JP2002542264A - Immunization with nucleic acids - Google Patents

Abstract

Summary of the Invention The main object of the present invention is to provide an alternative to conventional vaccine strategies using genetic vaccines to supply novel peptides that mimic the antigenic structure of protein, polysaccharide or lipid antigens It is to be. A recombinant nucleic acid molecule is described. This molecule encodes a polypeptide that mimics the target antigen. Reagents comprising vectors having the first sequence and compositions comprising these molecules are also described. Methods for constructing these reagents and using these reagents to elicit an immune response are also described.

Description

DETAILED DESCRIPTION OF THE INVENTION

TECHNICAL FIELD This invention relates to the general fields of molecular biology and immunology, and generally to reagents useful in nucleic acid immunization techniques. More particularly, the present invention relates to novel nucleic acid vaccine sequences that mimic conventional vaccine components, in particular mimic antigens, and nucleic acid molecules comprising such mimetic sequences, and such It relates to the use of reagents containing nucleic acid molecules.

BACKGROUND Vaccination is currently the most cost-effective and successful means of controlling infectious diseases known to humans. Conventional vaccine strategies typically involve a vaccine composition derived from an infectious agent (eg, an intact pathogen (eg, a live attenuated or inactivated pathogen) or a portion of a pathogen (eg, a purified subunit). ) To a subject. However, for many infectious agents, conventional vaccine strategies still have to be successfully developed, and there are also many instances where these conventional strategies have failed. One reason for this is that some pathogens may have surface components that are structurally similar to the host antigen, thus causing an inappropriate immune response when used in vaccine compositions. Because you get it. Another well-known problem in conventional vaccine development is that infants cannot respond to certain vaccines due to their immature immune system. In addition, because predominant surface antigens can often be multivalent, in order to be widely effective, a successful vaccine composition needs to consider multiple valencies. These problems are particularly acute with polysaccharide vaccine compositions (eg, pneumococcal and meningococcal polysaccharide vaccines, and influenza B polysaccharide vaccines).

[0003] Streptococcus pneumoniae is a major cause of morbidity and mortality in all age groups. It is one of the most common causes of bacterial pneumonia, and it is also an important cause of otitis media, meningitis and sepsis. Despite the initial success with antibiotics and chemotherapeutic agents (eg, sulfonamides), pneumococcal [sex] pneumonia remains an important cause of morbidity and mortality. There are approximately 500,000 cases each year. St
It has been observed that immunization with a vaccine composition comprising the capsular serotype polysaccharide of R. pneumoniae provides a very poor antibody response (particularly in children under 2 years of age). In addition, Streptococcus p
neumonia still has 86 recognized capsular types, each of which causes disease in humans. A complete polysaccharide vaccine composition against this pathogen has to consider all 86 capsular types and therefore cannot be manufactured.

[0004] Neisseria meningitidis is a causative agent of bacterial meningitis and sepsis in humans, and is responsible for meningococcal meningitis, a disease that can occur epidemic. is there. Meningococci are classified into serogroups based on the immunological characteristics of capsular and cell wall antigens. Recently recognized serogroups include A, B, C, D, W-135, X, Y, Z and 29E. Capsular polysaccharide antigens responsible for meningococcal serogroup specificity have been identified and purified from some of these groups, including the A, B, C, D, W-135 and Y serogroups. ing.

[0005] The identification of these meningococcal antigens has led to several commercial polysaccharide-based vaccines (
In particular, several meningococcal serogroups A, B, C, Y and vaccines developed against W135 have been developed. Isolated high molecular weight polysaccharides have been used in Group A and Group C vaccines, which can elicit group-specific complement-dependent bacterial antibodies in adults. However, these vaccines are not effective in young children, especially those younger than 2 years. The experimental group B vaccine (consisting of outer membrane protein vesicles) was found to be approximately 50% protective in adolescents. However, no protection was observed in vaccinated infants and children, the age group at highest risk of disease. Furthermore, these vaccines are serotype and subtype specific, and the predominant group B strains undergo both geographic and temporal changes, indicating the usefulness of such vaccines Severely.

[0006] Haemophilus influenzae is responsible for a number of serious infections in humans. In infants and young children, it causes acute bacterial meningitis and some other serious pediatric diseases, such as arthritis, cellulitis, pneumonia, and acute epiglottitis. In adults, it is most often associated with chronic lung disease. Although a number of different serotypes of Haemophilus influenzae have been identified, type b is the most common cause of human morbidity. H. i
Polysaccharide vaccines against nfluenzae (type b) are somewhat effective in adults, however, these vaccines provide very poor antibody responses in immunized children 2 years and younger. Because they are T-dependent antigens.

[0007] The same applies to other polysaccharide antigens. The influenzae polysaccharide can be converted to a T-dependent antigen by conjugation to a protein carrier. Such polysaccharide-protein conjugates are immunogenic in children and can elicit a boostable IgG response. H. Polysaccharide conjugate vaccines against influenzae (type b) have been very effective in controlling the disease in the United States over the past decade. However, developing and manufacturing conjugate vaccines is a very expensive and complicated process, and can lead to prohibitively high costs in these vaccine compositions.

SUMMARY OF THE INVENTION A primary object of the present invention is to replace conventional vaccine strategies using genetic vaccines to supply novel peptides that mimic the antigenic structure of protein, polysaccharide or lipid antigens It is to provide. More specifically, the pathogen-derived 1
Novel nucleic acid sequences encoding peptides that mimic one or more immunogenic epitopes are provided. The encoded peptide molecule has a different chemical composition than the original (eg, native) immunogen. These nucleic acid sequences can be identified using a variety of different approaches, most typically using a random peptide display library panned with antigen-specific antibody molecules. Once identified and synthesized, these nucleic acid molecules can be easily inserted into an appropriate molecule (eg, a plasmid vector) and used in a nucleic acid immunization regime to provide an immune response against a selected antigen. Can be done.

[0009] In biological systems, peptides can mimic polysaccharide molecules by binding to polysaccharide-specific antibodies, as well as to other polysaccharide binding proteins. This mimic has been used in the art, and molecules such as concanavalin A, which binds to oligosaccharides with terminal α-linked mannose or glucose residues, have a pII
It has been used to select peptidomimetics from bacterial phage libraries with short peptide sequences at the amino terminus of the I-coat protein. Oldenbe
rg et al. (1992) Proc. Natl. Acad. Sci. USA 89: 5
393; Scott et al. (1992) Proc. Natl. Acad. Sci. U
SA 89: 5398. Similarly, monoclonal antibodies have again been used to identify peptidomimetics of carbohydrates present on the surface of adenocarcinoma cells using phage libraries. Hoess et al. (1993) Gene 128: 43.

[0010] Peptides have also been used to raise polysaccharide-specific antibodies. For example,
Westerink et al. (1988) Infect. Immun. 56: 1120
Is used to raise anti-idiotype antibodies. meningitidis (
C serogroup) A monoclonal antibody against capsular polysaccharide was used. Mice passively immunized with this antibody were protected against infection with a lethal dose of meningococcal bacteria. That peptide fragments derived from anti-idiotypic antibody molecules elicit serum antibodies that protect the animals from death after lethal challenge with bacteremia and meningococcal group C bacteria;
It was found subsequently. Westerink et al. (1995) Proc. Natl. A
cad. Sci. USA 92: 4021.

[0011] These and other attempts have led to the identification of several peptidomimetics, namely peptides that mimic various bacterial polysaccharides and even protein antigens. However, these peptides have low immunogenicity per se and are chemically conjugated to carrier proteins when used as vaccine compositions. The present invention is based on the discovery of nucleic acid sequences encoding particular peptidomimetics (eg, peptides that mimic polysaccharide antigens), and the use of such nucleic acid sequences in genetic vaccine compositions.

Thus, in one aspect of the invention, there is provided a recombinant nucleic acid molecule comprising a nucleic acid sequence encoding a peptidomimetic of interest, wherein the nucleic acid sequence is operably linked to one or more regulatory sequences. Are linked. In one particular embodiment, the nucleic acid molecule is
Vector constructs (eg, plasmid vectors or recombinant viral vectors)
Exists inside. In another specific embodiment, the peptidomimetic corresponds to a polysaccharide antigen derived from or derived from a bacterial species selected from the group consisting of: Neisseria meningitidis, Streptococci.
us pneumoniae, and Haemophilus influen
zae.

In another aspect of the invention, there is provided a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a peptidomimetic of interest and a second nucleotide sequence encoding a peptide carrier molecule, wherein the first nucleic acid sequence comprises The one sequence and the second sequence are ligated together to form a hybrid sequence. In one particular embodiment, the peptide carrier molecule is a hepatitis B virus core antigen.

In a related aspect of the invention, the recombinant nucleic acid molecules of the invention are used in the manufacture of a polynucleotide medicament for raising an immune response in a subject against an agent comprising an antigen corresponding to a peptidomimetic. Is done. This polynucleotide drug is
It may be in the form of a composition comprising a recombinant nucleic acid molecule of the invention in combination with a pharmaceutically acceptable carrier or excipient. In certain aspects, the polynucleotide medicament is a liposome preparation. In another aspect, the polynucleotide drug is a particle drug. Preferably, the particulate medicament is suitable for transdermal injection into a subject to be treated.

[0015] A primary object of the present invention is also to provide particles suitable for transdermal injection with a needleless syringe. Here, the particles comprise a carrier coated with a recombinant nucleic acid molecule according to the invention.

It is a further primary object of the present invention to provide a method for eliciting an immune response to a target antigen in an immunized subject using a nucleic acid molecule encoding a peptidomimetic of the target antigen. It is. The method involves a primary immunization step, comprising one or more steps of transfecting the subject's cells with a recombinant nucleic acid molecule encoding the peptidomimetic. Cells can be transfected using expression cassettes and / or vectors containing any one of the recombinant nucleic acid molecules of the invention, and the transfection allows expression of the peptidomimetic in the subject. This is performed under the following conditions. The method may further involve a secondary (ie, booster) immunization step, comprising one or more steps of administering the secondary composition to the subject. Here, this secondary composition contains the same peptidomimetic and / or target antigen. These immunization methods are sufficient to elicit an immune response against the target antigen.

The means of transfection performed during the primary immunization step may be in vivo or ex vivo (eg, to obtain transfected cells and subsequently introduce the cells into a subject, followed by a secondary immunization step). ) Can be performed. If in vivo transfection is used, the nucleic acid molecule may be administered to the subject by intramuscular or intradermal injection of plasmid DNA, or preferably, to the subject using particle-mediated delivery techniques. .

An advantage of the present invention is that these recombinant nucleic acid molecules can be used as reagents in nucleic acid immunization strategies to achieve a superior qualitative and quantitative immune response against specific antigens, especially polysaccharide antigens. It is possible to do. Using nucleic acid vaccine compositions encoding a peptidomimetic of the target antigen, typically respond to subjects of all ages, especially against conventional vaccine compositions (eg, polysaccharide-based compositions). It is also an advantage that non-sexual, young children) can be vaccinated.
Because the peptidomimetics are chemically different from their corresponding target antigens, they may cause an inappropriate immune response in the immunized subject (where the natural or native form of the antigen produces autoreactive antibody production). That can occur, such as subject conditions). Still further advantages of the present invention are that DNA-based peptidomimetic vaccines can be produced simply and accurately, and that sequences encoding multiple peptidomimetics are provided in a single molecule. . These peptidomimetic nucleic acid vaccine compositions can also convert T-independent polysaccharides to T-dependent peptide antigens, and thus elicit a long-term IgG response with memory immunity.

[0019] These and other objects, aspects, embodiments and advantages of the present invention will be readily apparent to those skilled in the art in light of the disclosure herein.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Before describing the present invention in detail, it is to be understood that this invention is not limited to particular exemplified molecules or process parameters, which can, of course, vary. It should be. It should also be understood that the techniques used herein are for the purpose of describing particular embodiments of the present invention only and are not intended to be limiting. Further, the practice of the present invention will employ, unless otherwise indicated, conventional methods of virology, microbiology, molecular biology, recombinant DNA technology and immunology, all of which are within the skill of the art. It is in. Such techniques are explained fully in the literature. See, for example, Sambrook et al., Molecular Clon.
ing: A Laboratory Manual (2nd edition, 1989); DN
A Cloning: A Practical Approach, Part I & II
(D. Glover Edition); Oligonucleotide Syntheses
is (N. Gait ed., 1984); A Practical Guide
o Molecular Cloning (1984); and Fundame
See ntal Virology, 2nd Edition, Volumes I & II (ed. by BN Fields and DM Knipe).

[0021] All publications, patents and patent applications cited herein (both supra and infra) are hereby incorporated by reference in their entirety.

As used herein and in the appended claims, the singular forms “a”, “
Note that "an" and "the" include plural references unless the content clearly dictates otherwise.

A. Definitions Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although numerous methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein.

In describing the present invention, the following terminology will be used, and is intended to be defined as described below.

The term “nucleic acid immunization”, as used herein, introduces nucleic acid encoding one or more selected antigens into a host cell for in vivo expression of the antigen (s). That means. In the present invention, the nucleic acid molecule encodes one or more peptidomimetics corresponding to those corresponding to the antigen of interest. The nucleic acid can be introduced directly into the recipient subject by, for example, standard intramuscular or intradermal injection; transdermal particle delivery; inhalation; topical or transdermal, nasal or mucosal administration. The molecule can alternatively be introduced into cells removed ex vivo from a subject. In this latter case, the cells are reintroduced into the subject, where an immune response can be elicited against the antigen corresponding to the peptidomimetic encoded by the nucleic acid molecule.

By “needle-free syringe” is meant a device that delivers a particle composition cost-effectively without the aid of a conventional needle to pierce the skin. Needleless syringes for use with the present invention are discussed elsewhere herein.

The term “transdermal” delivery refers to intradermal (eg, into the dermis or epithelium), transdermal (tra
nsdermal (eg, “percutaneous”) and transmucosal administration (ie, delivery by passage of an agent into or through the skin or mucosal tissue), see, eg, Transderma
l Drug Delivery: Developmental Issue
s and Research Initiatives, Hadgraft
and Guy (eds.), Marcel Dekker, Inc. , (19
89); Controlled Drug Delivery: Fundam
entals and Applications, Robinson and
Lee (eds.), Marcel Dekker Inc. , (1987)
And Transdermal Delivery of Drugs, Vo;
ls. 1-3, Kydonieus and Berner (eds.), CR
C Press, (1987). Thus, this term is used in US Patent No. 5,630,
Needleless syringe delivery as described in US Pat. No. 796, and US Pat.
796, including delivery from particle-mediated delivery as described in US Pat.

The terms “carrier molecule” and “peptide carrier molecule” are used herein in the ordinary sense and refer to a peptide sequence, typically a macromolecule. To the macromolecule, a small molecule (eg, a hapten (eg, a peptidomimetic)) can be attached to enhance the immunogenicity of the small molecule.

“Core carrier” refers to a guest nucleic acid (eg, DNA) that imparts a defined particle size and provides a sufficiently high density to achieve the moment required for cell membrane transduction, thereby The guest molecule is a particle mediated technology (eg, US Pat.
No. 00,792) means a carrier that is coated so that it can be delivered. Core carriers are typically tungsten, gold, platinum, ferrite,
Including materials such as polystyrene and latex. See, for example, Particle Bombardment Technologyfor.
Gene Transfer, (1994) Yang, N .; ed. , Oxfo
rd University Press, New York, NY 10-1
One page.

“Antigen” refers to any factor (generally a macromolecule) that can elicit an immunological response in an individual. The term may be used to refer to a homogeneous or heterogeneous population of individual macromolecules or antigenic macromolecules. As used herein, “antigen” generally refers to a target molecule or portion thereof that contains one or more epitopes. Here, a peptide corresponding to the antigen can be obtained. For the purposes of the present invention, the antigen may be derived from any known target virus, bacterial, parasite or fungal pathogen. This term also contemplates any of a variety of tumor-specific antigens. Further, for the purposes of the present invention, "antigen" refers to modifications (eg, deletions, additions and substitutions (generally, Include proteins that have modifications that are conservative) .These modifications may be intentional (eg, by site-directed mutagenesis) or may be accidental, such as by mutation of the host producing the antigen. .

Peptides that “mimic the target antigen” (sometimes referred to as peptidomimetics)
A peptide sequence having a different chemical composition from the target antigen, but still capable of at least cross-reacting with an antibody molecule specific for the target antigen, and if such a peptide sequence is expressed in a subject, An immune response can be elicited against the target antigen. Such a peptide can mimic a protein (peptide) antigen, a polysaccharide antigen, or a lipid antigen. Under the present invention, when a peptide mimics a target protein or peptide antigen, it has a different chemical structure, ie, a different amino acid sequence, than the target protein or peptide antigen.

In various aspects of the invention, the peptide corresponds to an antigen that includes one or more T cell epitopes. "T cell epitope" generally refers to a characteristic of a peptide structure that can induce a T cell response. In this regard, it is acceptable in the art that T cell epitopes include linear peptide determinants that assume an extended conformation within the peptide bond cleavage of the MHC molecule (Unanue
et al. (1987) Science 236: 551-557). As used herein, a T cell epitope generally includes at least about 3-5.
A peptide having amino acid residues, and preferably at least 5-10
Or a peptide having more amino acid residues. The ability of a particular antigen and its peptidomimetics to stimulate a cell-mediated immunogenic response is determined by a number of well-known assays, such as lymphoproliferation (lymphocyte activation) assays, CTL cytotoxic cell assays, or sensitization. By performing an assay for T lymphocytes specific for that antigen in a given subject). See, for example, Erickson et al. (1993) J. Amer. Immun
ol. 151: 4189-4199; and Doe et al. (1994)
Eur. J. Immunol. 24: 2369-2376.

In another aspect of the invention, the peptidomimetic corresponds to an antigen comprising one or more B cell epitopes. "B cell epitope" generally refers to the site on an antigen to which a particular antibody molecule binds. Identification of epitopes that can elicit an antibody response can be readily performed using techniques well known in the art. For example, Geysen et al. (198
4) Proc. Natl. Acad. Sci. USA 81: 3998-400.
No. 4,708,871 (for identifying epitopes on antigens and chemically synthesizing them) And Geysen et al. (1986)
) See Molecular Immunology 23: 709-715 (Technique for identifying peptides with high affinity for a given antibody).

An “immune response” to an antigen of interest is the development in an individual of a humoral and / or cellular immune response to a peptidomimetic corresponding to the antigen. For the purposes of the present invention, a "humoral immune response" refers to an immune response mediated by antibody molecules, while a "cellular immune response" is an immune response mediated by T lymphocytes and / or other leukocytes. Refers to the response.

A polynucleotide is typically composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (polynucleotide Uracil (U) replaces thymine when is RNA); Thus, the term nucleic acid sequence is an alphabetical representation of a polynucleotide molecule. This alphabetic representation can be entered into a database on a computer with a central processing unit and used for bioinformatics applications such as functional genomics and homology searches.

A “vector” can transfer a nucleic acid molecule to a target cell (eg, a viral vector, a non-viral vector, a particulate carrier, and a liposome). Typically,
"Vector construct", "expression vector", and "gene transfer vector" refer to any nucleic acid construct capable of directing the expression of a gene of interest and transferring a gene sequence to a target cell. Thus, the term includes cloning and expression vehicles, as well as viral vectors. "Plasmids" are vectors in the form of extrachromosomal genetic elements.

A nucleic acid sequence “encoding” a peptidomimetic of a selected antigen, when placed under the control of appropriate regulatory sequences, is transcribed (in the case of DNA) and translated into a polypeptide in vivo. (In the case of mRNA) a nucleic acid molecule. The boundaries of the coding sequence are determined by a start codon at the 5 '(amino) terminus and a translation stop codon at the 3' (carboxy) terminus. For purposes of the present invention, such nucleic acid sequences may include, but are not limited to, cDNA from viral, prokaryotic or eukaryotic mRNA, viral or prokaryotic DNA or RN.
Genomic sequences from A, and even synthetic DNA sequences. A transcription termination sequence may be located 3 'to the coding sequence.

A “promoter” is a nucleotide sequence that initiates and regulates the transcription of a polynucleotide encoding a polypeptide. A promoter is an inducible promoter (expression of a polynucleotide sequence operably linked to a promoter). , An analyte, a cofactor, when induced by a regulatory protein, etc.), a repressible promoter (expression of a polynucleotide sequence operably linked to the promoter,
And constitutive promoters, if suppressed by analytes, cofactors, regulatory proteins, etc.). The term “promoter” or “control element”
Includes full-length promoter regions and functional (eg, obtains, controls transcription or translation) segments of these regions.

“Operably linked” refers to an arrangement of elements that is configured so that the components so described perform their useful function. Thus, a given promoter operably linked to a nucleic acid sequence may direct the expression of that sequence when the appropriate enzyme is present. A promoter need not be contiguous with a sequence as long as it functions to direct the expression of the sequence. Thus, for example, the intervention of a transcribed but not yet translated sequence may be between the promoter sequence and the nucleic acid sequence, and the nucleic acid sequence and the promoter sequence may still be "operably linked to the coding sequence. Have been "done.

“Recombinant” is used to describe a nucleic acid molecule (polynucleotide) of genomic, cDNA, semi-synthetic, or synthetic origin, by origin or manipulation not associated with all or a portion of the polynucleotide. Used. The polynucleotide is naturally associated and / or linked to a polynucleotide other than the naturally linked polynucleotide. Two nucleic acid sequences contained within a single recombinant nucleic acid molecule are "heterologous" to each other if they are not normally associated with each other in nature.

Techniques for determining “sequence identity” or “sequence homology” of nucleic acids and amino acids are also known in the art. Typically, such techniques involve determining the nucleotide sequence of mRNA for a gene and / or determining the amino acid sequence encoded thereby, and combining these sequences with a second nucleotide or amino acid sequence. And comparing. Typically,"
"Identity" refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid match of two polynucleotide or polypeptide sequences, respectively.
Two or more sequences (polynucleotides or amino acids) can be compared by determining their "percent identity." The percent identity of the two sequences, whether in the nucleic acid or amino acid sequence, is the number of exact matches between the two aligned sequences divided by the length of the shorter sequence, and 100
Is multiplied by The approximate alignment for the nucleic acid sequence was
And Waterman, Advances in Applied Math
electronics 2; 482-489 (1981). This algorithm is based on Dayhoff, Atlas of
Protein Sequence and Structure, M.C. O.
Edited by Dayhoff, 5 Addendum, 3: 353-358, National Biom
electronic Research Foundation, Washingto
n, D. C. , USA, can be applied to amino acid sequences by using a scoring matrix, and is described in Gribskov, Nucl. A
cids Res. 14 (6): 6745-6763 (1986). An exemplary implementation of this algorithm for determining the percent identity of a sequence is described in Genetics Computer Group (Madi) in the "Best Fit" utility application.
son, WI). The default parameters for this method are Wisconsin Sequence Analysis Package.
e Program Manual, Version 8 (1995) (Gene
tics Computer Group, available from Madison, WI). A preferred method of establishing percent identity in the context of the present invention is copyrighted by the University of Edinburg and is described in John F. Collins and Shane S.C. Sturro
k, and developed by IntelliGenetics, Inc. (M
using the program of the MPSRCH package distributed by the Company's own View, CA. If the default parameters are used for the scorecard, from the suite package, Smith-Wa
A terman algorithm may be used (eg, 12 gap open penalty, 1 gap extension penalty and 6 gaps)
. From that data, a generated "match" value indicates "sequence identity." Other suitable programs for calculating percent identity or similarity between sequences are generally known in the art; for example, another alignment program is B
LAST, used with default parameters. For example, BLAST
N and BLASTP can be used using the following default parameters: genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; matrix = BLOSUM62; description = 50 sequences ;
Sort by = HIGH SCORE; database = non-redundancy, GenBank and EMBL and DDBJ and PDB and Ge
nBank CDS translation and Swiss protein and Supdate and PIR. Details of these programs can be found at the following internet address: h
http: // www. ncbi. nlm. gov / cgi-bin / BLAST
Can be found in

Alternatively, homology can be determined by hybridization of the polynucleotide under conditions that form a stable duplex between regions of homology, then digested with a single-strand-specific nuclease, and Determine the size of the digested fragment. As determined using the methods described above, two DNA sequences or two polypeptide sequences have at least about 80% -85% sequence identity over a defined length of the molecule; Preferably "substantially homologous" to each other if they show at least about 90% sequence identity and most preferably at least about 95% to 98% sequence identity. As used herein, substantially homologous refers to sequences that show complete identity to the specified DNA or polypeptide sequence. DNA sequences that are substantially homologous can be identified, for example, in Southern hybridization experiments under stringent conditions as defined for that particular system. For example, stringent hybridization conditions include 50% formamide, 5 × Denhardt's solution, 5 × SSC, 0.1
% SDS and 100 μg / ml denatured salmon sperm DNA, and washing conditions are 2 × SSC at 37 ° C., 0.1% SDS, then 1 × SSC at 68 ° C.,
It may contain 0.1% SDS. Defining appropriate hybridization conditions is within the skill of the art. See, eg, Sambrook et al., Supra; DNA Cl
oning, supra; Nucleic Acid Hybridization,
See above.

The term “adjuvant” refers to the ability to specifically or non-specifically alter, increase, direct, or redirect an antigen-specific immune response.
g) Any substance or composition that can be, enhanced, or initiated is contemplated. Thus, co-administration of an adjuvant with an antigen can result in lower or lower doses of the antigen required to achieve the desired immune response in the subject to which the antigen is administered, or It can result in a qualitatively and / or quantitatively different immune response in the subject. The efficacy of the adjuvant is determined by administering the adjuvant to the animal with the vaccine composition, administering the vaccine composition alone to the animal in parallel, and determining the antibody and / or cell-mediated immunity in the two groups by a standard assay. (Eg, radioimmunoassays, ELISAs, CTL assays, etc., all of which are well known in the art). Typically, in a vaccine composition, the adjuvant is a separate part from the antigen, but the single molecule has adjuvant and antigenic properties (
For example, cholera toxin).

The terms “individual” and “subject” include, but are not limited to, humans and other primates, and include non-human primates (eg, chimpanzees and other ape and monkey species; livestock) (Eg, cows, sheep, pigs, goats and horses);
Domestic animals (eg, dogs and cats); laboratory animals including rodents (eg, mice, rats and guinea pigs); birds including domestic, wild and hunting birds (eg, chickens, turkeys and other poultry) Used interchangeably herein to refer to any member of the subdivision cordata, including birds (ducks, geese, etc.). The term does not imply a particular age. Thus, both adult and newborn individuals are intended to be covered. The methods described herein are intended for use in any of the above vertebrate species. This is because the immune system of all these vertebrates works in the same way.

B. General Methods In one embodiment, a recombinant nucleic acid molecule is provided. Recombinant molecules include sequences encoding peptides that mimic the target antigen. The target antigen may be any suitable antigen, and preferably is associated with a pathogen (eg, a viral, bacterial or parasitic pathogen), or the antigen may be a tumor-specific antigen. In certain embodiments, the sequence is a polysaccharide antigen (eg, Neisserial).
a meningitidis, Streptococcus pneumo
niae or a polysaccharide derived from or obtained from Haemophilus influenza bacterial species).

[0046] Particular peptidomimetics are identified using techniques known to those skilled in the art. For example, soluble peptides, peptides tethered on a solid phase, peptides displayed on bacterial phage surface proteins, bacterial surface proteins or antibodies are all
Can be used for screening for suitable peptidomimetics. One preferred method for identifying linear peptide epitopes requires the construction and screening of a random peptide or protein bacteriophage library. Such phage display technology can be used to display millions of variants of a given protein or peptide on the surface of a bacteriophage,
This allows for high performance screening to find highly reactive molecules for a given target antigen. These libraries can be constructed using conventional procedures known in the art. For example, suitable procedures are described in US Pat. Nos. 5,223,409 and 5,403,484, and Devlin et al. (1990) Sc.
issue 249: 404-406; Kay et al. (1993) Gene 128.
: 59-65; Smith et al. (1993) Gene 128: 37-42; Ho.
ess et al. (1993) Gene 128: 43-49; and Sastry et al.
1989) Proc. Natl. Acad. Sci. USA 86: 5728-
No. 5732, all of which are hereby incorporated by reference.

Thus, any of these or equivalent procedures can be used to create a phage display library for screening for peptidomimetics for a target antigen. Suitable target viral antigens include, but are not limited to, the hepatitis family of viruses (hepatitis A virus (HAV),
Hepatitis B virus (HBV), Hepatitis C virus (HCV), Hepatitis delta (H
DV), a polynucleotide sequence encoding an antigen from hepatitis E virus (HEV) and hepatitis G virus (HGV); herpes simplex virus (HSV)
Type 1 and 2 (eg, HSV-1 and HSV-2 glycoproteins, gB, gD
And gH) -type antigens; varicella-zoster virus (VZV), Epstein-
Bar virus (EBV) and cytomegalovirus (CMV) (CMV gB
And gH); and other human herpesviruses (eg,
Antigens from HHV6 and HHV7 (see, eg, Chee et al. (1990) Cyt
omegaviruses (edited by JK McDougall, Spring)
er-Verlag, pp. 125-169; McGeoch et al. G
en. Virol. 69: 1531-1574; U.S. Patent No. 5,171,568.
No .; Baer et al. (1984) Nature 310: 207-211; and D.
Avison et al. (1986) J. Am. Gen. Virol. 67: 1759-181
6).

HIV antigens, including members of various HIV gene subtypes (eg, the gp120 sequence for many HIV-1 and HIV-2 isolates) are known and reported (eg, Myers Et al., Los Alamos Da
tabase, Los Alamos National Laboratory
y, Los Alamos, New Mexico (1992); and Mod
row et al. (1987) J. Am. Virol. 61: 570-578).
And antigens derived from any of these isolates find use in the present methods. Further, the invention is equally applicable to other immunogenic molecules from any of a variety of HIV isolates. These isolates contain various coat proteins (eg, gpl60 and gp41, gag antigens (eg, p24gag and p24).
55gag) and HIV pol, env, tat, vif, rev, ne
f, vpr, vpu and proteins derived from the LTR region)). Antigens derived from or derived from other viruses (eg, without limitation, antigens from members of the following family (Picornavirid)
ae (eg, poliovirus); Caliciviridae; Toga
viridae (eg, rubella virus, dengue virus, etc.); Flavi
viridae; Coronaviridae; Reoviridae; Bir
naviridae; Rhabodoviridae (eg, rabies virus etc.); Filoviridae; Paramyxoviridae (eg,
Epidemic parotitis virus, measles virus, respiratory syncytial virus, etc.); Bun
yaviridae; Arenaviridae; Retroviradae (
For example, HTLV-I; HTLV-II; HIV-1 (HTLV-III, LA
V, ARV, hTLR, etc.)) (in particular, HIV _IIIb , H
IV _SF2 , HIV _LAV , HIV _LAI , HIV _MN ; HIV-1 _CM235 , HIV-1 _USA
Antigens from, but not limited to, HIV-2 isolates))
Can be used to build display libraries. For a description of these and other viruses, see, eg, Virology 3rd Edition (WK
. Joklik ed., 1988); Fundamental Virology,
See Second Edition (ed. By BN Fields and DM Knipe, 1991).

[0049] Sequences encoding appropriate bacterial and parasitic antigens include, but are not limited to, diseases (eg, diphtheria, pertussis, tetanus, tuberculosis, bacterial or fungal pneumonia, cholera, typhoid,
Plague, shigellosis or salmonellosis, Legionaire's disease (Legionaire's
Disease, Lyme disease, Leprosy, Malaria, Hookworm, Onchocerciasis, Schistosomiasis, Trypanosomiasis, Lesmaniasis, Giardia, Giardia, Amoebiasis, Amoebiasis Boreliosis
a) and trichinellosis) obtained from or derived from known etiologies. Still further antigens may be derived from or derived from non-conventional factors such as the following agents: for example, Kleu, Creutzfeldt-Jakob disease (
CJD), protein-like infectious particles such as prions associated with scrapie, infectious encephalopathy of mink and chronic wasting disease, or bovine spongiform encephalopathy.

[0050] Once the library is constructed, it is screened for monoclonal antibodies against the target antigen. Bacteriophage plaques that bind to the screening antibody are selected, cloned (using standard cloning techniques), expanded, and then in a standard competitive binding assay format,
Tested for ability to inhibit binding of antibody to target antigen. Bacteriophages displaying peptides that inhibit antibody binding are sequenced and the nucleic acid and amino acid sequences of the cloned peptidomimetic are determined. The nucleic acid sequence is then synthesized and used as a reagent to determine whether the encoded peptide will produce an antibody against the target antigen, and will further react with the target antigen in a host immunized with the nucleic acid sequence. A strong immune response.

A similar phage library procedure can also be used to identify peptides that mimic the structural epitope of the target antigen. For example, mice can be immunized with a monoclonal antibody specific for a target antigen. Splenocytes from mice are collected after a sufficient time for an immune response. MRNA for the heavy and trans chain variable regions of mouse IgG (obtained from recovered splenocytes) is extracted and a cDNA library is constructed. This cDNA is then, for example,
(1989) Science 246: 1275-1281, which is incorporated herein by reference, can be cloned into a commercially available combinatorial bacteriophage library.

[0052] These combinatorial libraries were then screened using monoclonal antibodies as described above, and positive plaques were selected and cloned according to standard techniques. The cloned bacteriophage was expanded and screened for its ability to inhibit monoclonal antibodies that bind to the target antigen. These bacteriophages that inhibit antibody binding are further screened for the ability to elicit the production of anti-target antigen antibodies in the immunized animal, and the selected candidates are identified as heavy and light chain variable regions ( For example, it was sequenced to determine the sequence of the antigen-binding site, and predictions were made for generating peptidomimetics corresponding to the structural epitopes of the target antigen.

The nucleic acid sequence encoding the peptidomimetic is then paired with one or more appropriate control sequences to provide a recombinant nucleic acid molecule of the invention. See, for example, Sambrook et al., Supra, for a description of cloning techniques and techniques used to obtain and isolate DNA. The polynucleotide sequence may also include
Rather than cloning, it can be made synthetically.

[0054] Once the sequences related to the peptidomimetic and the related control sequences are obtained, they can be operably linked together to form a recombinant nucleic acid molecule using standard cloning or molecular biology techniques. Can be provided. For example, Edge (1981)
Nature 292: 756; Nambair et al. (1984) Science.
223: 1299; and Jay et al. Biol. Chem. 2
59: 6311. The nucleic acid molecule can then be inserted into a suitable vector, such as an expression plasmid vector construct or an expression viral vector construct.

[0055] More typically, once the sequence encoding the peptidomimetic has been identified and properly synthesized, it can be placed in a vector that already contains control sequences operably linked to the inserted sequence. Can be inserted. Thus, it allows expression of the peptidomimetic in a target subject in vivo. For example, typical promoters for mammalian cell expression include the SV40 early promoter, the CMV promoter (eg, the CMV immediate early promoter), the mouse mammary tumor virus LTR promoter, the adenovirus major late promoter.
(Ad MLP) and other suitable and efficient promoter systems. Non-viral promoters, such as those derived from the mouse metallothionein gene, can also be used for mammalian expression. Preferably, there is also a sequence located 5 'to the coding sequence for optimizing the initiation of translation. Examples of transcription termination / polyadenylation signals include Sam
Signals from SV40 as described in Brook et al. (supra), as well as signals from bovine growth hormone terminator sequences. Introns containing splicing donor and acceptor sites can also be designed into expression cassettes.

[0056] In addition, enhancer elements can be included in the expression cassette to increase expression levels. Examples of suitable enhancers include the SV40 early gene enhancer (Dijkema et al. (1985) EMBO J. 4: 761), the enhancer / promoter from the Rous meat species virus terminally overlapping sequence (LTR) (Gor).
(1982) Proc. Natl. Acad. Sci. USA 79:
6777), and elements derived from human or mouse CMV (Boshart
Et al. (1985) Cell 41: 521) (eg, elements contained in the CMV intron A sequence).

In another example, a sequence encoding a peptidomimetic (identified and prepared as described above) is combined with a second sequence encoding a peptide carrier molecule to obtain a hybrid sequence. . Many suitable peptide carrier sequences are known to those of skill in the art, and they are all equally suitable for use with the present invention. However, in a preferred embodiment, the peptide carrier molecule is provided by a sequence encoding hepatitis B virus nucleocapsid antigen (HbcAg).
The sequence encoding the peptidomimetic can be inserted into the loop region of the immunodominant core epitope (ICE) of the HBcAg carrier molecule. Alternatively, the ICE area
A sequence that can be deleted from the molecule and that encodes a peptidomimetic can be inserted at the position of the ICE region or any other N-terminus of the HBcAg portion of the molecule,
It can be inserted at the C-terminal or internal position. Preferably, the insertion of the peptidomimetic encoding sequence into the HBcAg portion of the hybrid molecule does not affect the ability of the expression product to self-assemble into hybrid core carrier particles. When transfected into a suitable host cell, the recombinant nucleic acid molecule encodes a hybrid HBcAg carrier moiety, where the HBcAg moiety functions as a carrier and the peptidomimetic moiety functions as an immunogen.

The HBcAg portion of a recombinant nucleic acid molecule can be obtained from a known source. In this regard, hepatitis B virus (HBV) is an enveloped virus with a small, double-stranded DNA genome. The sequence of the HBV genome (eg,
dw and ayw) are known and are well characterized (Tiollai
(1985) Nature 317: 489; Chisari et al. (1989)
) Microb. Pathog. 6: 311). HBcAg is a polypeptide composed of 180 amino acid residues and has several well-studied immunodominant portions (eg, the ICE loop region). HBcAg is HBc
Ag can readily be expressed in Escherichia coli and other prokaryotes, where Ag self-assembles into particles. For this reason, many peptide antigens are HBc
Ag hybridized to provide hybrid core carrier particles that exhibit enhanced B cell immunogenicity (Schoedel et al. (1994) J. Exper. Med. 1).
80: 1037; Clarke et al. (1987) Nature 330: 381;
Borisova et al. (1989) FEBS Lett. 259: 121; Sta
hl et al. (1989) Proc. natl. Acad. Sci. USA 86: 6
283). Nucleic acid sequences encoding HBcAg are also known and
Plasmid constructs containing the g sequence have been described (Schoedel et al., supra).
). In the expression product, the immunodominant loop region is the I present at residues about 74-81.
Together with CE, it spans residues 72-85 of the 180 residue HBcAg molecule.

In some molecules, a third, auxiliary sequence provides for secretion of an adherent hybrid HBcAg peptidomimetic molecule from mammalian cells. Such secretory leader sequences are known to those of skill in the art, and include, for example, tissue plasminogen activators (
tpa) Includes leader signal sequence.

Once the sequence encoding the peptidomimetic is H
When inserted into a BcAg sequence, the recombinant molecule can be inserted into a vector containing control sequences operably linked to the inserted sequence, and thus, hybridize in vivo in the targeted subject species. Allows expression of HBcAg antigen molecules. Suitable control sequences are described herein above.

Once completed, any of the above-described recombinant nucleic acid molecules can be used for nucleic acid immunization using standard gene delivery protocols. Methods for gene delivery are known in the art. For example, US Patent Nos. 5,399,346 and 5,58
Nos. 0,859 and 5,589,466. The gene can be delivered directly to the subject, or can be delivered ex vivo into cells from the subject, and the cells can be reimplanted into the subject.

For example, preparations containing the recombinant polynucleotides described above, with or without the addition of adjuvant compositions, are compatible with standard pharmaceutical formulation chemistry and methodology, all of which are readily available to those of skill in the art. And can be provided. For example, a composition comprising one or more nucleic acid sequences (eg, in the form of a suitable vector, such as a DNA plasmid)
Can be combined with one or more pharmaceutically acceptable excipients or vehicles to provide a liquid preparation.

Auxiliary substances such as wetting or emulsifying agents, pH interfering substances and the like can be present in excipients or vehicles. These excipients, vehicles and auxiliary substances are generally pharmaceutical agents that do not elicit an immune response in the individual receiving the composition and can be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, for example, water, saline, polyethylene glycol, hyaluronic acid, glycerol and ethanol. Pharmaceutically acceptable salts may also be included therein: mineral salts (eg, hydrochloride, hydrobromide, phosphate, sulfate, etc.); and salts of organic acids (eg, acetate, Propionate, malonic acid salt, benzoate, etc.). Although not required, if peptides, proteins or other molecules are to be included in the vaccine composition, it is also preferred that the preparations include pharmaceutically acceptable excipients, which in particular act as stabilizers for them. Examples of suitable carriers that also act as stabilizers for the peptide include, but are not limited to, the following pharmaceutical grades: glucose, sucrose, lactose,
Trehalose, mannitol, sorbitol, inositol, dextran and the like. Other suitable carriers include, but are not limited to, starch, cellulose, sodium or calcium phosphate, citric acid, tartaric acid, glycine, high molecular weight polyethylene glycol (PEG), and combinations thereof. . Pharmaceutically acceptable excipients, vehicles and auxiliary substances are referred to in REMINGTON'S PHARMACE, incorporated herein by reference.
UTICAL SCIENCES (Mack Pub. Co., NJ. 199)
Available in 1).

[0064] Facilitators of nucleic acid uptake and / or expression ("
A transfection-enhancing factor ") can also be included in the composition (eg,
Enhancers (eg, bupivacaine, cardiotoxin and sucrose) and transfection-enhancing vehicles (eg, liposome preparations conventionally used to deliver nucleic acid molecules). Useful liposome preparations include cationic (positively charged), anionic (negatively charged) and neutral preparations, with cationic liposomes being particularly preferred. Cationic liposomes are used for intracellular delivery of plasmid DNA (Felgner et al. (1987) Pr.
oc. Natl. Acad. Sci. USA 84: 74137416) and intracellular delivery of mRNA (Malone et al. (1989) Proc. Natl. Ac).
ad. Sci. USA 86: 6077-6081). Alternatively, the nucleic acid molecules of the invention can be encapsulated, adsorbed to, or bound to a particulate carrier. Suitable particulate carriers include poly (lactide) and particulate carriers derived from polymethyl methacrylate polymers, as well as PLG microparticles derived from poly (lactide-co-glycolide). See, for example, Jeffery et al. (1993) Pharm. Res. 10: 362-368
checking ... Other particle systems and polymers can also be used (eg, polymers: for example, polylysine, polyarginine, polyornithine, spermine, spermidine, and conjugates of these molecules).

[0065] If desired, viral vectors can be used to deliver the polynucleotides of the invention. Many virus-based systems have been developed for gene transfer into mammalian cells. For example, a selected coding sequence can be inserted into a vector and packaged into a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to the subject's cells, either in vivo or ex vivo. Many retroviral systems have been described (US Pat. No. 5,219,740; Miller et al. (1989)).
BioTechniques 7: 980-990; Miller, A .; D. (
1990) Human Gene Therapy 1: 5-14; and Bu
rns et al. (1993) Proc. Natl. Acad. Sci. USA 90:
8033-8037).

A number of adenoviral vectors have also been described (Haj-Ahmad et al. (1.
986) J. Virol. 57: 267-274; Bett et al. (1993) J. Am.
Virol. 67: 5911-5921; Mittereder et al. (1994).
Human Gene Therapy 5: 717-729; and Rich
(1993) Human Gene Therapy 4: 461-476).
. In addition, various adeno-associated virus (AAV) vector systems have been developed for gene delivery. AAV vectors can be readily constructed using techniques well known in the art. For example, U.S. Patent Nos. 5,173,414 and 5,139,
No. 941; International Publication Nos. WO 92/01070 (published Jan. 23, 1992) and WO 93/03769 (published Mar. 4, 1993); L
ebkowski et al. (1988) Molec. Cell. Biol. 8: 398
8-3996; Vincent et al. (1990) Vaccines 90 (Col.
d Spring Harbor Laboratory Press); Car
ter. J. (1992) Current Opinion in Bio
Technology 3: 533-539; Muzyczka, N .; (199
2) Current Topics in Microbiol. and Im
munol. 158: 97-129; and Kotin, R .; M. (1994)
See Human Gene Therapy 5: 793-801. Additional viral vectors that find use for delivering nucleic acid molecules encoding the present peptide mimetics include mimetics from the pox family of viruses, including vaccinia virus and avian poxvirus.

Here again, the formulation of a liposome or viral vector composition comprising a nucleic acid molecule as described above can be performed using standard pharmaceutical formulation chemistry and methodology, all of which are readily available to those skilled in the art. Can be implemented. For example, a composition comprising one or more nucleic acid molecules can be combined with one or more pharmaceutically acceptable excipients or vehicles. Auxiliary substances such as wetting or emulsifying agents, pH buffering substances and the like can be present in excipients or vehicles.

Although not required, the polynucleotide medicaments of the invention can be effectively used in any suitable adjuvant or combination with an adjuvant. For example, suitable adjuvants include, but are not limited to: adjuvants formed from aluminum salts (alum) (eg, aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc.); oil-in-water and in oils Water emulsion formulations (eg, Complete Freund's Adjuvant (CFA) and Incomplete Freund's Adjuvant (IFA)); adjuvants formed from bacterial cell wall components (
For example, adjuvants containing lipopolysaccharides (eg, lipid A, or monophosphoryl lipid A (MPL) (Imoto et al. (198)
5) Tet. Lett. 26: 1545-1548)), trehalose dimycolate (TDM) and cell wall skeleton (CWS)); heat shock proteins or derivatives thereof; adjuvants derived from: ADP-ribosylating bacterial toxin (Diphtheria toxin (DT), pertussis toxin (PT), cholera toxin (CT), E. coli
Non-thermostable toxins (LTl and LT2), Pseudomonas endotoxin A, Ps
eumonas exotoxin S, B. cereus extracellular enzyme; sphae
ricus toxin, C. botulinum C2 and C3 toxins; limo
sum extracellular enzymes, as well as C.I. perfringens, C.I. spirifo
rma and C.I. difficile, Staphylococcus aur
eus EDIN contains a toxin derived from), and ADP- ribosylating bacterial toxin mutants (e.g., CRM _197, a nontoxic diphtheria toxin mutant) (e.g., Bi
xler et al. (1989) Adv. Exp. Med. Biol. 251: 175;
And Constantino et al. (1992) Vaccine); saponin adjuvant (eg, Quil A (US Pat. No. 5,057,540), or particles produced from saponins such as ISCOM (immunostimulating complex); chemokines and cytokines ( For example, interleukins (eg, IL-1, IL-
2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-12, etc.))
, Interferon (for example, gama interferon (gama interfon)
eron), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (
TNF), defensins 1 or 2, RANTES, MIP1-α and MI
P-2 etc.); muramyl peptide (for example, N-acetyl-
Muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl- ^L -alanyl- ^D -isoglutamine (nor-MDP), N-acetylmuramyl- ^L -alanyl- ^D -Isoglutaminyl- ^L -alanine-2- (1'-2'-dipalmitoyl (dipalmito)
yl) -sn-glycero-3hydroxyphosphoryloxy (huydoxyp)
phosphoryloxy) -ethylamine (MTP-PE) and the like;
Adjuvants derived from synthetic oligonucleotides containing the G family, CpG dinucleotides and CpG motifs (eg, Krieg et al., Nature (1
995) 374: 546, Medzhitov et al. (1997) Curr. Opi
n. Immunol. 9: 4-9, and Davis et al. Immunol.
(1998) 160: 870-876); and synthetic adjuvants (e.g., PCPP (poly [di (carboxatophenoxy (carboxy)));
latophenoxy)) phosphazene) (Pa
yne et al., Vaccines (1998) 16: 92-98). Such adjuvants are available from many vendors (eg, Accurate Chemicals; R
ibi Immunochemicals, Hamilton, MT; GIBC
O; Sigma, St. Louis, MO). Preferred adjuvants are those derived from ADP-ribosylating bacterial toxins, with cholera toxins and thermolabile toxins being most preferred. Oligonucleotides containing a CpG motif are also preferred. Other preferred adjuvants are those provided in nucleic acid form (eg, nucleic acid sequences encoding chemokines and cytokines) (eg, interleukins (eg, IL-1, IL-2, IL-
4, IL-5, IL-6, IL-7, IL-8, IL-12, etc.), interferons (eg, Gama interferon), macrophage colony stimulating factor (
M-CSF), tumor necrosis factor (TNF), defensin 1 or 2, RANT
ES, MIP1-α molecule and MIP-2 molecule).

The adjuvants can be delivered individually or can be administered in a combination of two or more adjuvants. In this regard, the combined adjuvant may have an additive or synergistic effect in promoting the desired immune response. A synergistic effect is one in which the results achieved by combining two or more adjuvants are greater than would be expected by simply adding the results achieved with each adjuvant when administered individually. A preferred adjuvant combination is an ADP-ribosylating bacterial toxin and an adjuvant derived from a synthetic oligonucleotide containing a CpG motif.

When used in nucleic acid immunization, the formulated composition comprises an amount of a nucleic acid molecule, which is expressed in an immunized subject to provide a peptidomimetic. , As defined above, is sufficient to increase the immune response. Suitable effective amounts can be readily determined by one skilled in the art. Such an amount
It falls within a relatively wide range that can be determined through routine trials. This composition has about 0
. It can contain from 1% to about 99.9% of the recombinant nucleic acid molecule and can be administered directly to a subject or delivered ex vivo to cells from the subject using methods known to those of skill in the art. .

For example, a polynucleotide pharmaceutical product of the present invention can be administered to a subject in vivo using a variety of known routes and techniques. Liquid preparations include injectable solutions,
It can be provided as a suspension or emulsion and is administered via parenteral, subcutaneous, intradermal, intramuscular, intravenous injection using conventional needles and syringes or using a liquid jet injection system Can be done. Liquid preparations may also be administered topically to the skin or mucosal tissues, or may be presented as a finely divided spray suitable for respiratory or pulmonary administration. Other modes of administration include oral routes, suppositories, and active or passive transdermal delivery techniques.

Alternatively, the vaccine composition can be administered ex vivo, for example, the delivery and reimplantation of transformed cells into a subject are known (eg, dextran-mediated transformation, calcium phosphate precipitation, electroporation). Poration and direct microinjection into the nucleus). Other routes of administration include, but are not limited to, rectal and sheath, intraperitoneal, intravenous, oral and intramuscular.

However, the nucleic acid molecule is delivered using a needle-free syringe (eg, ejecting microparticles coated with nucleic acid into the target tissue, a particle acceleration device), or transdermally applying the nucleic acid composition in particulate form Is preferred. In this regard, gene gun-based nucleic acid immunization has been shown to elicit both humoral and cytotoxic T lymphocyte immune responses following epidermal delivery of nanogram quantities of DNA. Pertm
er et al. (1995) Vaccine 13: 1427-1430. Particle-mediated delivery techniques have been compared to other types of nucleic acid inoculation and have been found to be significantly superior. Fynan et al. (1995) Int. J. Immunophar
maclogy 17: 79-83; Fynan et al. (1993) Proc. N
atl. Acad. Sci. USA 90: 11478-11482, and R
az et al. (1994) Proc. Natl. Acad. Sci. USA 91: 9
519-9523. Such studies have investigated particle-mediated delivery of nucleic acid-based vaccines to both superficial skin and muscle tissue.

[0074] Particle-mediated methods for delivering nucleic acid preparations are known in the art. Thus, once prepared and appropriately purified, the nucleic acid molecules can be coated onto core carrier particles using various techniques known in the art. The core carrier particles are selected from materials having a suitable density within the range of particle sizes typically used for intracellular delivery from a gene gun device. The optimal carrier particle size will, of course, depend on the diameter of the target cell.

For the purposes of the present invention, tungsten, gold, platinum and iridium carrier particles may be used. Tungsten and gold particles are preferred. Tungsten particles are readily available with an average size of 0.5-2.0 μm in diameter. Gold particles or microcrystalline gold (eg, gold powder A1570 (Engelhard Corp.,
East Newark, NJ)) also finds use in the present invention. Gold particles provide a uniform size (1 from Alpha Chemicals)
Available in a particle size of μ3 μm, or Degussa, South Pla
infield, available from NJ in a range of particle sizes including 0.95 μm).
Microcrystalline gold offers a variety of particle size distributions, typically in the range of 0.5-5 μm. However, the irregular surface area of microcrystalline gold provides a very efficient coating with nucleic acids.

A number of methods are known and have been described for coating or depositing DNA or RNA on gold or tungsten particles. Most of such methods generally involve the transfer of a predetermined amount of gold or tungsten to plasmid DN.
A, Combined with CaCl ₂ and spermidine. The resulting solution is vortexed continuously during the coating procedure to ensure uniformity of the reaction mixture. After precipitation of the nucleic acids, the coated particles can be transferred to a suitable membrane and dried before use, coated on the surface of a sample module or cassette, or a delivery cassette for use in a particular gene gun device Can be loaded.

A variety of needle-free syringes suitable for particle-mediated delivery are known in the art and are all suitable for use in practicing the present invention. Current device designs use explosive, electrical or gaseous emission to propel the coated carrier particles to target cells. The coated carrier particles may be releasably adhered to a carrier sheet that is itself movable, or may be removably adhered to a surface through which a gas stream passes, lifting the particles off this surface and targeting them to a target. And accelerate. An example of a gas release device is described in US Pat.
04,253. Explosive devices are disclosed in US Pat. No. 4,945.
, 050. One example of a helium emitting particle accelerator is P
powerJect XR (registered trademark) instrument (PowerJect Vacc
ines, Inc. Madison), WI, which is described in U.S. Patent No. 5,120,657. An electrical emission device suitable for use herein is described in U.S. Patent No. 5,149,655. The disclosures of all these patents are incorporated herein by reference.

Alternatively, the particulate nucleic acid composition can be prepared using a conventional needle-free syringe device
It can be administered transdermally. For example, a particle composition comprising a nucleic acid molecule of the present invention can be obtained using common pharmaceutical methods, such as simple evaporation (crystallization), vacuum drying, spray drying or freeze drying. If desired, the particles can be further enriched using the techniques described in co-owned International Publication WO 97/48485, which is incorporated herein by reference. Subsequently, these particulate compositions are disclosed in International Publication Nos. WO 94/24263 and WO
Nos. 96/04947, WO 96/12513, and WO 96/20
No. 022, all of which are incorporated herein by reference, can be delivered from a needleless syringe system.

Delivery of particles from the needleless syringe systems referred to above generally ranges from 0.1 to 25
It is carried out with particles having an approximate size in the range of 0 μm, preferably in the range of about 10 to 70 μm. Particles larger than about 250 μm can also be delivered from the device, where the upper limit is that the size of the particles causes undesired damage to skin cells. The actual distance that the delivered particles penetrate the target surface is determined by the particle size (eg, apparent particle diameter, assuming a round spherical particle structure), particle density, initial velocity at which the particles strike the surface, as well as the target Depends on skin tissue density and kinematic viscosity. In this regard, optimal particle densities for use in needleless injection are generally between about 0.1 g / cm ³ and about 25 g / cm ³ , preferably about 0.9 g / cm ^3.
ranges between cm ³ and 1.5 g / cm ^3, and injection rate is generally about 10
It is in the range between 0 and 3,000 m / sec. With appropriate gas pressure, 10
Particles having an average diameter of ７０70 μm can be accelerated through the nozzle at a speed approaching the supersonic speed of the driving airflow.

In yet another embodiment of the present invention, there is provided a method for raising an immune response in a subject. The method comprises subjecting a subject's cells to one of the recombinant nucleic acid molecules of the present invention (as described herein above) for at least a first step (in the subject, the immune response to the target antigen). At a suitable level to cause the expression of the peptidomimetic). The method can include, in the step of boosting, administering to the subject a second time, wherein the vaccine composition delivered in the second administration can be the same nucleic acid molecule, or It can be a different molecule, including a peptidomimetic. For example, the secondary composition can be any suitable vaccine composition that includes a nucleic acid molecule that encodes a peptidomimetic, or a composition that includes a peptidomimetic that is already in the form of a peptide or protein. Direct delivery of the secondary composition in vivo, generally using a conventional syringe, with or without a viral vector (eg, a modified vaccinia vector) as described above, or This is also accomplished by injection, either using a particle mediated delivery system as described above. Injections are typically either subcutaneous, epidermal, intradermal, intramucosal (eg, nasal, rectal and / or sheath), intraperitoneal, intravenous, oral or intramuscular. Other modes of administration include oral and pulmonary administration, suppositories, and transdermal applications. Dosage treatment may be a single dose schedule or a multiple dose schedule.

C. Examples The following are examples of specific embodiments for practicing the present invention. These examples are given for illustrative purposes only, and are not intended to limit the scope of the invention in any way.

Efforts have been made to ensure accuracy with respect to numbers used (eg, amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

Example 1 (Construction of Hybrid HBcAg Antigen Molecule) A sequence encoding HBcAg particles was obtained in which the arginine-rich region at the C-terminus was removed (this deletion does not prevent particle formation). Then, the unique restriction site (
The BSP120I site) was inserted into the ICE to provide an insertion point for one or more peptidomimetic sequences. The resulting sequence is shown below as SEQ ID NO: 4. here,
The BSP120I site is indicated by the boxed sequence region.

[0084]

Embedded image The protein transcribed from the recombinant nucleic acid molecule of SEQ ID NO: 4 is shown below as SEQ ID NO: 5.
As shown. Here again, the insertion point (BSP120I site) for the peptidomimetic sequence is indicated by the boxed residues.

[0085]

Embedded image The sequence containing the coding sequence for the secretory signal peptide was then ligated to the carrier peptide sequence to provide a recombinant nucleic acid molecule. This unique secretory sequence is the coding sequence for the tissue plasminogen activator (tpa) signal peptide,
It is shown below as SEQ ID NO: 6.

[0086]

Embedded image The protein sequence of this tpa signal peptide is shown below as SEQ ID NO: 7.

[0087]

Embedded image Then, the obtained recombinant molecule was inserted into a plasmid backbone containing the early CMV promoter and the intron A region to obtain an expression cassette. The resulting construct was called p7198 and a map of this construct is shown in FIG.

Next, a synthetic oligonucleotide encoding a peptidomimetic of a meningococcal group C polysaccharide antigen was provided. The sequence of the peptidomimetic encoded by these oligonucleotides is as follows:

[0089]

Embedded image The nucleic acid sequence of this synthetic oligonucleotide is shown below as SEQ ID NO: 2 and SEQ ID NO: 3.

[0090]

Embedded image The oligonucleotide of SEQ ID NO: 2 or SEQ ID NO: 3 was cloned into the BSP120I restriction site of the hepatitis B core antigen peptide carrier sequence in p7198 as shown in FIG. Successful cloning of the peptidomimetic DNA into this carrier plasmid was performed by using commercially available HBe (rDNA) according to the manufacturer's instructions.
Confirmation by DNA sequencing and proper expression of hepatitis B core in transfected B16 cells as determined using the EIA kit (Abbott Laboratories).

(Primer annealing and cloning) More specifically, 2 μL of the oligo pair was combined with 18 μL of 50 mM NaCl, 10 mM Tris-Cl (pH 7.
9) Added to buffer and incubated at 65 ° C for 2 minutes. This pair
Transfer to a 100 ml beaker filled with 65 ° C. water and place it on a bench top (
and cooled to room temperature.

The peptide carrier plasmid was cut with a restriction enzyme (BSP 120I), followed by removal of the 5 ′ phosphate with shrimp alkaline phosphatase, and electrophoresed on low melting agarose. Isolating the gel slice containing the plasmid,
The gel slice was melted by heating at 65 ° C. for 10 minutes. 2 μL of molten agarose was removed and added to 28 μL of 1 × ligase buffer. To this mixture, 1 μL of the annealed oligo pair and 0.5 μl T4 DNA ligase were added. After overnight incubation at 16 ° C., the ligation reaction was transformed into competent cells, plated on LB plates containing ampicillin, and incubated overnight to grow resistant colonies. Plasmid DNA was isolated from resistant colonies and screened for the presence of the inserted oligo by standard methods. Plasmid DNA positive for the presence of oligos was sequenced to confirm the fidelity of the oligo insertion. Plasmids determined to have the expected sequence were cloned into B16 cells and HBe (rDNA) E
The IA kit (Abbott Laboratories) was utilized to further analyze in vitro "e" antigen (core antigen form) gene expression.

[0093] On the first day, host cells were plated at 20-40% confluency on tissue culture plates and grown overnight in an incubator. On the second day, a transfection reaction was performed. For each vector to be tested, 20 μL of Lipofectin® reagent (Lifectin)
eTechnologies) was added to 180 μL of Optimen® medium (Life Technologies) and incubated at room temperature for 45 minutes. For each vector to be tested, 2 μg of the vector was mixed with 200 μL of Optimem® medium immediately before use. In 45 minutes,
The vector and Lipofectin® solution were mixed together and left at room temperature for another 10 minutes. During this last incubation, the plated host cells are removed from the incubator and Optim
Washed twice with em® medium. 1.6 minutes of Optimem in 10 minutes
® was added to the Lipofectin® / Vector mix, and 1 ml of the resulting mix was added to each of the two cell wells from which the Optimem® wash was removed. The tissue culture plate was returned to the incubator and left gently for 5 hours, at which point Lipofecti
The n® / vector mixture was removed and replaced with standard cell maintenance media.

[0094] Eighteen to twenty-four hours after the medium change, the cell maintenance medium is recovered, the cells are washed with PBS, and 500 μL of PBS / 0.1% Triton X1
Dissolved by adding 00. The medium and cell lysate are centrifuged to remove small debris and 50-100 μL of these samples are added to Hbe (r
DNA) The samples were analyzed for antigen expression by placing in the wells of a reaction vessel provided with the EIA kit (Abbott Laboratories). The test sample volume was adjusted with PBS, and the procedure was continued according to the manufacturer's instructions. At the end of the incubation, the wells were washed to remove all liquid reaction components, and 300 wells were added to each well.
μL of color development buffer was added. At 30 minutes, the color reaction was stopped by adding 1 molar sulfuric acid, and the absorbance of the reaction was measured at 490 nm.
This absorbance data correlates with the amount of antigen produced and the ability of the antigen to be secreted outside the cell.

Example 2 Immunization with a Nucleic Acid Molecule Encoding a Peptidomimetic of Meningococcal Polysaccharide Antigen Seven week old female Balb / C mice were used for immunogenicity studies. To prepare mice for vaccination, mice were anesthetized by intraperitoneal injection of 100 mg / kg ketamine mixed with 10 mg / kg xylazine,
The abdominal skin was then shaved by clipping. In the first study, the PowderJect XR gene gun device (Powd
erJect Vaccines, Inc. , Madison, Wiscons
Mice (n = 6) were vaccinated on days 0, 21 and 50 with 1 μg of MP-MCP DNA using (in). Yang et al. (1997
) "Particle-Medied Gene Delivery in
Vivo and in vitro ", Current Protocol
s in Human Genetics, John Wiley & Son
s, Inc. 12.6.1-12.14. Six control mice were vaccinated with a control vector encoding hepatitis B core antigen without the peptidomimetic insert. All mice were boosted IP on day 80 with 5 μg meningococcal group C polysaccharide (MCP). Prior to each vaccination, blood samples were collected by orbital bleeding under anesthesia, 7 and 14 days after MCP boost.

The antibody response following DNA vaccination was determined by ELISA using MCP as the detection antigen according to published techniques. Granoff et al. (1998).
Clin. Diagn. Lab. Immunol. 5 (4) 479-485. D
Vaccination with the NA vaccine alone did not elicit detectable IgG antibodies. All mice had a high Ig after one week of boost to MCP boost.
Responds with a G titer and this titer was maintained unchanged for 2 weeks. This suggests a proper start of DNA vaccination. Control mice primed with a control vector encoding only the hepatitis B core antigen and then boosted with MCP had virtually no IgG titers at any time tested (see FIG. 2). ).

It is understood that bactericidal antibodies to N. meningitidis correlate with protection, thus determining the bactericidal serum of mouse sera using published techniques. Maslank
a (1997) Clin. Diagn. Lab. Immunol. 4 (2) 1
56-167. There was no detectable bactericidal titer in the pre-immune serum and the serum after DNA vaccination. However, after MCP boost, bactericidal titers were detected in both DNA immunized mice and control vector immunized mice, but animals primed with MP-MCP DNA and boosted with MCP were not treated with MCP. It was higher titer than the boosted control group (see Table 1 below).

[0098]

[Table 1] A second immunization study was performed to determine if two vaccinations using MP-MCP DNA were sufficient to prime an IgG response in mice. In this second study, mice were challenged with a PowerJect XR device using
On days 28 and 28, they were vaccinated with 1 μg of MP-MCP DNA and on day 40 boosted by IP injection with 5 μg of MCP polysaccharide. Blood samples were collected on days 0, 40 and 47. D
Mice primed with the NA vaccine and then boosted with MCP had significantly higher titers than control mice primed with the control vector and boosted with MCP (see FIG. 3). This indicated that two immunizations with 1 μg of DNA were sufficient to prime an IgG response in mice.

Thus, novel recombinant nucleic acid molecules, compositions containing these molecules, and methods of using them have been described. While the preferred embodiment of the invention has been described in some detail, it will be understood that obvious changes can be made without departing from the spirit and scope of the invention as defined by the appended claims. Is done.

[Brief description of the drawings]

FIG. 1 shows a DNA vector expressing a peptidomimetic of the target antigen. This vector expresses the hepatitis B core antigen carrier peptide under the control of the CMV promoter. DNA encoding the peptidomimetic is cloned into an internal portion of the core antigen sequence. A chimeric molecule comprising a core antigen and a mimetic peptide is expressed from this vector.

FIG. 2 shows the results from the first immunization study of Example 2. IgG titers are against MCP in mice immunized with the peptidomimetic MCP DNA vaccine and boosted with N. meningitidis group C polysaccharide (MCP).
Mice were vaccinated with 1 μg of DNA vaccine on days 0, 21 and 50. Control mice were vaccinated on the same schedule with a vector encoding only the hepatitis B core antigen peptide carrier. All mice were boosted on day 80 with 5 μg of MCP. IgG titers against MCP
The determination was made using pooled sera from six mice. Serum at 1:20, 1:
Tested at 40, 1:80 and 1: 160 dilutions. The data shows antibody titers against MCP detected at a serum dilution of 1:20.

FIG. 3 shows the results from the second immunization study of Example 2. IgG titers are against MCP in mice immunized with a peptidomimetic DNA vaccine (corresponding to the MCP target antigen). Mice were vaccinated with 1 μg of DNA vaccine on days 0 and 28, and then boosted on day 60 with 5 μg of MCP. Control mice received 5 μg of MCP on day 60. MC
IgG titers to P were determined using sera pooled from 4 mice. Serum was tested at 1:20, 1:40, 1:80 and 1: 160 dilutions. The IgG titer for this MCP gives 25% of the maximum ELISA reading,
At serum dilution.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 39/09 A61K 39/09 39/095 39/095 47/02 47/02 48/00 48/00 A61P 31/04 A61P 31/04 C12N 15/09 ZNA C12N 15/00 ZNAA (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT , LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM) , KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AG, AL, AM, A T, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CR, CU, CZ, DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH , GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, TZ, UA, UG, UZ, VN, YU , ZA, ZW F term (reference) 4B024 AA01 BA31 CA02 DA02 HA17 4C076 AA19 AA32 AA61 BB16 CC06 CC31 DD21 FF68 4C084 AA02 AA13 BA44 CA04 CA53 CA62 MA05 MA24 MA38 MA41 MA66 NA14 ZB351 ZB352 4C016 AA01CC04 BA0387 AA02 BC83 MA66 NA14 ZB35

Claims (54)

[Claims] 1. Use of a recombinant nucleic acid molecule in the manufacture of a polynucleotide medicament for eliciting an immune response in a subject against an agent comprising a target antigen, said nucleic acid molecule comprising a peptidomimetic of said target antigen. Use comprising a first nucleic acid sequence encoding a product. 2. The use according to claim 1, wherein said recombinant nucleic acid molecule is an expression vector. 3. The use according to claim 1, wherein the recombinant nucleic acid molecule is present in a plasmid vector. 4. The use according to any one of claims 1 to 3, wherein said target antigen is a bacterial antigen. 5. Use according to any one of the preceding claims, wherein the target antigen is a bacterial polysaccharide. 6. The method according to claim 6, wherein the polysaccharide is Neisseria meningitid.
is, Streptococcus pneumoniae and Haemop
6. Use according to claim 5, wherein the use is derived from or obtained from a bacterial species selected from the group consisting of H. influenzae. 7. The bacterial polysaccharide is a pneumococcal type 4 polysaccharide.
Use as described in. 8. Use according to claim 5, wherein the bacterial polysaccharide is a meningococcal group C polysaccharide. 9. The method of claim 1, wherein the first nucleic acid sequence has the sequence ACARIYYRYDGGFAY.
9. Use according to claim 8, encoding a peptidomimetic having (SEQ ID NO: 1). 10. The method according to claim 1, wherein the first nucleic acid sequence is the following sequence: GGCCTGCTTGTGCTAGAATCTATTACAGATATGAT
9. Use according to claim 8, comprising GGATTCGCTTACG (SEQ ID NO: 2). 11. The method of claim 1 wherein said first nucleic acid sequence is:
9. Use according to claim 8, comprising TCTAGCACAAGCA (SEQ ID NO: 3). 12. Use according to any one of the preceding claims, wherein the medicament is a liposome preparation. 13. The method according to claim 1, wherein the medicine is a particle medicine.
Use as described in section. 14. The particulate drug is suitable for transdermal injection into the subject.
14. Use according to claim 13. 15. The use according to claim 14, wherein the particulate medicament is about 0.
Use comprising carrier particles having a size of 5-5 μm, said carrier particles being coated with a recombinant nucleic acid molecule. 16. Use according to claim 15, wherein the carrier particles are selected from particles of tungsten, gold, platinum and iridium. 17. The use according to any one of claims 14 to 16, wherein
The use wherein the particulate medicament is injected into the subject via a needleless syringe. 18. Use of a recombinant nucleic acid molecule in the manufacture of a polynucleotide medicament for eliciting an immune response in a subject against an agent comprising a target antigen, said nucleic acid comprising: (a) A first nucleic acid sequence encoding a peptidomimetic, and (b) a second nucleic acid sequence encoding a peptide carrier molecule, wherein the first and second nucleic acid sequences are linked together to form a hybrid sequence. Do, use. 19. The use according to claim 18, wherein said recombinant nucleic acid molecule is an expression vector. 20. The recombinant nucleic acid molecule is present in a plasmid vector.
Use according to claim 18 or 19. 21. The use according to any one of claims 18 to 20, wherein said target antigen is a bacterial antigen. 22. Use according to any of claims 18 to 21, wherein said target antigen is a bacterial polysaccharide. 23. The method according to claim 23, wherein the polysaccharide is Neisseria meningiti.
dis, Streptococcus pneumoniae and Haemo
23. The use according to claim 22, wherein the use is derived from or obtained from a bacterial species selected from the group consisting of philus influenzae. 24. The use according to claim 22, wherein said bacterial polysaccharide is a pneumococcal type 4 polysaccharide. 25. The use according to claim 22, wherein the bacterial polysaccharide is a meningococcal group C polysaccharide. 26. The method according to claim 26, wherein the first nucleic acid sequence has the sequence ACARIYYRYDGFA.
The use according to claim 25, which encodes a peptidomimetic having Y (SEQ ID NO: 1). 27. The first nucleic acid sequence having the following sequence: GGCCTGCTTGTGCTAGAATCTATTACAGATATGAT
26. The use according to claim 25 comprising GGATTCGCTTACG (SEQ ID NO: 2). 28. The first nucleic acid sequence comprising: GGCCCGTAAGCGAATCCATCATATCTGTAAATAGAT
26. The use according to claim 25, comprising TCTAGCACAAGCA (SEQ ID NO: 3). 29. The use according to any one of claims 18 to 28, wherein the medicament is a liposome preparation. 30. The use according to any one of claims 18 to 28, wherein said medicament is a particulate medicament. 31. The particulate drug is suitable for transdermal injection into the subject.
31. Use according to claim 30. 32. The use according to claim 31, wherein the particulate medicament is about 0.
Use comprising carrier particles having a size of 5-5 μm, said carrier particles being coated with a recombinant nucleic acid molecule. 33. The use according to claim 32, wherein said carrier particles are selected from particles of tungsten, gold, platinum and iridium. 34. The use according to any one of claims 30 to 33, wherein the particulate medicament is infused into the subject via a needleless syringe. 35. The use according to any one of claims 18 to 34, wherein said peptide carrier molecule is derived from or obtained from hepatitis B virus. 36. The use according to claim 35, wherein said peptide carrier is a hepatitis B core antigen. 37. The use according to claim 36, wherein said first nucleic acid sequence is inserted into said second nucleic acid sequence. 38. The use according to any one of claims 1 to 37, wherein said subject is a human. 39. A particle suitable for transdermal injection with a needleless syringe, said particle comprising a carrier particle coated with a recombinant nucleic acid molecule, said recombinant nucleic acid molecule comprising:
A particle comprising a first nucleic acid sequence encoding a peptidomimetic of a target antigen. 40. The particle of claim 39, wherein said recombinant nucleic acid molecule is in an expression vector. 41. The recombinant nucleic acid molecule is present in a plasmid vector.
41. The particles according to claim 39 or 40. 42. The particle of any one of claims 39 to 41, wherein said target antigen is a bacterial antigen. 43. The particle of any one of claims 39 to 42, wherein said target antigen is a bacterial polysaccharide. 44. The method according to claim 46, wherein the polysaccharide is Neisseria meningiti.
dis, Streptococcus pneumoniae and Haemo
44. The particle of claim 43, wherein the particle is derived from or obtained from a bacterial species selected from the group consisting of philus influenzae. 45. The particle of claim 43, wherein said bacterial polysaccharide is a pneumococcal type 4 polysaccharide. 46. The particle of claim 43, wherein said bacterial polysaccharide is a meningococcal group C polysaccharide. 47. A unitary or multi-dose container adapted for use in a needleless syringe, said container comprising particles as defined in any one of claims 39-46. ,container. 48. A needleless syringe filled with the particles defined in any one of claims 39 to 46. 49. A composition comprising a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a peptidomimetic of a target antigen, wherein the recombinant nucleic acid molecule is a pharmaceutically acceptable carrier or carrier. A composition in combination with a vehicle. 50. A composition comprising a recombinant nucleic acid molecule, comprising: (a) a first nucleic acid sequence encoding a peptidomimetic of a target antigen; and (b) a peptide carrier molecule. A second nucleic acid sequence encoding, wherein the first and second nucleic acid sequences are linked together to form a hybrid sequence and are combined with a pharmaceutically acceptable carrier or excipient. . 51. A method of eliciting an immune response in a subject, the method comprising transfecting cells of the subject with a recombinant nucleic acid molecule of any of claims 1 or 18. The transfecting step is performed under conditions that allow expression of the molecule comprising the peptidomimetic in the subject; and the expression is sufficient to elicit an immune response against the target antigen; Method. 52. The method of claim 51, wherein said transfecting is performed in vivo using a particle mediated transfection technique. 53. The method of claim 51, wherein said transfecting step is performed ex vivo to obtain transfected cells, wherein said transfected cells are substantially isolated from said subject. The method introduced. 54. The subject of any one of claims 51 to 53, wherein said subject is a human.
The method described in the section.