EP1180150A2

EP1180150A2 - Nucleic acid immunization

Info

Publication number: EP1180150A2
Application number: EP00926234A
Authority: EP
Inventors: Dexiang Chen; James T. Fuller
Original assignee: Powderject Vaccines Inc
Current assignee: Powderject Vaccines Inc
Priority date: 1999-04-21
Filing date: 2000-04-21
Publication date: 2002-02-20
Also published as: WO2000063385A3; NZ515041A; CA2370646A1; WO2000063385A2; JP2002542264A; AU4479700A

Abstract

Recombinant nucleic acid molecules are described. The molecules have a first sequence encoding a peptide that mimics a target antigen. Reagents, including vectors and compositions containing these molecules are also described. Methods for constructing these reagents, and methods for using these reagents to elicit an immune response are also described.

Description

NUCLEIC ACID IMMUNIZATION

Technical Field

The invention relates to the general fields of molecular biology and immunology, and generally relates to reagents useful in nucleic acid immunization techniques. More specifically, the invention relates to novel nucleic acid vaccine sequences that mimic conventional vaccine components, particularly that mimic antigens, as well as nucleic acid molecules containing such mimic sequences, and to the use of reagents containing such nucleic acid molecules for nucleic acid immunization.

Background Vaccination is currently the most cost-effective and successful means of controlling infectious diseases known in to man. Conventional vaccine strategies typically entail inoculation of a subject with a vaccine composition derived from an infectious agent, for example, a composition containing intact pathogens (e.g., live attenuated or inactivated pathogens) or portions of a pathogen (e.g., purified subunits). However, for numerous infectious agents, conventional vaccine strategies have yet to be successfully developed, and there are also many cases where these conventional strategies have failed to work. One reason for this is that some pathogens may have a surface component that is structurally similar to a host antigen, and can thus cause inappropriate immune reactions if used in a vaccine composition. Another well-appreciated problem in conventional vaccine development is the inability of infants to respond to certain vaccines because of their immature immune system. In addition, dominant surface antigens can often be multivalent, and successful vaccine compositions need to account for numerous valencies in order to be broadly effective. These problems are particularly acute with respect to polysaccharide vaccine compositions, such as pneumococcal and meningococcal polysaccharide vaccines, and Haemophilus inβuenzae (type b) polysaccharide vaccines.

Streptococcus pneumoniae is a leading cause of morbidity and mortality in persons of all ages. It is the single most common cause of bacterial pneumonia, and is also an important cause of otitis media, meningitis and septicemia. Despite early successes with antimicrobial agents and chemotherapies (e.g., sulfonamides), pneumococcal pneumonia continues to remains as an important cause of morbidity and mortality, with an estimated half million cases per year. Immunization using vaccine compositions containing capsular serotype polysaccharides of Streptococcus pneumoniae has been observed to provide a very poor antibody response, particularly in children under the age of two. In addition, Streptococcus pneumonia now has 86 recognized capsule types, each causing human disease. A perfect polysaccharide vaccine composition against this pathogen would need to account for all 86 capsule types, and is thus impossible to manufacture.

Neisseria meningitidis is a causative agent of bacterial meningitis and sepsis in humans, and is the cause of meningococcal meningitis, a disease having the potential for occurring in epidemic form. Meningococci are divided into serological groups based on the im-muno logical characteristics of capsular and cell wall antigens. Currently recognized serogroups include A, B, C, D, W-135, X, Y, Z and 29E. The capsular polysaccharide antigens responsible for meningococcal serogroup specificity have been identified and purified from several of these groups, including the A, B, C, D, W-135 and Y serogroups.

The identification of these meningococcal antigens has led to the development of several commercial polysaccharide-based vaccines, particularly those developed against meningococcal serogroups A, B, C, Y and W135. Isolated high-molecular weight polysaccharides have been used in group A and group C vaccines which are capable of inducing group-specific, complement dependent bactericidal antibodies in adults. However, these vaccines are ineffective in young children, particularly those under the age of two. Experimental group B vaccines (consisting of outer membrane protein vesicles) have been found to be approximately 50% protective in adolescents. However, no protection has been observed in vaccinated infants and children, the age groups that are at greatest risk of disease. Additionally, these vaccines are serotype- and subtype-specific, and the dominant group B strains are subject to both geographic and temporal variation, seriously limiting the usefulness of such vaccines.

Haemophilus inβuenzae is responsible for a number of severe infections in humans. In infants and young children, it causes acute bacterial meningitis and several other severe pediatric diseases such as pyarthrosis, cellulitis, pneumonia and acute epiglottitis. In adults, it is most often associated with chronic pulmonary disease. Although a number of different serotypes of Haemophilus influenzae have been identified, type b is the most common cause of human morbidity. Polysaccharide vaccines against H influenzae type b have been somewhat effective in adults, however, these vaccines provide a very poor antibody response in immunized children under the age of two since they are T-independent antigens.

As with other polysaccharide antigens, H. influenzae polysaccharides can be converted to T-dependent antigens by conjugation to a protein carrier. Such polysaccharide-protein conjugates are immunogenic in infants, and are capable of eliciting a boostable IgG response. The polysaccharide conjugate vaccine for H. influenzae type b has been very effective in controlling the disease over the past 10 years in the United States. However, developing and manufacturing any conjugate vaccine is a very expensive and complicated process, leading to an prohibitively high cost in these vaccine compositions.

Summary of the Invention

It is a primary object of the invention to provide an alternative to conventional vaccine strategies using a genetic vaccine to supply novel peptides that mimic the antigenic structure of a protein antigen, a polysaccharide antigen, or a lipid antigen. More particularly, novel nucleic acid sequences are provided that encode a peptide mimicking one or more immunogenic epitopes from a pathogen. The encoded peptide molecules have a different chemical composition than the original (e.g., native) immunogen. These nucleic acid sequences can be identified using a variety of different approaches, most typically using random peptide display libraries that are panned using antigen-specific antibody molecules. Once identified and synthesized, these nucleic acid molecules can be readily inserted into a suitable molecule, for example a plasmid vector, and used in a nucleic acid immunization regime to provide an immune response against a selected antigen.

In biological systems, peptides can mimic polysaccharide molecules by binding to polysaccharide-specific antibodies as well as to other polysaccharide- binding proteins. This mimicry has been exploited in the art, and molecules such as concanavalin A (which binds to oligosaccharides bearing terminal alpha-linked mannose or glucose residues), has been used to select peptide mimics from bacterial phage libraries that bear short peptide sequences at the amino-terminus of the pill coat protein. Oldenberg et al. (1992) Proc. Natl. Acad. Sci. USA 89:5393; Scott et al. (1992) Proc. Natl. Acad. Sci. USA 89:5398. Similarly, monoclonal antibodies have been used to identify peptide mimics of carbohydrates present on the surface of adenocarcinoma cells, again using a phage library. Hoess et al. (1993) Gene 128:43. Peptides have also be used to elicit polysaccharide-specific antibodies. For example, Westerink et al. (1988) Infect. Immun. 56: 1120, used a monoclonal antibody to the N. meningitidis serogroup C capsular polysaccharide to elicit an anti- idiotype antibody. Mice passively immunized with this antibody were protected against infection with a lethal dose of meningococcal bacteria. It was subsequently found that a peptide fragment derived from an anti-idiotype antibody molecule elicited serum antibodies that protected animals from bacteremia and death after lethal challenge with meningococcal group C bacteria.. Westerink et al. (1995) Proc. Natl. Acad. Sci. USA 92:4021.

These and other efforts have led to the identification of several peptide mimics, that is, peptides that mimic various bacterial polysaccharides and even protein antigens. However, these peptides are poorly immunogenic per se, and if used as vaccine compositions, are chemically conjugated to a carrier protein. The present invention is based on the discovery of nucleic acid sequences that encode particular peptide mimics, for example, peptides that mimic polysaccharide antigens, and the use of such nucleic acid sequences in a genetic vaccine composition. Thus, in one aspect of the" invention, a recombinant nucleic acid molecule is provided which includes a nucleic acid sequence encoding a peptide mimic of interest, wherein the nucleic acid sequence is operably linked to one or more suitable control sequences. In one particular embodiment, the nucleic acid molecule is present in a vector construct, for example in a plasmid vector or in a recombinant viral vector. In another particular embodiment, the peptide mimic corresponds to a polysaccharide antigen derived or obtained from a bacteria species selected from the group consisting of Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae.

In another aspect of the invention, a recombinant nucleic acid molecule is provided which includes a first nucleic acid sequence encoding a peptide mimic of interest and a second nucleotide sequence that encodes a peptide carrier molecule, wherein the first and second sequences are linked together to form a hybrid sequence. In one particular embodiment, the peptide carrier molecule is a hepatitis B virus core antigen.

In related aspects of the invention, the recombinant nucleic acid molecules of the present invention are used in the manufacture of a polynucleotide medicament for eliciting an immune response in a subject against an agent that comprises an antigen corresponding to the peptide mimic. The polynucleotide medicaments can be in the form of a composition that contains the recombinant nucleic acid molecules of the present invention combined with a pharmaceutically acceptable carrier or excipient. In certain aspects, the polynucleotide medicament is a liposomal preparation. In other aspects, the polynucleotide medicament is a particulate medicament. It is preferred that the particulate medicaments be suitable for transdermal injection into the subject to be treated.

It is also a primary object of the invention to provide particles suitable for transdermal injection by means of a needleless syringe, where the particles comprise carriers coated with a recombinant nucleic acid molecule according to the present invention.

It is a further primary object of the invention to provide a method for eliciting an immune response against a target antigen in an immunized subject using a nucleic acid molecule which encodes a peptide mimic of the target antigen. The method entails a primary immunization step comprising one or more steps of transfecting cells of the subject with a recombinant nucleic acid molecule encoding the peptide mimic. Expression cassettes and/or vectors including any one of the recombinant nucleic acid molecules of the present invention can be used to transfect the cells, and transfection is carried out under conditions that permit expression of the peptide mimic within the subject. The method can further entail a secondary, or booster immunization step comprising one or more steps of administering a secondary composition to the subject, wherein the secondary composition comprises the same peptide mimic and/or the target antigen. These immunization methods are sufficient to elicit an immune response against the target antigen. The transfection procedure carried out during the primary immunization step can be conducted either in vivo, or ex vivo (e.g., to obtain transfected cells which are subsequently introduced into the subject prior to carrying out the secondary immunization step). When in vivo transfection is used, the nucleic acid molecule can be administered to the subject by way of intramuscular or intradermal injection of plasmid DNA or, preferably, administered to the subject using a particle-mediated delivery technique.

It is an advantage of the invention that these recombinant nucleic acid molecules can be used as reagents in nucleic acid immunization strategies to attain a qualitatively and quantitatively superior immune response to particular antigens, particularly polysaccharide antigens. It is also an advantage that nucleic acid vaccine compositions that encode a peptide mimic of a target antigen can be used to vaccinate subjects of all ages, particularly young children who are typically non- response to conventional vaccine compositions such as polysaccharide-based compositions. Since the peptide mimics are chemically different from their corresponding target antigens, they may avoid inappropriate immune reactions in immunized subjects, such as those situations where a natural or native form of the antigen could cause auto-reactive antibody production. It is yet a further advantage of the invention that DNA-based peptide mimic vaccines are simply and accurately producible, and that multiple peptide mimic coding sequences can be provided in a single molecule. These peptide mimic nucleic acid vaccine compositions also are able to convert T-independent polysaccharide into a T-dependent peptide antigen, thus eliciting a long-lasting IgG response with memory immunity.

These and other objects, aspects, embodiments and advantages of the present invention will readily occur to those of ordinary skill in the art in view of the disclosure herein.

Brief Description of the Figures

Figure 1 depicts a DNA vector expressing a peptide mimic of a target antigen. The vector expresses a hepatitis B core antigen carrier peptide under the control of a CMN promoter. DΝA encoding the peptide mimic is cloned into an internal portion of the core antigen sequence. Chimeric molecules comprising the core antigen and the mimic peptide are expressed from the vector.

Figure 2 depicts the results from the first immunization study of Example 2. IgG titers are to a meningococcal group C polysaccharide (MCP) in mice immunized with a peptide mimic MCP DΝA vaccine and boosted with MCP. Mice were vaccinated with 1 μg of DΝA vaccine on days 0, 21, and 50. Control mice were vaccinated by the same schedule with a vector encoding only hepatitis B core antigen peptide carrier. All mice were boosted with 5 μg of MCP on day 80. IgG titers to MCP were determined using pooled sera from six mice. Sera were tested at 1 :20, 40, 80, and 160 dilution. Data represents antibody titer to MCP detected at 1:20 serum dilution.

Figure 3 depicts the results from the second immunization study of Example 2. IgG titers are to MCP in mice immunized with a peptide mimic DΝA vaccine 9corresponidng to a MCP target antigen). Mice were vaccinated with 1 μg of DΝA vaccine on days 0 and 28, then boosted with 5 μg of MCP on day 60. Control mice received 5 μg of MCP on day 60. IgG titers to MCP were determined using pooled sera from four mice. Sera were tested at 1 :20, 40, 80, and 160 dilution. The IgG titer to MCP is the serum dilution that gives 25% of the maximum ELISA reading.

Detailed Description of the Preferred Embodiments Before describing the present invention in detail, it is to be understood that this invention is not limited to particularly exemplified molecules or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting. In addition, the practice of the present invention will employ, unless otherwise indicated, conventional methods of virology, microbiology, molecular biology, recombinant DNA techniques and immunology all of which are within the ordinary skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); DNA Cloning: A Practical Approach, vol. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., 1984); A Practical Guide to Molecular Cloning (1984); and Fundamental Virology, 2nd

Edition, vol. I & II (B.N. Fields and D.M. Knipe, eds.).

All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

It must be noted that, as used in this specification and the appended claims, the singular forms "a," "an" and "the" include plural referents unless the content clearly dictates otherwise.

A. Definitions

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although a number of methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein.

In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.

The term "nucleic acid immunization" is used herein to refer to the introduction of a nucleic acid molecule encoding one or more selected antigens into a host cell for the in vivo expression of the antigen or antigens. In the present invention, the nucleic acid molecule encodes one or more peptide mimics that correspond to an antigen of interest. The nucleic acid molecule can be introduced directly into the recipient subject, such as by standard intramuscular or intradermal injection; transdermal particle delivery; inhalation; topically, or by oral, intranasal or mucosal modes of administration. The molecule alternatively can be introduced ex vivo into cells which have been removed from a subject. In this latter case, the cells are reintroduced into the subject where an immune response can be mounted against the antigen corresponding to the peptide mimic encoded by the nucleic acid molecule.

By "needleless syringe" is meant an instrument which delivers a particulate composition transdermally without the aid of a conventional needle to pierce the skin. Needleless syringes for use with the present invention are discussed throughout this document.

The term "transdermal" delivery intends intradermal (e.g., into the dermis or epidermis), transdermal (e.g., "percutaneous") and transmucosal administration, i.e., delivery by passage of an agent into or through skin or mucosal tissue. See, e.g., Transdermal Drug Delivery: Developmental Issues and Research Initiatives, Hadgraft and Guy (eds.), Marcel Dekker, Inc., (1989); Controlled Drug Delivery:

Fundamentals and Applications, Robinson and Lee (eds.), Marcel Dekker Inc., (1987); and Transdermal Delivery of Drugs, Vols. 1-3, Kydonieus and Berner (eds.), CRC Press, (1987). Thus, the term encompasses delivery from a needleless syringe deliver as described in U.S. Patent No. 5,630,796, as well as particle-mediated delivery as described in U.S. Patent No. 5,865,796.

The terms "carrier molecule" and "peptide carrier molecule" are used herein in their normal sense to denote a peptide sequence, typically a macromolecule, to which a smaller molecule (e.g., a hapten such as a peptide mimic) can be attached in order to enhance the immunogenicity of that smaller molecule. By "core carrier" is meant a carrier on which a guest nucleic acid (e.g.,

DNA) is coated in order to impart a defined particle size as well as a sufficiently high density to achieve the momentum required for cell membrane penetration, such that the guest molecule can be delivered using particle-mediated techniques (see, e.g., U.S. Patent No. 5,100,792). Core carriers typically include materials such as tungsten, gold, platinum, ferrite, polystyrene and latex. See e.g., Particle

Bombardment Technology for Gene Transfer, (1994) Yang, N. ed., Oxford University Press, New York, NY pages 10-11.

An "antigen" refers to any agent, generally a macromolecule, which can elicit an immunological response in an individual. The term may be used to refer to an individual macromolecule or to a homogeneous or heterogeneous population of antigenic macromolecules. As used herein, "antigen" is generally used to refer to a target molecule or portion thereof which contains one or more epitopes, wherein a peptide mimic can be obtained which corresponds to the antigen. For purposes of the present invention, antigens can be from any known target virus, bacteria, parasite or fungal pathogen. The term also intends any of the various tumor-specific antigens. Furthermore, for purposes of the present invention, an "antigen" includes a protein having modifications, such as deletions, additions and substitutions (generally conservative in nature) to the native sequence, so long as the protein (and thus its peptide mimic) maintains sufficient immunogenicity. These modifications may be deliberate, for example through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the antigens.

A peptide "that mimics a target antigen," sometimes referred to as a "peptide mimic," is a peptide sequence that has a different chemical composition than the target antigen, yet is capable of at least cross-reacting with an antibody molecule specific for the target antigen and, when such a peptide sequence is expressed in a subject, it is capable of eliciting an immune response against the target antigen.

Such peptides can mimic protein (peptide) antigens, polysaccharide antigens, or lipid antigens. Under the invention, when a peptide mimics a target protein or peptide antigen, it will have a different chemical structure, i.e., a different amino acid sequence than the target protein or peptide antigen. In various aspects of the invention, the peptide mimics correspond to an antigen containing one or more T cell epitopes. A "T cell epitope" refers generally to those features of a peptide structure which are capable of inducing a T cell response. In this regard, it is accepted in the art that T cell epitopes comprise linear peptide determinants that assume extended conformations within the peptide- binding cleft of MHC molecules, (Unanue et al. (1987) Science 236:551-557). As used herein, a T cell epitope is generally a peptide having at least about 3-5 amino acid residues, and preferably at least 5-10 or more amino acid residues. The ability of a particular antigen, and of its peptide mimic to stimulate a cell-mediated immunological response may be determined by a number of well-known assays, such as by lymphoproliferation (lymphocyte activation) assays, CTL cytotoxic cell assays, or by assaying for T-lymphocytes specific for the antigen in a sensitized subject. See, e.g., Erickson et al. (1993) J. Immunol. 151:4189-4199; and Doe et al. (1994) Eur. J. Immunol. 24:2369-2376.

In other aspects of the invention, the peptide mimics correspond to an antigen containing one or more B cell epitopes. A "B cell epitope" generally refers to the site on an antigen to which a specific antibody molecule binds. The identification of epitopes which are able to elicit an antibody response is readily accomplished using techniques well known in the art. See, e.g., Geysen et al. (1984) Proc. Natl. Acad. Sci. USA 81.3998-4002 (general method of rapidly synthesizing peptides to determine the location of immunogenic epitopes in a given antigen); U.S. Patent No. 4,708,871 (procedures for identifying and chemically synthesizing epitopes of antigens); and Geysen et al. (1986) Molecular Immunology 23:709-715 (technique for identifying peptides with high affinity for a given antibody).

An "immune response" against an antigen of interest is the development in an individual of a humoral and/or a cellular immune response to a peptide mimic that corresponds to that antigen. For purposes of the present invention, a "humoral immune response" refers to an immune response mediated by antibody molecules, while a "cellular immune response" is one mediated by T-lymphocytes and/or other white blood cells.

A polynucleotide is typically composed of a specific sequence of four nucleotide bases: adenine (A); cytosine (C); guanine (G); and thymine (T) (uracil

(U) for thymine (T) when the polynucleotide is RNA). Thus, the term nucleic acid sequence is the alphabetical representation of a polynucleotide molecule. This alphabetical representation can be input into databases in a computer having a central processing unit and used for bioinformatics applications such as functional genomics and homology searching.

A "vector" is capable of transferring nucleic acid sequences to target cells (e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes). Typically, "vector construct," "expression vector," and "gene transfer vector," mean any nucleic acid construct capable of directing the expression of a gene of interest and which can transfer gene sequences to target cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. A "plasmid" is vector in the form of an extrachromosomal genetic element.

A nucleic acid sequence which "encodes" a peptide mimic of a selected antigen is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of m-RNA) into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. For the purposes of the invention, such nucleic acid sequences can include, but are not limited to, cDNA from viral, procaryotic or eucaryotic m-RNA, genomic sequences from viral or procaryotic DNA or RNA, and even synthetic DNA sequences. A transcription termination sequence may be located 3' to the coding sequence.

A "promoter" is a nucleotide sequence which initiates and regulates transcription of a polypeptide-encoding polynucleotide. Promoters can include inducible promoters (where expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), repressible promoters (where expression of a polynucleotide sequence operably linked to the promoter is repressed by an analyte, cofactor, regulatory protein, etc.), and constitutive promoters. It is intended that the term "promoter" or "control element" includes full-length promoter regions and functional (e.g., controls transcription or translation) segments of these regions.

"Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given promoter operably linked to a nucleic acid sequence is capable of effecting the expression of that sequence when the proper enzymes are present. The promoter need not be contiguous with the sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the nucleic acid sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.

"Recombinant" is used herein to describe a nucleic acid molecule (polynucleotide) of genomic, cDNA, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature and/or is linked to a polynucleotide other than that to which it is linked in nature. Two nucleic acid sequences which are contained within a single recombinant nucleic acid molecule are "heterologous" relative to each other when they are not normally associated with each other in nature.

Techniques for determining nucleic acid and amino acid "sequence identity" or "sequence homology" also are known in the art. Typically, such techniques include determining the nucleotide sequence of the m-RNA for a gene and/or determining the amino acid sequence encoded thereby, and comparing these sequences to a second nucleotide or amino acid sequence. In general, "identity" refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Two or more sequences (polynucleotide or amino acid) can be compared by determining their "percent identity." The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequences and multiplied by 100. An approximate alignment for nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981). This algorithm can be applied to amino acid sequences by using the scoring matrix developed by Davhoff. Atlas of Protein Sequences and Structure. M.O. Dayhoff ed., 5 suppl. 3:353-358, National Biomedical Research Foundation, Washington, D.C., USA, and normalized by Gribskov, Nucl. Acids Res. 14(6):6745-6763 (1986). An exemplary implementation of this algorithm to determine percent identity of a sequence is provided by the Genetics Computer

Group (Madison, WI) in the "BestFit" utility application. The default parameters for this method are described in the Wisconsin Sequence Analysis Package Program Manual, Version 8 (1995) (available from Genetics Computer Group, Madison, WI). A preferred method of establishing percent identity in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by

IntelliGenetics, Inc. (Mountain View, CA). From this suite of packages the Smith- Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the "Match" value reflects "sequence identity." Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used using the following default parameters: genetic code = standard; filter = none; strand = both; cutoff = 60; expect = 10; Matrix = BLOSUM62; Descriptions = 50 sequences; sort by = HIGH SCORE; Databases = non-redundant, GenBank + EMBL + DDBJ + PDB + GenBank CDS translations + Swiss protein + Spupdate + PIR. Details of these programs can be found at the following internet address: http://www.ncbi.nlm.gov/cgi-bin/BLAST. Alternatively, homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. Two DNA, or two polypeptide sequences are "substantially homologous" to each other when the sequences exhibit at least about 80%-85%, preferably at least about 90%, and most preferably at least about 95%-98% sequence identity over a defined length of the molecules, as determined using the methods above. As used herein, substantially homologous also refers to sequences showing complete identity to the specified DNA or polypeptide sequence. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. For example, stringent hybridization conditions can include

50% formamide, 5x Denhardt's Solution, 5x SSC, 0.1% SDS and 100 μg/ml denatured salmon sperm DNA and the washing conditions can include 2x SSC, 0.1% SDS at 37°C followed by lx SSC, 0.1% SDS at 68°C. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra. The term "adjuvant" intends any material or composition capable of specifically or non-specifically altering, enhancing, directing, redirecting, potentiating or initiating an antigen-specific immune response. Thus, coadministration of an adjuvant with an antigen may result in a lower dose or fewer doses of antigen being necessary to achieve a desired immune response in the subject to which the antigen is administered, or coadministration may result in a qualitatively and/or quantitatively different immune response in the subject. The effectiveness of an adjuvant can be determined by administering the adjuvant with a vaccine composition in parallel with vaccine composition alone to animals and comparing antibody and/or cellular-mediated immunity in the two groups using standard assays such as radioimmunoassay, ELIS As, CTL assays, and the like, all well known in the art. Typically, in a vaccine composition, the adjuvant is a separate moiety from the antigen, although a single molecule can have both adjuvant and antigen properties (e.g., cholera toxin).

The terms "individual" and "subject" are used interchangeably herein to refer to any member of the subphylum cordata, including, without limitation, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; laboratory animals including rodents such as mice, rats and guinea pigs; birds, including domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, and the like. The terms do not denote a particular age. Thus, both adult and newborn individuals are intended to be covered. The methods described herein are intended for use in any of the above vertebrate species, since the immune systems of all of these vertebrates operate similarly. B. General Methods

In one embodiment, a recombinant nucleic acid molecule is provided. The recombinant molecule includes a sequence that encodes a peptide that mimics a target antigen. The target antigen can be any suitable antigen, and will preferably be associated with a pathogen, such as a viral, bacterial or parasitic pathogen, or the antigen may be a tumor-specific antigen. In particular embodiments, the sequence encodes a peptide that mimics a polysaccharide antigen, for example a polysaccharide derived or obtained from a Neisseria meningitidis, Streptococcus pneumoniae, or a Haemophilus influenzae bacterial species. The particular peptide mimics are identified using techniques known to those skilled in the art. For example, soluble peptides, peptides tethered on a solid phase, peptides displayed on bacterial phage surface proteins, bacterial surface proteins or antibodies can all be used to screen for suitable peptide mimics. One preferred method for identifying linear peptide epitopes entails the construction and screening of random peptide or protein bacteriophage libraries. Such phage display techniques can be used to display millions of variations of a given protein or peptide on the surface of bacteriophage, enabling high throughput screening to discover highly reactive molecules for a given target antigen. These libraries can be constructed using conventional procedures known in the art. For example, suitable procedures are described in U.S. Patent Nos. 5,223, 409 and 5,403,484, as well as in Devlin et al. (1990) Science 249:404-406: Kay et al. (1993) Gene 128:59-65; Smith et al. (1993) Gene 128:37-42; Hoess et al. (1993) Gene 128:43-49; and Sastry et al. (1989) Proc. Natl. Acad. Sci. USA 86:5728-5732, all of which patents and publications are incorporated herein by reference. Any of these, or comparable procedures can thus be used to generate phage display libraries for screening for peptide mimics for target antigens. Suitable target viral antigens include, but are not limited to, polynucleotide sequences encoding antigens from the hepatitis family of viruses, including hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), the delta hepatitis virus (HDV), hepatitis E virus (HEV) and hepatitis G virus (HGV); antigens derived from herpes simplex virus (HSV) types 1 and 2, such as HSV-1 and HSV-2 glycoproteins gB, gD and gH; antigens from varicella zoster virus (VZV), Epstein-Barr virus (EBV) and cytomegalovirus (CMV) including CMV gB and gH; and antigens from other human herpesviruses such as HHV6 and HHV7. (See, e.g. Chee et al. (1990) Cytomegaloviruses (J.K. McDougall, ed., Springer-Verlag, pp. 125-169; McGeoch et al. (1988) J. Gen. Virol. 69:1531-1574; U.S. Patent No. 5,171,568; Baer et al.

(1984) Nature 310:207-211; and Davison et al. (1986) J. Gen. Virol. 67:1759-1816.)

HIV antigens, such as the gpl20 sequences for a multitude of HIV-1 and HIV-2 isolates, including members of the various genetic subtypes of HIV, are known and reported (see, e.g., Myers et al., Los Alamos Database, Los Alamos National Laboratory, Los Alamos, New Mexico (1992); and Modrow et al. (1987) J.

Virol. 61:570-578) and antigens derived from any of these isolates will find use in the present methods. Furthermore, the invention is equally applicable to other immunogenic moieties derived from any of the various HIV isolates, including any of the various envelope proteins such as gpl60 and gp41, gag antigens such as p24gag and p55gag, as well as proteins derived from the pol, env, tat, vif, rev, nef, vpr, vpu and LTR regions of HIV. Antigens derived or obtained from other viruses can also be used to construct display libraries, such as without limitation, those from members of the families Picornaviridae (e.g., polioviruses, etc.); Caliciviridae; Togaviridae (e.g., rubella virus, dengue virus, etc.); Flaviviridae; Coronaviridae; Reoviridae; Birnaviridae; Rhabodoviridae (e.g., rabies virus, etc.); Filoviridae;

Paramyxoviridae (e.g., mumps virus, measles virus, respiratory syncytial virus, etc.); Bunyaviridae; Arenaviridae; Retroviradae (e.g., HTLV-I; HTLV-II; HIV-1 (also known as HTLV-III, LAV, ARV, hTLR, etc.)), including but not limited to antigens from the isolates HIV_IIIb, HIV_SF2, HIV_LAV, HIV_LAI, HIV^); HIV-1_CM235, HIN-1_US4; HIV-2, among others. See, e.g. Virology, 3rd Edition (W.K. Joklik ed. 1988);

Fundamental Virology, 2nd Edition (B.Ν. Fields and D.M. Knipe, eds. 1991), for a description of these and other viruses.

Sequences encoding suitable bacterial and parasitic antigens are obtained or derived from known causative agents responsible for diseases such as Diptheria, Pertussis, Tetanus, Tuberculosis, Bacterial or Fungal Pneumonia, Cholera, Typhoid,

Plague, Shigellosis or Salmonellosis, Legionaire's Disease, Lyme Disease, Leprosy, Malaria, Hookworm, Onchocerciasis, Schistosomiasis, Trypamasomialsis, Lesmaniasis, Giardia, Amoebiasis, Filariasis, Borelia, and Trichinosis. Still further antigens can be obtained or derived from unconventional agents such as the causative agents of kuru, Creutzfeldt- Jakob disease (CJD), scrapie, transmissible mink encephalopathy, and chronic wasting diseases, or from proteinaceous infectious particles such as prions that are associated with mad cow disease.

Once the library is constructed, it is screened with a monoclonal antibody against the target antigen. Bacteriophage plaques that bind to the screening antibody are selected, cloned (using standard cloning techniques) and expanded, and then tested for the ability to inhibit binding of the antibody to the target antigen in a standard competitive binding assay format. Bacteriophage which display peptides that inhibit binding of the antibody are sequenced to determine the nucleic acid sequence and amino acid sequence of the cloned peptide mimic. The nucleic acid sequence is then synthesized and used as a reagent in order to determine whether or not the encoded peptide will generate antibodies against the target antigen, and can further elicit a sufficient immune response against the target antigen in a host immunized with the nucleic acid sequence.

Similar phage library procedures can also be used to identify peptides that mimic conformational epitopes of a target antigen. For example, mice can be immunized with a monoclonal antibody specific for the target antigen. Splenocytes from the mice are harvested after sufficient time has elapsed for an immune response. m-RNA for the variable regions of the heavy and light chain murine IgG (obtained from the harvested splenocytes) is extracted, and a cDNA library is constructed. This cDNA can then be cloned into commercially available combinatorial bacteriophage libraries, for example using the methodology of Huse et al. (1989) Science 246:1275-1281. which publication is incorporated herein by reference.

These combinatorial libraries are then screened using monoclonal antibodies as described above, and positive plaques are selected and cloned according to standard techniques. The cloned τjacteriophages are expanded and screened for their ability to inhibit monoclonal antibody binding to the target antigen. Those bacteriophages that do inhibit antibody binding are further screened for their ability to elicit anti-target antigen antibody production in immunized animals, and selected candidates are sequenced to determine the sequence of the heavy and light chain variable regions (e.g., the antigen binding sites), and predictions are made to generate peptide mimics which correspond with the conformational epitope of the target antigens.

Nucleic acid sequences which encode the peptide mimics are then paired with one or more suitable control sequences to provide the recombinant nucleic acid molecule of the present invention. See, e.g., Sambrook et al., supra, for a description of cloning techniques, and techniques used to obtain and isolate DNA.

Polynucleotide sequences can also be produced synthetically, rather than cloned.

Once the sequence for the peptide mimic and the relevant control sequences have been obtained, they can be operably linked together to provide a recombinant nucleic acid molecule using standard cloning or molecular biology techniques. See, e.g., Edge (1981) Nature 292:756; Nambair et al. (1984) Science 223:1299; and Jay et al. 91984) J. Biol. Chem. 259:6311. The nucleic acid molecule can then be inserted into a suitable vector such as an expression plasmid or viral vector construct.

More typically, once the sequence that encodes the peptide mimic has been identified and suitably synthesized, it can be inserted into a vector which already includes control sequences that will be operably linked to the inserted sequence, thus allowing for expression of the peptide mimic in vivo in a targeted subject. For example, typical promoters for mammalian cell expression include the SV40 early promoter, a CMV promoter such as the CMV immediate early promoter, the mouse mammary tumor virus LTR promoter, the adeno virus major late promoter (Ad

MLP), and other suitably efficient promoter systems. Nonviral promoters, such as a promoter derived from the murine metallothionein gene, may also be used for mammalian expression. Preferably, a sequence for optimization of initiation of translation, located 5' to the coding sequence, is also present. Examples of transcription terminator/polyadenylation signals include those derived from SV40, as described in Sambrook et al., supra, as well as a bovine growth hormone terminator sequence. Introns, containing splice donor and acceptor sites, may also be designed into the expression cassette.

In addition, enhancer elements may be included within the expression cassettes in order to increase expression levels. Examples of suitable enhancers include the SV40 early gene enhancer (Dijkema et al. (1985) E RO J. 4:761), the enhancer/promoter derived from the long terminal repeat (LTR) of the Rous Sarcoma Virus (Gorman et al. (1982) Proc. Natl. Acad. Sci. USA 79:6777), and elements derived from human or murine CMV (Boshart et al. (1985) Cell 41:521), for example, elements included in the CMV intron A sequence. In another embodiment, a sequence encoding a peptide mimic (identified and prepared as described above) is combined with a second sequence encoding a peptide carrier molecule to obtain a hybrid sequence. A number of suitable peptide carrier sequences are known to those skilled in the art, and are all equally suitable for use with the present invention. However, in a preferred embodiment, the peptide carrier molecule is provided by a sequence that encodes a hepatitis B virus nucleocapsid antigen (HbcAg). The sequence encoding the peptide mimic can be inserted into the immunodominant core epitope (ICE) loop region of the HBcAg carrier molecule. Alternatively, the ICE region can be deleted from the molecule, and the sequence encoding the peptide mimic can inserted in place of the ICE region, or inserted into any other N-terminal, C-terminal or internal position of the

HBcAg portion of the molecule. It is preferred that insertion of the sequence encoding the peptide mimic into the HBcAg portion of the hybrid molecule does not interfere with the ability of the expression product to self-assemble into a hybrid core carrier particle. When transfected into an appropriate host cell, the recombinant nucleic acid molecule encodes a hybrid HBcAg carrier moiety, wherein the HBcAg portion serves as a carrier, and the peptide mimic portion serves as the immunogen.

The HBcAg portion of the recombinant nucleic acid molecule can be obtained from known sources. In this regard, the hepatitis B virus (HBV) is a small, enveloped virus with a double-stranded DNA genome. The sequence of the HBV genome (e.g., particularly of subtypes adw and ayw) is known and well characterized. Tiollais et al. (1985) Nature 317:489, Chisari et al. (1989) Microb. Pathog. 6:311. The HBcAg is a polypeptide comprised of 180 amino acid residues and has several immunodominant portions which have been highly studied (e.g., the ICE loop region). HBcAg can be readily expressed in Escherichia coli and other prokaryotes where it self-assembles into particles. For this reason, numerous peptide antigens have been fused to the HBcAg to provide hybrid core carrier particles that exhibit enhanced B cell immunogenicity. Schδdel et al. (1994) J. Exper. Med. 180:1037; Clarke et al. (1987) Nature 330:381; Borisova et al. (1989) FEBSLett. 259:121; Stahl et al. (1989) Proc. natl. Acad. Sci. USA 86:6283. The nucleic acid sequence encoding the HBcAg is also known, and plasmid constructs containing the HBcAg sequence have been described. Schδdel et al., supra. In the expression product, the immunodominant loop region spans residues 72-85 of the 180 residue HBcAg molecule, with the ICE occurring at about residues 74-81.

In some molecules, a third, ancillary sequence can be included which provides for secretion of an attached hybrid HbcAg-peptide mimic molecule from a mammalian cell. Such secretion leader sequences are known to those skilled in the art, and include, for example, the tissue plasminogen activator (tpa) leader signal sequence.

Once the sequence encoding the peptide mimic has been inserted into the HBcAg sequence to obtain the hybrid sequence, this recombinant molecule can be inserted into a vector which includes control sequences operably linked to the inserted sequence, thus allowing for expression of the hybrid HBcAg-antigen molecule in vivo in a targeted subject species. Suitable control sequences have been described herein above.

Once complete, any of the above-described recombinant nucleic acid molecules can be used for nucleic acid immunization using standard gene delivery protocols. Methods for gene delivery are known in the art. See, e.g., U.S. Patent Nos. 5,399,346, 5,580,859, 5,589,466. Genes can be delivered either directly into a subject or, alternatively, delivered ex vivo into cells derived from the subject and the cells reimplanted in the subject. For example, a preparation comprising the above-described recombinant polynucleotides, with or without addition of an adjuvant composition, can be provided using standard pharmaceutical formulation chemistries and methodologies all of which are readily available to the ordinarily skilled artisan. For example, compositions containing one or more nucleic acid sequences (e.g., present in a suitable vector form such as a DNA plasmid) can be combined with one or more pharmaceutically acceptable excipients or vehicles to provide a liquid preparation.

Auxiliary substances, such as wetting or emulsifying agents, pH buffering substances and the like, may be present in the excipient or vehicle. These excipients, vehicles and auxiliary substances are generally pharmaceutical agents that do not induce an immune response in the individual receiving the composition, and which may be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, polyethyleneglycol, hyaluronic acid, glycerol and ethanol. Pharmaceutically acceptable salts can also be included therein, for example, mineral acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, malonates, benzoates, and the like. It is also preferred, although not required, that the preparation will contain a pharmaceutically acceptable excipient that serves as a stabilizer, particularly for peptide, protein or other like molecules if they are to be included in the vaccine composition. Examples of suitable carriers that also act as stabilizers for peptides include, without limitation, pharmaceutical grades of dextrose, sucrose, lactose, trehalose, mannitol, sorbitol, inositol, dextran, and the like. Other suitable carriers include, again without limitation, starch, cellulose, sodium or calcium phosphates, citric acid, tartaric acid, glycine, high molecular weight polyethylene glycols (PEGs), and combination thereof. A thorough discussion of pharmaceutically acceptable excipients, vehicles and auxiliary substances is available in

REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Pub. Co., N.J. 1991), incorporated herein by reference.

Certain facilitators of nucleic acid uptake and/or expression ("transfection facilitating agents") can also be included in the compositions, for example, facilitators such as bupivacaine, cardiotoxin and sucrose, and transfection facilitating vehicles such as liposomal preparations that are routinely used to deliver nucleic acid molecules. Useful liposomal preparations include cationic (positively charged), anionic (negatively charged) and neutral preparations, with cationic liposomes particularly preferred. Cationic liposomes have been shown to mediate intracellular delivery of plasmid DNA (Feigner et al. (1987) Proc. Natl. Acad. Sci. USA 84:7413- 7416) and m-RNA (Malone et al. (1989) Proc. Natl. Acad. Sci. USA 86:6077-6081).

Alternatively, the nucleic acid molecules of the present invention may be encapsulated, adsorbed to, or associated with, particulate carriers. Suitable particulate carriers include those derived from polymethyl methacrylate polymers, as well as PLG microparticles derived from poly(lactides) and poly(lactide-co- glycolides). See, e.g., Jeffery et al. (1993) Pharm. Res. 10:362-368. Other particulate systems and polymers can also be used, for example, polymers such as polylysine, polyarginine, polyornithine, spermine, spermidine, as well as conjugates of these molecules.

If desired, viral vectors can be used to deliver the polynucleotides of the invention. A number of viral based systems have been developed for gene transfer into mammalian cells. For example, a selected coding sequence can be inserted into a vector and packaged in retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to cells of the subject either in vivo or ex vivo. A number of retroviral systems have been described (U.S. Patent No. 5,219,740; Miller et al. (1989) BioTechniques 7:980-990; Miller, A.D. (1990)

Human Gene Therapy 1:5-14; and Burns et al. (1993) Proc. Natl. Acad. Sci. USA 90:8033-8037.

A number of adenovirus vectors have also been described (Haj-Ahmad et al. (1986) J. Virol. 57:267-274; Bett et al. (1993) J. Virol. 67:5911-5921; Mittereder et al. (1994) Human Gene Therapy 5:717-729; and Rich et al. (1993) Human Gene

Therapy 4:461-476). Additionally, various adeno-associated virus (AAV) vector systems have been developed for gene delivery. AAV vectors can be readily constructed using techniques well known in the art. See, e.g., U.S. Patent Nos. 5,173,414 and 5,139,941 ; International Publication Nos. WO 92/01070 (published 23 January 1992) and WO 93/03769 (published 4 March 1993); Lebkowski et al.

(1988) Molec. Cell. Biol. 8:3988-3996; Vincent et al. (1990) Vaccines 90 (Cold Spring Harbor Laboratory Press); Carter, B.J. (1992) Current Opinion in Biotechnology 3:533-539; Muzyczka, N. (1992) Current Topics in Microbiol. and Immunol. 158:97-129; and Kotin, R.M. (1994) Human Gene Therapy 5:793-801. Additional viral vectors which will find use for delivering the nucleic acid molecules encoding the present peptide mimics include those derived from the pox family of viruses, including vaccinia virus and avian poxvirus.

Here again, formulation of liposomal or viral vector compositions comprising the above nucleic acid molecules can be carried out using standard pharmaceutical formulation chemistries and methodologies all of which are readily available to the reasonably skilled artisan. For example, compositions containing one or more nucleic acid molecules can be combined with one or more pharmaceutically acceptable excipients or vehicles. Auxiliary substances, such as wetting or emulsifying agents, pH buffering substances and the like, may be present in the excipient or vehicle. Although not required, the polynucleotide medicaments of the present invention may effectively be used with any suitable adjuvant or combination of adjuvants. For example, suitable adjuvants include, without limitation, adjuvants formed from aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc; oil-in-water and water-in-oil emulsion formulations, such as Complete Freunds Adjuvants (CFA) and Incomplete Freunds

Adjuvant (IF A); adjuvants formed from bacterial cell wall components such as adjuvants including lipopolysaccharides (e.g., lipid A or monophosphoryl lipid A (MPL), Imoto et al. (1985) Ret. Zett. 26:1545-1548), trehalose dimycolate (TDM), and cell wall skeleton (CWS); heat shock protein or derivatives thereof; adjuvants derived from ADP-ribosylating bacterial toxins, including diphtheria toxin (DT), pertussis toxin (PT), cholera toxin (CT), the E. coli heat- labile toxins (LT1 and LT2), Pseudomonas endotoxin A, Pseudomonas exo toxin S, R. cereus exoenzyme, R. sphaericus toxin, C. botulinum C2 and C3 toxins, C. limosum exoenzyme, as well as toxins from C. perfringens, C. spiriforma and C. difficile, Staphylococcus aureus ΕDIN, and ADP-ribosylating bacterial toxin mutants such as CRM_I97, a non-toxic diphtheria toxin mutant (see, e.g., Bixler et al. (1989) Adv. Exp. Med. Biol. 251 :175; and Constantino et al. (1992) Vaccine); saponin adjuvants such as Quil A (U.S. Pat. No. 5,057,540), or particles generated from saponins such as ISCOMs (immuno stimulating complexes); chemokines and cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-12, etc.), interferons (e.g., gama interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor

(TNF), defensins 1 or 2, RANTES, MlPl-α and MIP-2, etc; muramyl peptides such as N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl- ^L-alanyl-^D-isoglutamine (nor-MDP), N-acetylmuramyl-^L-alanyl-^D-isoglutaminyl-^L- alanine-2- (1' -2' -dipalmitoyl--sw-glycero-3 huydroxyphosphoryloxy)-ethylamine (MTP-PE) etc.; adjuvants derived from the CpG family of molecules, CpG dinucleotides and synthetic oligonucleotides which comprise CpG motifs (see, e.g., Krieg et al. Nature (1995) 374:546. Medzhitov et al. (1997) Curr. Opin. Immunol. 9:4-9, and Davis et al. J. Immunol. (1998) 160:870-876); and synthetic adjuvants such as PCPP (Poly[di(carboxylatophenoxy)phosphazene) (Payne et al. Vaccines (1998) 16:92-98.. Such adjuvants are commercially available from a number of distributors such as Accurate Chemicals; Ribi Immunechemicals, Hamilton, MT; GIBCO; Sigma, St. Louis, MO. Preferred adjuvants are those derived from ADP- ribosylating bacterial toxins, with cholera toxin and heat labile toxins being most preferred. Oligonucleotides containing a CpG motif are also preferred. Other preferred adjuvants are those provided in nucleic acid form, for example nucleic acid sequences that encode chemokines and cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-8, IL-12, etc.), interferons (e.g., gama interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), defensins 1 or 2, RANTES, MlPl-α and MIP-2 molecules. The adjuvant may delivered individually or delivered in a combination of two or more adjuvants. In this regard, combined adjuvants may have an additive or a synergistic effect in promoting a desired immune response. A synergistic effect is one where the result achieved by combining two or more adjuvants is greater than one would expect than by merely adding the result achieved with each adjuvant when administered individually. A preferred adjuvant combination is an adjuvant derived from an ADP-ribosylating bacterial toxin and a synthetic oligonucleotide comprising a CpG motif.

When used in nucleic acid immunizations, the formulated compositions will include an amount of the nucleic acid molecules which, when expressed to provide the peptide mimics in an immunized subject, is sufficient to mount an immunological response, as defined above. An appropriate effective amount can be readily determined by one of skill in the art. Such an amount will fall in a relatively broad range that can be determined through routine trials. The compositions may contain from about 0.1% to about 99.9% of the recombinant nucleic acid molecules and can be administered directly to the subject or, alternatively, delivered ex vivo, to cells derived from the subject, using methods known to those skilled in the art.

For example, the polynucleotide medicaments of the present invention can be administered to a subject in vivo using a variety of known routes and techniques. Liquid preparations can be provided as an injectable solution, suspension or emulsion and administered via parenteral, subcutaneous, intradermal, intramuscular, intravenous injection using a conventional needle and syringe, or using a liquid jet injection system. Liquid preparations can also be administered topically to skin or mucosal tissue, or provided as a finely divided spray suitable for respiratory or pulmonary administration. Other modes of administration include oral routes, suppositories, and active or passive transdermal delivery techniques. Alternatively, the vaccine compositions can be administered ex vivo, for example delivery and reimplantation of transformed cells into a subject are known (e.g., dextran-mediated transfection, calcium phosphate precipitation, electroporation, and direct microinjection of into nuclei). Other routes of administration include, but are not limited to, rectally and vaginally, intraperitoneally, intravenously, orally or intramuscularly.

It is preferred, however, that the nucleic acid molecules be delivered using a needleless syringe (e.g., a particle acceleration device which fires nucleic acid- coated microparticles into target tissue), or transdermally delivers particulate nucleic acid compositions. In this regard, gene gun-based nucleic acid immunization has been shown to elicit both humoral and cytotoxic T lymphocyte immune responses following epidermal delivery of nanogram quantities of DNA. Pertmer et al. (1995) Vaccine 13: 1427-1430. Particle-mediated delivery techniques have been compared to other types of nucleic acid inoculation, and found markedly superior. Fynan et al. (1995) Int. J. Immunopharmacology 17:79-83, Fynan et al. (1993) Proc. Natl. Acad. Sci. USA 90:11478-11482, and Raz et al. (1994) Proc. Natl. Acad. Sci. USA 91:9519-9523. Such studies have investigated particle-mediated delivery of nucleic acid-based vaccines to both superficial skin and muscle tissue.

Particle-mediated methods for delivering nucleic acid preparations are known in the art. Thus, once prepared and suitably purified, the above-described nucleic acid molecules can be coated onto core carrier particles using a variety of techniques known in the art. Core caarrier particles are selected from materials which have a suitable density in the range of particle sizes typically used for intracellular delivery from a gene gun device. The optimum carrier particle size will, of course, depend on the diameter of the target cells.

For the purposes of the invention, tungsten, gold, platinum and iridium carrier particles can be used. Tungsten and gold particles are preferred. Tungsten particles are readily available in average sizes of 0.5 to 2.0 μm in diameter. Gold particles or microcrystalline gold (e.g., gold powder A1570, available from Engelhard Corp., East Newark, NJ) will also find use with the present invention. Gold particles provide uniformity in size (available from Alpha Chemicals in particle sizes of 1-3 μm, or available from Degussa, South Plainfield, NJ in a range of particle sizes including 0.95 μm). Microcrystalline gold provides a diverse particle size distribution, typically in the range of 0.5-5 μm. However, the irregular surface area of microcrystalline gold provides for highly efficient coating with nucleic acids. A number of methods are known and have been described for coating or precipitating DNA or RNA onto gold or tungsten particles. Most such methods generally combine a predetermined amount of gold or tungsten with plasmid DNA, CaCl₂ and spermidine. The resulting solution is vortexed continually during the coating procedure to ensure uniformity of the reaction mixture. After precipitation of the nucleic acid, the coated particles can be transferred to suitable membranes and allowed to dry prior to use, coated onto surfaces of a sample module or cassette, or loaded into a delivery cassette for use in particular gene gun instruments.

Various needleless syringes suitable for particle-mediated delivery are known in the art, and are all suited for use in the practice of the invention. Current device designs employ an explosive, electric or gaseous discharge to propel the coated carrier particles toward target cells. The coated carrier particles can themselves be releasably attached to a movable carrier sheet, or removably attached to a surface along which a gas stream passes, lifting the particles from the surface and accelerating them toward the target. An example of a gaseous discharge device is described in U.S. Patent No. 5,204,253. An explosive-type device is described in U.S. Patent No. 4,945,050. One example of a helium discharge-type particle acceleration apparatus is the PowderJect XR^® instrument (PowderJect Vaccines, Inc., Madison), WI, which instrument is described in U.S. Patent No. 5,120,657. An electric discharge apparatus suitable for use herein is described in U.S. Patent No. 5,149,655. The disclosure of all of these patents is incorporated herein by reference. Alternatively, particulate nucleic acid compositions can administered transdermally using a conventional needleless syringe device. For example, a particulate composition comprising the nucleic acid molecules of the present invention can be obtained using general pharmaceutical methods such as simple evaporation (crystallization), vacuum drying, spray drying or lyophilization. If desired, the particles can be further densified using the techniques described in commonly owned International Publication No. WO 97/48485, incorporated herein by reference. These particulate compositions can then be delivered from a needleless syringe system such as those described in commonly owned International Publication Nos. WO 94/24263, WO 96/04947, WO 96/12513, and WO 96/20022, all of which are incorporated herein by reference.

Delivery of particles from the above-referenced needleless syringe systems is practiced with particles having an approximate size generally ranging from 0.1 to 250 μm, preferably ranging from about 10-70 μm. Particles larger than about 250 μm can also be delivered from the devices, with the upper limitation being the point at which the size of the particles would cause untoward damage to the skin cells.

The actual distance which the delivered particles will penetrate a target surface depends upon particle size (e.g., the nominal particle diameter assuming a roughly spherical particle geometry), particle density, the initial velocity at which the particle impacts the surface, and the density and kinematic viscosity of the targeted skin tissue. In this regard, optimal particle densities for use in needleless injection generally range between about 0.1 and 25 g/cm³, preferably between about 0.9 and

1.5 g/cm³, and injection velocities generally range between about 100 and 3,000 m/sec. With appropriate gas pressure, particles having an average diameter of 10-70 μm can be accelerated through the nozzle at velocities approaching the supersonic speeds of a driving gas flow. In yet another embodiment of the invention, a method for eliciting an immune response in a subject is provided. The method entails transfecting cells of the subject with one of the recombinant nucleic acid molecules of the present invention (as described herein above) in at least a first step which is sufficient to bring about expression of the peptide mimic in the subject at levels suitable to elicit an immune response against the target antigen. The method may entail a secondary administration to the subject in a boosting step, wherein the vaccine composition delivered in the second administration can be the same nucleic acid molecule or a different molecule that includes the same peptide mimic. For example, the secondary composition can be any suitable vaccine composition which contains a nucleic acid molecule encoding the peptide mimic, or a composition containing the peptide mimic already in peptide or protein form. Direct delivery of the secondary compositions in vivo will generally be accomplished with or without viral vectors (e.g., a modified vaccinia vector) as described above, by injection using either a conventional syringe, or using a particle-mediated delivery system as also described above. Injection will typically be either subcutaneously, epidermally, intradermally, intramucosally (e.g., nasally, rectally and or vaginally), intraperitoneally, intravenously, orally or intramuscularly. Other modes of administration include oral and pulmonary administration, suppositories, and transdermal applications. Dosage treatment may be a single dose schedule or a multiple dose schedule. C. Experimental

Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. Efforts have been made to ensure accuracy with respect to numbers used

(e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

Example 1 Construction of Hybrid HBcAg- Antigen Molecules

A sequence encoding a HBcAg particle was obtained which had the C- terminal arginine-rich region removed (which deletion does not interfere with particle formation). A unique restriction site (a BSP120I site) was then inserted into the ICE to provide an insertion point for one or more peptide mimic sequences. The resulting sequence is depicted below as SEQUENCE ID NO. 4, wherein the BSP120I site is indicated by the boxed sequence region.

ATG GAC ATT GAC CCT TAT AAA GAA TTT GGA GCT ACT GTG GAG TTA CTC TCG TTT TTG CCT TCT GAC TTC TTT CCT TCC GTC AGA GAT CTC CTA GAC ACC GCC TCA GCT CTG TAT CGG GAA GCC TTA GAG TCT CCT GAG CAT TGC TCA CCT CAC CAC ACC GCA CTC AGG CAA GCC ATT CTC TGC TGG GGG GAA TTG ATG ACT CTA GCT ACC TGG GTG GGT AAT AAT TTG GAA GAT CCA GCA GGG CCC CGG GAT CTA GTA GTC AAT TAT GTT AAT ACT AAC ATG GGT TTA AAA ATT

AGG CAA CTA TTG TGG TTT CAT ATA TCT TGC CTT ACT TTC GGA

AGA GAG ACT GTA CTT GAA TAT TTG GTA TCT TTC GGA GTG TGG

ATT CGC ACT CCT CCA GCC TAT AGA CCA CCA AAT GCC CCT ATC

TTA TCA ACA CTT CCG GCG CGG CCG CTC TAA (SEQUENCE ID NO.4).

The protein translated from the recombinant nucleic acid molecule of SEQUENCE ID NO 4 is depicted below as SEQUENCE ID NO. 5. Here again, the insertion point (the BSP120I site) for the peptide mimic sequence is indicated by the boxed residues.

MDIDPYKEFG ATVELLSFLP SDFFPSVRDL LDTASALYRE ALESPEHCSP HHTALRQAIL C GE T AT WVGNNLEDPA GPRDLWΝYV ΝTΝMGLKIRQ LL FHISCLT FGRETVLEYL VSFGV IRTP PAYRPPΝAPI LSTLPARPL (SEQUENCE ID NO.5).

A sequence comprising the coding sequence for a secretion signal peptide was then linked to carrier peptide sequence to provide a recombinant nucleic acid molecule. This particular secretion sequence is the coding sequence for the tissue plasminogen activator (tpa) signal peptide, and is depicted below as SEQUENCE ID NO. 6.

ATG GAT GCA ATG AAG AGA GGG CTC TGC TGT GTG CTG CTG CTG TGT GGA GCA GTC TTC GTT TCG GCT (SEQUENCE ID NO.6).

The protein sequence for this tpa signal peptide is depicted below as SEQUENCE ID NO. 7.

DAMKRG CC VLLLCGAVFV SA (SEQUENCE ID NO. 7).

The resulting recombinant molecule was then inserted into a plasmid backbone containing the early CMV promoter and Intron A region to obtain an expression cassette. The resulting construct was termed p7198, and the map of this construct is depicted in Figure 1.

Synthetic oligonucleotides which encode peptide mimics for a meningococcal group C polysaccharide antigen were then provided. The sequence of the peptide mimic encoded by these oligonucleotides is: ACARIYYRYDGFAY (SEQUENCE ID NO. 1). The nucleic acid sequences for the synthetic oligonucleotides are depicted below as SEQUENCE ID NO. 2 and SEQUENCE ID NO. 3.

GGCCTGCTTGTGCTAGAATCTATTACAGATATGATGGATTCGCTTACG (SEQUENCE ID NO. 2).

GGCCCGTAAGCGAATCCATCATATCTGTAATAGATTCTAGCACAAGCA (SEQUENCE ID NO. 3).

The oligonucleotides of SEQUENCE ID NO. 2 or SEQUENCE ID NO. 3 were cloned into the BSP 1201 restriction site of the hepatitis B core antigen peptide carrier sequence in p7198 as shown in Figure 1. Successful cloning of the peptide mimic DNA into the carrier plasmid was verified by DNA sequencing and proper expression of the hepatitis B core in transfected B16 cells as determined using a commercially available HBe (rDNA) EIA kit (Abbott Laboratories) following the manufacturer's instructions.

Primer annealing and cloning: More particularly, 2 μL of the oligo pairs were added to 18 μL of 50mM NaCl, lOmM Tris-Cl (pH 7.9) buffer and incubated at 65 °C for two minutes. The pairs were moved to a 100 ml beaker full of 65 °C water that was cooled to room temperature on a benchtop.

The peptide carrier plasmid was cut with restriction enzyme (Bsp 1201), followed by 5 ' phosphate removal with shrimp alkaline phosphatase, and electrophoresed on low melting point agarose. The gel slice containing plasmid was isolated and heated at 65 °C for ten minutes to melt the gel slice. Two μL of molten agarose was removed and added to 28 μL of IX ligase buffer. To this mixture was added 1 μL of the annealed oligo pairs and 0.5 μl T4 DNA ligase. Following an overnight incubation at 16°C, the ligation reactions were transformed into competent cells, plated on LB plates containing ampicillin, and incubated overnight to allow growth of resistant colonies. Plasmid DNA was isolated from resistant colonies and screened for presence of inserted oligos by standard methods. Plasmid DNAs positive for presence of oligos were sequenced to confirm fidelity of oligo insertion. Plasmids determined to have the expected sequences were further analyzed for in vitro "e" antigen (a form of the core antigen) gene expression utilizing B16 cells and the HBe (rDNA) EIA kit (Abbott Laboratories). In-vitro analysis of gene expression: On day one, the host cells were plated on tissue culture plates at 20-40% confluency, and allowed to grow overnight in an incubator. On day two, the transfection reaction was performed. For each vector to be tested, 20 μL of Lipofectin® reagent (Life Technologies) was added to 180 μL of Optimem® media (Life Technologies), and allowed to incubate at room temperature for 45 minutes. For each vector to be tested, 2 μg of vector was mixed into 200 μL of Optimem® media just prior to use. At 45 minutes, the vector and Lipofectin® solutions were mixed together and allowed to stand at room temperature for an additional 10 minutes. During this final incubation, the plated host cells were removed from the incubator and washed twice with Optimem® media. At 10 minutes, 1.6 ml of Optimem® was added to the Lipofectin® / vector mix, and one milliliter of the resultant mix was added to each of two cell wells from which the Optimem® wash had been removed. The tissue culture plates were returned to the incubator and allowed to sit undisturbed for 5 hours, at which point the Lipofectin® / vector mix was removed and replaced by standard cell maintenance media. At eighteen to twenty-four hours after the media change, the cell maintenance media was collected, the cells washed with PBS and lysed by the addition of 500 μL PBS/0.1% Triton XI 00. The media and cell lysates were centrifuged to remove debris, and 50-100 μL of these samples analyzed for antigen expression by placing the samples into the wells of reaction vessels provided in the HBe (rDNA) EIA Kit (Abbott Laboratories). The volume of the test samples was adjusted with PBS, and the procedure continued according to manufacturer's instructions. When incubation was complete, the wells were washed clean of all liquid reaction components, and to each well 300 μL of color development buffer added. At 30 minutes, the color development reaction was stopped by the addition of 1 molar sulfuric acid, and the absorbance of the reaction was measured at 490nm.

The absorbance data correlates with the amount of antigen produced and it's ability to be secreted outside of cells.

Example 2 Immunization with a Nucleic Acid Molecule Encoding a Peptide Mimic of a Meningococcal Polysaccharide Antigen

Female Balb/C mice of 7 weeks of age were used for the immunogenicity studies. To prepare mice for vaccination, mice were anesthetized by an intraperitoneal injection of 100 mg/kg ketamine mixed withlO mg/kg xylazine and the abdominal skin was shaved by clipping. In the first study, mice (n=6) were vaccinated on days 0, 21, and 50 with 1 μg of MP-MCP DNA using the PowderJect XR gene gun device (PowderJect Naccines, Inc., Madison, Wisconsin) as previously described. Yang et al. (1997) "Particle-Mediated Gene Delivery in vivo and in vitro," in Current Protocols in Human Genetics, John Wiley & Sons, Inc. 12.6.1- 12.6.14. Six control mice were vaccinated with control vector encoding hepatitis B core antigen without the peptide mimic insert. All mice were boosted IP with 5 μg of meningococcal group C polysaccharide (MCP) on day 80. Blood samples were collected via retro-orbital bleeding under anesthesia prior to each vaccination, 7 and 14 days post the MCP boost. The antibody response following DΝA vaccination was determined by

ELISA using MCP as a detection antigen following published techniques. Granoff et al. (1998) Clin. Diagn. Lab. Immunol. 5(4):479-485. Naccinations with the DΝA vaccine alone did not elicit detectable IgG antibodies. All mice responded to MCP boost with high IgG titers one week post-boost and the titer was maintained for two weeks without change, suggesting adequate prime by the DΝA vaccination. Control mice primed with the control vector encoding only hepatitis B core antigen then boosted with MCP had virtually no IgG titer at any time point examined (see Figure 2).

It is accepted that bactericidal antibody to meningococcus correlates with protection, therefore, bactericidal activity of the mouse sera was determined using published techniques. Maslanka et al. (1997) Clin. Diagn. Lab. Immunol. 4(2): 156- 167. There was no detectable bactericidal titer with pre-immunization sera and sera post-DNA vaccination. However, after the MCP boost, bactericidal titers were detected in both the DNA immunized and control vector immunized mice, although animals primed with MP-MCP DNA and boosted with MCP had a higher titer than the control group that was also boosted with MCP (see Table 1 below).

Table 1 : MP-MCP DNA vaccination primed mice for bactericidal antibody response

Group Prime Boost Bactericidal titer

1 MP-MCP DNA MCP 64

2 Vector - <8

3 naive MCP 8 lotes:

1. Primary immunizations with MP-MCP DNA were given on days 0, 21, and 50, and boost immunization with MCP was delivered on day 80. Blood samples were taken on day 87. Pooled sera from six mice were assayed.

2. Bactericidal titer is the highest serum dilution that killed 50% of the bacteria included in the assay.

A second immunization study was performed to determine if two vaccinations using MP-MCP DNA would be sufficient to prime mice for an IgG response. In this second study, mice were vaccinated with 1 μg of MP-MCP DNA on days 0 and 28 using the PowderJect XR device and boosted by EP injection on day 40 with 5 μg of MCP polysaccharide. Blood samples were collected on days 0, 40, and 47. Mice primed with DNA vaccine then boosted with MCP had significantly higher titers than control mice that were primed with control vector and boosted with MCP (see Figure 3). This indicated that two immunizations with 1 μg of DNA were sufficient to prime mice for IgG response.

Accordingly, novel recombinant nucleic acid molecules, compositions containing those molecules, and methods of using the same have been described. Although preferred embodiments of the subject invention have been described in some detail, it is understood that obvious variations can be made without departing from the spirit and the scope of the invention as defined by the appended claims.

Claims

We claim:

1. Use of a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a peptide mimic of a target antigen, in the manufacture of a polynucleotide medicament for eliciting an immune response in a subject against an agent comprising the said target antigen.

2. Use according to claim 1 wherein the recombinant nucleic acid molecule is in an expression vector.

3. Use according to claim 1 or 2, wherein the recombinant nucleic acid molecule is present in a plasmid vector.

4. Use according to any one of claims 1 to 3, wherein the target antigen is a bacterial antigen.

5. Use according to any one of claims 1 to 4, wherein the target antigen is a bacterial polysaccharide.

6. Use according to claim 5, wherein the polysaccharide is derived or obtained from a bacteria species selected from the group consisting of Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae.

1. Use according to claim 5, wherein the bacterial polysaccharide is a pneumococcal type 4 polysaccharide.

8. Use according to claim 5, wherein the bacterial polysaccharide is a meningococcal group C polysaccharide.

9. Use according to claim 8, wherein the first nucleic acid sequence encodes a peptide mimic having the sequence ACARIYYRYDGFAY (SEQUENCE ID NO. 1).

10. Use according to claim 8, wherein the first nucleic acid sequence comprises the following sequence GGCCTGCTTGTGCTAGAATCTATTACAGATATGATGGATTCGCTTACG

(SEQUENCE ID NO. 2).

11. Use according to claim 8, wherein the first nucleic acid sequence comprises the following sequence GGCCCGTAAGCGAATCCATC ATATCTGTAATAGATTCTAGCAC AAGCA

(SEQUENCE ID NO. 3).

12. Use according to any one of claims 1-11, wherein the medicament is a liposomal preparation.

13. Use according to any one of claims 1-11, wherein the medicament is a particulate medicament.

14. Use according to claim 13 wherein the particulate medicament is suitable for transdermal injection into the said subject.

15. Use according to claim 14 wherein the particulate medicament comprises carrier particles having a size of from about 0.5 to about 5 μm and said carrier particles are coated with the recombinant nucleic acid molecule.

16. Use according to claim 15 wherein the carrier particles are selected from tungsten, gold, platinum and iridium particles.

17. Use according to any one of claims 14-16, wherein the particulate medicament is injected into the said subject by means of a needleless syringe.

18. Use of a recombinant nucleic acid molecule comprising (a) a first nucleic acid sequence encoding a peptide mimic of a target antigen and (b) a second nucleic acid sequence that encodes a peptide carrier molecule, in the manufacture of a polynucleotide medicament for eliciting an immune response in a subject against an agent comprising the said target antigen, wherein the first and second nucleic acid sequences are linked together to form a hybrid sequence.

19. Use according to claim 18 wherein the recombinant nucleic acid molecule is in an expression vector.

20. Use according to claim 18 or 19, wherein the recombinant nucleic acid molecule is present in a plasmid vector.

21. Use according to any one of claims 18 to 20, wherein the target antigen is a bacterial antigen.

22. Use according to any one of claims 18 to 21, wherein the target antigen is a bacterial polysaccharide.

23. Use according to claim 22, wherein the polysaccharide is derived or obtained from a bacteria species selected from the group consisting of Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae.

24. Use according to claim 22, wherein the bacterial polysaccharide is a pneumococcal type 4 polysaccharide.

25. Use according to claim 22, wherein the bacterial polysaccharide is a meningococcal group C polysaccharide.

26. Use according to claim 25, wherein the first nucleic acid sequence encodes a peptide mimic having the sequence ACARIYYRYDGFAY (SEQUENCE ID NON).

27. Use according to claim 25, wherein the first nucleic acid sequence comprises the following sequence GGCCTGCTTGTGCTAGAATCTATTACAGATATGATGGATTCGCTTACG

(SEQUENCE ID NO. 2).

28. Use according to claim 25, wherein the first nucleic acid sequence comprises the following sequence GGCCCGTAAGCGAATCC ATCATATCTGTAATAGATTCTAGCAC AAGCA

(SEQUENCE ID NO. 3).

29. Use according to any one of claims 18-28, wherein the medicament is a liposomal preparation.

30. Use according to any one of claims 18-28, wherein the medicament is a particulate medicament.

31. Use according to claim 30 wherein the particulate medicament is suitable for transdermal injection into the said subject.

32. Use according to claim 31 wherein the particulate medicament comprises carrier particles having a size of from about 0.5 to about 5 μm and said carrier particles are coated with the recombinant nucleic acid molecule.

33. Use according to claim 32 wherein the carrier particles are selected from tungsten, gold, platinum and iridium particles.

34. Use according to any one of claims 30-33, wherein the particulate medicament is injected into the said subject by means of a needleless syringe.

35. Use according to any one of claims 18-34, wherein the peptide carrier molecule is derived or obtained from a hepatitis B virus.

36. Use according to claim 35, wherein the peptide carrier molecule is a hepatitis B core antigen.

37. Use according to claim 36, wherein the first nucleic acid sequence is inserted into the second nucleic sequence.

38. Use according to any one of the preceding claims, wherein the said subject is human.

39. Particles suitable for transdermal injection by means of a needleless syringe, which particles comprise carrier particles coated with a recombinant nucleic acid molecule comprising a first nucleic acid sequence encoding a peptide mimic of a target antigen.

40. Particles according to claim 39, wherein the recombinant nucleic acid molecule is present in an expression vector.

41. Particles according to claim 39 or 40, wherein the recombinant nucleic acid molecule is present in a plasmid vector.

42. Particles according to any one of claims 39 to 41, wherein the target antigen is a bacterial antigen.

43. Particles according to any one of claims 39 to 42, wherein the target antigen is a bacterial polysaccharide.

44. Particles according to claim 43, wherein the polysaccharide is derived or obtained from a bacteria species selected from the group consisting of Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae.

45. Particles according to claim 43, wherein the bacterial polysaccharide is a pneumococcal type 4 polysaccharide.

46. Particles according to claim 43, wherein the bacterial polysaccharide is a meningococcal group C polysaccharide.

47. A single unit dosage or multidose container adapted for use in a needleless syringe, said container comprising particles as defined in any one of claims 39-46.

48. A needleless syringe loaded with particles as defined in any one of claims 39-46.

49. A composition comprising a recombinant nucleic acid molecule that contains a first nucleic acid sequence encoding a peptide mimic of a target antigen, wherein the said recombinant nucleic acid molecule is combined with a pharmaceutically acceptable carrier or excipient.

50. A composition comprising a recombinant nucleic acid molecule that contains (a) a first nucleic acid sequence encoding a peptide mimic of a target antigen and (b) a second nucleic acid sequence that encodes a peptide carrier molecule, wherein the first and second nucleic acid sequences are linked together to form a hybrid sequence and combined with a pharmaceutically acceptable carrier or excipient.

51. A method of eliciting an immune response in a subject, said method comprising transfecting cells of the subject with the recombinant nucleic acid molecule of either claim 1 or 18, wherein said transfecting is carried out under conditions that permit expression of a molecule comprising the peptide mimic within the said subject; and said expression is sufficient to elicit an immune response against the said target antigen.

52. The method of claim 51 , wherein the transfecting step is carried out in vivo using a particle-mediated transfection technique.

53. The method of claim 51 wherein the transfecting step is carried out ex vivo to obtain transfected cells which are subsequently introduced into said subject.

54. The method of any one of claims 51 to 53, wherein the subject is human.