system was kept at 8 to 12 ° C, and the pH was kept at 10.9 to 11.0 with 27% aqueous sodium hydroxide solution. After the dropping was completed, the reaction was aged for another 30 minutes. After completion of the reaction, the reaction system was heated to 50 ° C. to separate an oil layer and an aqueous layer, 27% sodium hydroxide was added to the taken oil layer to adjust pH to 14.0, and then cooled to room temperature. The precipitated solid was collected by filtration, washed with water, and dried. Pale yellow solid, 65.8 g (92% yield) ¹ H-NMR (CD3OD): σ = 0.90 (3H, t), 1.28-1.38 (18H,
m), 1.57 (6H, m), 2.17 (2H, t), 3.19 (4H, m) ESI-Mass: 313 (MH +) High Performance Liquid Chromatography (Column: YMC-Pack ODS-
AM AM-312, S-5um, 120A, 150 * 6.0mm, Column temperature: 40
The peak was confirmed at 0 ° C., eluent: 30 mM phosphate buffer (pH 3.0) / methanol = 25/75, flow rate: 1.0 ml / min, detection: UV210 nm). Ion chromatography (column: Ion pac AS-11 HC
2mm (Dionex), Guard column: Ion pac AG-11 HC 2mm
(Dionex), column temperature: room temperature, eluent: NaOH aqueous solution
A residual sulfuric acid amount of 0.12% was confirmed with 1.5 mM (0 min) → 30 mM (20 min), flow rate: 0.38 ml / min, regenerant: 5 mM H ₂ SO ₄ about 3 mL / min, detection: conductivity.

Example 2 Production of Myristoylamidobutylguanidine 52.7 g of 4-aminobutylguanidine sulfate obtained by concentrating and drying the 4-aminobutylguanidine aqueous solution produced in the same manner as in Example 1 (1) 180g of water (0.23mol), 2
-Propanol (165 g) was added, and the pH of the system was adjusted to 11.0 and the temperature to 10 ° C with a 27% aqueous sodium hydroxide solution. Myristoyl chloride (58.6 g, 0.15 mol) was added dropwise to the system over 30 minutes. At this time, the system temperature was maintained at 8 to 12 ° C and the pH was maintained at 10.9 to 11.0 with 27% aqueous sodium hydroxide solution. After the dropping was completed, the reaction was aged for another 30 minutes. After the reaction,
The reaction system was heated to 50 ° C. to separate an oil layer and an aqueous layer, 27% sodium hydroxide was added to the taken oil layer to adjust the pH to 14.0, and then cooled to room temperature. The precipitated solid is collected by filtration,
After further washing with water, it was dried. Light yellow solid, 72.7 g (96% yield) ¹ H-NMR (CD3OD): σ = 0.90 (3H, t), 1.28-1.38 (20H,
m), 1.57 (6H, m), 2.17 (2H, t), 3.19 (4H, m) ESI-Mass: 341 (MH +) High Performance Liquid Chromatography (Column: YMC-Pack ODS-
AM AM-312, S-5um, 120A, 150 * 6.0mm, Column temperature: 40
The peak was confirmed at 0 ° C., eluent: 30 mM phosphate buffer (pH 3.0) / methanol = 25/75, flow rate: 1.0 ml / min, detection: UV 210 nm). Ion chromatography (column: Ion pac AS-11 HC
2mm (Dionex), Guard column: Ion pac AG-11 HC 2mm
(Dionex), column temperature: room temperature, eluent: NaOH aqueous solution
A residual sulfuric acid amount of 0.5% was confirmed by measuring 1.5 mM (0 min) → 30 mM (20 min), flow rate: 0.38 ml / min, regenerant: 5 mM H ₂ SO ₄ about 3 mL / min, detection: conductivity.

Example 3 Production of Palmitoylamide Butylguanidine 4-aminobutylguanidine sulfate 52.7 g obtained by concentrating and drying the 4-aminobutylguanidine aqueous solution produced in the same manner as in Example 1 (1) (0.23mol) in water 361g, 2
-Propanol (165 g) was added, and 27% aqueous sodium hydroxide solution was added to adjust the system pH to 11.0 and the temperature to 10 ° C. 63.4 g (0.23 mol) of palmitoyl chloride was added dropwise to the system over 30 minutes. At this time, the system temperature was maintained at 8 to 12 ° C and the pH was maintained at 10.9 to 11.0 with 27% aqueous sodium hydroxide solution. After the dropping was completed, the reaction was aged for another 30 minutes. After the reaction was completed, 80 g of 2-propanol was added to the reaction system, heated to 60 ° C to separate into an oil layer and an aqueous layer, 27% sodium hydroxide was added to the taken oil layer to adjust the pH to 14.0, and then room temperature. Cooled down. The precipitated solid was collected by filtration, washed with water, and dried. Pale yellow solid, 77.9 g (92% yield) ¹ H-NMR (CD3OD): σ = 0.90 (3H, t), 1.28-1.38 (22H,
m), 1.57 (6H, m), 2.17 (2H, t), 3.19 (4H, m) ESI-Mass: 369 (MH +) High Performance Liquid Chromatography (Column: YMC-Pack ODS-
AM AM-312, S-5um, 120A, 150 * 6.0mm, Column temperature: 40
The peak was confirmed at ℃, eluent: 30 mM phosphate buffer (pH 3.0) / methanol = 15/85, flow rate: 1.0 ml / min, detection: UV 210 nm). Ion chromatography (column: Ion pac AS-11 HC
2mm (Dionex), Guard column: Ion pac AG-11 HC 2mm
(Dionex), column temperature: room temperature, eluent: NaOH aqueous solution
A residual sulfuric acid amount of 0.04% was confirmed with 1.5 mM (0 min) → 30 mM (20 min), flow rate: 0.38 ml / min, regenerant: 5 mM H ₂ SO ₄ about 3 mL / min, detection: conductivity.

Example 4 Production of Lauroylamide Butylguanidine Acetate 500 ml of an aqueous solution containing 0.24 mol of 4-aminobutylguanidine sulfate obtained in the same manner as in Example 1 (1) was used as a system in a 27% aqueous sodium hydroxide solution. PH was adjusted to 11.0 and temperature was adjusted to 10 ° C. 52 g (0.24 mol) of lauroyl chloride was added dropwise to the system over 20 minutes. At this time, set the system temperature to 8 to 12 ° C and the pH to 2
It was maintained at 10.9 to 11.0 with a 7% aqueous sodium hydroxide solution.
After the dropping was completed, the reaction was aged for another 30 minutes. After the reaction was completed, the precipitated solid content was collected by filtration. 200 ml of a hydrochloric acid methanol solution (hydrochloric acid-containing 10 to 20 wt%) was added to the filtered solid to adjust the pH of the system to 1.0, and the mixture was kept at 50 ° C. for 30 minutes. afterwards,
Acetic acid 15g (0.26mol) was added and 17wt% KOH ethanol solution
100 g was added, the mixture was stirred, the pH was 7, and the mixture was allowed to cool to room temperature. After cooling, the precipitated solid was filtered off and the solvent of the mother liquor was distilled off. The residue was recrystallized from butanone. White solid, 37 g (44% yield) ¹ H-NMR (CD3OD): σ = 0.90 (3H, t), 1.28-1.38 (18H,
m), 1.57 (6H, m), 1.88 (3H, s), 2.17 (2H, t), 3.19 (4H,
m) High Performance Liquid Chromatography (Column: YMC-Pack ODS-
AM AM-312, S-5um, 120A, 150 * 6.0mm, Column temperature: 40
The peak was confirmed at 0 ° C., eluent: 30 mM phosphate buffer (pH 3.0) / methanol = 25/75, flow rate: 1.0 ml / min, detection: UV210 nm).

[0090]

INDUSTRIAL APPLICABILITY According to the above-mentioned production method of the present invention, the desired amide group-containing guanidine derivative or a salt thereof can be produced industrially and conveniently.

Further, by using the production method of the present invention, the complicated synthetic steps required for synthesizing the amide group-containing guanidine derivative can be simplified, so that the cost of the amide group-containing guanidine derivative useful as a surfactant can be reduced. Become.

[0092]

[Sequence list]

SEQUENCE LISTING <110> AJINOMOTO Co., LTD <120> Method for producing amide group-containing guanidine derivative and its salt <130> PAMA-14141 <140><141><150> JP2001-157834 <151> 2001-05-25 <160> 5 <170> PatentIn Ver. 2.1 <210> 1 <211> 30 <212> DNA <213> Artificial Sequence <220><223> Description of Artificial Sequence: primer1 <400> 1 gaccatggct aaagtattaa ttgttgaaag 30 <210 > 2 <211> 28 <212> DNA <213> Artificial Sequence <220><223> Description of Artificial Sequence: primer2 <400> 2 ccggatccac gccttcagcg gaatagtg 28

[Brief description of drawings]

FIG. 1 is a flowchart showing the steps for producing a recombinant in which an arginine decarboxylase gene is amplified and expressed.

FIG. 2 is a flow chart showing the construction process of plasmid pTrcadi1.

Continued front page    (72) Inventor Yutaka Matsui             1-1, Suzuki-cho, Kawasaki-ku, Kawasaki-shi, Kanagawa             Elementary Co., Ltd. Fermentation Technology Laboratory (72) Inventor Yukiko Mori             450 Morotomizu, Morotomi-cho, Saga-gun, Saga Prefecture             Elementary Kyushu factory (72) Inventor Yoshimi Kikuchi             1-1, Suzuki-cho, Kawasaki-ku, Kawasaki-shi, Kanagawa             Elementary Co., Ltd. Fermentation Technology Laboratory (72) Inventor Ikumasa Onishi             1-1, Suzuki-cho, Kawasaki-ku, Kawasaki-shi, Kanagawa             Elementary Co., Ltd. Fermentation Technology Laboratory F term (reference) 4B024 AA01 AA03 BA07 CA04 DA06                       EA04 FA02 GA11 HA01                 4B064 AE01 CA21 CB14 CB30 CD13                       CE08 CE16 DA16                 4H006 AA02 AB84 AC53 BB10 BB31                       BE01

Claims (11)

[Claims] 1. The following general formula (I): (In the general formula (I), R ¹ and R ² are a hydrogen atom or a carbon number 1
To 4 linear or branched alkyl or alkenyl groups, which may be the same or different. A is a linear or branched alkylene group having 1 to 10 carbon atoms or an alkenylene group. ) The amino group-containing guanidine derivative represented by the formula (1) is reacted with a fatty acid halide or a fatty acid ester, and the following general formula (II): (In the general formula (II), R ¹ and R ^{2 each} represent a hydrogen atom or a carbon number of 1 to 1.
4 straight or branched chain alkyl or alkenyl groups, which may be the same or different. R ³ is a linear or branched alkyl group or alkenyl group having 1 to 22 carbon atoms. A is a linear or branched alkylene group having 1 to 10 carbon atoms or an alkenylene group. ) A method for producing an amide group-containing guanidine derivative represented by: 2. In the general formula (II), R ³ is a linear or branched alkyl group or alkenyl group having 7 to 17 carbon atoms, wherein the amide group is contained. Method for producing guanidine derivative. 3. The method for producing an amide group-containing guanidine derivative according to claim 1 or 2, wherein the amino group-containing guanidine derivative represented by the general formula (I) is 4-aminobutylguanidine. 4. The method for producing an amide group-containing guanidine derivative according to claim 3, wherein the 4-aminobutylguanidine is obtained by decarboxylating arginine using arginine decarboxylase. 5. The amide group-containing guanidine according to claim 4, wherein the arginine decarboxylase is an arginine decarboxylase produced by a recombinant in which the arginine decarboxylase gene is amplified and expressed. Method for producing derivative. 6. The method for producing an amide group-containing guanidine derivative according to claim 5, wherein the arginine decarboxylase gene is an Escherichia coli-derived adi gene. 7. The recombinant is FERM-BP793.
1. The method for producing an amide group-containing guanidine derivative according to claim 5, wherein the method is 1. 8. The amide group-containing guanidine according to claim 4, wherein in the conversion reaction of arginine to 4-aminobutylguanidine, the pH of the reaction system is controlled to be less than pH 6. Method for producing derivative. 9. The amide group-containing guanidine derivative according to any one of claims 1 to 8, wherein the amino group-containing guanidine derivative represented by the general formula (I) is reacted with a fatty acid halide. Production method. 10. The amino group-containing guanidine derivative represented by the general formula (I) is reacted with a fatty acid halide in water or a mixed solvent of water and an organic solvent. Of the amide group-containing guanidine derivative of 1. 11. A method for producing a salt of an amide group-containing guanidine derivative, which comprises neutralizing a solution of the amide group-containing guanidine derivative produced by the method according to any one of claims 1 to 10. .