JP2002531113A - Protein transduction system and methods of use - Google Patents

Abstract

  (57) [Summary] The present invention relates to a protein transduction system that selectively kills or damages diseased cells or pathogen-infected cells by introducing a fusion protein comprising a protein transduction domain and a cytotoxic domain into cells. The invention can be used as an anti-pathogen system against dead or damaged cells infected with one or more pathogenic viruses or plasmodium. The present invention is applicable to any human disease that is involved in the expression of intracellular proteases that are specific to the affected cell species and are not found in other cells. In addition, other cell-specific properties can be exploited to target specific cell types, such as high levels of heavy metals, DNA damage, and uncontrolled cell division.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] This application is related to US Provisional Application No. 60 / 111,70, filed Dec. 10, 1998.
No. 1 benefit, the entire contents of which are incorporated herein by reference.

BACKGROUND OF THE INVENTION TECHNICAL FIELD The present invention relates to a protein transduction system that selectively kills or damages diseased cells or pathogen-infected cells by introducing a fusion protein comprising a protein transduction domain and a cytotoxic domain into cells. This cytotoxic domain is capable of specific activation in cells that exhibit unique characteristics. In addition, a unique transduction domain is provided which enhances the transduction ability of the fusion protein. The present invention can be used as an anti-pathogen system against dead or damaged cells infected with one or more pathogenic viruses or plasmodium. The present invention is applicable to any human disease that is involved in the expression of intracellular proteases that are specific to the affected cell type and are not found in other cells. In addition, other cell-specific properties can be exploited to target specific cell types, such as high levels of heavy metals, DNA damage, and uncontrolled cell division.

[0003] 2. BACKGROUND Various pathogens infect mammals, especially primates such as humans. For example, certain viruses, bacteria, fungi, yeast, helminths, plasmodium and protozoa have been recognized as human pathogens. For example, Harrison's Principles of Int
ernal Medicine, 12th ed. McGraw ~ Hill, Inc. (1991).

[0004] Pathogens often kill or damage cells by mechanisms that develop morphological features. For example, pathogen-infected cells that have undergone apoptosis or necrosis can easily identify cell changes.

[0005] There is an increasing understanding of cellular proteins and especially enzymes involved in apoptosis.
For example, certain intracellular proteases, such as caspases (ie, cysteinyl aspartate-specific proteases), C. elegans ced-3 and granzyme B are involved in apoptosis. Nucleic acid sequences encoding multiple caspases and proteolytic substrates for apoptosis have been identified. For example, caspase ~ 3 (ie, CPP32) has been particularly well studied. Thompson, CB Science, 267: 1456 (1995); Walker, N.
See PC et al., Cell, 78: 343 (1994).

[0006] There are also related attempts to identify proteins involved in necrosis. For example, necrosis is believed to occur after the expression of certain DNA viruses such as herpes virus.

[0007] Pathogens often trigger the synthesis of certain proteins, particularly enzymes such as proteases. It is believed that almost all pathogens require one or more specific proteases to achieve a productive infection. For example, it is believed that the following typical human pathogens require the expression of at least one pathogen-specific protease: a typical human pathogen is a cytomegavirus (
CMV); herpes simplex virus, such as herpes simplex virus type 1 (HSV ~ 1); hepatitis virus, such as hepatitis C virus (HCV); certain plasmodium, such as P. f
alciparum; human immunodeficiency virus type 1 (HIV-1 and HTLV-III, LAV or HTLV
Human immunodeficiency virus type 2 (HIV ~ 2); Kaposi's sarcoma-associated herpesvirus (KSHV or human herpesvirus 8); yellow fever virus; certain flaviviruses; and rhinovirus.

[0008] Sometimes proteases are encoded by the pathogen itself. In this case, the protease is often called a pathogen-specific protease. For example, CMV, HCV, HIV-1, HIV-2, KSHV and P. falciparum are good examples of pathogens that encode pathogen-specific proteases. Such proteases have various functions and can be said to be indispensable for productive infection.

Certain pathogen-specific proteases, such as serine proteases encoded by HCV, aspartic proteases encoded by P. falciparum (ie, plasmepsins I and II), and mature proteases encoded by HSV-1 Some attempts have been made to analyze. Dilanni, C
L. et al., J. Biol. Chem., 268: 2048 (1993); and Francis, SE et al., EMBOJ.
, 13: 306 (1994).

[0010] In contrast, inducible expression of certain host cell proteases is thought to modulate productive infection by other pathogens. Such host cell proteases are sometimes referred to as inducible host cell proteases. For example, bacterial infection of eukaryotic cells, such as certain plants, may induce the expression of normally quiescent host cell proteases. Induction of host cell proteases is thought to attempt to damage the pathogen, thereby protecting the host cell from infection.

[0011] Infection by the HIV virus is quite noticeable. It is now almost universally agreed that the human family of such retroviruses is an etiological mediator of acquired immunodeficiency syndrome (AIDS) and related disorders. Productive infection by almost all HIV viruses requires the expression of certain HIV-specific proteases. For example, Barre ~ Sinoussi et al., Science, 220: 868-871 (1983
See Gallo et al., Science, 224: 500-503 (1984).

[0012] The development of therapeutic agents targeting pathogen infections such as HIV infection has been promoted. One common approach focuses on disrupting the apparent stages of pathogen transmission. In particular, therapeutics have been developed to combat certain HIV-specific enzymes, such as reverse transcriptase (RT) and pathogen-specific proteases.

[0013] In attempts to treat CMV and HSV infections, other drugs, such as certain cytokines, have been used.

[0014] Another proposed method for treating pathogen infections is called "intracellular immunization." Briefly, the method involves a genetically modified host cell with the intent of rendering the host cell incapable of supporting a productive infection. For example, certain eukaryotic cells have been shown to be immunized against pathogen infection using this method. For example, Baltimore, Nature, 335: 7395 (1988); Har
See rison et al., Human Gene Therapy, 3: 461 (1992); and U.S. Patent No. 5,554,528 to Harrison et al.

[0015] More specific forms of genetic modification have been reported to involve managing the genetic makeup encoding the cytotoxin. In this case, the configuration is designed so that the gene can once express cytotoxin in the cell.

However, conventional methods for treating pathogen infections have some limitations. For example, methods that use cytotoxins to kill cells are not always successful. One explanation is believed to relate to the pleiotropic effects reported for many intracellular cytotoxins. Such effects often complicate analysis of cell killing. In addition, many genetic constructs that encode cytotoxins
It is believed that the basal activity in the host cell is inappropriately increased. Such problems result in what is referred to as "leaky" cytotoxic expression, leading to the death of infected and uninfected cells.

Other methods of treating pathogen infections also have problems. For example, methods that rely on the use of drugs are not completely effective. Specifically, patients infected with active or persistent pathogens often require long-term therapeutic intervention, sometimes for months or years. The growth of drug-resistant pathogens presents even more problems. Thus, the long-term utility of this method is controversial.

In particular, current therapies for HIV utilize small molecule inhibitors that target HIV protease. However, the emergence of resistant HIV strains is becoming a major problem. For example, Coffin, JM, et al., Retroviruses, Cold Spring Harbor Press, Cold Sp.
Ring Harbor, NY (1997); Kaplan, AH et al., "Selection of multiple human immunodeficiency virus 1 variants with low sensitivity to viral protease inhibitors and encoding the viral protease.
ficiency virus type 1 variants that encode viral proteases with decrease
d sensitivity to an inhibitor of the viral protease) ”, Proc. Natl. Aca
d. Sci. USA 91: 5597 (1994); Condra, JH, et al., "In Vivo emergence of HIV-1 mutants resistant to multiple protease inhibitors."
V ~ 1 variants resistant o multiple protease inhibitors) ", Nature 374: 56
9 (1995); Gulnik, SV et al., "Kinetic characteri and kinetic characteristics of HIV-1 protease mutants selected under drug pressure.
zation and cross ~ resistance patterns of HIV ~ 1 protease mutants selected
under drug pressure), Biochemistry, 34: 9282 (1995); and Tisdale,
M. et al., "Cross-resistance analysis of human immunodeficiency virus type 1 variants individually selected for resistance to five different protease inhibitors.
ysis of human immunodeficiency virus type 1 variants individually select
ed for resistance to five different protease inhibitors), Antimicrob.
See Agents Chemother. 39: 1704 (1995).

It is known that the use of the retroviral TAT protein has been elucidated in certain therapeutic settings. TAT has been reported to transactivate certain HIV genes and is believed to be essential for the productive transmission of most human HIV retroviruses. TAT proteins have been used to introduce certain types of fusion proteins into cells. This process is commonly called transduction. See U.S. Patent No. 5,652,122 to Frankel et al .; and Chen, LL et al., Anal. Biochem., 227: 168 (1995).

However, the use of TAT for introducing a fusion protein into cells has significant drawbacks.

For example, it is difficult to keep the fusion protein in a cell at an appropriate concentration. To overcome this problem, it is conceivable to administer large amounts of the fusion protein, which is useful for maintaining an appropriate intracellular concentration. The need for large doses of the fusion protein may hinder the spread of some therapeutic fusion proteins. For example, the use of large amounts of several TAT fusion proteins may negatively affect the viability of some host cells.

In addition, it is difficult to maintain many conventional transduction fusion proteins in a conformation that is compatible with therapy. By way of illustration, many conventional TAT fusion proteins are believed to be partially or completely denatured during transduction. In many cases, this denaturation has the potential to significantly reduce or prevent transduction.

In addition, the need to properly fold conventional transduction fusion proteins complicates attempts to purify and store the protein.

[0024] Other disadvantages have been reported with proteins or certain TAT fragments fused to TAT. These drawbacks relate to how TAT is thought to act intracellularly. Specifically, there is recognition that TAT or a TAT fragment confers certain biological characteristics to the fusion protein. Some of these features, and especially nuclear localization and RNA binding, are not always preferred. In particular, there is concern that many TAT fusion proteins are difficult to locate extranuclear or away from RNA. For example, Dang et al., J. Biol. Chem., 264: 18109 (1989); for a discussion of TAT-related properties, see Calnan, BJ et al., Genes Dev., 5: 201 (1991).
checking ...

An anti-pathogen system that exhibits high transduction efficiency and can specifically transport cytotoxins to pathogen-infected cells is desired. Further, an anti-pathogen system that can be activated by pathogen-infected cells and that can transport cytotoxins essentially as inactivating molecules is desired.

SUMMARY OF THE INVENTION The present invention relates to methods for transducing proteins into cells and for selectively damaging or killing cells that exhibit unique properties. In general, protein transduction systems include fusion molecules that comprise a transduction region and a cytotoxic region genetically, and thus are covalently linked together as an in-frame fusion molecule. The invention further relates to a transduction region that increases the transduction efficiency of the fusion molecule. This system can be used, inter alia, to injure or kill pathogen-infected cells. The anti-pathogen system is
It is essentially inactive in uninfected cells, but specifically activated in cells infected by the pathogen. Further, there is provided a method of using the anti-pathogen system to treat infection by pathogens, particularly certain viruses and human pathogens such as Plasmodium. The present invention is also applicable to any human disease involving the expression of cellular proteases, especially in diseased cell types but not many cells. In addition, other cell-specific properties may be exploited for target-specific cell types, such as high concentrations of heavy metals, DNA damage, uncontrolled cell division, and the like.

[0027] The preferred use of the anti-pathogen system involves that the pathogen infection induces at least one pathogen-specific protease. Preferably, the protease is capable of specifically cleaving the target amino acid sequence. The target amino acid sequence is one component of the fusion molecule and is sometimes referred to herein as a protease recognition or cleavage site. Specific cleavage of the protease recognition site cleaves the fusion molecule, generally at or near the cytotoxic region, forming a cytotoxin. The cytotoxin so formed can kill or hurt cells infected by the pathogen.

In particular, the present anti-pathogenic system is associated with the formation of a cytotoxin against the presence of a pathogen-inducing protease, thereby providing a strongly focused cytotoxic activity against infected cells. The formation of cytotoxins is minimized or eliminated in uninfected cells and infected cells that retain pathogen inactivation. Thus, the antipathogenic system can efficiently and specifically distinguish between productive infected and non-infected cells.

The present anti-pathogen system has a number of important advantages. For example, it can be easily processed to respond to changes in pathogen serotype. That is, the anti-pathogenic system can specifically kill or injure cells infected with one or more pathogen species. On the other hand, prior methods of inhibiting infection, especially drug-based methods, are not usually designed to respond to changes in pathogen serotype.
This deficiency often results in uncontrolled growth of drug-resistant pathogen species. As will become clearer from the discussion below, the present anti-pathogenic system is capable of exploiting the production of one or more pathogen-inducing proteases to kill or damage cells infected by the pathogen serotype. In particular, on the other hand, most prior drug-based methods attempt to simply inhibit the pathogenic process, for example, by inhibiting the activity of the pathogen gene product. The anti-pathogen system is more flexible and can be used to reduce or even eliminate the emergence of pathogen species, particularly by exposing infected cells to cytotoxins.

As an illustration of the flexibility of the present invention, anti-pathogenic systems are particularly useful for the emergence of HIV serotypes. For example, many patients infected with HIV represent different viral species. Conventional drug-based therapies usually attempt to inhibit the activity of HIV enzymes such as RT or HIV protease. Such treatment often results in a spectrum of HIV serotypes as a clinical consequence. It has been recognized that HIV serotypes can develop partial or even complete resistance to treatment. "Cocktail" using multiple anti-HIV drugs
l) Even what is called "treatment" has been problematic. In contrast, the antipathogenic system of the present invention is very flexible, and by using HIV protease,
It is applicable to killing or damaging cells that produce serotypes. Clearly, anti-pathogenic systems are also formulated to address the increased activity of such HIV proteases or the number of infected cells with enhanced activation of this system.

The flexibility of the present anti-pathogenic system appears in some parts, as it can be prepared to kill or hurt cells infected by almost any number of HIV serotypes. Thus, according to the present invention, it is possible to configure an anti-pathogen system to combat one or more HIV species in a particular patient. This feature is very useful in several respects. For example, it provides a specific way to fight HIV infection in a single patient without resorting to the administration of drugs that are inherently harmful or ineffective. Clearly, the antipathogenic system can be designed to be effective at nanomolar doses or less. This low concentration of antiviral activity is clearly lower than many existing drug-based therapies. This feature of the invention has a beneficial effect on the patient's resistance to the antipathogenic system.

In addition, the present anti-pathogen system is fully compatible with recognized anti-HIV therapies, such as those used in a “cocktail” format (ie, a combination of anti-HIV drugs) to kill or hurt infected cells There is.

In certain embodiments of the invention, an anti-pathogenic system is used to reduce or eliminate expression of the HIV antigenic system by utilizing an HIV protease produced by the virus.

Exemplary fusion proteins that kill HIV-infected cells are described in Examples 11 and 12 below.
To provide.

Furthermore, the present anti-pathogenic system is capable of transducing unexpectedly large fusion molecules into cells. In particular, it has been discovered that the antipathogenic system adapts to misfolded (ie, partially or completely unfolded) fusion molecules and provides for efficient transduction of these molecules into cells. . Above all, about 1
It is believed to apply to misfolded fusion proteins having molecular weights ranging from 500 kDa or more. Thus, the present antipathogenic system is broadly capable of transducing a wide range of fusion molecules into cells.

More particularly, the ability to transduce a misfolded fusion molecule has substantial advantages over conventional transduction methods. For example, the misfolded fusion protein used in connection with the present invention will apparently enhance transduction efficiency, sometimes by about 10-fold or more. Furthermore, it has been found that by improperly folding the fusion protein, it is possible to optimize the amount of the fusion protein in the cell. Preparation and storage of the fusion molecule also has an advantageous effect by misfolding.

As discussed, the present anti-pathogenic system is flexible. For example, it is not limited to any particular pathogen or cell type, provided that the pathogen is capable of inducing at least one specified protease in the cell. The protease may in particular be a pathogen-inducible or host-derived, protease induced in response to (ie, synthesized or activated by) a reaction to interferon. However, the specified protease must be able to cleave the protease recognition site on the fusion molecule in order to activate the cytotoxin.

The present anti-pathogen system and methods of using it can be used in vitro or in vivo. Furthermore, the order or number of the components of the fusion molecule is not critical, provided that each component on the molecule is operably linked and can perform its intended specific function.

The cytotoxins produced by the anti-pathogenic system are screened to kill or damage infected cells, preferably in the presence of one or more cellular proteases and usually a pathogen or host cell-derived protease. Preferably the cytotoxin is
At least about 20%, 25%, 50% as assessed by standard cell viability tests
, 75%, 80% or 90% of cells, preferably about 95%, 98% or 10%
Cells infected with up to 0% of pathogens can be killed. The preferred survival test uses standard trypan blue (Trypa blue), although other assays may be used if desired.
n Blue) exclusion assay. It is also preferred that the cytotoxin activity is limited to the producing cells.

As already mentioned, the present anti-pathogenic system comprises an in-frame fusion molecule. The fusion can be performed by conventional recombinant nucleic acid methods. If desired, the fusion can also be performed by chemical conjugation of the transducing protein to a cytotoxic region, according to conventional methods described below.

In general, the transduction region of the fusion molecule can be almost any synthetic or naturally occurring amino acid sequence capable of transducing or assisting in transduction of the fusion molecule. For example, transduction can be performed according to the present invention using an HIV TAT protein or a fragment thereof that covalently binds to a protein sequence, particularly a fusion molecule. Alternatively, the transducing protein is an Antennapedia homeodomain or HSV VP22 sequence,
Alternatively, it can be a suitable transducing protein such as those known in the art.

The type and size of the transducing amino acid sequence can be guided by various parameters, including the desired degree of transduction. Preferred sequences will transduce at least about 20%, 25%, 50%, 75%, 80% or 90% of the cells of interest, more preferably at least about 95%, 98% or up to about 100%. It is possible. Transduction efficiency, typically expressed as a percentage of transduced cells, can be determined by several conventional methods, such as the specific microscopy methods discussed below (eg, flow cytometry analysis).

More preferred transducing sequences may exhibit cell insertion and elimination rates (sometimes designated as k1 and k2, respectively), where at least picomolar amounts of the fusion molecule are preferred in the cell. Amino acid sequence insertion and elimination rates can be easily determined, or at least predictable, by standard kinetic analysis using a detectable labeled fusion molecule. Typically, the ratio of insertion speed to ejection speed is between about 5 and about 100, up to about 1000.

Particularly preferred is to transduce a transducing amino acid sequence comprising a peptide characterized by at least an intrinsic alpha-helix. Transduction is
It has been found that the transduced amino acid sequence is optimized when it exhibits a pronounced alpha-helix. Further, a sequence having at least one basic amino acid residue essentially arranged on the peptide surface is preferable. Generally, such preferred transducing peptides are synthetic proteins or peptide sequences.

Further preferred transduction amino acid sequences are class I transduction regions, or similar terms, and include a strong alpha helix structure with a plane of arginine (Arg) residues below the helix cylinder.

In one embodiment, the class I transduction region is a peptide represented by the following general formula: B1-X1-X2-X3-B2-X4-X5-B3, wherein B1, B2 and B3 are each independently the same or different basic amino acids, and X1, X2, X3, X4 and X5 are each independently And the same or different alpha-helix promoting amino acids.

In another embodiment, the class I transducing peptide has the general formula: B1-X1-X2-B2-B3-X3-X4-B4, wherein B1, B2, B3
And B4 are each independently the same or different basic amino acids;
1, X2, X3 and X4 are each independently the same or different alpha-
Helix-promoting amino acids.

Further preferred transducing peptides are often referred to herein as “Class II” regions or similar terms. These regions are generally basic residues such as lysine (Lys) or arginine (Arg), preferably arginine (Arg).
And contains at least one proline (Pro) residue sufficient to introduce "kinks" within the region.

In one embodiment, the class II region is a peptide represented by the following sequence: X-X-R-X- (P / X)-(B / X) -B- (P / X) -X
-B- (B / X), where X is any alpha helix promoting residue, preferably alanine, P / X is proline or X as previously defined, and B is a basic amino acid residue, e.g. Arginine (Arg) or lysine (Lys), preferably arginine (Arg), R is arginine (Arg) and B / X is B or X as defined above.

Further transducing sequences according to the invention include a TAT fragment comprising at least amino acids 49-56 of TAT up to about the full length TAT sequence. Preferred T
An AT fragment contains one or more amino acid changes that are sufficient to increase the alpha-helicality of the fragment. In most instances, the amino acid change introduced will include the addition of a recognized alpha-helix promoting amino acid. Alternatively, the amino acid change is a TAT that interferes with alpha helix formation or stabilization.
Removing one or more amino acids from the fragment is included. In a more specific embodiment, the TAT fragment may include at least one amino acid substitution with an alpha-helix promoting amino acid. Preferably, the TAT fragment is made by standard peptide synthesis techniques, although a recombinant DNA approach may be preferred in some cases.

A further transduction protein of the invention includes a TAT49-56 sequence in which at least two basic amino acids in the sequence are essentially aligned along at least one surface of the TAT, preferably Included are TAT fragments as modified to be TAT49-56 sequences. In one embodiment, such sequences are made by making at least one specified amino acid addition or substitution to the TAT49-56 sequence. An exemplary TAT fragment is at least amino acid 49- of TAT, such that the replacement sequences 49-56 basic amino acid residues along at least one compartment surface, and preferably sequences the TAT 49-56 sequence. At least one specified amino acid substitution within 56.

Further transducing proteins according to the invention include TAT fragments wherein the TAT49-56 sequence contains at least one substitution with an alpha-helix promoting amino acid. In one embodiment, the substitutions are selected such that at least two basic amino acid residues within the TAT fragment are arranged essentially along at least one surface of the TAT fragment. In a more particular embodiment, the substitutions are selected such that at least two basic amino acid sequences in the TAT49-56 sequence are arranged essentially along at least one surface of the sequence.

Further provided is a chimeric transduction protein comprising at least two different transduction protein portions. For example, a chimeric transducing protein can be formed by fusing two different TAT fragments, eg, one from HIV-1 and another from HIV-2. Alternatively, other transducing proteins can be formed by fusing the desired transducing protein to an asymmetric amino acid sequence such as 6XHis (sometimes referred to as "HIS"), EE, HA or Myc.

As mentioned above, the fusion molecules of the invention also include a fused cytotoxic region. Generally, a cytotoxic region contains a potentially toxic molecule and one or more specialized protease cleavage sites. The phrase "potentially toxic"
"y toxic" means that when the molecule is present as part of a cytotoxic area, it is not significantly cytotoxic to infected or uninfected cells (preferably about 30 as assayed by standard cell viability tests). %, 20%, 10%, 5
%, Less than 3% or 2% cell viability. More preferably 1% or less viability). As mentioned above, a protease cleavage site may be specifically cleaved by one or more proteases induced by a pathogen infection.

In particular, the protease cleavage site is chosen to remain essentially uncleaved in uninfected cells, thereby retaining the cytotoxic region in an inactive state. These protease cleavage sites may also be chosen to remain essentially uncleaved in cells where the pathogen is inactive. However, in the presence of a specialized pathogen-derived or host cell-derived protease, the protease cleavage site is specifically cleaved to produce a cytotoxin from a potentially toxic molecule. That is, cleavage of the protease site releases a cytotoxic region from the fusion molecule, thereby forming an active cytotoxin. One or more protease cleavage sites are generally located within the cytotoxic region to optimize release of all or a partial region from the fusion protein and to increase cytotoxin formation.

Further preferred protease cleavage sites are chosen such that they are not cleaved by proteases normally associated with uninfected cells. These proteases are commonly referred to as "housekeeping" proteases and are well known.

A protease cleavage site is sometimes referred to herein as indicating its ability to be specifically cleaved by one or more proteases induced by a pathogen infection.
It is referred to as the "pathogen-specific" cleavage site. A protease cleavage site is "responsive" to a pathogen (or one or more pathogens) as long as cleavage of such a site releases a cytotoxic region from the fusion molecule, thereby activating a cytotoxin. It is.

[0058] The cytotoxic region can include one or more of a variety of potentially toxic molecules, provided that they are releasable from the fusion molecule as discussed. Exemplary cytotoxic regions for use in fusion molecules include immature enzymes. These immature enzymes are sometimes referred to as zymogens, proenzymes, preproenzymes, or simply the more mature enzymes "pre-", "pre-pro" (pre-pr).
o) "or" pro- "form.

Preferred zymogens can be specifically activated to cytotoxins (ie cytotoxic enzymes) by site-specific proteolysis at one or more naturally occurring protease cleavage sites on the zymogen. Zymogens can be further processed in some instances by autoproteolysis.

In particular, preferred cytotoxic regions containing zymogens are within the zymogen and / or
Or it may include one or more specialized protease cleavage sites added to the periphery. The cleavage site is selectively positioned to facilitate release of the zymogen and processing to the mature or more mature cytotoxic enzyme.

In particular, the addition of a protease cleavage site to the zymogen can be with respect to the naturally occurring protease cleavage site within the zymogen. However,
Preferably, the cleavage site is substituted for one or more naturally occurring cleavage sites. In this embodiment, the substituted protease cleavage site in the zymogen is specifically cleavable by one or more pathogen-specific proteases. One of the naturally occurring protease cleavage sites of zymogen
Partial or complete replacement at one or more pathogen-reactive cleavage sites, maturation of zymogens to cytotoxins, has been known to occur under essential or complete control by pathogen infection. Was.

Various specific zymogens are suitable for inclusion within the cytotoxic area, as discussed below. These active forms of zymogens generally include bacterial toxins, in particular exotoxins, plant toxins and invertebrate toxins, including conotoxins, snakes and spider toxins.

Further designed cytotoxic regions include known proteins with the potential to exert genetically dominant properties. That is, the protein may be more specifically cleaved than the fusion protein and essentially abolish one or more cellular functions, such as cell replication. In this embodiment, the potential dominant protein must not exhibit dominant properties (sometimes known as the dominant phenotype) until the protein is released from the fusion protein. Examples of potentially dominant proteins according to the invention include proteins that inhibit cell replication, such as Retinoblastoma protein (Rb), p16 and p53.

Further designed cytotoxic regions include essentially inactive enzymes that have the ability to convert a particular nucleoside or analog thereof into a cytotoxic. In this embodiment, the cytotoxic region may include one or more specialized protease cleavage sites, preferably arranged to release an inactive enzyme from the fusion protein. Following release, the enzyme converts the nucleoside or analog thereof to a cytotoxin. Examples of such enzymes include viral thymidine kinase and nucleoside deaminase such as cytosine deaminase. Cytotoxic regions containing catalytically active fragments of enzymes such as those commonly known in the art are also contemplated.

The present anti-pathogen system offers a number of further important advantages. For example, the antipathogenic system unexpectedly adapts a misfolded fusion protein. As will become more apparent from the discussion below and the examples, it has been found that this property essentially increases the concentration of the fusion protein in the cell. Generally, no corresponding increase in the amount of fusion protein administered is necessary. Without intending to be bound by theory, transduction of a misfolded fusion protein requires a modest number of molecules, and only a few of them may reveal effective cytotoxic effects. It is believed that it needs to be refolded. For example, Example 5
With certain preferred fusion proteins, such as those described below at 6, it is believed that only about 10-100 correctly refolded fusion proteins are required to kill or damage infected cells. I have. Thus, the present invention can reduce or even eliminate the need to concentrate large amounts of cytotoxic molecules in cells to perform significant anti-pathogen activity.

In addition, it has been found that the activity of the present antipathogenic system is often enhanced by quantitative activity. More particularly, it is known that specific cleavage of the cytotoxic region can attract additional fusion molecules into infected cells. This feature may be particularly advantageous for fusion proteins that contain a cytotoxic region, which is preferably administered at a suboptimal dose. In such instances, the fusion protein is enriched, inter alia, in infected cells, thereby increasing the concentration of cytotoxin to a lethal or near-lethal concentration. Importantly, cytotoxicity remains suboptimal in uninfected cells.

[0067] Still further advantages are provided for certain fusion proteins of the present invention that include a TAT fragment as described above. For example, the cytotoxic region of a protein fused to a TAT fragment need not be directed to the cell nucleus or RNA. More particularly, the fusion molecules are configured to separate cytotoxic regions from TAT fragments inside infected cells,
Thereby avoiding unnecessary enrichment with proteins or RNA in the nucleus. It is recognized that in uninfected cells, such fusion proteins may be directed to the nucleus or RNA. Thus, different localization of the fusion protein in infected and uninfected cells may provide a way of distinguishing such cells from each other, for example, by observation.

The anti-pathogen system of the present invention may also have a beneficial effect on certain drug-based anti-pathogen treatments. More particularly, cells infected with retroviruses, especially HIV, can contain infectious particles for long periods, sometimes months or even years. Beyond this time, retroviruses can develop substantial resistance to most drugs, sometimes by altering one or only a few genomic sequences. It has been recognized that once a retrovirus becomes resistant to one drug, such virus becomes resistant to a wide range of drugs. Thus, treatment using a drug-based approach is generally inflexible and does not readily apply to the presence of resistant viruses. A related concern was also considered regarding the development of other resistant pathogen species, such as certain Plasmodium protozoa.

In contrast, the present anti-pathogen system kills or injures cells infected with the pathogen, regardless of the pathogen's ability to acquire drug resistance. The development of drug resistant pathogens, especially drug resistant HIV species, is due to the large number of protease cleavage sites to which this system can accommodate,
Almost impossible with this antipathogenic system. By way of example, the HIV virus is about 8 to 1
It has been reported to have 0 such cleavage sites. In order for the system to develop intrinsic resistance to an anti-pathogenic system that could contain one or more such sites, the virus must modify its cleavage site and the corresponding viral protease. Will not be.

Thus, the present anti-pathogenic system is expected to significantly reduce or even eliminate the presence of many pathogen-resistant species, especially certain drug-resistant HIV species.

Furthermore, the antipathogenic system of the present invention is compatible with various drug-based therapies. Thus, the anti-pathogenic system can be used as the sole active agent or in combination with one or more therapeutic agents, for example, to minimize or eliminate pathogens, especially drug-resistant pathogen species.

Further, there is provided an essentially pure fusion molecule of the invention. The invention also provides nucleic acid sequences encoding extrachromosomal DNA sequences that are organized as fusion proteins, especially autonomously replicating DNA vectors.

The present invention also provides a method for controlling or eliminating infection with one or more pathogens in a primate, such as a mammal, especially a human. The method further includes, inter alia, administering a therapeutically effective amount of the antipathogenic system. The method further includes treating a mammal infected or suspected of being infected by one or more pathogens.

A preferred method according to the invention for controlling or eliminating infection by one or more pathogens comprises providing the anti-pathogen system as an aerosol,
And similar, such as administration via the nasal or oral route. Dosage regimens are specifically designed to administer the antipathogenic system to lung tissue, particularly to facilitate contact with the lung epithelium and enhance transport into the bloodstream.

Also, the method comprises administering to a mammal such as a primate, especially a human, a therapeutically effective amount of an anti-pathogen system in the presence of one or more pathogens.
Methods are provided for inducing apoptosis in a previously determined cell population.

Cells infected with one or more pathogens may be cells maintained in culture, eg, primary cultures of immortalized cell lines or cells or tissues, tissues or organs (eg, lungs) in vivo. It can be a cell that can be a part. Thus, the anti-pathogen system can be used in vitro and in vivo as needed.

The present invention also provides essentially pure fusion molecules, especially fusion proteins in which, in addition to the transduction described above, the cytotoxic region may also optionally contain other components. These components can be covalently or non-covalently attached thereto and may include, among other things, one or more polypeptide sequences. The added polypeptide sequence is sometimes referred to herein as a protein identification or purification “tag”.
It is expressed as Examples of such tags are EE, 6 × his, HA and MYC
It is.

As discussed, although correctly folded fusion proteins may be desirable in some cases, the fusion proteins described herein may be provided in a misfolded form. preferable. Misfolded fusion proteins are generally purified, if necessary, by a chromatographic approach capable of purifying the desired fusion molecule from naturally associated cellular components. Typically, this approach involves isolating the fusion from a suitable host cell, denaturing the misfolded fusion protein, and using conventional chromatographic methods to purify the fusion molecule. . Expression of a misfolded fusion protein in inclusion bodies has several advantages, including protecting the misfolded fusion protein from degradation by host cell proteases. In addition, providing the fusion protein in a misfolded form avoids time consuming and costly protein folding techniques.

Further, the invention provides a method of making a substantial amount of a fusion protein. Generally speaking, the method involves obtaining an essentially pure fusion molecule,
It involves expressing the desired fusion molecule in a suitable host cell, culturing the cell, and purifying the fusion molecule therefrom. This method can be used to express and purify the desired fusion protein on a large scale (ie, at least in milligram quantities) from various devices including roller bottles, spinner flasks, tissue culture plates, bioreactors or enzymes.

This method for isolating and purifying the fusion proteins of the present invention is very useful. For example, for fusion proteins that exhibit desirable killing activity, it would be very useful to have a method for expressing and purifying the fusion protein. It is particularly useful to have a method that can produce fusion proteins in large quantities, and the fusion molecule can be made as a component of a kit suitable for medical, research, home or commercial use. In addition, it is useful to be able to simplify structural analysis and to have large amounts of the fusion protein for further purification and / or testing if desired.

The invention also features in vitro and in vivo selection for detecting compounds with therapeutic potential that modulate, and preferably inhibit, proteins induced by pathogen infection, especially proteases. I do. For example, one method generally involves infecting a desired cell with a pathogen, contacting the cell with a fusion protein of the invention, transducing the fusion protein, adding a compound to the cell, killing with the fusion protein. Detecting damaged or damaged cells. The efficacy of a particular compound can be easily assessed by determining the amount of cell kill as a function of the concentration of the compound added.

Further provided is a method of inhibiting pathogen infection in a mammal, especially a primate such as a human, comprising administering to the mammal a therapeutically effective amount of an anti-pathogenic system. In one embodiment, the fusion protein includes a covalently linked protein transduction region and a cytotoxic region. The method includes transducing the fusion protein into a mammalian cell, cleaving the fusion protein sufficient to release a cytotoxic region from the fusion protein, enriching the cytotoxic region in the cell, And producing a cytotoxin sufficient to suppress pathogen infection in mammals. Examples of pathogens include, but are not limited to, retroviruses, herpes viruses, viruses that can cause influenza or hepatitis, and Plasmodium, which can cause malaria. Preferred cytotoxic areas and cytotoxins are described in more detail below.

In another embodiment of the method for inhibiting pathogen infection in a mammal, a prodrug (eg, a suitable nucleoside or analog thereof) is administered to remove the cytotoxin and the prodrug-enriched cytotoxic region. Produced by contact with.

Further, according to the present invention, 1) an A TAT compartment, especially a protein transducing fragment thereof, and 2) a pathogen-derived or host cell-derived protease, such as an HIV protease or a catalytically active fragment thereof, covalently linked in sequence. There is provided a fusion protein comprising:

In addition, the present invention provides an anti-pathogenic system, wherein the fusion protein is covalently linked in sequence: 1) a transduction region, 2) a first zymogen subunit,
3) Protease cleavage site, 4) Contains second zymogen subunit. Also provided is an antipathogenic system wherein the transduction region is TAT, the first zymogen subunit is p5 Bid, the protease cleavage site is an HIV protease cleavage site, and the second zymogen subunit is p15 Bid. Is done.

The present invention also provides that the fusion protein is covalently linked in sequence, 1) transduction region, 2) first protease cleavage site, 3) first zymogen subunit, 3) second protease cleavage site, 4) Also provides an anti-pathogenic system consisting of a second zymogen subunit. The transduction region is TAT, the first protease cleavage site is an HIV p7-p1 protease cleavage site, the first zymogen subunit is p17 caspase-3, and the second protease cleavage site is HIV p17.
A p24 protease cleavage site, wherein the second zymogen subunit is p12
An anti-pathogenic system is provided that is caspase-3.

The present invention also provides a method of killing HIV infected cells. In one embodiment, the method comprises contacting the cell with an effective dose of a fusion protein, wherein the fusion protein is covalently linked in sequence: 1) a transduction region, 2) a first zymogen. Subunit, 3) protease cleavage site, 4) second zymogen subunit, or 1) transduction region, 2) first protease cleavage site, 3) first zymogen subunit, 3) second protease cleavage site, 4) Consists of a second zymogen subunit. The fusion protein can be administered in vitro or in vivo as needed. For example, the fusion protein can be administered in vivo to a mammal in need of such treatment, such as a primate, especially a human patient infected by the HIV virus.

The method of the present invention is also applicable to human diseases. In fact, human diseases involving the expression of cellular proteases, especially in diseased cell types, but not other cells, can be exploited to specifically kill that cell. In addition, other cell-specific properties can also be exploited to target specific cell types, such as high concentrations of heavy metals, DNA damage, uncontrolled cell division, and the like.

Prostate cancer is an example of the flexibility of the present invention for treating non-pathogen-related human diseases. Prostate cells are prostate specific antigen (Prostate A).
It expresses specific cellular proteases such as N.tingen (PSA) and has a 1000-fold increase in heavy metal zinc concentration as compared to the rest of the human body. Importantly, both of these properties are retained in prostate cancer cells. Further, as a model system, the patient is a child and the prostate is not required for any body function. Thus, all malignant or non-malignant prostate cells can be removed from the body without loss of viability to the patient.

[0090] PSA is a member of the subfamily of the kallikrein family of cellular proteases (Lilja et al., 1985, Watt et al.).
However, like chymotrypsin and trypsin, it has a chymotrypsin-type substrate specificity that distinguishes it from other kallikrein family members (
Christenson et al. Lilja et al. 1989
). PSA is specifically synthesized by prostate cells and secreted into the prostate lumen. The function of PSA is to cleave gel-forming proteins present in semen such as SgI & II (Lilja et al. 1985). By comparison with the sequence-specific cleavage of PSA to chymotrypsin, the sequence "HSSKLQ" (single letter amino acid code) is sufficiently cleaved by PSA (cleaved after the Q residue) (the site not cleaved by chymotrypsin). Denmeade et al).

Because of the strong cell-cell connection in the prostate, PSA does not leak into the bloodstream or is detected in the bloodstream. However, during rapid growth of prostate cancer, the connection is looser and allows the release of low concentrations of PSA into the bloodstream. In addition, metastasis of prostate cancer cells results in further release and detection of PSA in the bloodstream. In using pathogen-specific proteases to identify and kill infected cells, PSA is 1) specifically expressed on malignant prostate cells and 2)
Has specific substrate specificity or cleavage site. Thus, PSA is a good example of a human disease that can be targeted by transducable killing proteins.

The design of a PSA-activating transducible killing molecule can take several forms, as discussed above, to allow for a pathogen-activating killing molecule. First, PSA present in the shedding parcel can be used to activate the transduced zymogen intracellularly into a killed form as outlined above. Second, extracellular PSA can be used to transduce the closest cells, prostate cells, and activate zymogens that induce apoptosis.

[0093] A 1000-fold excess of zinc in prostate cells could also be exploited by dimerization and therefore transduction of inactive proteins that require high concentrations of Zn for activation. Such examples include using the dimerization region of the cellular transcription factor (T × F) and the dimerization region of the HPV E7 protein. The caspase pl7 and pl2 regions can be designed to have an end tag for the E7 or TxF dimerization region. Transduced caspase-3 pl7 and pl
The essential dimerization of the two subunits is due to the E7 / T
Depends on dimerization of the XF region. Therefore, induction of apoptosis is due to E7 / Tf
It occurs only when the F region is dimerized by Zn. Thus, such transducible killing molecules are specifically activated only in cells containing high concentrations of Zn, such as prostate cells.

The protein transduction system of the present invention can also be used to target and kill cancer cells, generally based on their high proliferative activity when compared to normal cells. For example, tumors containing wild-type p53 tumor suppressor protein respond significantly better to traditional anti-tumor regimens such as irradiation or chemotherapy than tumors containing mutant p53 (Lowe et al.) ). In fact, p53 status is currently the single most obvious determinant of patient outcome after treatment. Therefore, wild-type p53
Into tumors may restore the sensitivity of these cancers to conventional anticancer therapies, and, importantly, significantly reduce the amount of anticancer therapy needed to kill the cancer cells May be possible. This may offer a different benefit to the patient by avoiding high concentrations of anti-cancer treatment that also results in non-specific killing of normal cells in the patient. Furthermore, due to the continuous level of DNA damage present in p53-mutants / harmful tumors, the introduction of wild-type p53 reduces the apparent and / or dramatic levels of anti-cancer therapy ( Apoptosis can be very well induced in the absence of a minor threshold).

We have determined that a transducible version of p53 (TAT-p53 1-36
4) was prepared and added to human Jurkat leukemia T cells and normal human diploid fibroblasts. Addition of the TAT-p531-364 protein resulted in specific cell death of tumor cells, while normal cells showed minimal toxicity.

TAT-pl6 or TAT in combination with TAT-p53 protein
-Transduction of additional anti-cell cycle tumor suppressor proteins such as p27 may help to effect a further increase in killing. Furthermore, transduction of TAT-p53 protein in combination with conventional small molecule chemotherapy to induce DNA damage,
Further activation of transduced p53, and thus a synergistic effect, is possible. Other aspects of the invention are disclosed below.

As described above, the present invention provides proteins that exhibit high transduction efficiencies and can be used to specifically kill or injure cells that exhibit unique characteristics such as pathogen infection, cellular growth, etc. It features a transduction system. Protein transduction or anti-pathogen systems generally include a fusion protein comprising a transduction domain genetically fused to a cytotoxic domain as an in-frame fusion protein. Preferred fusion proteins exhibit high transduction efficiencies, for example, as measured in later assays. The transduction domain introduces the fusion protein into the cell and once inside the cell releases the cytotoxic domain from the fusion protein to form a cytotoxin in the infected cell. In a preferred embodiment, the function of the fusion protein is specifically enhanced, for example, by optimizing the transduction domain structure and by misfolding the fusion molecule.

The method of the present invention can also be applied to human diseases. Indeed, any human disease in which a cellular protease is specifically expressed in the cell type of the disease and not in other cells can be used to kill the cell specifically. In addition, other cells specific for the property can be utilized, for example, to target specific types of cells with high levels of heavy metals.

Preferred fusion proteins reduce the pathogen infected cells by at least about 25%, as assessed by routine tests for cell viability, discussed below.
It is capable of killing 0%, 50%, 60% or 70%, preferably 80%, 90%, more preferably at least 95% to 100%.

An “anti-pathogen system” according to the invention includes one or more of the fusion molecules described herein and the potential to enhance activity, including solubility, stability and / or transduction efficiency. Included are additional components that may be added to it, such as those that are present. Examples include, but are not limited to, serum proteins such as bovine serum albumin, buffers such as phosphate buffered saline, or pharmaceutically acceptable vehicles or stabilizers. For a discussion of pharmaceutically acceptable vehicles, stabilizers, etc., see generally Remington's Pharmaceutical Science.
"checking. Preferred anti-pathogen systems include between about 1 and 3 and preferably 1 to 3 dissolved in a pharmaceutically acceptable carrier such as water or buffered saline.
Two fusion proteins are included.

As discussed in more detail below, the anti-pathogen system may be administered as the sole active agent or in combination with one or more drugs such as those specifically provided below. Can be.

As used herein, by the term “fusion molecule” is meant a molecule to be transduced, which is usually shared by recombinant, chemical or other suitable methods with the cytotoxic domain. A bound (ie, fused) protein or peptide sequence is meant. If desired, the fusion molecule can be fused in one or several places via a peptide linker sequence. The peptide sequence includes one or more sites for cleavage by a pathogen-induced or host-cell-induced protease. Alternatively, a peptide linker may be used to help construct the fusion molecule. The cytotoxic domain usually includes one potentially toxic molecule, such as a zymogen, sometimes such a molecule is between about 2 and about 5 to 10. Specifically preferred fusion molecules are fusion proteins.

As noted, components of the fusion proteins disclosed herein, such as the transducing amino acid sequence, cytotoxic domain, protease cleavage site and peptide linker, provide the fusion protein with the intended function. It can be organized in almost any way, provided that it has. In particular, if desired, each component of the fusion protein can be separated from other components by at least one suitable peptide linker sequence. Further, the fusion protein may include a tag, for example, to facilitate identification and / or purification of the fusion protein.
More specific fusion proteins are described below.

Preferred peptide linker sequences are typically up to about 20 or 30 amino acids, more preferably up to about 10 or 15 amino acids, and even more preferably about 1-5 amino acids.
Amino acids. The linker sequence is generally flexible so as not to confine the fusion molecule to a single, inflexible structure. For example, a linker sequence can be used to separate a DNA binding protein from a fusion molecule. Specifically, a peptide linker sequence can be placed between the protein transduction domain and the cytotoxic domain, for example, to chemically crosslink and to provide flexibility to the molecule.

The term “misfolded” in reference to a fusion protein refers to a protein that is partially or completely unfolded (ie, denatured). By contacting with one or more chaotropic agents as discussed below, the fusion protein can be partially or completely misfolded.

More generally, the misfolded fusion proteins disclosed herein represent high Gibbs free energy (ΔG) forms of the corresponding native protein. Preferred are misfolded fusion proteins that are completely soluble in aqueous solution. In contrast, native fusion proteins usually fold correctly, are completely soluble in aqueous solution, and have a relatively low ΔG. Thus, in most instances, the native fusion protein is stable.

[0107] It is possible to detect misfolding of the fusion protein by one or a combination of conventional strategies. Misfolding can be detected by a variety of conventional biophysical techniques, including, for example, measuring optical rotation with native (control) and misfolded molecules. As stated, administration of the anti-pathogen system involves transduction of the misfolded fusion protein in vitro and in vivo. Without wishing to be bound by theory, after transducing the fusion protein into the cell, the misfolded fusion protein may be fully refolded, for example, by a chaperone and activated in response to a pathogen infection. Is believed to be sufficient to produce a fusion protein that can be produced.

By the term “fully lysable” or similar terms, low G force centrifugation (eg, less than about 30,000 revolutions per minute in a conventional centrifuge) requires, for example, an aqueous solution such as a cell culture. By fusion molecules and especially fusion proteins that do not readily precipitate from the buffer. In addition, the fusion molecule is placed at temperatures greater than about 5-37 ° C. and at low or neutral concentrations of anionic or nonionic surfactant at neutral or near neutral PH. When fused, the fusion molecule is soluble. Under such conditions, soluble proteins often have low sedimentation values, for example, less than 10 to 50 Svedberg units.

The aqueous solutions cited herein include buffering compounds to determine the pH, typically a pH in the range of about 5-9, and an ionic strength in the range between about 2 mM and 500 mM. Have. Protease inhibitors or weak nonionic surfactants may be added. Further, if desired, a carrier protein such as bovine serum albumin (BSA) may be added in the order of mg / ml. Exemplary aqueous buffers include normal phosphate buffered saline, Tris buffered saline, or other well-known buffers and cell culture formulations.

“Polypeptide” preferably refers to a polymer consisting essentially of some of the 20 natural amino acids, regardless of its size. Although the term "protein" is often used to refer to relatively large proteins, and "peptide" is often used to refer to small polypeptides, the use of such terms in the art overlaps Often do. The term "polypeptide" refers to proteins, polypeptides and peptides unless otherwise noted.

The term “potential toxic molecule” refers to an amino acid sequence such as a protein, polypeptide or peptide capable of producing the desired toxic effect as discussed below; a sugar or polysaccharide; a lipid or glycolipid; Mean glycoprotein or lipoprotein. Also contemplated are potentially toxic nucleic acids that encode toxic or potentially toxic proteins, peptides or peptides. Thus, preferred molecules include
Regulators, enzymes, antibodies, or drugs and DNA, RNA, and oligonucleotides. Potentially toxic molecules may be naturally occurring, may be synthesized from known compounds by, for example, recombinant or chemical synthesis, and may include heterogeneous components. Potentially toxic molecules are generally from about 0.1 to 100 KD or more, up to about 1000 KD, preferably about 0.1 KD, as determined by conventional molecular sizing techniques such as centrifugation or SDS polyacrylamide gel electrophoresis. .1, 0.2, 0.5, 1, 2, 5, 10, 20, 30, and 50 KD.

As used herein, the term “cell” is intended to encompass any primary cell or any group of such cells in immortalized cell lines, tissues and organs. Preferably, the cells are of mammalian origin, especially of human origin, and can be infected by one or more pathogens. A "host cell" in accordance with the invention may be an infected cell, or may be an E. coli that can be used to propagate a nucleic acid described herein. It may be a cell such as E. coli.

The present anti-pathogen system is suitable for use in vitro and in vivo with a variety of cells that are infected or may be infected with one or more pathogens.

As described for the use of anti-pathogen systems, cells in culture can be infected with a single serotype of pathogen. The infected cells are then contacted in vitro with the particular fusion protein. As discussed earlier, the fusion protein
The cytotoxic domain is configured to be activated in the presence of one or more proteases induced by the pathogen infection. After providing for transduction of the cells (typically less than about 30 minutes), the cells can cleave the fusion protein for up to about 2 to 24 hours, typically about 18 hours. After this time, the cells are washed with a suitable buffer or cell culture and then assessed for viability. The time allotted to kill or damage cells by the fusion protein will vary depending on the particular cytotoxic domain chosen. However, viability can often be assessed after about 2-6 hours to about 24 hours. As described in more detail below, cell viability can be easily measured or quantified by monitoring uptake of well-known dyes (eg, trypan blue) or fluorescence.

The present anti-pathogen system is also useful for the treatment of various human diseases in vitro or in vivo where the expression of cellular proteases occurs specifically in the cell types of the disease and not in other cells. It is suitable. In addition, other cells that are specific for properties
It can also be used to target specific cell types such as high levels of heavy metals, DNA damage, uncontrolled cell division and the like.

Preferred embodiments of the invention carry primary or secondary tumors, including tumors in the mammary gland, prostate, ovary, central nervous system, brain, colon, lung, skin, etc., or disseminated tumors such as leukemia cells. Methods for treating an animal that is in need.

Particularly preferred are methods of treating prostate cancer. A preferred treatment for cancer is to use a transducible form of the p53 protein. The fusion protein may include the full-length p53 protein, or may include a portion of the p53 protein that can act as a tumor suppressor. Particularly preferred is the TAT-p53 1-364 fusion construct.

As mentioned above, the anti-pathogen system is flexible and can be provided in a form tailored to a particular application. For example, the system comprises two fusion proteins, wherein the first fusion protein comprises a transduction domain and a cytotoxic domain and the second fusion protein comprises a transduction domain and a pathogen-derived protease or a host cell-derived protease. Can be provided.

[0119] Cells transduced with the fusion molecules of the invention can be assessed for viability by conventional methods. In one approach, cell viability can be easily assessed by measuring DNA replication after or during transduction. For example, a preferred assay involves the incorporation of one or more detectably labeled nucleosides, such as radiolabeled thymidine, into cells. Incorporation can be conveniently measured by several conventional approaches, including trichloroacetic acid (TCA) precipitation followed by scintillation counting. Other methods for measuring cell viability include the well-known trypan blue exclusion method.

As mentioned, the fusion molecules of the present invention efficiently transduce target cells or groups of such cells. If desired, transduction efficiency can be monitored and quantified by a single strategy or a combination of various strategies.

For example, one approach involves an in vitro assay that measures the uptake of the fusion protein by cells. The assay measures, for example, detectably labeling the fusion protein with a radioactive, fluorescent, phosphorescent, or chemiluminescent tag (eg, fluorescein, rhodamine, or FITC), and then measures incorporation of the labeled fusion protein. Is included. Alternatively, the fusion protein can be labeled with an enzyme capable of forming a detectable label, such as horseradish peroxidase, β-galactosidase, chloramphenicol acetyltransferase or luciferase. In a preferred approach, it is possible to genetically fuse the desired fusion protein to the well-known green fluorescent protein (GFP) and then assay the fusion protein. Uptake can be measured by quantifying cells labeled with a conventional cell sorter (eg, FACS), by fluorescence microscopy, or by several conventional methods, such as by autoradiography. For disclosure related to the assay, see
See generally Sambrook et al. And Ausubel et al.

Preferred fusion proteins of the invention are measured by any conventional method for monitoring the uptake of proteins by cells, in particular at least about the total number of target cells, as measured by FACS or related microscopy. 20% ~
Transduction can be as high as 80%, more preferably at least about 90%, 95%, 99%, 100%. The total number of target cells can be calculated by a standard method.

As noted, the present invention relates to fusion proteins and nucleic acids (eg, DNA) encoding the fusion proteins. Where the cytotoxic domain is a polypeptide sequence, the term fusion protein is intended to describe at least two polypeptides, typically from different sources and operably linked. With respect to polypeptides, the term "operably linked" is intended to mean that two polypeptides are linked in such a way that each polypeptide can perform its intended function. Typically, the two polypeptides are covalently linked via a peptide bond. As discussed, if desired, the two polypeptides may be separated by a peptide linker.

[0124] The fusion proteins described herein are preferably made by conventional recombinant DNA techniques. For example, a DNA molecule encoding a first polypeptide can be joined to another DNA encoding a second polypeptide. In this example, the resulting hybrid DNA can be expressed in a suitable host cell, producing a fusion protein. After splicing, the translational frames of the encoded polypeptides are not altered (ie, the DNA molecules are spliced in frame with each other) and are 3 'to 5' to each other.
Connect DNA molecules in the direction. The resulting DNA molecule encodes the fusion protein in frame.

The components of the fusion protein can be organized in almost any order, provided that each is capable of performing its intended function. For example, in one embodiment, the protein transduction domain is adjacent to a pathogen-specific protease cleavage site contained within the cytotoxic domain. Further, the cytotoxic domain can be flanked by pathogen-specific protease cleavage sites, one or both of which can be flanked by protein transduction domains. The present invention also contemplates circular fusion proteins.

Preferred cytotoxic domains that contain a pathogen-specific cleavage site are of a size such that such domains can perform their intended function. Particularly preferred cytotoxic domains are at least about 0.1, 0.2, 0.5, 0.75, 1, 5, 10,
25, 30, 50, 100, 200, 500 kD It can be about 1000 kD or more. It should be clear that the size of the cytotoxic domain usually exceeds the size of the fusion protein. Preferred pathogen-specific cleavage sites are from about 4 to about 30 or 40
, Preferably about 8 to about 20, more preferably about 14 amino acids in length.

See Table 1 below. Pathogen-specific protease cleavage sites can be created and fused to the cytotoxic domain by various methods, including well-known chemical cross-linking methods. See, for example, Means, GE and Feeney, RE (1974) in Chemical Modification of Proteins (Holden ~ Day). See also SS Wong (1991) in Chemistry of Protein Conjugation and Cross-Linking (CRC Press). However, recombination is generally preferred for producing in-frame fusion proteins.

As mentioned, fusion molecules consistent with the invention can be organized in several ways. In an exemplary configuration, the C-terminus of the transduction domain is operably linked to the N-terminus of the cytotoxic domain. If desired, the ligation can be achieved by recombinant methods. However, in another configuration, the N-terminus of the transduction domain is linked to the C-terminus of the cytotoxic domain. Within the cytotoxic domain, the N-terminus of the first pathogen-specific protease cleavage site can be operably linked to the C-terminus of the transduction domain, and the C-terminus of the protease cleavage site can be linked to the N of the potential toxic molecule. It can be operably linked to a terminus. In yet another configuration, the C-terminus of the cytotoxic domain can be linked to the N-terminus of a second pathogen-specific protease cleavage site that is the same or different from the first pathogen-specific site. Preferably, the first and second pathogen-cleavage sites are specifically cleaved by the same protease induced by the pathogen infection.

Alternatively or additionally, one or more protease cleavage sites may be
It can be inserted into potentially toxic molecules as needed. Preferred fusion proteins consistent with the present invention include (N-C-terminal)
Operably linked: 1) transduction domain / one or more pathogen-specific protease cleavage sites / and potential toxic molecules; 2) transduction domain / pathogen-specific protease cleavage sites / and zymogen; and 3 ) Transduction domain /
A first pathogen-specific protease cleavage site / first zymogen subunit / second pathogen-specific protease cleavage site / and a second zymogen subunit. Further, EE, HA, Myc, and polyhistidine, especially 6Xhis
One or more protein tags, such as to improve solubility,
Alternatively, it can be fused to the N-terminus of the transduction domain, if desired, to facilitate isolation and identification of the fusion protein. See the examples below.

Although not generally preferred, the polypeptide sequence can be operably linked to a fusion protein to facilitate transport to the cell nucleus. Amino acid sequences that, when included in a protein, act to promote transport of the protein to the nucleus are known and are referred to as nuclear localization signals (NLS). The nuclear localization signal is typically 1
It is composed of basic amino acids. When bound to a heterogeneous protein (eg, a fusion protein of the invention), the nuclear localization signal facilitates transport of the protein to the cell nucleus. It is exposed on the cell surface and binds a nuclear localization signal to the heterogeneous protein so as not to interfere with the function of the protein. Preferably, the NLS binds to one end of the protein, for example, the N-terminus. SV40 nuclear localization signal is NLS
And can be included in the fusion proteins of the invention. The SV40 nuclear localization signal has the following amino acid sequence: Thr-Pro-Lys
-Lys-Lys-Lys-Arg-Lys-Val (SEQ ID NO: 3
). Preferably, the nucleic acid encoding the nuclear localization signal is spliced in-frame (eg, at the 5 'end) to the nucleic acid encoding the fusion protein by conventional recombinant DNA techniques.

As mentioned above, the fusion proteins of the invention may be partially referred to herein as protein transduction domains, transduction domains, transduction domains or “PT
D ", which comprises the first polypeptide, which provides for entry of the fusion protein into the cell. Peptides having the ability to provide entry of the ligated peptide into cells are known and are described in TAT, "Penetratin" Ala-Lys-Ile-T.
rp-Phe-Gln-Asn-Arg-Arg-Met-Lys-Trp-L
ys-LysGlu-Asn (SEQ ID NO: 1) (Derossi et al., J. Am.
Bio. Chem., 269: 10444 (1994)), and those described above, such as Antennapedia homeodomain and HSV V22 (Elliot and O'Hare, Cell, 88: 223 (1997)).

An exemplary transducing protein comprises at least the basic region of TAT (natural TAT).
TAT fragment containing amino acids 49-57) of the protein. The TAT fragment can be between about 9, 10, 12, 15, 20, 25, 30, or 50 amino acids up to 86 amino acids in length. The TAT fragment is preferably TA
It lacks TAT exon 2 which encodes a T-cysteine rich region (amino acids 22-36 of native TAT) and a carboxyl terminal domain (amino acids 73-86 of native TAT). The TAT transduction domain has the following amino acid sequence: YGR
KKRRQRRR (SEQ ID NO: 2). The amino acid sequence is sometimes referred to herein as "minimal TAT sequence." See U.S. Patent No. 5,674,980 and the references cited therein for the TAT structure. Also,
For TAT sequences, see Green, M. and Lowenstein, PM (1988).

As discussed above, and in the examples below, various modifications that enhance transduction with respect to the TAT fragment are contemplated. For example, glycine residues can be flanked by protein transduction domains to allow free rotation. See, for example, FIG. 2 of the drawings. Alternatively, if desired, other amino acid sequences and especially neutral and / or hydrophilic residues may be added to the TAT fragment. A protein tag such as those known in the art may be added to the TAT fragment. Examples of such protein tags include 6XHis, HA, EE and Myc. Generally, the size of the modified TAT fragment is at least 10, 1
2, 15, 20, 25, 30, 50, 100, 200 to about 500 amino acids.

The transduction domain of the fusion protein can be obtained from any of the proteins and any of the proteins that facilitate entry of the fusion protein into cells. As noted, preferred proteins include, for example, TAT, as well as non-naturally occurring sequences.
Antennapedia homeodomain and HSA V22. For example,
Facilitates the adaptability of the synthesized protein transduction domain by simply examining the fusion protein to determine if the synthesized protein transduction domain allows the fusion protein to enter the cell as desired Can be evaluated.

The term “synthesized protein” or similar terms, non-natural amino acid sequences, are made by methods involving recombinant methods or chemical peptide synthesis. Numerous variants of the transduced TAT protein have been described in the art. Such variants can be used in accordance with the present invention. See U.S. Patent No. 5,652,122, which discloses a method for making and using transduced TAT proteins, the disclosure of which is incorporated by reference.

By conventional techniques, additional transduction domains and, in particular, proteins that transduce, can be readily identified. For example, in one approach, a candidate transduction domain, such as the desired TAT fragment, is fused to the cytotoxic domain using conventional recombination techniques to form an in-frame fusion protein. Subsequently, the fusion protein is detectably labeled, for example by a radioactive atom or a fluorescent label such as FITC. The detectably labeled fusion protein is then added to the cells as described above, and the level of the fusion protein is measured. Preferred transduction domains can achieve intracellular concentrations of the fusion protein of between about 1 picomolar to about 100 micromolar, preferably between about 50 picomolar to about 75 micromolar, more preferably between about 1 to about 100 nanomolar. .

Particularly contemplated trait-introducing proteins include, for example, TAT, as described above,
As obtained by targeted mutagenesis of a known transducing protein or fragment such as VP22 or Antennapedia. Typically, when compared to the same fusion protein containing the corresponding full-length transduction protein sequence, the mutated transduction protein will have at least about 2, 3, 4, 5, 10, 20, 30,
Shows 40- or 50-fold better transduction of the desired fusion protein.

A preferred transducing protein consistent with the present invention is a class I amino acid sequence, preferably a peptide sequence that includes at least a peptide represented by the following general formula: B1-X1-X2-X3-B2 -X4-X5-B3 (wherein,
B1, B2 and B3 are each independently basic amino acids and are the same or different; and X1, X2, X3, X4 and X5 are each independently alpha-
Helix enhancing amino acids, which are the same or different). Typically, such sequences are synthetic.

As used herein, the term “basic amino acid” or similar terms refers to basic residues such as primary, secondary or tertiary amines or cyclic groups containing a nitrogen ring configuration. Refers to an amino acid having a group. Preferred basic amino acids are lysine (Lys) and arginine (Arg), with arginine being particularly preferred. Histidine (His)
) Can also be a suitable basic amino acid.

The term “alpha-helix” enhancing amino acids and similar terms refer to amino acids that have a recognized tendency to form or stabilize an alpha-helix, as measured by assays well known in the art. means. In general, O'Neil, KT and D
See eGrado, WF (1990) Science 250: 646 and the references cited therein for such assays. Preferred alpha-helix enhancing amino acids include alanine (Ala), arginine (Arg), lysine (Lys), leucine (Leu), and methionine (Met). Particularly preferred alpha-
The helix enhancing amino acid is alanine. The term "substantially alpha-helical" means that the particular peptide has a recognizable alpha-helical structure, as determined, for example, by a helical wheel diagram or other conventional means.

In one embodiment, the peptide has the formula: B1-X1-X2-X3-B2-X4-
X5-B3 wherein at least one of B1, B2 and B3 is arginine, preferably all of B1, B2 and B3 are arginine; and X1, X2
, X3, X4 and X5 are each independently an alpha-helix enhancing amino acid;
The same or different). Preferably, at least one of X1, X2, X3, X4 and X5 is alanine, more preferably X1, X2, X3, X
4 and X5 are all alanine. In another embodiment, the peptide has the formula:
B1-X1-X2-X3-B2-X4-X5-B3 (wherein B1, B2 and B
3 are each independently a basic amino acid and are the same or different; and X1
, X2, X3, X4 and X5 are alanine, and more preferably all of X1, X2, X3, X4 and X5 are alanine). In such embodiments, a basic amino acid residue such as arginine is substantially aligned along at least one surface of the peptide, typically along one surface.

An additional preferred transducing protein consistent with the present invention is a synthetic amino acid sequence, preferably a peptide comprising at least a peptide represented by the following general formula: B1-X1-X2-B2 -B3-X3-X4-B4 (wherein B1
, B2B3 and B4 are each independently basic amino acids and are the same or different; and X1, X2, X3 and X4 are each independently alpha-helix enhancing amino acids and are the same or different). In one embodiment, B1, B
At least one of 2, B3 and B4 is arginine, preferably B1, B
2, B3 and B4 are all arginine; and X1, X2, X3 and X
4 are independently alpha-helix enhancing amino acids, which are the same or different. In another embodiment, B1, B2, B3 and B4 are each independently a basic amino acid and are the same or different; and X1, X2, X3, and X
At least one of 4 is alanine, more preferably all of X1, X2, X3 and X4 are alanine residues. In such embodiments, a basic amino acid residue such as arginine is substantially aligned along at least one surface of the peptide, typically along one surface.

The term “substantial sequence” of basic amino acid residues or similar terms refers to each residue being between about 3-4 Angstroms on the conceptualized alpha helix, preferably about 3.
6 Angstroms, meaning that a basic amino acid residue positions with respect to at least another basic amino acid residue so that it can be spaced apart from the others. In the following, the arrangement can be performed by several conventional methods, including inspection of a conventional spiral wheel diagram such as that shown in FIGS. Preferred transduction domains exhibit about 2, 3, 4, 5, 6, or about 7 to about 10 substantially ordered basic amino acid residues.

Further preferred transducing proteins of the present invention include at least the peptides represented by the following specific peptide sequences: YARKARRQARR (SE
Q ID NO: 3), YAARAAARQARA (SEQ ID NO: 4),
YARAARRAARR (SEQ ID NO: 5), YARAARRAARA
(SEQ ID NO: 6), YARRRRRRRRRR (SEQ ID NO:
7) and YAAARRRRRRRR (SEQ ID NO: 8). Particularly preferred is a transducing peptide sequence consisting of the following peptide sequence: YARK
ARRQARR (SEQ ID NO: 3), YARAAARQARA (SEQ
ID NO: 4), YARAARRAARR (SEQ ID NO: 5), Y
ARAARRAARA (SEQ ID NO: 6), YARRRRRRRRRR (
(SEQ ID NO: 7) and YAAARRRRRRRR (SEQ ID NO:
8).

An additional transducing protein of the invention is an amino acid sequence, preferably
A synthetic sequence comprising at least one amino acid modification in at least 49-56 of TAT. For example, in one embodiment, the synthetic peptide is a suitable TA
At least 47-56, 48-56, 47-57, 48 of TAT wherein the TAT sequence has been modified to increase the alpha-helicality of the TAT sequence relative to the T control sequence.
-57, or 49-57 amino acids. Preferably, the TAT sequence includes at least one amino acid substitution with an alpha helix enhancing amino acid such as alanine.

The additional transducing protein is an amino acid sequence, preferably a TAT sequence such that two or more basic amino acids, such as arginine, are arranged substantially along at least one side of the TAT sequence. Modified at least 47-
A synthetic peptide sequence comprising 56, 48-56, 47-57, 48-57, or 49-57 amino acids. The alignment can be facilitated by a variety of approaches, including visualizing the TAT sequence as an alpha helix on a helical wheel. See FIGS. 11 and 12 below.

Further transduction proteins of the present invention are those wherein the TAT sequence includes at least one amino acid substitution with an alpha helix enhancing amino acid at least 49- to a TAT.
56, preferably 47-56, 48-56, 47-57, 48-57, or 49
1 is a peptide sequence that includes ~ 57 amino acids. In this embodiment, an amino acid substitution is selected to align two or more arginines substantially along at least one surface of the TAT sequence, preferably along one surface. In one embodiment, preferably, about 2, 3, 4, or 5 arginine residues are substantially aligned along at least one side of the helix, and more particularly, along one side of the helix. For example, to increase alpha helicality and align arginine residues on at least one side of the helix, TAT
About 1, 2, 3, 4, or 5 amino acid residues up to 6 amino acid residues in the sequence can be replaced with alanine residues.

An additional transducing protein consistent with the present invention is an Antp sequence (SEQ I
DNO: 10, see Table 2 below), preferably comprising an amino acid sequence comprising at least the transducing portion of the Antp sequence modified according to what has been described above for a particular TAT sequence. In particular, the modification is selected to align basic amino acid residues (eg, arginine) along at least one side of the Antp sequence, or both, to increase the alpha-helicality of the transducing protein. At least one amino acid substitution, deletion or addition can be included. Examples include a suitable control peptide, eg, at least one amino acid modification sufficient to increase transduction efficiency by about 2, 5, or 10 to 100 or more times compared to the Antp sequence (SEQ ID NO: 10). The Antp sequence has been modified to include
It is a transduction protein that includes the Antp sequence (SEQ ID NO: 10).

Further preferred are the class II transducing amino acid sequences as described above.
In one embodiment, the class II sequence is a peptide represented by the formula:
X1-X2-R-X3- (P / X4)-(B / X5) -B- (P / X6) -X4
-B- (B / X7); wherein X1, X2, X3, X4, X5, X6, and X7
Are each alpha-helical facilitating residues and are the same or different; (P / X4)
And (P / X6) are independently proline or alpha helix-assisting residues; B is a basic amino acid residue; (B / X5) and (B / X7) are each independently B or alpha And R is arginine (Arg)).
A preferred alpha helix-promoting residue is alanine (Ala). Preferred basic amino acids are arginine (Arg), lysine (Lys), especially Arg. Particularly preferred class II transducing amino acid sequences are at least one proline residue,
Usually it will contain between about 1-3 proline residues.

More specifically, the class II peptide sequence is described in Example 13 below (SEQ I
D NO: 36-41).

The molecular weight of the transduction domains described herein will vary according to parameters such as the intended use and the desired transduction efficiency. Generally, the transduction domain exhibits a molecular weight between about 1, 2, 3, 5, 10, 20 to about 50 kD, as determined by SDS-PAGE gel electrophoresis or other suitable assay. Specific preferred transduction domains are described more fully below and in the Examples below.

As noted, preferred transduction domains consistent with the present invention exhibit enhanced transduction efficiencies. This augmentation is performed using standard methods, as specifically described below.
It can be assessed by one or a variant. One common approach, sometimes referred to herein as a transduction efficiency assay or similar term, is to transduce cells with one or more suitable control molecules in parallel with the desired transducing protein. Transduction efficiency is determined with reference to a control assay. Preferably, the transduction rate and the intracellular amount of a particular transduction domain are measured and compared to a control molecule. Exemplary suitable control molecules include TAT 47-57 (SEQ ID N
O: 1) amino acids, 49-57 amino acids of TAT, and the Antp sequence (SEQ
ID NO: 10).

Two or more protein transduction domains of the invention, for example, about 2,3,4,5
, 6 to up to about 10 or more protein transduction domains can be covalently linked to the desired molecule to be transduced. In this embodiment, the protein transduction domains can be linked in tandem or separated by one suitable peptide linker as desired.

[0154] Preferred protein transduction domains of the present invention have a range of about 5-10-10 when compared to a suitable control molecule, such as, for example, a minimal TAT sequence or other suitable control molecule.
Transduction is enhanced up to 0-fold or more. An example of a preferred transduction assay is described in Example 7 below.

The transducing proteins of the present invention can be made by various conventional methods. For example, DNA encoding a desired transducing protein can be obtained by isolating DNA from natural resources by known synthetic methods, such as, for example, the phosphotriester method. See, eg, Oligonucleotide Synthesis (M, Gaited., 1984, IRL Press). A synthetic oligonucleotide may be prepared using a commercially available automatic oligonucleotide synthesizer. A synthetic oligonucleotide encoding the transducing protein may be inserted into a variety of suitable vectors (eg, a TAT vector) and expressed in a suitable host cell. See Ausubel et al. And Sambrook et al. Below.

[0156] As discussed, the components of the fusion protein can be linked in several ways. In one embodiment, the transduction domain of the fusion protein is operably linked to a cytotoxic domain (sometimes referred to herein as "CD"). As also discussed, the function of the cytotoxic domain in this example is to produce a cytotoxin that can kill or damage infected cells under certain conditions. The cytotoxic domain is transduced into cells as part of the fusion protein and is specifically intended to be released from the fusion protein in the presence of one or more specific proteases induced by pathogen infection. I have. In some cases, release of the cytotoxin involves further processing or maturation of the host cell. A preferred method of operatively linking the transduction domain and the cytotoxic domain is to use a nucleic acid sequence encoding the same ligand to form together an in-frame genetic fusion protein.

As noted above, the present invention is compatible with various cytotoxic domains. Preferred cytotoxic domains include potential toxic molecules such as known zymogens. In general, most zymogens show poor catalytic activity. However, once activated by protein modification, and especially proteolysis at one or more protease cleavage sites, the zymogen is converted to the mature enzyme. In instances where the transformation (maturation) involves proteolysis, the cleavage occurs at a site specific to the zymogen. The fragment released from the zymogen itself has catalytic activity, and the release may further advance the immature enzyme to a lesser or fully mature form. Zymogens containing such fragments are often called autocatalytic enzymes. However, in other cases, the fragments lack sufficient catalytic activity and must be cleaved to form the mature enzyme. Particular catalytic fragments may be naturally associated with the zymogen, or may be added recombinantly to the zymogen in accordance with conventional techniques to form a heterogeneous enzyme. The natural protease cleavage site in a zymogen usually serves to partition subunits within the zymogen. These can be replaced or added according to the methods discussed herein.

Particular zymogens for use in accordance with the present invention include those associated with apoptosis, especially cysteinyl aspartate-specific proteinase (caspase) and, in particular, caspase-3 (CPP32, apopain, Yama ),
Caspase-5 (ICErel-III, TY), Caspase-4 (ICEre
1-II TX, ICH-2), caspase-1 (ICE), caspase-7 (
Mch3, ICE-LAP3, CMH-1), caspase-6 (Mch2), caspase-8 (MACH, FLICE, Mch5), caspase-10 (Mch
4), caspase-2 (ICH-1), caspase-9 (ICH-LAP6, M
ch6) and their catalytically active fragments which are relatively inactive zymogen fragments.

In particular, activation of caspase-3 (Casp3) has previously been shown to be a rubicon of apoptosis by cleavage of inhibitors of caspase-activating DNAse (ICAD), activation and final activation of CAD. Eventually causes cell death. For example, Sa
lvesen GS et al. Caspases: Intracellular signaling through proteolysis
(Cell, 91: 443, 1997), Henkart, PA ICE family proteases: mediators of any apoptotic cell death? (Immunity 4: 195, 1996), Co
hen, GM, Caspase: a killer of apoptosis (J. Biochem., 326: 1, 1997)
Woo, M., et al., Essential contribution of caspase 3 / Casp3 to apoptosis and nuclear changes associated therewith (Gene & Deve., 12: 806, 1998), Enari, M., et.
al., Caspase-activating DNase and its inhibitor, which degrade DNA during apoptosis (Nature, 391: 43, 1998); Liu, X., et al., DFF40 demonstrate DNA fragmentation and chromatin during apoptosis. Acad. Sc is induced.
i. USA 15: 8461, 1998). In addition, activation of Casp3 results in inactive C
It catalyzes the activation of asp3, thereby further amplifying the apoptotic signal.

The structure of Casp3 zymogen is known to include an N-terminal Pro domain, followed by a caspase cleavage recognition site, then a p17 domain containing the catalytic Cys residue, a second caspase cleavage site, and finally a p12 domain. (See FIG. 16). The zymogen form of Casp3 remains inactive; however, during apoptotic signaling, it is cleaved by upstream caspases such as caspase-8 in T cells, losing the Pro domain, and active p17: This results in a p12 heterodimer. See Woo, M. et al. (Supra).

Example 12 below describes the specific inactivation of the HIV virus replication apparatus to treat HIV infected cells. The strategy utilizes HIV protease to kill infected cells, while leaving uninfected cells intact. As described more fully in Example 12, a modified caspase-3 protein, TAT-Casp3, was generated. This fusion protein transduces infected and uninfected cells by -100%. However, due to the replacement of the endogenous degradation site for the HIV proteolytic site, TAT-Casp3 is specifically activated only by HIV protease in infected cells, resulting in apoptosis, whereas in uninfected cells, it is the inactive zymogen. It remains in form. Ratner, L. et al., AIDS virus, HT
See the complete nucleotide sequence of LV-III (Nature, 313: 277, 1985). By replacement of the proteolytic cleavage site, this strategy allows the hepatitis C virus,
It is applicable to other pathogens that encode specific proteases, such as cytomegalovirus and malaria. Rice, CM, Flaviviridae: Virus and its replication (Fields Virology [eds. Fields, BN, Knipe, DM, & Ho
wley, PM] pp. 931-960 [Lipponcott ~ Raven Publishers, Philadelph
ia], 1996); Welch, AR et al., Herpesvirus Mutant Protease, Assembin: Identification of Its Gene, Putative Active Site Domain and Cleavage Site,
Natl. Acad. Sci. USA 88: 10792 (1991); Francis, SE et al., Malaria parasite, hemoglobin metabolism in Plasmodium falciparum, Ann. Rev. Mic.
robiol., 51:97 (1997).

For disclosure of the complete nucleotide sequence of the AIDS virus, see Ratner, L. et al.
See also al. (1985) (supra). Won for disclosure on treating HIV infection
g, J.K (1997) Science 278: 1291 and Finzi, D. et al. (1997) Science 278:
See also 1295. See the following references for more specific information relating to the structure and function of the HIV virus. Wu, X. et al. ENBO J. (1997) 16: 5113; Lillehoj, E.
P. et al. (1998); Kohl, NE et al. (1998) PNAS (USA) 85: 4686; Gottling
er, HG et al., (1989) PNAS (USA) 86: 5781.

In particular, Example 12 shows the generation of a transducible, modified pro-apoptotic caspase-3 protein (ie, TAT-Casp3) that replaces the HIV proteolytic cleavage site for an endogenous site. Further, the fusion molecule efficiently transduces ~ 100% of the cells, but remains inactive in uninfected cells. In HIV infected cells, TAT-Casp3 is activated by HIV protease and becomes apoptotic in infected cells. As will be apparent from the accompanying examples and discussions, this specific strategy is generally applicable and is compatible with other pathogens encoding specific proteases such as hepatitis C virus, cytomegalovirus and malaria. Can be used to fight.

A further preferred zymogen is granzyme B.

A further preferred zymogen is Bid. The Bid protein has been reported to be a 20 kD protein related to the Bcl2 / Bax family of apoptosis regulating proteins. Luo et al. (1998) Cell 94: 481; Li et a
l. (1998) Cell 94: 491; see Wang et al. (1996) Gene & Dev., (1996) 10: 2859. Mouse Bid sequence is GenBank accession number U75506; NID:
g1669513. See Example 11.

As mentioned above, it has been found that mass action enhances the activity of certain embodiments of the anti-pathogen system. More specifically, often very low doses (ie,
It is believed that it is possible to administer the anti-pathogen system at the nanomolar level). This feature can be particularly advantageous because it can increase the tolerance of cells (and patients) to the anti-pathogen system.

More specifically, cleavage of the cytotoxic domain appears to further attract the fusion molecule to infected cells, thereby producing a particular concentration of cytotoxic domain and cytotoxin within such infected cells. . The concentration may be particularly important for some cytotoxins, especially those that require high concentrations for optimal effect. Illustrative examples of such cytotoxins include the zymogens of hemagglutinating proteases such as thrombin and fibrin; trypsin, chymotrypsin, diphtheria toxin, ricin, shiga toxin, abrin, cholera toxin, saponin, pseudomonas exotoxin (PE) , Pokeweed antiviral proteins, and those obtained from gelonin. Additional examples include biologically active fragments of diphtheria toxin A chain and ricin A chain.

Even more preferred are cytotoxic domains that include proteins and, in particular, certain kinases associated with necrosis and enzymes such as nucleoside deaminase. Such enzymes include thymidine kinases, such as HIV thymidine kinase, and cytosine deaminase, and their respective catalytically active fragments.

Further preferred zymogens include those active on the surface of cells infected with a pathogen such as a phospholipase enzyme, especially phospholipase C.

Preferred zymogens and enzymes are capable of killing cells as determined by a suitable assay for cell viability, eg, trypan blue exclusion. More preferred zymogens and enzymes are about 5, 10, as determined by standard methods.
It has a molecular weight between 20, 30, 10, 50 kD and 100-500 kD or more. SDS-PAGE gel electrophoresis. The molecular weight can be measured by a number of conventional methods, such as centrifugation and column chromatography.

Particularly preferred zymogens are caspase-3 (CPP32, apopain, Yama
a) or a catalytically active fragment thereof. See Examples 5-6 below. Another particularly preferred enzyme is HSV-1 thymidine kinase or a catalytically active fragment thereof. See Example 8 below.

In general, the preparation of fusion proteins of the invention includes, for example, polymerase chain amplification reaction (PCR), preparation of plasmid DNA, cleavage of DNA with restriction enzymes, preparation of oligonucleotides, ligation of DNA, isolation of mRNA, Conventional recombination steps include introducing the DNA into suitable cells and culturing the cells. In addition, fusion molecules can be isolated and purified using chaotropic agents and well-known electrophoresis, centrifugation and chromatography methods. In general, see the molecular cloning of Sambrook et al: Laboratory Manual (Second Edition, 1989) for a disclosure related to such methods and the modern protocol in molecular biology of Ausubel et al (John Wiley & Sons, New York, 1989).

Table 1 below provides pathogen-specific proteases and protease cleavage sites for a number of known pathogens. The protease cleavage sites listed are examples of those that can be used in accordance with the present invention.

[0174]

[Table 1]

The disclosure of Gluzman, IY et al., J. Clin. Inv, which is incorporated by reference.
est., 94: 1602 (1994); Grakoui, A. et al., J. of Virol., 67: 2832 (1993).
Koiykholov, AA et al., J. of Virol., 68: 7525 (1994); and Barrie, K. A .;
See also et al., Virology 219: 407 (1996). Additional pathogen-specific proteases and specific cleavage sites have been described and can be used in accordance with the present anti-pathogen system.

For example, HIV-1 mature proteases and protease cleavage sites have been described. Hall, MR and W. Gibson, Vir, disclosures incorporated by reference.
ology, 227: 160 (1997).

In addition, two aspartic proteinases, referred to as plasmepsins I and II, have been found in the digestive vacuole of P. falciparum. Corresponding proteinase cleavage sites are also disclosed. For example, Moon, RP, Eur. J. Biochem.,
224: 552 (1997). Any of the above-cited protease cleavage sites is desired, as long as the site is specifically cleaved by the pathogen-specific protease as intended (eg,
It is well recognized that such modifications can be made by site-directed mutagenesis. In some cases, it may be useful to determine the minimum sequence required for specific proteolytic cleavage, for example, to optimize size and spatial considerations for the fusion protein. Such minimal sequences have been reported for a number of pathogen-specific protease cleavage sites. Other methods include mutagenesis,
In particular, by deletion analysis and site-directed mutagenesis, the minimum sequence for the desired protein cleavage site can be readily obtained. As described below, the modified cleavage site can be easily measured by a conventional protease cleavage assay.

By the term “specifically cleaved”, a peptide bond at a specific protease cleavage site is specifically broken (ie, hydrolyzed) by one or more proteases induced by a pathogen infection. ). That is, the protease cleavage site is not destroyed by proteases that occur naturally in infected and uninfected cells as proteases that are basically required for cell survival. The specific cleavage of such a protease cleavage site is based on S
It can be monitored by various techniques, including DS-PAGE polyacrylamide gel electrophoresis.

A preferred pathogen-specific cleavage site includes the HIV-1 protease cleavage site p17
To p24 (SQVSQNY--PIVQNLQ; SEQ ID NO: 9), p
7 to p1 (CTERQN--FLGKIWP; SEQ ID NO: 10) and pr-RT (IGCTLNF--PISPIET; SEQ ID NO: 11)
Is mentioned. See Table 1 above and Examples below.

Particularly preferred fusion proteins include 1) a minimal TAT sequence / p17-p24 or a TAT such as a protease-RT cleavage site / HSVTK or a suitable one thereof, operably linked in sequence (N-terminal to C-terminal). 2) minimal TAT sequence / protease-RT cleavage site / large domain of CPP32 / p17-p24
A cleavage site and a TAT such as a small subunit of CPP32 or a suitable transducing fragment thereof; 3) a minimal TAT sequence / p17-p24 or a protease-RT cleavage site / and a TAT such as p16 wild-type or a variant thereof or a TAT thereof. Suitable transducing fragments; and 4) minimal TAT sequence / (p7-p1) protease alteration site / HIV
TAT, such as a protease, or a suitable transducing fragment thereof.

As mentioned above, it has been found that utilization of the present anti-pathogen system is facilitated by providing the fusion protein in a misfolded form. For example, when used in accordance with the present anti-pathogen system, native fusion proteins have been shown to transduce much less efficiently than the corresponding misfolded sequences. Therefore, it is generally preferred that the fusion protein be completely or partially denatured prior to use in the present anti-pathogen system. Methods for fully or partially denaturing proteins are well known and include urea, especially about 6-8 M urea, β-mercaptoethanol, DTT, SDS or other detergents, especially ionic detergents such as Treatment with a recognized chaotropic agent may be mentioned. Further contemplated are physical processes that can denature proteins and polypeptides, such as heating or sonication. Also envisioned are methods that include one or more chaotropic agents and physical treatment.

[0182] In a preferred method of the invention, the fusion protein is introduced into a cell as a misfolded fusion protein. As mentioned above, it has been found that the rate and amount of fusion protein uptake into cells is significantly increased when compared to the same fusion protein introduced into the same cell with low energy and an essentially native structure. ing.

The invention further provides nucleic acid sequences, and particularly DNA sequences, encoding the fusion proteins. Preferably, the DNA sequence is carried by a vector adapted for extrachromosomal replication, such as a phage, virus, plasmid, phagemid, cosmid, YAC or episome. In particular, DNA vectors encoding the desired fusion protein can be used to facilitate the preparative methods described herein and to obtain sufficient amounts of the fusion protein. The DNA sequence can be inserted into an appropriate expression vector, that is, a vector containing elements necessary for transcription and translation of the sequence encoding the inserted protein. Various host-vector systems may be used to express the protein-encoding sequence. These include
A virus-infected mammalian cell line; a virus-infected insect cell line (eg,
Microorganisms such as yeast containing baculovirus) yeast vectors, or bacteria transformed with bacteriophage DNA, plasmid DNA or cosmid DNA. Depending on the host-vector system utilized, any one of a number of suitable transcription and translation elements may be used. In general, see Sambrook et al.
See el et al.

In general, preferred DNA vectors according to the invention comprise a first cloning site for the introduction of a first nucleotide sequence encoding a protein transduction domain in the 5 ′ to 3 ′ direction, Includes a nucleotide sequence linked by a phosphodiester bond operably linked to a sequence encoding the domain. Preferably, the encoded cytotoxic domain includes an additional cloning site for those encoding potential toxic molecules such as zymogens. More preferably, the cytotoxic domain includes an additional cloning site for the encoded protease cleavage site.

FIGS. 3-6 depict particularly preferred DNA vectors of the invention. The DNA vector is derived from the pTAT / pTAT-HA vector illustrated in FIG. pT
Preferred nucleic acid linker sequences for use with the AT / pTAT-HA vector are shown in FIG.

In most instances, it is preferred that the components of the fusion protein encoded by the DNA vector be provided in "cassette" format. By the term "cassette" it is meant that each component can be easily replaced by another component by conventional recombinant methods. DNA vectors incorporated in a cassette format are particularly desirable, especially when the encoded fusion protein is to be used against pathogens that have or may have the ability to generate serotypes.

More specifically, it is assumed that the serotype of a particular pathogen may be associated with individual protease cleavage sites specific to that serotype. In this case, one or more existing protease cleavage sites in the DNA vector integrated as a cassette can be replaced by other predetermined protease cleavage sites as needed. Specific protease cleavage sites can be selected to match the presence of the pathogen in an individual patient.

More generally, a DNA vector according to the invention incorporated as a cassette treats mammals and especially humans by providing a means to add or replace components of the fusion protein as needed. Minimize or eliminate the occurrence of serotypes of pathogens during

In particular, with respect to pathogenic viruses such as HIV, by providing a means to replace new HIV proteolytic cleavage sites in the fusion protein, specific strains of the virus and future mutations of the virus may be introduced. Specifically DN to adapt
Integrate the A vector. Such sites can be readily determined in patients by amplification of the polymerase chain reaction (PCR) of DNA obtained from the patient using conventional oligonucleotide primers and sequencing of the DNA across the sites of viral cleavage. Can be. For example, various suitable oligonucleotide primers can be selected for amplification consistent with the published sequence. The new / altered cleavage site may be replaced by a fusion protein, such as pTAT-C described in the Examples below.
Inserted into the PP32 bacterial expression vector, purified the protein, misfolded,
It can then be administered to the patient in a relatively short time frame (about 3-4 weeks).

Significantly, the present anti-pathogen system can also act as an effective “warning system” that can record changes in the serotype of the pathogen in vitro or in vivo. In particular, reduced killing by the anti-pathogen system demonstrates the development of pathogen serotypes. The ability to rapidly detect the emergence of genetically altered pathogen serotypes is particularly relevant for developing rationally-based therapies, for example,
By modifying the fusion proteins described above, and / or
It can be corrected by implementing an approach to cocktails' therapy.

The term “cloning site” is intended to include at least one restriction endonuclease site. Typically, a nucleic acid contains a plurality of different restriction endonuclease sites (eg, a polylinker). Optimal localization of the cloning site in a DNA vector facilitates cassette integration.

The fusion proteins of the present invention can be separated and purified by appropriate combination of known techniques. Such methods include, for example, methods utilizing solubility such as salting out and solvent precipitation, and methods utilizing differences in molecular weight such as dialysis, ultrafiltration, gel filtration and SDS-polyacrylamide gel electrophoresis. A method utilizing a difference in charge such as ion exchange column chromatography, a method utilizing a specific affinity such as affinity chromatography, a method utilizing a difference in hydrophobicity such as reverse phase high performance liquid chromatography, and Isoelectric focusing, a method using a difference in isoelectric point such as a metal affinity column such as Ni-NTA can be used.
For disclosures related to such methods, see Sambrook et al. And Ausubel e, supra.
See t al.

Preferably, the fusion proteins of the invention are substantially pure. That is, the fusion protein preferably has at least 80% or 90% to 95% homogeneity (w / w).
The fusion protein is isolated from the naturally occurring cell replacement as present in For many pharmaceutical, clinical and research applications, fusion proteins with at least 98-99% homogeneity (w / w) are most preferred. For therapeutic applications, the fusion protein once purified should be substantially free of contamination. Once partially or substantially purely purified, the soluble fusion protein can be used therapeutically or in performing in vitro or in vivo assays as disclosed herein. Substantial purity can be determined by various conventional techniques such as chromatography and gel electrophoresis.

As discussed above, the fusion proteins of the invention can be expressed in an insoluble form. Thereby, the proteolytic degradation of the fusion protein can be avoided, the protein yield can be significantly increased, and the delivery of the fusion protein to target cells can be enhanced. Insoluble proteins can be purified by known methods such as affinity chromatography or other methods as detailed above.

As described generally above, host cells can be used for preparative purposes to expand the nucleic acid encoding the desired fusion protein. Thus, a host cell can include a prokaryotic or eukaryotic cell for which fusion protein production is specifically intended. Thus, host cells specifically include yeast, flies, insects, plants, frogs, mammalian cells and organs capable of increasing the nucleic acid encoding the fusion. Non-limiting examples of mammalian cells that can be used include CHO dhfr cells (Urlaub and Chasm, Pr.
oc. Natl. Acad. Sci. USA, 77: 4216, 1980), 293 cells (Graham et al., J.
Gen. Virol., 36:59, 1977) or myeloma cells such as SP2 or NSO (Gal
fre and Milstein, Meth. Enzymol., 73 (B): 3, 1981).

Host cells capable of increasing the nucleic acid encoding the desired fusion protein include insects (eg, Sp. Frugiperda), yeasts (eg, Current Opin of Fleer, R generally).
S. cerevisiae, as outlined in ion in Biotechnology, 3 (5): 486496, 1992,
Non-mammalian cells including S. pombe, P. pastoris, K. lactis, H. polymorpha), fungal and plant cells are also included. Also considered is E. coli.
And certain prokaryotic cells, such as Bacillus.

Nucleic acids encoding the desired fusion proteins can be introduced into host cells by conventional techniques for gene transfer into cells. The terms "transfect" or "transfection" refer to introducing a nucleic acid into a host cell, including calcium phosphate co-precipitation, transfection with DEAE-dextran, lipofection, electroporation, microinjection, viral transduction and / or integration. It is intended to encompass any conventional techniques. Suitable methods for transfecting host cells can be found in Sanbrook et al, supra, and other laboratory textbooks.

The present invention further provides a production process for isolating a fusion protein of interest. In the process, a host cell (eg, a yeast, fungus, insect, bacterial or animal cell) that introduces a nucleic acid encoding a fusion protein of interest operably linked to a regulatory sequence encodes the fusion protein of interest. Proliferate on a production scale in culture medium in the presence of the fusion protein to stimulate transcription of the nucleotide sequence. Subsequently, the fusion protein of interest is isolated from the recovered host cells or culture medium. Conventional protein purification techniques can be used to isolate the fusion protein of interest from the culture medium or harvested host cells. In particular, purification techniques are used to express and purify the desired fusion protein on a large scale (ie, at least milligram quantities) from various tools, including roller bottles, rotating flasks, tissue culture plates, bioreactors, or fermenters. Can be used.

More particularly, various methods can produce misfolded fusion proteins according to the invention. For example, in a preferred method, the desired fusion protein is expressed in suitable bacterial cells and then isolated as inclusion bodies from such cells. After substantially denaturing the fusion protein with a strong chaotropic agent such as about 6-8 M urea, the first column is chromatographed to separate the fusion protein from other bacterial cell components involved. The bound fusion protein is then eluted by conventional means and then dialyzed in a suitable buffer or chromatographed on a second column to remove urea. Such dialysis or chromatography provides a fusion protein with a mixed structure with a minor portion that is a correctly refolded structure with minimal energy. For example, about 25% of the protein is in a low energy folded state. As cited herein, an at least partially denatured fusion protein has a total number of amino acid residues in a substantially pure fusion protein sample, for example, at least about 10,15,
At least a portion of 20, 30, 40, 50, 60, 70, or 75 percent means being in a structure other than the lowest energy refolded structure.

The fusion protein misfolded into a mixed structure can then be transduced into the desired cells. For example, the fusion protein can be added directly to the cultured cells or the medium in which such cells are growing.

Without wishing to be bound by theory, the high energy, denatured forms of the fusion proteins of the present invention incorporate low energy structures that can more easily transduce cells of interest. It is considered possible. In contrast, proteins with properly folded structures are necessarily in a low energy state and cannot take up relatively high energy and thus unstable structures that are more easily introduced into cells.

[0202] As mentioned above, the invention is thus a method of treating pathogen infections, such as viral infections and diseases associated with the virus, wherein the method generally comprises treating one or more fusion proteins therapeutically. It comprises administering to a mammal, especially a human, suffering from or susceptible to a pathogen infection in large amounts.

For example, the fusion proteins of the invention are useful for treating cells infected with a virus capable of causing an immunodeficiency disorder, especially in humans. The fusion proteins are useful for treating retroviral infection in cells and cells of humans, especially HIV-infected humans. Specific examples of retroviral infections that may be treated according to the invention include HIV-1, HIV-2, and human T-cell lymphotropic virus (HTLV) infections such as HTLV-I or HTLV-II. Retroviral infection of humans.

The invention also relates to influenza, including influenza A and B, and for example, herpes simplex virus, including herpes simplex type 1 and 2 virus (HSV1, HSV2), herpes zoster virus (VZV; herpes zoster), human herpes. Virus 6, cytomegalovirus (CMV), Epstein Barr virus (EBV)
Diseases caused by or otherwise associated with viruses of the herpes family, such as herpes virus infection, and other herpes virus infections, such as feline herpes virus infection, and associated with hepatitis viruses, including hepatitis C (HCV). Also provided are methods of treating the disease. Examples of clinical symptoms caused by such viruses include herpetic keratitis, herpetic encephalitis, herpes (simple), especially in patients with immunodeficiency, including kidney and bone marrow transplant patients and patients with acquired immunodeficiency syndrome (AIDS). Herpes) and genital infections (due to herpes simplex), varicella and shingles (due to herpes zoster) and CMV pneumonia and retinitis. Epstein-Barr virus can cause infectious monocytosis and has also been suggested as a cause of nasopharyngeal carcinoma, immunoblastic lymphoma and Burkitt lymphoma.

It is contemplated that pathogens may exist in a highly toxic, latent or attenuated form. Also, populations of pathogens containing a mixture of these forms have been considered. Examples of particular pathogens of interest include, for example, CMV, HSV
-1, HCV, especially viruses such as HCV type C, HIV-1, HIV-2, KSH, yellow fever virus, certain flaviviruses and rhinoviruses.
Furthermore, the pathogen may be malaria or P. falciparum, P. vivax, P. ovale, or P. ma
It can be anything that is capable of causing a medical condition related to the same as lariae. Typically, malaria parasites cause malaria and various medical complications associated with malaria. The invention can be used to treat an existing condition, or can be used prophylactically to prevent infection by one or more pathogens.

The anti-pathogen systems of the invention and especially the fusion proteins can be administered to cells in vivo or in vitro by a single strategy or a combination of strategies. For example, as described above, primary cells or cells are cultured in vitro, typically by conventional cell culture methods, including contacting the cells with the fusion protein and transducing the fusion protein through the cells for a specified period of time. The fusion protein can be administered to immortalized cells growing at Typically, the medium is removed from the cells prior to contacting to increase the concentration of the fusion protein.

In addition, the fusion protein can be administered to the cells in vivo, for example, using a specific delivery mechanism suitable for introducing the fusion protein into such cells. In general, the type of delivery mechanism chosen will be guided by considerations including the location of the cells, the degree of transduction needed to kill the cells infected with the pathogen, and the general health of the cells.

In particular, the fusion proteins of the invention can be administered orally, topically (including transdermal, buccal, or sublingual).
Can also be administered to mammals, especially primates such as humans, using a variety of suitable routes, including intranasal, nasal, and parenteral (including intraperitoneal, subcutaneous, intravenous, intradermal, or intramuscular injection). Good. In general, Remington's Pharmaceutical Science (Mack Pub. Co.
, Eaton, PA, 1980). Nasal or oral routes that result in sufficient contact are considered one or more fusion proteins to be generally preferred along with airway epithelium, lung tissue.

The fusion proteins of the invention can be used as the sole active agent and in combination with one or more fusion proteins provided herein, or AZT, ddI, dd
Reverse transcriptase inhibitors such as dideoxynucleosides, including C, 3TC, FTC, DAPD, 1592U89 or CS92; Ro3-3335 and Ro24-74
Antagonists such as 29; and 9- (2-hydroxyethoxymethyl) guanine (
Acyclovir), ganciclovir or penicyclovir, in combination with other drugs such as interferons such as alpha-interferon or other agents such as interleukins, or other immunomodulatory agents including bone marrow transplantation or lymphocyte transplantation or It can be administered with other agents, such as levamisole or thymosin, which increase the number and / or function of lymphocytes accordingly.

Additional drugs that can be administered with one or more fusion proteins of the invention include Goodman, G. et al. (1993) The Pharmacological Basis of The
rapeutics, 8th edition, (McGraw ~ Hill Inc) pages 978-998. Preferred antimalarial agents include
Chloroquine, chloroganidine, pyrimethamine, mefloquine, primaquinine and quinine are mentioned.

[0211] Administering two or more of the above-cited substances, including fusion proteins of the invention, comprises:
Examples of "cocktail" or "cocktail" therapy. One or more fusion proteins of the invention may be administered by itself, but may be administered by conventional excipients, preferably pharmaceutically acceptable organic compounds generally suitable for oral or nasal delivery, as described above. Or they may be present as part of a pharmaceutical composition in admixture with an inorganic carrier material. However, it may be possible to combine the fusion protein with a vehicle that is suitable for other modes of administration, i.e., parenteral, oral, or other administration, does not adversely react with the fusion protein, and is not harmful to the recipient. is there. Suitable pharmaceutically acceptable carriers include water, saline, alcohol, vegetable oils, polyethylene glycol, gelatin, lactose, amylose, magnesium stearate,
Examples include, but are not limited to, talc, silicic acid, viscous paraffin, aromatic oils, fatty acid monoglycerides and diglycerides, petroleum ether fatty acid esters, hydroxymethylcellulose, polyvinylpyrrolidone, and the like. The pharmaceutical compositions can be sterilized and, if desired, do not deleteriously react with the fusion protein, e.g., lubricants, preservatives, stabilizers, humectants, emulsifiers, salts to affect osmotic pressure,
It can be mixed with adjuvants such as buffers, colorants, flavors and / or fragrances.

For parenteral application, particularly suitable are solutions, preferably oily or aqueous solutions as well as suspensions, emulsions or implants, including suppositories. Ampules are a convenient unit dosage.

Particularly suitable for enteral administration are tablets, dragees or capsules having talc and / or a saccharide carrier binder and the like, wherein the carrier is preferably lactose and / or corn starch and / or Or potato starch. Syrups, elixirs and the like using sweet excipients can be used. Suitable release compositions can be formulated, including those in which the active ingredient is protected by a specifically degrading coating, for example, by microencapsulation, multi-coating, and the like.

The therapeutic fusion proteins of the invention can also be incorporated into liposomes. Incorporation can be performed by well-known liposome preparation methods, such as sonication and extrusion.

[0215] The actual preferred amount of active fusion protein used in a given treatment will precisely depend on the particular fusion protein utilized, the particular anti-pathogen system established, the method of application, the particular site of administration and the like. Will be recognized. Optimal dosing rates for a given dosing protocol can be readily ascertained by one skilled in the art using conventional dosage assays performed with respect to the above guidelines.

Generally, for the treatment of a pathogen infection, eg, a viral infection such as an HIV infection,
An appropriate effective amount of more than one fusion protein is 1 kg body weight of the recipient individual per day.
0.01 to 100 mg / kg, preferably 0.1 to 50 mg / kg body weight of recipient individual per day, more preferably 1 to 20 mg / kg body weight of recipient individual per day Is within. The desired dose is 1
It is suitably administered once daily, or in several divided doses, for example in 2 to 5 divided doses, at appropriate intervals during the day or on a suitable schedule. As already pointed out, the preferred mode of administration is by spraying, in particular nasal or oral.

Another aspect of the present invention relates to a kit comprising the components of the antipathogenic system of the present invention.
Such kits can be used to kill or damage cells infected by one or more previously identified pathogens. In one embodiment, the kit comprises at least two container means, a first container means comprising one or more of the fusion proteins of the invention and an optional second container means comprising a recombinant vector encoding said fusion protein. It has a carrier means that is held in a sealed form inside. To use the antipathogenic system provided using the components of the kit, the fusion protein is administered to the cells in vitro or in vivo based on the methods described above.

The present invention is widely applicable to a variety of situations where killing or damaging cells infected by a single pathogen or a combination of multiple pathogens is required. In addition to the specific uses described above, the present invention relates to plants, such as those found in cells from other mammals such as primates and livestock, including certain birds, dogs, cats, horses, sheep, cattle and the like. It is also applicable to study the pathogen transmission mechanism of eukaryotic cells, such as cells of insect, insect or animal origin.

In another aspect of the invention, an anti-pathogenic system can be used in screening candidate compounds for their ability to inhibit certain proteins, particularly pathogen-specific proteases, in infected cells. In particular, as a preferred screening method, a strong therapeutic ability to transduce an anti-pathogen into a desired cell, preferably a cultured cell including an immortalized or primary cell, infect the cell with the pathogen, and inhibit a pathogen-specific protease And testing the cells for resistance to pathogens, for example, by performing a conventional cell viability assay.

Assays generally determine the effect of a compound of interest on cells, for example, the resulting phenotype, by comparison to a reference control. In addition, candidate compounds can be added before, after, or during transduction of cells with the anti-pathogen system.

The reference control can be a cell before the fusion protein has been introduced, a cell not having the fusion protein introduced, or a cell that is non-functional, eg, does not have a non-functional transcriptionally active region. . Before, after, or during the administration of the compound, one or more defined pathogens can be added to the cells.

The candidate compounds of interest include, for example, cytokines, tumor suppressors, antibodies, receptors, muteins, fragments, or portions of those proteins,
It is also an active RNA molecule such as an antisense RNA molecule or a ribozyme, or one of several molecules including a drug substance. For example, known HIV RT such as AZT
Combinatorial libraries consisting of derivatives of inhibitors can be easily tested by this method. Preferred compounds according to the present invention reduce at least about 40%, 50%, 60%, 70%, preferably at least about 80% of dead cells as assayed by standard cell viability assays such as the trypan blue elimination test. %, Even more preferably at least 90% or more.

A preferred method for screening candidate compounds for a therapeutic ability to inhibit a pathogen-specific protease comprises the following steps. a) transducing a group of cells with the fusion protein of the present invention, infecting the cells with a pathogen capable of expressing or inducing a pathogen-specific protease; Contacting with a pathogen-specific protease, and c) correlating any cytoxin effect with the therapeutic potential of the candidate compound to alter the pathogen-specific protease. Protein transduction domains include TAT, antennapedia homeo domain,
HSV VP22, suitable fragments thereof, or non-naturally occurring sequences capable of transducing. Cytotoxic domains can include, for example, caspases and one or more protease cleavage sites.

The DNA and protein sequences described herein can be obtained from a variety of commonly known sources, including those specifically mentioned; preferred sources are Nation
al Library of Medicine (located at 38A, 8N05, Rockville Pike, Bethesda, MD
20894) National Center for Biotechnology Information (NCBI) ~ Genet
ic Sequence Data Bank (Genbank). Genbank is also on the Internet (ht
tp: //www.ncbi.nlm.nih.gov), and for details on Genbank, refer mainly to Benson, DA et al., Nucl. Acids. Res., 25: l (1997). Please.

[0225] Other reagents used in the examples, such as antibodies, cells, and viruses, may be obtained from recognized private or public sources, such as Linscott's Directory (40 Glen Drive).
, Mill Valley California 94941) and the American Type Culture Collection (
ATCC) (located at 12301 Parklawn Drive, Rockvill, Md 20852). All documents mentioned herein are hereby incorporated by reference.

The following examples further illustrate the invention. These examples are provided to aid the understanding of the present invention and are not to be construed as limiting the invention.

Example 1 Production of TAT Fusion Protein Expression Vector A preferred plasmid for TAT fusion protein expression was prepared as follows. FIG. 1 shows a map of the plasmid. FIG. 2 shows the pTAT-HA linker nucleic acid sequence (SEQ ID NO: 14) and amino acid sequence (SEQ ID NO: 15) together with pTAT-HA linker.
Figure 4 shows the nucleic acid sequence (SEQ ID NO: 12) and amino acid sequence (SEQ ID NO: 13) of the AT linker.

The pTAT and pTAT-HA (tag) bacterial expression vectors comprise an 11 amino acid TAT domain flanked by glycine residues to allow free binding rotation of the TAT domain (G-RKKKRRQRRR-G) (SEQ ID NO: 16). Is inserted into the BamHI site of pRSET-A. The polylinker converts the second oligonucleotide to NcoI-
By inserting into the NcoI site (5 'or N') containing the KpnI-Agel-XhoI-SphI-EcoRI cloning site and the EcoRI site, the TA
A C-terminus is added to the T domain (see FIG. 1). After this, BstBI-Hi
The remaining original polylinker of the pRET-A plasmid containing the ndIII site follows.

The oligonucleotide encoding the HA tag flanked by glycine (YPYDVPDYA; SEQ ID NO: 17; see FIG. 2 (sequence in bold)) was identified as pTA
The pTAT-HA plasmid was created by insertion into the NcoI site of T. The 5 'or N' NcoI site is inactivated and only 3 'or C' is HA tag,
It was subsequently treated with the polylinker described above. The HA tag allows detection of the fusion protein by immunoblotting, immunoprecipitation, or immunohistochemistry using a 12CA5 anti-HA antibody.

The nucleotides and amino acids of each linker are shown in FIG. The pRSET-A backbone encodes ampicillin resistance, fl, ori, ColE1 ori (plasmid replication), and transcription is driven by the T7 RNA polymerase promoter.

Example 2-Misfolded TAT fusion protein The TAT fusion protein described below was purified from host cells and intentionally misfolded to improve transduction. That is, the transfected BL21 (DE3) pLysS cells (Novagen) obtained from a 1-liter culture solution for 5 hours were subjected to ultrasonic treatment to purify the fusion protein. 10 ml of buffer A (8 M urea / 20 mM HEPES (pH 7.2 (100 mM NaCl)) was added to the culture solution.
Was inoculated with 100 ml from a culture solution cultured overnight. Cell lysates were separated by centrifugation and Ni-NAT using buffer A supplemented with 20 mM imidazole.
Loaded on column (Qiagen). Next, the column was washed with 10 times the column volume, elution was carried out by increasing the concentration of imidazole contained in buffer A (stepwise), and 4M urea / 20 mM HEPES (pH 7.2 (50 mM NaCl
)) Was applied to a Mono-Q column. The TAT fusion protein was converted to 1M Na
Elution with Cl step, PBS or 20 mM HEPES [pH 7.2] / 13
It was desalted on a PD-10 desalting column (Pharmacia) using 7 mM NaCl, and further frozen at −80 ° C. in 10% glycerol. The FITC-labeled TAT fusion protein was obtained by performing fluorescein labeling (Pierce) and then performing gel purification using PBS on an S-12 column attached to FPLC (Pharmacia).

Example 3 Production of TATp16 Fusion Protein TA with HIV Protease Cleavage Site (p17-p24 or p7-p1)
The Tp16 fusion protein was synthesized based on the following method. A. Preparation of pTAT- (HIV cleavage site) construct This plasmid was made by inserting a double-stranded oligomer encoding the p17-p14 and p7-p1 HIV cleavage sites into the NcoI site of pTAT and pTAT-HA. . The cleavage site consists of 14 amino acids and each end of the HIV cleavage site consists of 7 amino acids.

P17-p24 site (57 mer), positive strand: 5 ′ CAT GTC AGG CTC CCA GGT GTC ACA GAA CTA TCC AAT CGT GCA GAA CCT GCA
GGG CGC 3 ′ (SEQ ID NO: 18) p7-p1 HIV cleavage site (60 mer), positive strand: 5 ′ CAT GCA TTC AGG CTG CAC CGA ACG CCA GGG TAA CTT CCT GGG CAA AAT CTG
GCC AGG CGC 3 '(SEQ ID NO: 19)

The HIV cleavage site p17-p24 (SEQ ID NO: 18) or p7-p1 (SEQ ID NO :)
Was fused (3 ′ to PTD site) with the pTAT vector described in Example 1 to produce a pTAT-HIV1 or pTAT-HIV2 vector, respectively. The pTAT-HIV1,2 vector is used, for example, in FIGS.
The parent vector of the construct shown in Table 1 was used. The cDNA sequence of p16 protein was replaced with p17-
Fusion to the p24 HIV cleavage site produced the in-frame TAT-p16 fusion protein cDNA (FIG. 5). A second p16 fusion protein was made by fusing the p16 cDNA to the pTAT-HIV2 vector. The order of the components of each vector construct (from the N 'end to the C' end) is HIS-TAT-
PTD-cleavage site-p16-protein, "cleavage site" is p17-p24
Alternatively, p7-p1 cleavage sites are indicated. The fusion protein was purified and misfolded according to the method described in Example 2 above.
The TAT-p16 cDNA vector was grown in DH5-α bacteria.

The purified p16 fusion proteins were individually transfected into HIV infected Jurkat T cells. Methods for infecting Jurkat T cells with HIV and transducing fusion proteins are described in the Examples that follow. After 4, 8 and 12 hours, commercial anti-P1
Cells are analyzed for cleavage of the fusion protein by Western immunoblot using Antibody 6 (Santa Cruz). As a control, to construct the vector (HIV protease cleavage site) shown in FIG.
It was fused to an AT vector. The vector encoding the p16 fusion protein was fused to uncleaved TAT in infected cells. However, a valid disconnect is
Nothing was observed with the p16 fusion protein encoded by the vector shown in FIG. 5 containing the HIV cleavage site.

Example 4-Detection of p16 fusion protein in transduced cells To determine if the fusion protein could remain in the cell cytosol of HIV infected cells, the TAT-produced in Example 3 was used. HIV1,2p1
The 6 fusion proteins were purified and FITC labeled as described above. Next, based on Example 6 below, about 35-45 nanomolar of the labeled fusion protein was added to
NLHX staining) and uninfected Jurkat T cells. Then the transduced Jur
Kat T cells were analyzed by FACS. All (100%) of the cells in the mixed group of HIV infected / uninfected cells were 1,2,2 after the addition of the FITC binding fusion protein.
Transduced at 4, 8, and 16 hours. However, if the cells were washed with fresh medium and the PTD was eliminated from the cells by a concentration gradient (currently high inside and zero outside), the infected cells retained the cleaved substrate (p16 portion), The uninfected control group lost all of the transduced protein as determined by the continuous presence of FITC-labeled p16 as analyzed by FACS (it was transduced).

Example 5 TAT-CPP32 Fusion Protein Human CPP32 cDNA (Alnemri et al., J. Biol. Chem., 269: 30761 (19
94); Genbank Accession No. U13737) was generated by separately PCR-treating the CPP32 p17 and p12 domains (ie, performing a polymerase chain amplification (PCR) step), adding the DNA fragments together, and using external PCR primers. PCR treatment. An outline of the protocol is shown in FIG. This is called the double PCR cloning method and is a general methodological approach of joining two separate DNA fragments together, as described below.

CPP32 using A (+ strand) and B (-strand) primers (see below)
The p17 domain of the cDNA and the p12 domain were PCR treated with B (+ strand) and C (-strand) primers. The A primer encodes a p17-p1 HIV cleavage site in frame with the CPP32p17 domain coding sequence, and
Primers encode the p17-p24 HIV cleavage site. This first PCR
Thereafter, the two purified fragments were mixed and subjected to PCR using only the A (+ strand) and C (-strand) primers. The 3 'end of the p17 PCR processing domain is p12
Due to having the (-) strand at the 5 'end of the PCR treatment domain, the two DNA fragments form a base pair. After this PCR, the obtained DNA fragment was
A digest of about 900 bp was generated by digesting the 'end with XhoI and the 3' end with EcoRI. This fragment was cloned into the XhoI and EcoRI sites of the pTAT and pTAT-HA plasmids. As already outlined, the protein, TAT-CPP32 wild type, was produced in PL2I (DE3) cells.

A (+ strand) primer, (90 mer): 5 ′ CGC CTC GAG GGC GGC TGC ACC GAA CGC CAG GCT AAC TTC CTG GGC AAA ATC
TGG CCA GGC GGA ATA TCC CTG GAC AAC AGT TAT AAA ATG 3 '(SEQ ID NO: 20
) B (+ strand) primer, (72 mer): 5 'GGC GGC TCC CAG GTG TCA CAG AAC TAT CCA ATC GTG CAG AAC CTG CAG GGG
GGT GTT GAT GAT GAC ATG GCG 3 ′ (SEQ ID NO: 21) B (−strand) primer, (75 mer): 5 ′ ACC GCC CTG CAG GTT CTG CAC GAT TGG ATA GTT CTG TGA CAC CTG GGA GCC
GCC TGT CTC AAT GCC ACA GTC CAG 3 '(SEQ ID NO: 22) C (-strand) primer, (37 mer): 5' CGA GCT ACG CGA ATT CTT AGT GAT AAA AAT AGA GTT C 3 '(SEQ ID NO: 2)
3)

The order of the components of the resulting construct (from N ′ end to C ′ end) is HI
S-TAT-PTD-HIV2-CPP32 to HIV1 subunit-CPP
There were 32 small subunits. HIS-TAT-PTD-HIV2-CP
Each of the vectors encoding the large subunit of the P32-HIV-small subunit of the CPP32 cDNA fusion protein grew in DH5-α bacteria. The large subunit of HIS-TAT-PTD-HIV2-CPP32-HIV1-the small subunit of the CPP32 fusion protein is referred to as "TAT-CPP32
".

Example 6 Specific Cell Killing by TAT-CPP32 Fusion Protein To demonstrate that the TAT-CPP32 fusion protein produced in Example 5 has the ability to kill HIV infected cells, a fusion protein was generated. Example 2
Labeled in a form detectable by FITC as described in. Labeled T
The AT-CPP32 fusion protein was tested in the following manner. 5 × 10 6 Jurkat T cells were transformed with HIV (NLHX strain, 1 × 10 5 per ml).
１1 × 10 6 infectious virus). Cells were grown in RPMI medium. Approximately 4-7 days after infection, the culture was removed from the plates and 35-45 nanomolar TAT-CPP32 fusion protein was added to the cells. Transduction of the cells was performed by incubating the cells with the fusion protein for about 30 minutes. Using FACS analysis, it was found that about 100% of the cells were transduced by the fusion protein. The culture was then returned to the plate and cell killing approximately 18 hours after transduction was examined using conventional trypan blue extraction and microscopy. It was found that almost all of the infected cells were killed by TAT-CPP32. This result is significant. This is because it indicates that the TAT-CPP32 fusion protein specifically kills HIV-infected cells but does not kill uninfected cells in that group.

Example 7-Inhibition of TAT CPP32 Lethal Activity Administration of HIV Protease Inhibitors To demonstrate that the TAT-CPP32 fusion protein killed HIV-infected Jurkat T cells by a mechanism that required specific introduction of HIV protease, protease inhibition of infected cells after introduction of the fusion protein was performed. The agent ritonavir (Abbott) was added. That is, the cells were infected and transduced as described in Example 6 above. After transduction, about 1 μg / ml of ritonavir was added to the cell culture and the cells were incubated for about 18 hours. The cells were then assayed for cell killing using conventional trypan blue extraction and microscopy. It has been found that administration of ritonavir basically inhibits the ability of TAT-CPP32 to cause killing of infected cells. Thus, killing of HIV infected cells by the TAT-CPP32 fusion protein requires active HIV protease.

[0243] 2. Mutation of the CPP32 fusion protein (TAT-CPP32 mutant C163M). Cysteine was inactivated by mutating it to methionine. That is, the TAT-CPP32 molecule prepared in Example 5 was mutated in order to change the catalytically active Cys residue (163rd position) of the active site to Met by site-directed mutagenesis. The following double-stranded oligomer nucleotides were replaced with p17 of TAT-CPP32.
And the StuI site (in the p17 domain at the 5 'end of the inserted sequence) at the p17-p24 HIV cleavage site between the p12 and p12 domains. The duplex oligomer has a blunt end at the StuI 5 'site and PstI 3'
It has a 3 'overhang at the end.

Positive strand oligo (85 mer): 5 'CCA TGC GTG CTA CCG AAC TGG ACT GTG GCA TTG AGA CAG GCG GCT CCC AGG
TGT CAC AGA ACT ATC CAA TCG TGC AGA ACC TGC A 3 '(SEQ ID NO: 24) (bold letters indicate codon changes from Cys to Met).

To indicate the mutated catalytic Cys residue at position 163 of the CPP32 fusion protein, the fusion protein was labeled “TAT-CPP32mut” or “TAT-CPP”.
32 mutants ". The TAT-CPP32mut fusion protein was purified and transduced into HIV infected Jurkat T cells as described above in Example 6. The finding was that the fusion protein was unable to kill HIV infected cells. In contrast, the results of Example 6 show that the TAT-CPP32 fusion protein (wild-type catalytic Cys residue) specifically killed HIV-infected Jurkat cells.

It has been observed that the activity of caspases, especially CPP32, induces apoptosis, which is known in the art as the “return point”.
The results are consistent with this recognition. The results indicate that the TAT-CPP32 fusion protein specifically kills HIV-infected cells, probably by causing apoptosis. In particular, the released CPP32 molecule appears to initiate apoptosis only in infected cells by activating endogenous caspases by cleavage and by cleavage of specific substrates such as PARP.

In order to cleave and process viral polyproteins such as gag and gag-pol for maturation as part of the HIV infection life cycle, HIV replication generally involves HIV replication.
It is recognized in the art that it requires the presence and specific activity of V protease. HIV infected cells in which HIV is replicated (but not uninfected cells)
The transduction of the HIV lethal molecule against E. coli results in the specific recognition of a modified HIV cleavage site on any of the anti-HIV lethal molecules of the invention, converting it from an inactive protein to an active lethal molecule. However, uninfected cells do not contain HIV-specific protease, so if they were present in inactive cells, they would remain in an inactive form.

[0248] It is not believed to be bound to any particular theory, and anti-H such as TAT-CPP32 molecule
It is believed that cells induced by the IV fusion protein undergo apoptosis, thereby reducing the viral burst of newly encapsulated viral particles. Also, since some proteins, including proteases and RT, are encapsulated inside the virion, any evasion-packed viral particles will 1) kill the particles prior to infection of new cells, and 2) kill newly infected cells. May contain an active anti-HIV lethal molecule capable of inducing apoptosis, and if so, it should occur prior to replication of any viral particles.

Example 8 Specific Cells Killed by TAT-TK Fusion Protein and Production FIG. 7 transduces cells with a fusion protein having TK and then transduces the prodrug (acyclovir (Glaxo Wellcome))
1 shows an outline of a method for killing HIV-infected Jurkat T cells. TK released from the fusion protein converts acyclovir to an active lethal molecule, thereby killing infected cells. However, uninfected (control) cells are not harmed by transduction of the TK fusion protein and administration of acyclovir. The TAT-TK fusion protein was constructed by the following method. HSV-1TK
The sequence was obtained from Genbank (Accession No. J02224). PCR primers corresponding to N 'and C' of TK were generated. After PCR, the DNA fragment was cut with NcoI and EcoRI and inserted into the NcoI and EcoI sites of pTAT- (HIVp17-p24 cleavage site) or pTAT- (HIVp7-p1 cleavage site).

TK forward PCR primer (34 mer): 5 ′ CGG GCC GGC CCC ATG GCT TCG TAC CCC TGC CAT C 3 ′ (SEQ ID NO: 25) TK reverse primer (39 mer): 5 ′ GGC GGG CCG GGA ATT CTC AGT TAG CCT CCC CCA TCT CCC 3 '(SEQ ID NO: 26)

Each of the fusion proteins was purified and misfolded as previously described in Example 2. About 5 × 10 6 Jurkat T cells were transformed with HIV (as described above in Example 6).
NLHX strain). About 4 to 7 days after the infection, the culture medium was removed from the plate, and about 35 to 45 nmol of the TAT-TK fusion protein (p17
-P24 or p7-p1 cleavage site) was added to the cells. Cells were transduced by incubating the cells with the fusion protein for about 30 minutes. F
Using ACS analysis, it was found that about 100% of the cells were transduced by the fusion protein.

The transduced cells were incubated for about 18 hours to allow for the construction of TK cleaved from the TAT-TK fusion protein. After this time, the cells were washed with medium and incubated for a further 4 hours. At this point, about 1 to 100 nanomolar acyclovir was added to the plate. About 3 days later, the infected and uninfected cells were examined for cell killing by conventional trypan blue extraction and microscopy. It was found that almost 100% of the total number of infected cells was killed by administration of the TAT-TK fusion protein and acyclovir.

The results show that TK enzymes were specifically enriched in infected cells. However, in uninfected cells, the TK enzyme was not concentrated, indicating that after washing, the TAT-TK fusion abolished transduction from those cells. Therefore, HSV TK
Is considered to be impossible in normal cells because the prodrug is processed into an active lethal agent only in cells in which the prodrug is retained and infected cells, but not in human / mammal TK. Thus, the results indicate that the TAT-TK fusion protein is an effective HIV lethal molecule. In addition to TK, the HSV cytosine deaminase cDNA can be readily substituted for the TK gene and combined with certain nucleoside analogs known in the art to Causes lethal effect or damage.

The specifically described TAT-TK and TAT-CPP32 fusion proteins can be used to inject HIV-infected patients in an injectable form or preferably via an inhaler for delivery to the lung where it is introduced into the bloodstream. Can be administered. The fusion protein
It will be introduced into all contacted cells (airways and lungs, tissues, blood cells, etc.), including cells infected primarily with HIV, such as certain immune cells in the bloodstream.

Based on experimental and theoretical modeling, it has been reported that the mean half-life of HIV-infected T cells in vivo is about 1.6 days. Thus, a preferred treatment protocol for HIV infected individuals is by injection over a period of several weeks, more preferably by inhalation. The effectiveness of these methods is demonstrated by the well-known procedures for detecting HIV virus particles contained in biological fluids such as blood (eg, PC
It can be monitored by performing R). This process is often known as assessing a patient's viral load. The manipulations can help determine the appropriate dosage of the fusion protein alone or in combination with an anti-HIV agent, such as those already mentioned.

Example 9 Transduction of Uninfected Jurkat T Cells with TAT-HIV Protease HIV infection has been found to be difficult to monitor in vitro and often changes depending on the proportion of infected cells. I have. Also, not all cells that can be infected by a pathogen are infected by the HIV virus. To help overcome these problems and to better understand the induced lethality by the TAT-CPP32 fusion protein, co-transduction experiments were performed with HIV protease fused to TAT. The goal is to target a cell killing molecule (TAT-CPP32
) And a HI for cleaving the first fusion protein
Two types of fusion proteins consisting of a second fusion protein containing V protease (TAT-protease) are co-transfected into non-infected Jurkat T cells. That is, the protease derived from the NLHX strain of HIV was converted to pTAT- (p7-p1
HI transducible by PCR cloning into a vector)
V protease was constructed. PCR primers are synthesized to correspond to the translation termination site and the start ATG (methionine) of the protease. Nc
pTAT- (p7-p) at the oI 5 '/ N' end and the EcoRI site 3 '/ C' end.
One cleavage site) was inserted into the vector. The protein, pTAT- (p7-p1) -protease, was expressed from the plasmid in BL2I (DE3) cells and the protein was purified as previously described. The fusion protein will be referred to as "TAT protease".

To test the activity of TAT-CPP32 by TAT protease, 2x
106 Jurkat T cells were placed in 1 ml of culture medium (RPMI medium). To those cells, various combinations of control and experimental transducible proteins were added in the range of 50-100 nM as follows. 1. Control 2. 2. TAT-protease (50-100 nM) 3. TAT-CPP32 wild type (50-100 nM) 4. TAT-CPP32 mutant (50-100 nM) 5. TAT-CPP32 wild type + TAT protease 6. TAT-CPP32 mutant + TAT protease 7. Ritonavir (HIV protease inhibitor) 8. TAT-CPP32 wild type + ritonavir TAT-CPP32 mutant + ritonavir

Cells were assayed for survival 18 hours after addition by trypan blue exclusion staining microscopy. TAT-protease, TAT-CPP3
2 Wild-type and mutant proteins showed minimal cytotoxicity when added alone. See FIG. 9 and FIG. However, not the mutant but TAT-C
Addition of TAT protease in addition to PP32 wild-type results in substantial loss of viable cells, activation of TAT-CPP32 wild-type protein, and thereby activation of TAT-CPP32 wild-type protein. The addition of a protease inhibitor to this experiment resulted in a reduction in specific TAT-CPP32 wild-type lethality. Thus, activation of TAT-CPP32 requires the presence of HIV protease. Taken together, these observations indicate that activation of the TAT-CPP32 protein is specific only to cells expressing the HIV protease.

Co-transduction methods are generally considered to be applicable for killing or damaging cells that are not normally infected with the HIV virus. Examples of such cells include certain CD4- (minus) immune cells and non-immune cells such as fibroblasts. Further, such methods are readily adapted to include other transducing fusion proteins described herein, such as certain TAT fusion proteins required for administration of prodrugs (eg, TAT-TK and acyclovir). You will understand that.

Example 10-Synthetic transduction domain with enhanced transduction efficiency The following artificial (ie, synthetic) peptides were made by conventional peptide synthesis as described previously. The goal of this experiment was to produce a transduction domain that could be transduced more effectively as judged by the intracellular concentration of the transduced cells. The transduction domain is combined with a suitable control, generally "
Tested against controls that are "native" TAT or Antp. That is, the FITC group was synthetically bound to the 100% N-terminal of each peptide so that the transduction rate and intracellular concentration of each peptide could be quantified in an equilibrium state. The TAT transduction domain is recognized as an alpha helix structure. In each synthetic peptide sequence,
Alpha helices were shaped by varying the amount of Arg on one surface. That is, a series of synthetic polypeptides were designed to contain different amounts of Arg residues on one side and to be replaced by Ala residues. Both Ala and Arg residues have the highest probability of maintaining an alpha helix structure /
Has energetics. See FIGS. 11 and 12 where each peptide is illustrated as a helical wheel. The peptides are shown in Table 2 below.

[0261]

[Table 2]

The synthetic peptide was transduced into Jurkat T cells along the above line of Example 4. As can be seen from Table 2, all of the synthetic peptides were transduced into cells. The data show that the synthetic peptide with the most favorable rate and intracellular peptide concentration was substituted Ala
Alpha helix structure by residue (compared to naturally occurring TAT) had the highest probability. In addition, the best synthetic peptides had Arg residues aligned on a single face of the helix, as suggested by the spiral wheel diagram. See FIGS. 11 and 12. In particular, the modified synthetic peptides represented by SEQ ID NOs: 3 to 8 had about 5 to 10-fold increase in intracellular concentration when compared to naturally occurring TAT (SEQ ID NO: 1).

The data shows that it is possible to design synthetic peptides with increased transduction efficiency compared to TAT. For example, the data show that transduction of naturally occurring TAT by increasing the probability of alpha helical helix formation within the peptide and by aligning at least two Arg residues on a single polypeptide helix surface. This shows that efficiency can be increased. Various fusion amino acids,
For example, to increase the transduction efficiency of a fusion amino acid with 2, 5, 10, 20, 50, and 100 amino acids added to the synthetic polypeptide sequence, the synthetic polypeptide sequence shown in Table 2 can be used. it can. About 10, 15, 20, 30, 5
Synthetic polypeptide sequences can also be fused to protein sequences of 0, or up to about 100, up to about 500 kD, or more. The resulting fusion protein is tested for increased transduction efficiency as described above.

The naturally occurring Antp peptide (SEQ ID NO: 10) generally has a slower transduction rate than the TAT peptide. Accordingly, the synthetic peptides and naturally occurring TATs described above are often preferred for transducing amino acid sequences, particularly large proteins, into cells.

Table 2 shows that synthetic peptide sequences that result in rapid translocation by transduction across cell membranes are increased into cells. The data indicate that those peptides with 1) strong alpha helix properties, 2) at least one face / surface covered with Arg residues have the best transduction domain. Figure 11 below
And 12 show spiral wheel plots showing residue substitutions. All of the synthetic peptides have transduction rates approximating those of TAT (47-57). However, some result in increased intracellular concentrations. Certain polypeptide sequences have at least the face of a helix containing basic residues such as Arg.

Example 11-Killing HIV / Pathogen Infected Cells by Transduction with Modified TAT-Bid Protein The pro-apoptotic protein Bid is an apoptosis regulatory protein, Bcl
2/20 kDa protein associated with the Bax system. Bid is present in the cytoplasmic zymogen (zymogen proform). Activation of cells that undergo apoptosis by signals through receptors such as Fas results in activation of two distinct pro-apoptotic cascades / pathways. Activation of caspase 8 also results in a direct cleavage of cytoplasmic p20 Bid at residue Asp59 (aspartic acid residue # 59 in mouse or Asp60 in human). This results in loss of the 5 kd “pro” domain of Bid and p15 Bi to mitochondria.
Transfer of d occurs, resulting in release of cytochrome c and poisoning of mitochondria and subsequent death. Thus, Bid exists as an inactive proform / zymogen that is specifically activated by proteolytic cleavage, thereby inducing apoptosis via a DNA degradation pathway and a different pathway than caspase 3 (CPP32). .

The transducible TAT-Bid protein adds TAT to the N ′ terminus and
id endogenous caspase cleavage site is removed and replaced with an HIV cleavage site (TAT-p
5 Bid-HIV cleavage-p15 Bid). The goal was to test the effect of the fusion protein on killing HIV-infected cells or cells expressing HIV protease. To make a comparison between the two transducible Bid proteins, TAT-HI
V-cleaved-p15Bid protein can also be synthesized. A summary of the cloning strategy is given below and, like the TAT-CPP32 protein, any pathogen protease cleavage site could be cloned into this lethal protein. In this example, the HIV cleavage site is used as a model system. Also, TAT-B
Killing by id may be more effective than TAT-CPP32 in certain cell types / diseases, or rather, killing infected cells further by co-transduction of both lethal proteins, and In some cases, it may be complementary to TAT-CPP32 so that a synergistic effect is obtained even at a lower concentration.

[0268] 1. Cloning strategy Performing double PCR ensures that the final product is Neo
I (DNA cleavage site)-p5Bid domain-HIV proteolytic cleavage site (
Mouse Bid was PCR amplified by using the following DNA primers that would be the (on the encoded protein) -p15 Bid domain. TAT-HI
V truncation-p15Bid is also described but is under construction. First, the p5 domain is PCR amplified with primers 1F and 2R and another PCR
In the reaction, the p15 domain is PCR amplified with primers 2F and 4R. Those D
The NA fragments are purified, mixed together, and hybridized through the common region present in 2F and 2R present at the 3 'and 5' ends of each DNA fragment. The 3 'fragment of this DNA fragment is extended at the end and the final PCR reaction is performed using primer 1 selected against a DNA fragment of standard length.
Perform using only F and 4R. This is a common cloning method. The standard length fragment is then cloned / ligated into pTAT-HA by cutting at the 5 ′ end with NcoI and at the 3 ′ end with EcoRI. The resulting plasmid, E. coli with pTAT-Bid. coli strain DH5α
Was transformed, followed by E. coli. E. coli strain BL21 (DE3) pLysS was transformed and the protein was purified as outlined for the TAT-CPP32 protein. The resulting protein contains an HIV protease cleavage site between the TAT-p5 and p15 domains, and TAT-p5-HIV-p15Bi.
Called d.

[0269] TAT-HIV was performed as described above except that a single PCR reaction was required.
-P15Bid can be configured. Primer 3F has an NcoI DNA cleavage site followed by an HIV proteolytic cleavage site and contains a DNA sequence homologous to the 5 'end of the p15Bid domain. The DNA fragment generated from the PCR reaction with primers 3F and 4R was
digested with coRI and NcoI and E of pTAT-HA, as already outlined.
Clone into the coRI site.

[0270] 2. Primer: Primer IF (87mer): CGC GCC ATG GGC GGC TCC CAG GTG TCA CA
G AAC TAT CCA ATC GTG CAG AAC CTG CAG GGC GGC GAC TCT GAG GTC AGC AAC GG
T TCC (SEQ ID NO: 27) Primer 2F (52 mer): TTC CTG GGC AAA ATC TGG CCA GGC GGC AG
C CAG GCC AGC CGC TCC TTC AAC C (SEQ ID NO: 28) Primer 2R (46 mer): GTT AGC CTG GCG TTC GGT GCA GCC TGT CT
G CAG CTC GTC TTC GAG G (SEQ ID NO: 29) Primer 3F (88 mer): CGC GCC ATG GGC GGC TGC ACC GAA CGC C
AG GCT AAC TTC CTG GGC AAA ATC TGG CCA GGC GGC AGC CAG GCC AGC CGC TCC T
TC AAC C (SEQ ID NO: 30) Primer 4R (71 mer): CGC GAA TTC TCA GTC AGC ATA GTC TGG GA
G GTC ATA TGG ATA GCC GTC CAT CTC GTT TCT AAC CAA GTT CC (SEQ ID NO: 31)

The above strategy for cloning TAT-p5-HIV-p15 and TAT-HIV-p15 is shown in FIGS.

Example 12 Killing HIV-Infected Cells by Transduction with HIV Protease-Activated Caspase 3 Protein To specifically kill cells infected with the HIV virus, HIV protease-activated caspase 3 protein was generated. The fusion protein was synthesized as follows. First, two residues are deleted from the two endogenous caspase cleavage sites (Asp-Ser), further surrounding the HIVpl7-p24 site ("A" site) and the p7-pl cleavage site ("D" site). By inserting 14 residues, the modified Ca
sp3 was synthesized (FIG. 16). To introduce the modified Casp3 protein into cells, the previously described method of directly transducing cells of standard length protein was used. See the following references. Barrie, KA, et al., Natural variation in HIV ~ 1 protease, gag p7
and p6, and protease cleavage sites within gag / pol polyproteins: amino a
cid substitutions in the absence of protease inhibitors in mother and ch
ildren infected by human immunodeficiency virus type 1.Virology 219: 40
7 (1996); Ezhevsky, SA, et al., Hypo ~ phosphorylation of the retinoblastoma
protein by cyclin D; Cdk4 / 6 complexes results in active pRb. Proc. Natl
Acad. Sci. USA 94: 10699 (1997); Lissy, NA, et al., TCR ~ antigen induced cell death (AID) occurs f.
rom a late G1 phase cell cycle check point.Immunity 8: 57 (1998); Nagahara, H, et al., Highly efficient transduction of full length T
AT fusion proteins directly into mammalian cell; p27kipl mediates cell m
igration.Nature Med. (in press) (1998); Vocero ~ Akbani, A., et al., Transaction of full length TAT fusion pr
oteins directly into mammalian cells: analysis of TCR ~ activation induced
cell death (AID) .In Methods in Enzymology (ed.Read, JC) (Academic
Press San Diego) (in press) (1998)

That is, misfolded fusion proteins produced by bacteria and containing the in-frame N'-terminal protein transduction domain of HIV TAT transduce ~ 100% of all target cell types in a rapid and concentration-dependent manner. Such target cell types include, for example, peripheral blood lymphocytes (PBL), all cells present in whole blood, diploid fibroblasts, fibrosarcoma cells, hepatocellular carcinoma, and leukemia T cells Is mentioned. Ezhevsky, DA et al., Lissy, N.A, et al., Nagahara, H.,
See, et al., and Vocerro-Akbani, A, et al., supra. Modified Casp3
Of TAT-C by removing the prodomain of
The asp3WT fusion protein is obtained (FIG. 16). In addition, catalytically inactive T
The generation of the AT-Casp3 mutein is based on the Casp3 active site Cys63.
This was done by substituting the Met residue for the residue (TAT-Casp3MUT). To test the ability of the TAT-Casp3 protein to transduce cells, the TAT-Casp3 protein was conjugated to fluorescein (FITC) and then added directly to the culture of Jurkat T cells, followed by flow cytometry (FACS). (FIGS. 17 and 18). TAT-Casp3WT and TA
Both T-Casp3MUT proteins rapidly transduced 〜100% of the cells, with maximal intracellular concentrations in less than 20 minutes. Also, based on the narrow peak width before and after the addition of the FITC-labeled protein, individual cells in the group were identified as TAT-Casp3.
-Includes individual approximate intracellular concentrations of FITC protein. Confocal microscopy analysis revealed the presence of TAT-Casp3FITC protein present in both cytoplasmic and nuclear compartments, not just binding to cell membranes.
FACS analysis of transformed cells in equilibrium 1 hour after addition of 3, 6, and 12 nM TAT-Casp3WT-FITC protein showed a concentration dependence of protein transduction (FIG. 20). Thus, the TAT-Casp3 protein is easily transduced to １００100% of the total cells in a rapid and concentration-dependent manner.

To test the concept of HIV protease cleavage of the transformed heterosubstrate, it was synthesized by inserting an HIV proteolytic cleavage site into a previously characterized TAT-p16 fusion protein. Ezhevsky, SA et al., Lissy, N.
See A., et al., And Voccro ~ Akbani, A., et al., Supra. HIV A
When the cleavage site was inserted between the TAT domain and the p16 domain, TAT-
The A-p16 fusion protein was obtained (FIG. 16). In addition, transformable HIV
Protease (TAT-HIVPr) was synthesized. See FIG. FITC
Labeled TAT-A-p16, TAT-16 protein, (Ezhevsky, SA et al.
And Voccro ~ Akbani, A., et al. (Supra), and TAT-HI.
The VPr protein (Figure 19) was found to rapidly transduce ~ 100% of the cells.

Hereinafter, the production and transduction of the TAT fusion protein shown in FIGS. 16 to 20 will be described in more detail. FIG. 16 is a diagram showing an HIV cleavage site sequence and a domain of a TAT fusion protein. FIGS. 17-18 show fluorescein (FITC) labeled TAT-Casp3WT, TAT-Ca added to cells at 0, 20, and 30 minutes.
Figure 4 shows FACS kinetic analysis of sp3MUT and TAT-HIVPr protein. FIG. 20 shows 3, 6, and 12 nM of TAT-Cas added 1 hour after addition.
Figure 5 shows FACS dose analysis of p3Wt-FITC protein. Note the rapid and concentration-dependent FITC-labeled transduction of １００100% of the cells and the intracellular concentrations within the group that are nearly identical as measured by the FACS peaks of the control and transduced cells.

To assay for in vivo cleavage, p16 (−) Jurkat T cells were transformed with 100 cells.
Transduction was performed for 5 hours with nM TAT-Ap16 or control TAT-p16 protein alone (no HIV cleavage site) or in combination with 50 nM ATHIV pr fusion protein. Subsequently, anti-p16 immunoblot analysis for in vitro cleavage at the HIV A proteolytic cleavage site was performed (FIG. 21).
Co-transduction of the TAT-A-p16 protein substrate with TAT-HIVPr induces specific substrate cleavage while the control TAT-p16 protein (HIV
(No cleavage site) was not cleaved. Dimensional analysis of the truncated TAT-A-p16 protein consists of retaining the remaining HIV half-sites present on the N 'end of p16 (FIG. 21, rows 4-5). The HIV A site is the TAT-
It is also noteworthy that the D site containing Dp16 was preferentially cleaved.

Furthermore, the TAT-Casp3MUT protein was transduced into cells in combination with the TAT-HIVPr protein (FIG. 22). TAT-Casp3 and TA
Co-transduction with T-HIVPr allows TAT-Ca at the HIV "A" site between the p17 and p12 domains in an HIV protease-dependent manner.
As a specific cleavage of sp3 is detected, a TAT site-p17-A half site protein is obtained. These observations indicate that transduced TAT-Ap16 and TAT-Casp3 proteins containing a heterologous HIV binding site were
It shows that it can be recognized as a substrate by IV protease.

The in vivo treatment with the co-transduced cells shown in FIGS. 21 and 22 is described in more detail as follows. FIG. Culture of p16 (-) Jurkat T cells was performed with TATHI
Transformed with TAT-p16 or TAT-A-p16 substrate protein in combination with VPr protein. TATA-p16 protein and TAT-H
Co-transduction with the IVPr protein resulted in specific cleavage at the HIV A site. WCE, lysate of whole HepG2 cells is wild-type endogenous p16,
That is, TAT containing A-p16 and retaining the HIV half-site on p16
-The A-16 product was cleaved. FIG. TATCasp3MUT protein (TA
T— “D” site—p17 domain— “A” site—p12 domain) alone or TA
Cultures of Jurkat T cells were transduced in combination with T-HIVPr (Pr) protein as indicated and immunoblotted with anti-caspase 3 antibody specific for the p17 domain. The cleavage product of TAT-D-p17-A, TAT-Casp3 contains an N'-terminal N'-terminal HIV A half-site.

Additionally, the ability of the TAT-Casp3 protein to induce apoptosis in cells co-transduced with the TAT-HIVPr protein was tested. Jurkat
T cells were treated with 100 nM TAT-Casp3WT or TATCasp3MUT protein alone or in combination with 50 mM TAT-HIVPr protein and assayed for cell viability 16 hours after the treatment (FIG. 23).
). The TAT-Casp3WT protein alone transduces cells with low levels of cytotoxicity. However, co-transduction of TAT-Caps3WT with the TATHIVpr protein shows only marginal cytotoxicity and has
No AT-HIV protease cytotoxic effect was also shown. TAT-Cas
Requirement for HIV protease to activate p3 protein To further illustrate, cells were first pretreated with the HIV protease inhibitor ritonavir (1 μg / ml) followed by TAT-Casp3WT or TAT-Casp.
3MUT and TAT-HIVPr protein were co-transduced (FIG. 23). Pretreatment of cells with ritonavir protects against the cytotoxic effects of TAT-Casp3WT when co-transformed with TAT-HIVPr protein. T
Kinetic analysis of AT-Casp3-dependent cell death is shown by a primary lethal curve with cell death detected as early as day 4 after transduction (F.11B). These results indicate that cytotoxicity occurs only in the presence of the catalytically active TAT-Casp3WT protein, and activation of TAT-Casp3WT specifically requires an HIV protease having the TAT-Casp3 HIV protein cleavage activity (FIG. 2
2). Salvensen, GS, et al., Henkart, PA, Cohen., G, M., Moo, M., e
See t al., Enari, M. et al., Liu, X ,, et al., supra.

Hereinafter, TAT-Cas in the co-transduced cells shown in FIGS. 11A and 11B
The activation of p3 and the induction of apoptosis will be described in detail. FIG. 11A. Culture of Jurkat T cells was performed using TAT-Casp3WT (WT), TAT-Casp3MUT (MU
Transduction was performed for 16 hours in combination with T) and TAT-HIV protease (Pr) protein and cell viability was analyzed. Co-transduction of TAT-Casp3WT with TAT-HIVPr protein results in specific cytotoxicity. On the other hand, transduction of TAT-Casp3MUT by TAT-HIVPr does not occur. The inclusion of ritonavir (Rit), an inhibitor of the HIV protease, blocks active TAT-Casp3WT protein and further protects cells from cytotoxic effects. FIG. 11B. Culture of Jurkat T cells by TAT-Cas
p3WT (WT), TA in combination with TAT-HIVPr (Pr) protein
Co-transduction with T-Casp3 MUT (MUT) protein was performed and the kinetics of cell viability was analyzed as previously indicated.

In addition, transduced cultures were degraded using Genome D using the TUNEL assay.
Tested for NA. Coates, PJ, Molecular methods for the identific
ation of apoptosis in tissues. See J. Histotechnology 17: 261 (1994). 100 nM TAT-Casp3WT, 100 nM TAT-casp3
Transduction of cells with MUT or 50 nM TAT-HIVPr protein alone shows only the background intensity of TUNEL-positive cells (FIG. 25). But,
Cotransduction of TAT-Casp3WT and TAT-HIVPr protein significantly increases TUNEL-positive cells. TAT-Casp3MUT and TAT
-Co-transduction with HIV protein shows only background intensity of TUNEL positive cells (Figure 25). Activation of TAT-Casp3 is also assayed by its ability to cleave an artificial casper3 substrate. Jurkat T cells are 100m
M TAT-Casp3WT or TAT-CaspMUT protein alone,
Alternatively, transduction for 6 hours in combination with 50 mM TAT-HIV Pr protein and further release of fluorescein AFC (FIG. 26) by DEVD
-Assayed for AFC increase. Xiang, J. et al., Bax ~ induced cell de
ath may not require interleukin 1B ~ converting enzyme ~ like process.Proc
., Natl., Acad. Sci. USA 93: 14550 (1996). Consistent with the above results for TUNEL, co-transduction of TAT-Casp3WT and TAT-HIVPr proteins into cells results in a greater increase in caspase activity than αFAS.

The HIV protease activates the TAT-Casp3WT protein shown in FIGS. 25 and 26, details of which are inserted below. FIG. Co-transduction of Jurkat T cell cultures with TAT-Casp3WT (WT) and TAT-HIVPr (Pr) proteins resulted in specific TUNEL-positive cells and apoptosis end markers. However, TAT-Casp3MUT (MUT)
In combination with TAT-HIVPr protein, or TAT-Cas
Single transduction with p3WT, TAT-Casp3MUT, or TAT-HIVPr protein remained at the background intensity of TUNEL-positive cells. Horizontal axis: TUNEL-positive cells per high-power microscope field; control of PBS addition to Ctrl medium; error bars represent SD. FIG. Transduction of TAT-Casp3WT in combination with TAT-HIV protease results in specific activity of caspase-3 as measured by DEVDAFC cleavage and by AFC fluorescence reported as enzyme activity. Ctr, PBS addition control; ocFAS crosslink, positive control.

TAT-Casp3WT, TAT-Casp3MUT, or TAT-HIVP
Transduction with r alone showed only background intensity of caspase activity. Also, the appearance of cells with DNA content <2N was detected in TAT-Casp3 and TA-HIVPr co-transduced cells, and standard features of caspase 3 induced apoptosis in contrast to necrosis. See Woo, M, et al. (Supra). These observations indicate that the transduced TAT-Casp3WT protein remains inactive in cells lacking HIV protease, but in cells harboring active HIV protease with prominent features leading to apoptosis and ultimately death. It becomes specifically activated.

The absence of a general animal model for HIV suggests that TATCas
It is of interest to determine whether the p3WT protein can kill cells infected by live HIV in culture. To make such a determination, Jurkat T cells were recruited to HIV for 7-14 days.
-I was infected with the NLHX strain, and the effects of HIV on cytopathology were examined using a microscope. Westervelt, P. et al., Identification of a determinant withi
n the HIV ~ I surface envelope glycoprotein critical for productive infect
Proc. Natl. Acad. Sci. USA 88: 3097 (ion of cultured primary monocytes.
(1991). At the start of each transduction experiment, approximately 50% of the culture is HI
V-positive. The HIV-infected culture was subjected to 100 mM TAT-Casp3WT or T
Transduction with ATCasp3MUT protein was performed for 16 hours, after which cell viability was examined (FIG. 27). Treatment of HIV infected cells with the TAT-Casp3WT protein significantly reduced HIV positive cells from the culture. We also detected the appearance of cells with a DNA content <2N and the appearance of reduced nuclei in TAT-Casp3 treated cells. However, transduction of the TATCasp3MUT protein had only negligible effects.

To determine whether TAT-Casp3WT-induced apoptosis was dependent on active HIV protease in infected cultures, HIV-infected cultures were incubated for 1 hour.
1 μg prior to transduction with 00nM TAT-Casp3WT protein
HIV-infected cultures were pretreated with ritonavir / ml (FIG. 8). Consistent with the above experiment, pretreatment of the HIV-infected culture with ritonavir resulted in TAT-Casp.
3WT-induced apoptosis could be prevented. It was also observed that the viability of ritonavir-treated cells was increased, which was due to the protease inhibitor-treated H
Consistent with increased life span of IV infected cells. Coffin, JM, et al. (Supra). These observations indicate that TAT-Casp3WT with active HIV protease
Shows that the HIV-infected cells were specifically killed by the protein,
This shows that apoptosis is not induced in cells lacking protease activity.

The specific killing of HIV-infected cells shown in FIG. 8 is described in detail below. Jurkat T cells were infected with the HIV strain NLHX for 7-10 days, followed by TAT-C
1 for asp3WT (WT) or TAT-Casp3MUT (MUT) protein
Transduction was performed for 6 hours and assayed for cell viability.
The TAT-Casp3WT protein efficiently kills most HIV-positive cells in a single dose. At this time, the catalytically inactive TAT-Casp3MUT protein has no effect. Pretreatment of HIV infected cells with the HIV protease inhibitor ritonavir (Rit) protects infected cells from killing by TAT-Casp3WT protein. Ctrl, controls addition of PBS to culture; horizontal axis, viability of group of HIV-positive cells at the start of transduction; error bar representing SD.

This example describes a novel strategy for killing HIV infected cells. Importantly, this strategy combined with a protein transduction delivery system,
Utilizing a modified precursor of Casp3 is to utilize an HIV-encoding protease. The results show that transduction of the protein into the cells is a rapid and concentration-dependent process targeting ~ 100% of the cells. Importantly, the TAT-Casp3 protein remains inactive in uninfected cells,
Specifically activated by HIV protease-dependent cleavage in HIV-infected cells. Due to this degree of specificity, killing HIV-infected cells with such a strategy can result in a high therapeutic index for the patient.

As already mentioned, current treatments for HIV infected cells with protease inhibitors increase the lifespan of infected cells. Compared to treatment with protease inhibitors, TAT-Casp3 protein specifically kills HIV infected cells.
Also, the selection of mutants that provide HIV proteases that are resistant to a wide range of inhibitors is a continuing and growing problem in fighting HIV epidemics. However, by replacing the HIV cleavage site, in the approach provided in this example and elsewhere in this disclosure, the TAT-Casp3 protein contiguous to the diversity and / or mutation of the HIV strain proteolytic cleavage site Enables adaptability.

The TAT-Casp3 proteins described herein can be used to combat other pathogens by engineering the protein to have a protease cleavage site specific for the relevant pathogen.

The following method was used in this example. 1. Cell culture-p16 (-) Jurkat T cells (ATCC) were expanded as described. See Lissy, NA et al. (Supra). For in vivo substrate cleavage, 1 × 10 6 cells were treated with 100 nM TAT-p16, TAT-A-p16,
Transduced for 1, 5, or 8 hours as indicated by AT-Casp3MUT and / or 50 nM TAT-HIV Pr protein, and anti-p16 (Sa
nta Cruz) or anti-Casp3 (Pharmingen) immunoblot analysis. See Ezhevsky, SA et al., Supra. TAT- for uninfected cells
For Casp3 cytotoxicity, 1 × 10 6 cells were treated with 100 nM TAT-Cas.
p3WT, TAT-Casp3MUT, and / or 50 nM TAT-HI
Transduced with V Pr protein for 16 hours and excluded trypan blue and / or
Alternatively, viability was assayed by genomic DNA damage by TUNEL assay (Trevigen). The number of TUNEL positive cells reported per high power microscopy field was averaged over 4 fields per experiment. TAT-Casp3 activity was increased by 20 μl
g of whole cell lysate and incubation with 50 μM DEVD-AFC and fluorescent AFC formation was measured on a FL500 microplate fluorescence reader (Bio-Tek) as described. See Xiang, J. et al., Supra. Cells were transfected with 1 μg / ml Ritonavir (Abbott Lab) prior to transduction.
Incubated for 1 hour in s). TAT-Cas for infected cells
For p3 cytotoxicity, Jurkat cultures were infected with 100 ng p24 Ag equivalent of the NLHX HIV-1 strain for 7-14 days, assayed microscopically for cytopathic effects, then repeated at 1 x 106 / ml and repeated at 100 nM. TAT-
Transduction with Casp3WT or TAT-Casp3MUT protein for 16 hours followed by exclusion dye viability assay. Infected cells were treated with TAT-Ca
1 μg / ml Ritonavir prior to transduction with sp3WT protein
For 24 hours. See Xiang, J. et al., Supra. For flow cytometry (FACS) analysis, fluorescein (FITC) -conjugated TAT fusion protein was added to Jurkat T cell culture medium and 1 x 104 cells were analyzed by FACS as described. See Ezhevsky, SA et al., Supra.

[0291] 2. TAT fusion protein-pTAT-A / D-p16 expression vector
p17-p24 ("A") cleavage site (single amino acid code: SQVSQNY-
PIVQNLQ SEQ ID NO: 9) or HIV p7-p1 (“D”) cleavage site (
A double-stranded oligomer nucleic acid encoding 14 residues of CTERQAN-FLGKIWP; SEQ ID NO: 10) was constructed by inserting it into the NcoI site of pTAT-p16. Ratner, L. et al., Welch, AR et al., Nagahara, H. et al., And Vocero ~ Akba
See ni, A et al., supra. The pTAT-Casp3WT vector was ligated with a primer (p17 forward primer: 5′-CGCCTCGAGGGCGGCTGCACCGAACGCCAGGCTAACTTCCTGGGCAAAATCTGGCCAGGCGGAATA
TCCCTGGACAACAGTTATAAAATG ~ 3 '(SEQ ID NO: 32); p17 reverse primer: 5' ~ CCGCCCTGCAGGTTCTGCACGATTGGATAGTTCTGTGACACCTGGGAGCCGCCTGT CTCAATGCCACAGTCCAG 3 '(SEQ ID NO: 33);
TGGCG 3 ′ (SEQ ID NO: 34); p12 reverse primer: 5 ′ to CGAGCTACGCGAATTCTTAGTGATAAATAATAGAGTTC 3 ′ (SEQ ID NO: 35) The PCR products were then mixed and constructed by PCR amplification using p17 forward and p12 reverse primers (p17 reverse and p12 forward primer sequences overlap). The resulting PCR fragment was subcloned into pTAT-HA2324 to obtain the TAT-D-p17-A-p12 conformation (see FIGS. 25 and 26). pTAT-Casp3MUT vector was converted to a double-stranded oligomer nucleotide (positive strand: 5'CCATGCGTGGTACCGAACTGGACTGTGGCATTGAGACAGGCGGCTCCCAGGTGTCACAGAACTATCCA
ATCGTGCAGAACCTGCA ~ 3 '(SEQ ID NO: 36) Contains Met residue in place of active site Cys' 63 residue) by TAT-Cas
It was constructed by insertion into the StuI and PstI sites of the p3WT vector.

The pTAT-HIV Pr vector was obtained by PCR cloning the HIV protease gene from the HXBR HIV strain (forward primer: 5′CGGTCCATGGGCGGCGGCCCTCAGGTCACTCTTTGGCAACG 3 ′ (SEQ ID NO: 37); reverse primer: 5′CGGGAATTCTCAAAAATTTAAAGTGCAACCAATCTG-3 ′ 38)), and was constructed by cloning into pTAT2324. Briefly,
BL21 (DE3) pLysS (Novagen) that highly expresses the TAT fusion protein
) Was purified by sonication in 8 M urea, purified on a Ni-NTA column, and misfolded on a Mono S column as described in 2324. FITC-conjugated TAT fusion proteins were generated by fluorescein isothiocyanate labeling (Pierce) and then FPLC (Pharmacia) or PD
Gel purification in PBS on an S-12 column attached to a -10 desalting column (Pharmacia) was then added directly to cells in cell culture medium and analyzed by FACS or microscopy.

Example 13 Generation and Testing of Class II Synthetic Transduction Domains A synthetic transduction domain that requires a strong α-helical structure with a face of arginine residues below the helical cylinder (now a class I synthetic trait) In the course of further investigation of the transduction domain), an apparent second class of transduction domain (termed class II) was discovered. Class II synthetic transduction domains also require base residues such as arginine or lysine (but preferably arginine), but the introduction of kinks in the secondary structure due to the inclusion of proline residues,
These are distinguished from Class I domains. The following is a class II synthetic transduction domain and HIV TAT 47-
6 are six examples of relative transduction abilities compared to 57, using the one letter amino acid code.

[0294]

[Table 3]

Example 14 Killing Prostate Cancer Cells by Transducing Killer Proteins The above for transducible killer proteins that target cells that affect cells based on the specificity of the pathogen encoded by a particular protease The methods and embodiments of the present invention are also applicable to human diseases. That is, any human disease that involves the differential expression of a cellular protease in a diseased cell type and non-cellularly can be exploited to specifically kill the cell. In addition, other cell properties may be exploited for certain cell types, such as those containing high levels of heavy metals. One good example is prostate cells that express certain cellular proteases, such as prostate specific antigen (PSA), and at 1000 times the level of the heavy metal zinc compared to other parts of the human body. There are prostate cells that contain Importantly, both of these attributes are persistent in prostate cancer cells. Further, as a model system, the physical function of the prostate may not be required after the patient has been given a child. Thus, all prostate cells, whether malignant or not, can be excised from the patient's body without loss of the patient's viability.

PSA is a subfamily member of the kallikrein family of cellular proteases (see “Lilja, et al., 1985” and “Wat et al.
Watt, et al)) has a chymotrypsin-type substrate specificity that distinguishes it from other members of the kallikrein family, like chymotrypsin and trypsin ("Christensen et al."). "as well as"
Lilja et al., 1989 "). PSA is specifically synthesized by prostate cells and secreted into the prostate lumen. The function of PSA is Sg
Cleavage of gel-forming proteins present in semen such as I and II (see Lilja, et al., 1985). Compared to the sequence-specific cleavage of PSA to chymotrypsin, the sequence "HSSKLQ" (amino acid single letter code) has been elucidated as a site directly cleaved by PSA (cleaved after the Q residue). Is not cleaved by (
Denmeade et al.).

For tight cell-cell junctions in the prostate, P
SA is never leaked into the bloodstream or detected. However, during rapid growth of the prostate tumor, the binding is loose and PSA is present in the bloodstream.
Will be released at low levels. In addition, metastasis of prostate tumor cells may result in additional release and detection of PSA in the bloodstream.
In utilizing pathogen-specific proteases to identify and kill infected cells, PSA is (1) specifically expressed in malignant prostate cells, and (2) specific substrate specificity. Sex or cleavage sites. Thus, P
SA is a good example of a human disease that can be targeted by a transducible killing protein.

The design of PSA-activating transducible killing molecules can take several forms, as is possible with pathogen-activating killing molecules (see examples above). First, PSA present in excretory vesicles can be used to activate zymogens that have been transduced intracellularly into the killer as outlined above. The extracellular PSA can then be used to transduce the closest cells, eg, prostate cells, and activate zymogens that lead to apoptosis.

“Example of PSA Activated by Transducable Killing Protein”

PSA-Bid-TAT Structure: p5 Bid-PSA Cleavage-p15 Bid-TAT STD Transduction Domain Cleavage by PSA will result in cells if activated extracellularly by PSA.
Alternatively, if activated to PSA intracellularly, it will produce an active p15 protein in the cytoplasm outside of the excretory parcel that is still capable of transduction. Where S
TD is a synthetic transduction domain.

PSA-Caspase3-TAT Structure: TAT / STD-p17 Casp3-PSA cleavage-p12 Casp
Cleavage by the 3-TAT / STD PSA results in the assembly of activity, both p17 and p12 domains, transducing into the nearest cell or out of the excretory parcel, p17: p12 caspase-3.
Heterodimer-induced apoptosis will result. Retention of the transduction domain in both the p17 and p12 subunits will cause these subunits to transduce cells independently after cleavage by PSA.

TAT-HSV TK-PSA Structure: TAT / STD-UB-HSV TK-PSA Cleavage-TK Repression Domain Cleavage by PSA still allows transduction of the enzyme into the cytoplasm of cells as outlined above. Meanwhile, the C-terminal repression domain is removed. The cleavage between the transduction domain (TAT / STD) -ubiquitin motif and HSV TK by a second constitutive cellular protease such as ubiquitin protease 1 (UBP-1) It will specifically retain HSV TK in prostate cells. The addition of a prodrug such as acyclovir for HSV TK causes the captured HSV TK to specifically progress to a cytotoxic form and render it inactive to other cells in the body. leave.

Another example of this type of strategy involves competing for transduction domains to kill orders of subunits, which will further generate PSA activating molecules.

[0304] Other methods for utilizing the characteristics of cells include the following examples. TAT / STD-17 Casp3-E71 TfF domain plus TAT /
STD-p12 Casp6-E7 / TfF domain In addition, more than 1000 times the amount of zinc in prostate cells can be removed by transduction of an inactive protein, which dimerizes, due to such activity. Requires high concentrations of zinc. Examples such as these include cellular transcription factors (TxF
) And the dimerization domain of the HPV E7 protein. The Caspase-3 p17 and p12 domains are E7
Alternatively, it can be engineered to have a terminal tag for the TxF dimerization domain.
The essential dimerization of transduced Caspase-3 p17 and p12 subunits is via coordination of E7 / T via the above described threshold concentration of zinc.
Depends on xF domain dimerization. Therefore, induction of apoptosis only occurs when the E7 / TfF domain is dimerized by zinc. Such transducible killing molecules are therefore specifically activated only in cells containing high concentrations of zinc, such as prostate cells.

Another example of this type of strategy is the incorporation of cell type characteristics.
As with pe specific properties), involves scrambling for transduction domains and killing subunit orders.

The following documents are cited in this example. Lilja et al, 1985. J. Clin. Invest. 76: 1899-1903. Watt et al. 1986. PNAS 83: 31663170. Christensson et al. 1990. JBC 194: 755-765. Lilja et al. 1997. Cancer Res. 4924-4930. Denmeade et al. 1997. Cancer Res. 4924-4930.

Example 15 Specific Killing of Tumor Cells by Transduction of p53 Protein and Repair of p53 Function As is well documented in the literature, tumors containing the wild-type p53 tumor suppressor protein were mutant p53 Show significantly better response to conventional anti-cancer therapies such as radiation and chemotherapy than tumors containing (Low et al). Thus, p53 status is currently the sole and most obvious determinant of patient outcome after treatment. Thus, the unnecessary introduction of wild-type p53 restores the sensitivity of these tumors to traditional anti-cancer therapies and, while important,
The anticancer therapy needed to kill the tumor cells would be significantly reduced. This is an undeniable advantage for patients by avoiding intensive anticancer therapies that nonspecifically even kill the patient's normal cells. In addition, due to the continuous level of DNA damage present in p53 mutant / minus tumors, the introduction of wild-type p53 can be dramatically reduced without and / or without anticancer therapy. Level (below the threshold)
It can cause apoptosis well.

To solve this problem, we introduced some transducible p53
The method used was previously described in the literature (Nagahara et al, 1998; Vocero-Akbani et al., 1999). We have previously expressed recombinant fusion proteins in bacteria having N 'and C' terminal protein transduction domains (PTDs) in cells in vitro and in all tissues in vivo. They have shown that cells can be rapidly transduced, including blood vessels and brain barriers (Scwarze et al.).
al., 1999). Human p53 has a 393 amino acid sequence (aa) length,
-CDNA encoded in the entire open reading frame (ORF) cloned in HA (Figure 28), extended to TATp53WT. Furthermore, the last 30aa is a negative regulatory domain that sterically blocks a DNA binding domain (DBD) because it is in contact with DNA (refs. 1-4). Therefore, TATp53, 1-36
4 uses standard molecular biology techniques to convert ORFs 1-364 of p53aa into pT
It was raised by cloning into AT-HA. Plasmids encoding TAT-p53WT and 1-364 proteins of TAT-p53 were BL
21 (DE3) LysS cells, and the fusion protein was purified using a 6 × HIS reader at the N ′ end of the fusion protein as described by Nagahara et al., 1998. Was done. However, some important differences from the standard procedure were required to purify the TAT-p53 protein (FIGS. 29 and 30). First, bacterial cells were sonicated in PBS, and the insoluble recombinant TAT-p53 protein was fragmented by centrifugation. A small piece of this sample was 6 M-GuHCl / 20 mM-HEPES / 100 m
Resuspended in M-NaCl and sonicated again. This is TAT-
This process is performed because the binding of the p53 protein to the Ni-NTA column with 8 M urea is weak. Importantly, the first step of PBS sonication was to determine whether soluble TAT-p53 was soluble in cellular proteins and soluble
It also means removing proteins. Thus, the two sonication steps dramatically increase highly purified full-length protein.

The TAT-p53 1-364 proteins were expressed in 2 × 10 ⁵ human Julkat leukemia T cells and 2.5 × 10 ⁵ normal human diploid fibroblasts at a final concentration of 50, 100, and 200 nM at 0 and Added for 24 hours. At 200 nM final concentration, one negative control only for the addition of PBS, the other was TAT-Bid.
MUT protein was included as a control for non-specific protein transduction effects. These cells were assayed for cell viability by trypan blue exclusion staining at the first application 48 hours after addition (FIG. 32). 1 of TAT-p53
Increasing the concentration of the 364 protein resulted in TAT-p53 1-3 with minimal toxicity.
Normal cells treated the 64 protein while causing specific cell death of tumor cells. In addition, negative controls for TAT-Bid MUT protein showed only background levels of toxicity.

[0310] These data show that while the remaining normal cells were not damaged, only 48
Demonstrates that reconstitution of p53 function by transduction of the TAT-p53 protein over time causes specific apoptosis (cell death) of tumor cells. Increasing the length of time that tumor fat is exposed to the TAT-p53 protein will likely increase the percentage killing of tumor cells.

In addition, additional anti-cell cycle tumors, such as TAT-p16 or TAT-p27, that have been recombined with a TAT-p53 protein.
Transduction of the suppressor protein will likely be synthesized to further increase killing. Still further, the TAT-p53 protein with the addition of conventional small molecule chemotherapeutic agents that damage DNA also causes p53 to further synergize.

Example 16 Inadequacy in Tumor Cells by Cdk Inhibitor
Cell cycle inhibitors specifically induce apoptosis (cell death) in tumor cells.₀Starting from the cell cycle from (static), G ₀ Going back to the cell cycle. But the tumor cells continue to divide virtually
(See Sherr, 1996). Therefore, improper Cdk inhibitors such as
Applying a transducible protein in which a cell cycle inhibitor is manifested
Can cause collisions in tumor cells leading to lysis. But normal cells
It can be said that we are accustomed to such anxiety. Jurkat leukemia T cells are 0
And 24 hours, TAT-p16 (Ezhevsky et al., 1997), TAT-p27 (N
agahara et al., 1998), and TAT-Cdk2-DN (dominant-negative
200 nM transducible Cdk inhibitor such as Nagahaea et al., 1998).
48 hours after addition of the first application by trypan blue exclusion staining
Cell viability was assayed (FIGS. 33 and 34). TAT-p27 is a tumor cell
Caused> 70% specific cell death. On the other hand, TAT-Cdk2DN is 60
% And TAT-p16 killed 40%. To control these proteins
, Normal diploid cell fibroblasts produced less than 5% toxicity. These observations
The result is that normal cells are resistant, whereas apoptosis-mediated suppressed cell cycle
Indicates that it can respond to

Example 17 Killing of tumor cells by transduction of a low molecular weight protein that binds specifically to cyclin-dependent kinases (Cdks) and non-specifically to other unknown proteins. Peptidyl mimet
ics) can be more responsive to cell cycle arrest caused by transduction. Normal cells and N-terminal PTD followed by glycine and 20 amino acids of p16 (84-1
Treatment of non-tumorigenic immortalized cells with a transducable protein containing residue 03: 5'-DAAREGFLATLVVLHRAGAR-3 '(SEQ ID NO: 42) retains low concentrations (<100 μM) At times, it causes G1 cell cycle arrest (see Gius et al., 1999). However, 250 and 500 μM of TAT-p16 protein at 0 and 24 hours on Jurkat leukemia T cells
High dose treatment such as caused> 99% of patent pending apoptosis (cell death) at 48 hours as measured by trypan blue exclusion staining (FIG. 35).
See). Importantly, the negative control of normal diploid cell fibroblasts (FIG. 35) and immortalized keratinocytes were arrested in the G1 state and showed less than 2% cytotoxicity (not shown). These results indicate that transduction of a region of the p16 ^INK4a tumor suppressor protein causes specific cell death of cells without damaging non-tumorigenic cells.

The following documents are cited in Examples 15 to 17. Hupp et al., Cell 71, 875-886 (1992) .Halazonetis et al., EMBO J 12, 10211028 (1993) .Waterman et al., Embo J 14, 512-519 (1995) .Wieczorek et al., Nature Medicine 2, 1143-1146 (1996) .Nagahara et al., Nature Medicine 4: 1449-1452 (1998) .Vocero-Akbani, A. et al., Nature Medicine, Jan. '99 5: 29-33 ( Gius et al., Cancer Research 59: 2577-2580 (1999) .Ezhevsky et al., Proc. Natl. Acad. Sci. USA 94: 10699-10704 (1997).

The present invention has been described in detail with reference to its preferred embodiments. However, it will be understood that modifications and improvements can be made by those skilled in the art, in light of the present disclosure, within the spirit and scope of the invention.

[Brief description of the drawings]

FIG. 1 is a plasmid map of pTAT / pTAT-HA.

FIG. 2 shows the nucleotide and amino acid sequences of the pTAT linker and the pTAT HA linker. The minimum TAT area is bold. The underlined sequence illustrates the minimal TAT region flanked by glycine residues.

FIG. 3 shows a TAT-HSV TK fusion protein vector among exemplary DNA vectors according to the present invention based on the pTAT / pTAT-HA plasmid. HIS indicated by a square is 6 × HIS tag, protein transduction region (
PTD), HIV protease-RT cleavage site (HIV1), herpes simplex virus thymidine kinase (HSV TK), large caspase-3 region (Lg), small caspase-3 region (Sm), HIV p17-p24 protease cleavage site (H
IV2), selective addition of p16 (mutant or wild-type p16 protein). Describe the approximate molecular weight of the vector.

FIG. 4 shows a TAT-caspase-3 fusion protein vector among exemplary DNA vectors according to the present invention based on the pTAT / pTAT-HA plasmid. HIS shown in squares are 6 × HIS tag, protein transduction region (PTD), HIV protease-RT cleavage site (HIV1), herpes simplex virus thymidine kinase (HSV TK), large caspase-3 region (Lg), small Caspase-3 region (Sm), HIV p17-p24 protease cleavage site (
HIV2), selective addition of p16 (mutant or wild-type p16 protein). Describe the approximate molecular weight of the vector.

FIG. 5 shows a TAT-p16 fusion protein vector among exemplary DNA vectors according to the present invention based on the pTAT / pTAT-HA plasmid. HIS indicated by a square is 6 × HIS tag, protein transduction region (PTD
), HIV protease-RT cleavage site (HIV1), herpes simplex virus thymidine kinase (HSV TK), large caspase-3 region (Lg), small caspase-3 region (Sm), HIV p17-p24 protease cleavage site (HIV2)
), Selective addition of p16 (mutant or wild-type p16 protein). Describe the approximate molecular weight of the vector.

FIG. 6 shows a PTD-p16 fusion vector among exemplary DNA vectors according to the present invention based on the pTAT / pTAT-HA plasmid. HIS shown in squares is 6 × HIS tag, protein transduction region (PTD), HIV
Protease-RT cleavage site (HIV1), herpes simplex virus thymidine kinase (HSV TK), large caspase-3 region (Lg), small caspase-3 region (Sm), HIV p17-p24 protease cleavage site (HIV2), p16
4 shows the selective addition of (mutant or wild-type p16 protein). Describe the approximate molecular weight of the vector.

FIG. 7 is a diagram schematically illustrating cell killing with a fusion protein containing an enzyme capable of converting a prodrug into an active agent. HIV1 and HIV2 are defined in FIGS.

FIG. 8 shows the construction of a TAT-CPP32 fusion protein according to the present invention.
FIG. 3 is a schematic diagram showing two methods.

FIG. 9 is a bar graph showing the percentage of viable cells after transduction of various TAT fusion proteins and treatment with anti-HIV agents.

FIG. 10 is a table showing the ratio of living cells (column 2 and below) used in the bar graph of FIG. 9;

FIG. 11 shows a spiral projection of a preferred transducing protein of the invention. “TAT (47-57)” is a TAT peptide (SEQ ID NO:
: 2) shows amino acids 47-57. "SFD" represents the transduced region sequence specified. The phrase “relative intracellular concentration (relative intrac) in FIG.
"ellar concentration" refers to the intracellular amount of transduced peptide sequence related to the TAT peptide.

FIG. 12 shows a spiral projection of a preferred transducing protein of the invention. "SFD" represents the transduced region sequence specified. The phrase “
Relative intracellular conc
"entration""refers to the intracellular amount of the transduced peptide sequence associated with the TAT peptide.

FIG. 13 illustrates one of various protein constructs, p5
FIG. 2 is a diagram of a bid protein in which the p15 region and the p15 region are emphasized. The caspase cleavage site at Arg59 is shown.

FIG. 14 illustrates one of various protein constructs, TA
The cloning of a T-p5-HIV-p15 fusion protein is outlined. Iris square = overhang between primers 2R and 2F indicating HIV cleavage.

FIG. 15 illustrates one of various protein structures, TA
Figure 2 shows a T-HIV-p15 fusion protein. See primer design description.

FIG. 16 shows the generation and transduction of a TAT fusion protein, showing the caspase 3 (Caps3) protein and various TAT / HIV fusion proteins made using the caspase 3 p17 and p12 regions.

FIG. 17 shows FAC of fluorescein (FITC) -labeled TAT fusion protein.
It is a graph showing S analysis.

FIG. 18 shows FAC of fluorescein (FITC) -labeled TAT fusion protein.
It is a graph showing S analysis.

FIG. 19 shows FAC of fluorescein (FITC) -labeled TAT fusion protein.
It is a graph showing S analysis.

FIG. 20 shows the FAC of fluorescein (FITC) -labeled TAT fusion protein.
It is a graph showing S analysis.

FIG. 21 is a representation of an immunoblot showing in vivo treatment of a TAT fusion protein with Jurkat T cells. Immunoblots were probed with anti-p16.

FIG. 22 is a representation of an immunoblot showing in vivo treatment of a TAT fusion protein with Jurkat T cells. The immunoblot shows anti-caspase-
Probed with 3 antibodies.

FIG. 23 is a graph showing the activation of TAT-Casp3 and apoptosis induction in co-transduced cells, showing the HIV protease inhibitor, ritokivir (
(Ritonavir (Rit)) together with cell viability after transduction with various TAT fusion proteins.

FIG. 24 is a graph showing activation of TAT-Casp3 and apoptosis induction in co-transduced cells, showing cell viability after transduction with various TAT fusion proteins.

FIG. 25 is a graph showing that HIV protease activates TAT-Casp3wt protein, and TUNEL using TAT fusion protein.
The result of a positive cell (the apoptosis end marker) is shown.

FIG. 26 is a graph showing that HIV protease activates TAT-Casp3wt protein, and shows the results of a caspase-3 enzyme assay using a TAT fusion protein.

FIG. 27 is a graph illustrating specific killing of HIV infected cells.

FIG. 28 is a diagram showing a plasmid map for pTAT-p53 WT and pTAT-p53 1-364. p53 ORF full length wild type (a
a 1-393) and the C 'truncated (aa 1-364) form
TW300 (R. Brachman, Washington University)
ty, St. Louis, MO, unpublished data).
T-HA (Ezhevsky et al. And Nagahara et a.
l. ), Resulting in plasmids pTAT-p53 WT and pTAT-p53 1-364.

FIG. 29 shows a Coomassie blue stained gel of TAT-p53 WT protein purified using a Ni-NTA column. The TAT-p53 WT protein was expressed in insoluble form in E. coli cells. The insoluble protein was pelleted and 6 M GuHCl / 20 mM HEPES / 100 mM Na
Suspended in Cl and sonicated. A 1 mL fraction of the TAT-p53 WT protein was eluted from the Ni-NTA column with increasing imidazole concentrations as indicated. High concentrations of TAT-p53 WT were obtained with Ni-N in the presence of 6M GuHCl.
Bound to TA.

FIG. 30 shows purified TAT-p53 WT and purified TAT-p53 1-3 eluted from a Ni-NTA column with increasing concentrations of imidazole (as shown).
64 is a p53 immunoblot of 64 proteins, panel A shows TAT-p53 WT
3 shows a blot for the protein.

FIG. 31 shows purified TAT-p53 WT and purified TAT-p53 1-3 eluted from a Ni-NTA column with increasing concentrations of imidazole (as shown).
64 is a p53 immunoblot of 64 proteins, panel B shows TAT-p53 1-
4 shows a blot for the 364 protein.

FIG. 32 is a graph of the cell viability of tumor cells (shaded bars) compared to normal cells (open bars) 48 hours after transduction with the TAT-p53 1-364 protein. Human leukemia Jurkat T cells and normal diploid fibroblasts were treated with various concentrations of TAT-p53 1-364 protein at time = 0 and 24 hours. Cells were then assayed for viability at 48 hours using trypan blue exclusion dye. PBS-only control (Ctrl) and 200
Includes nM TAT-Bid MUT protein.

FIG. 33 shows tumor cell killing by forced cell cycle arrest for transduction of Cdk inhibitor protein. Panel A shows treatment with a PTD-Cdk inhibitor protein fusion (TAT-p27, TAT-Cdk2-DN (dominant negative) and / or TAT-p16), where tumor cells are susceptible to cell cycle arrest-mediated apoptosis, 5 is a schematic diagram showing that normal cells are resistant.

FIG. 34 shows tumor cell killing by forced cell cycle arrest for transduction of Cdk inhibitor protein. Panel B is a graph showing the% cell viability of tumor cells at 48 hours after addition of the indicated PTD-fusion protein. Leukemia Jurkat T cells were collected at time = 0 and 24 hours at 2 hours.
Treated with 00nM TAT-p27, TAT-Cdk2-DN or TAT-p16. Cells were assayed for viability at 72 hours using trypan blue exclusion dye.

FIG. 35 is a graph showing cell viability of tumor cells (shaded bars) versus normal cells (open bars) 48 hours after transduction with TAT-p16 peptide. Human leukemia Jurkat T cells and normal diploid fibroblasts were treated with various concentrations of TAT-p16 peptide at time = 0 and 24 hours. Cells were then assayed for viability at 48 hours using trypan blue exclusion dye.

[Procedure amendment]

[Submission date] July 31, 2001 (2001.7.31)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0043

[Correction method] Change

[Correction contents]

Further preferred transducing sequences may exhibit cell insertion and elimination rates (sometimes designated as k ₁ and k _2, respectively) where at least picomolar amounts of the fusion molecule are preferred in the cell. Amino acid sequence insertion and elimination rates can be easily determined, or at least predictable, by standard kinetic analysis using a detectable labeled fusion molecule. Typically, the ratio of insertion speed to ejection speed is between about 5 and about 100, up to about 1000.

[Procedure amendment 2]

[Document name to be amended] Statement

[Correction target item name] 0046

[Correction method] Change

[Correction contents]

In one embodiment, the class I transduction region is a peptide represented by the following general formula: _{B 1 -X 1 -X 2 -X 3} -B 2 -X 4 -X 5 -B 3; wherein B _{1, B 2} and B ₃ are each independently the same or different basic amino acid, X _{1, X 2, X 3,} X 4 and X ₅ are each independently the same or different alpha - a helix promoting amino acid.

[Procedure amendment 3]

[Document name to be amended] Statement

[Correction target item name] 0047

[Correction method] Change

[Correction contents]

In another embodiment, the class I transducing peptide has the general formula: B ₁ -X ₁ -X ₂ -B ₂ -B ₃ -X ₃ -X ₄ -B ₄ ; wherein B ₁ , B ₂ , B ₃ and B ₄ are each independently the same or different basic amino acids And X ₁ , X ₂ , X ₃ , and X ₄ are each independently the same or different alpha-helix promoting amino acids.

[Procedure amendment 4]

[Document name to be amended] Statement

[Correction target item name] 0106

[Correction method] Change

[Correction contents]

More generally, the misfolded fusion proteins disclosed herein represent high Gibbs free energy ( ΔG ) forms of the corresponding native protein. Preferred are misfolded fusion proteins that are completely soluble in aqueous solution. In contrast, native fusion proteins usually fold correctly, are completely soluble in aqueous solution, and have a relatively low ΔG . Thus, in most instances, the native fusion protein is stable.

[Procedure amendment 5]

[Document name to be amended] Statement

[Correction target item name]

[Correction method] Change

[Correction contents]

A preferred transducing protein consistent with the present invention is a class I amino acid sequence, preferably a peptide sequence that includes at least a peptide represented by the following general formula: B ₁ -X ₁ -X _2- X ₃ -B ₂ -X ₄ -X ₅ -B _{3 wherein} B ₁ , B ₂ and B ₃ are each independently a basic amino acid and are the same or different; and X ₁ , X ₂ , X ₃ , X ₄ and X ₅ are each independently alpha-helix enhancing amino acids and are the same or different). Typically, such sequences are synthetic.

[Procedure amendment 6]

[Document name to be amended] Statement

[Correction target item name]

[Correction method] Change

[Correction contents]

In one embodiment, the peptide has the formula: _{B 1 -X 1 -X 2 -X 3} -B 2 -X 4 -X ₅ -B ₃  (WhereB ₁ , B ₂ andB ₃ At least one is arginine
,PreferablyB ₁ , B ₂ andB ₃ Are all arginines; andX ₁ , X ₂ , X ₃ , X ₄  as well asX ₅ Are each independently an alpha-helix enhancing amino acid;
The same or different). Preferably,X ₁ , X ₂ , X ₃ , X ₄ as well as X ₅  At least one is alanine, more preferablyX ₁ , X ₂ , X ₃ , X ₄  as well asX ₅ Are all alanine. In another embodiment, the peptide has the formula:B ₁ -X ₁ -X ₂ -X ₃ -B ₂ -X ₄ -X ₅ -B ₃  (WhereB ₁ , B ₂ andB ₃ Are each independently a basic amino acid,
One or different; andX ₁ , X ₂ , X ₃ , X ₄ as well asX ₅ At least one of
Alanine, more preferablyX ₁ , X ₂ , X ₃ , X ₄ as well asX ₅ All of Ara
Nin). In such embodiments, a basic such as arginine
The amino acid residues are substantially aligned along at least one surface of the peptide, typically
, Lined up along one side.

[Procedure amendment 7]

[Document name to be amended] Statement

[Correction target item name]

[Correction method] Change

[Correction contents]

An additional preferred transducing protein consistent with the present invention is a synthetic amino acid sequence, preferably a peptide comprising at least a peptide represented by the following general formula: B ₁ -X ₁ -X _{2 -B 2 -B 3 -X 3 -X} 4 -B 4 ( _{wherein, B 1, B 2, B} 3 and B ₄ are each independently basic amino acids, the same or different and; and X _{1, X 2, X} 3, and X ₄ are each independently an alpha - a spiral enhancing amino acid, the same or different). In one embodiment, at least one of B ₁ , B ₂ , B ₃ and B ₄ is arginine, preferably all of B ₁ , B ₂ , B ₃ and B ₄ are arginine; and X ₁ , X ₂ , X ₃ , and X ₄ are each independently alpha-helix enhancing amino acids and are the same or different. In another embodiment, B ₁ , B ₂ , B ₃ and B ₄ are each independently a basic amino acid and are the same or different; and at least _one of X ₁ , X ₂ , X ₃ and X ₄ One is alanine, and more preferably all of X ₁ , X ₂ , X ₃ , and X ₄ are alanine residues. In such an embodiment,
Basic amino acid residues such as arginine are substantially aligned along at least one surface of the peptide, typically along one surface.

[Procedure amendment 8]

[Document name to be amended] Statement

[Correction target item name] 0149

[Correction method] Change

[Correction contents]

Further preferred are the class II transducing amino acid sequences as described above.
In one embodiment, class II sequence is a peptide represented by the following _{formula: X 1 -X 2 -RX 3 -} (P / X 4) - (B / X 5) -B- (P / X ₆ ) -X ₄ -B- (B / X ₇ ); wherein X ₁ , X ₂ , X ₃ , X ₄ , X ₅ , X ₆ , and X ₇ are each an alpha-helical assisting residue. ( P / X ₄ ) and ( P / X ₆ ) are independently proline or alpha helix-assisting residues; B is a basic amino acid residue; (B / X ₅ ) And ( B / X ₇ ) are each independently a B or alpha helix-assisting residue; and R is arginine (Arg)). A preferred alpha helix-promoting residue is alanine (Ala). Preferred basic amino acids are arginine (Arg), lysine (Lys), especially Arg. Particularly preferred class II
The transducing amino acid sequence includes at least one proline residue, usually between about 1 and 3 proline residues.

[Procedure amendment 9]

[Document name to be amended] Statement

[Correction target item name]

[Correction method] Change

[Correction contents]

Particular zymogens for use in accordance with the present invention include those associated with apoptosis, especially cysteinyl aspartate-specific proteinase (caspase) and, in particular, caspase-3 (CPP32, apopain, Yama ),
Caspase _{-5 (ICE rel -III, TY)} , caspase _{-4 (ICE re l -II TX,} ICH-2), Caspase -1 (ICE), caspase-7 (
Mch3, ICE-LAP3, CMH-1), caspase-6 (Mch2), caspase-8 (MACH, FLICE, Mch5), caspase-10 (Mch
4), caspase-2 (ICH-1), caspase-9 (ICH-LAP6, M
ch6) and their catalytically active fragments which are relatively inactive zymogen fragments.

[Procedure amendment 10]

[Document name to be amended] Statement

[Correction target item name] 0234

[Correction method] Change

[Correction contents]

[0234] fused to pTAT vectors described oligonucleotides corresponding to the HIV cleavage site p17-p24 (SEQ ID NO: 18) or p7-p1 (SEQ ID NO: 1 9) in Example 1 (from 3 'to PTD site) is allowed pTAT-HIV ₁ or pTAT-HIV ₂ vector were respectively production Te. _{pTAT-HIV 1, 2} to the vector example 3
5 were used as parent vectors. The cDNA sequence of the p16 protein
Fusion to the 7-p24 HIV cleavage site produced the in-frame TAT-p16 fusion protein cDNA (FIG. 5). by fusing the pTAT-HIV ₂ vector P16cDNA, it made second p16 fusion proteins. The order of the components of each vector construct (from the N 'end to the C' end) was determined by HIS-TA
T-PTD-cleavage site-p16-protein, the "cleavage site" is p17-p
24 or p7-p1 cleavage sites are indicated, respectively. The fusion protein was purified and misfolded according to the method described in Example 2 above. The TAT-p16 cDNA vector was grown in DH5-α bacteria.

[Procedure amendment 11]

[Document name to be amended] Statement

[Correction target item name] 0236

[Correction method] Change

[Correction contents]

Example 4 Detection of p16 Fusion Protein in Transduced Cells To determine if the fusion protein could remain in the cell cytosol of HIV infected cells, the TAT- produced in Example 3 was used. purification of the HIV _{1, 2} p1 6 fusion protein was labeled with FITC as described above. Next, based on Example 6 below, about 35-45 nanomolar of the labeled fusion protein was added to
NLHX staining) and uninfected Jurkat T cells. Then the transduced Jur
Kat T cells were analyzed by FACS. All (100%) of the cells in the mixed group of HIV infected / uninfected cells were 1,2,2 after the addition of the FITC binding fusion protein.
Transduced at 4, 8, and 16 hours. However, if the cells were washed with fresh medium and the PTD was eliminated from the cells by a concentration gradient (currently high inside and zero outside), the infected cells retained the cleaved substrate (p16 portion), The uninfected control group lost all of the transduced protein as determined by the continuous presence of FITC-labeled p16 as analyzed by FACS (it was transduced).

[Procedure amendment 12]

[Document name to be amended] Statement

[Correction target item name] 0240

[Correction method] Change

[Correction contents]

The order of the components of the resulting construct (from N ′ end to C ′ end) is HI
_{S-TAT-PTD-subunit} of HIV 2 -CPP32- HIV ₁ -CPP
There were 32 small subunits. HIS-TAT-PTD- _HIV 2 -CP
Each of the vectors encoding the large subunit of the P32-HIV-small subunit of the CPP32 cDNA fusion protein grew in DH5-α bacteria. _HIS-TAT-PTD- HIV 2 -CPP32- small subunit of large subunit -CPP32 fusion protein of HIV ₁ "TAT-CPP32
".

[Procedure amendment 13]

[Document name to be amended] Statement

[Correction target item name] 0241

[Correction method] Change

[Correction contents]

Example 6 Specific Cell Killing by TAT-CPP32 Fusion Protein To demonstrate that the TAT-CPP32 fusion protein produced in Example 5 has the ability to kill HIV infected cells, a fusion protein was generated. Example 2
Labeled in a form detectable by FITC as described in. Labeled T
The AT-CPP32 fusion protein was tested in the following manner. 5 × 10 ⁶ Jurkat T cells were transformed with HIV (NLHX strain, 1 × 10 ⁵ per ml).
１1 × 10 ⁶ infectious virus). Cells were grown in RPMI medium. Approximately 4-7 days after infection, the culture was removed from the plates and 35-45 nanomolar TAT-CPP32 fusion protein was added to the cells. Transduction of the cells was performed by incubating the cells with the fusion protein for about 30 minutes. Using FACS analysis, it was found that about 100% of the cells were transduced by the fusion protein. The culture was then returned to the plate and cell killing approximately 18 hours after transduction was examined using conventional trypan blue extraction and microscopy. It was found that almost all of the infected cells were killed by TAT-CPP32. This result is significant. This is because it indicates that the TAT-CPP32 fusion protein specifically kills HIV-infected cells but does not kill uninfected cells in that group.

[Procedure amendment 14]

[Document name to be amended] Statement

[Correction target item name] 0245

[Correction method] Change

[Correction contents]

To indicate the mutated catalytic Cys residue at position 163 of the CPP32 fusion protein, the fusion protein was ^labeled “ TAT-CPP32 ^mut ” or “TAT-CPP
32 mutants ". The TAT-CPP32 ^mut fusion protein was purified and transduced into HIV infected Jurkat T cells as described above in Example 6. The finding was that the fusion protein was unable to kill HIV infected cells. In contrast, the results of Example 6 show that the TAT-CPP32 fusion protein (wild-type catalytic Cys residue) specifically killed HIV-infected Jurkat cells.

[Procedure amendment 15]

[Document name to be amended] Statement

[Correction target item name] 0251

[Correction method] Change

[Correction contents]

Each of the fusion proteins was purified and misfolded as previously described in Example 2. About 5 × 10 ⁶ Jurkat T cells were transformed with HIV (as described above in Example 6).
NLHX strain). About 4 to 7 days after the infection, the culture medium was removed from the plate, and about 35 to 45 nmol of the TAT-TK fusion protein (p17
-P24 or p7-p1 cleavage site) was added to the cells. Cells were transduced by incubating the cells with the fusion protein for about 30 minutes. F
Using ACS analysis, it was found that about 100% of the cells were transduced by the fusion protein.

[Procedure amendment 16]

[Document name to be amended] Statement

[Correction target item name]

[Correction method] Change

[Correction contents]

To test the activity of TAT-CPP32 by TAT protease, 2 × 10 ⁶ Jurkat T cells were placed in 1 ml culture (RPMI medium). To those cells, various combinations of control and experimental transducible proteins were added in the range of 50-100 nM as follows. 1. Control 2. 2. TAT-protease (50-100 nM) 3. TAT-CPP32 wild type (50-100 nM) 4. TAT-CPP32 mutant (50-100 nM) 5. TAT-CPP32 wild type + TAT protease 6. TAT-CPP32 mutant + TAT protease 7. Ritonavir (HIV protease inhibitor) 8. TAT-CPP32 wild type + ritonavir TAT-CPP32 mutant + ritonavir

[Procedure amendment 17]

[Document name to be amended] Statement

[Correction target item name] 0290

[Correction method] Change

[Correction contents]

The following method was used in this example. 1. Cell culture-p16 (-) Jurkat T cells (ATCC) were expanded as described. See Lissy, NA et al. (Supra). For in vivo substrate cleavage, 1 × 10 ⁶ cells were treated with 100 nM TAT-p16, TAT-A-p16,
Transduced for 1, 5, or 8 hours as indicated by AT-Casp3MUT and / or 50 nM TAT-HIV Pr protein, and anti-p16 (Sa
nta Cruz) or anti-Casp3 (Pharmingen) immunoblot analysis. See Ezhevsky, SA et al., Supra. TAT- for uninfected cells
For Casp3 cytotoxicity, 1 × 10 ⁶ cells were treated with 100 nM TAT-Cas.
p3WT, TAT-Casp3MUT, and / or 50 nM TAT-HI
Transduced with V Pr protein for 16 hours and excluded trypan blue and / or
Alternatively, viability was assayed by genomic DNA damage by TUNEL assay (Trevigen). The number of TUNEL positive cells reported per high power microscopy field was averaged over 4 fields per experiment. TAT-Casp3 activity was increased by 20 μl
g of whole cell lysate and incubation with 50 μM DEVD-AFC and fluorescent AFC formation was measured on a FL500 microplate fluorescence reader ( Bio-Tek ) as described. See Xiang, J. et al., Supra. Cells were transfected with 1 μg / ml Ritonavir (Abbott L
abs) for 1 hour. TAT-Ca against infected cells
For sp3 cytotoxicity, Jurkat cultures were infected with 100 ng p24 Ag equivalent of the NLHX HIV-1 strain for 7-14 days, assayed microscopically for cytopathic effects, then repeated at 1 × 10 ⁶ / ml and repeated at 100 nM. TAT
Transduction with -Casp3WT or TAT-Casp3MUT protein for 16 hours followed by exclusion dye viability assay. Infected cells were washed with TAT-C
1 μg / ml Ritonavir prior to transduction with asp3WT protein
For 24 hours. See Xiang, J. et al., Supra. For flow cytometry (FACS) analysis, Fluorescein (FITC) binding TAT fusion protein was added to the Jurkat T cell culture medium, and analyzed by FACS as described 1 × 10 ⁴ cells. See Ezhevsky, SA et al., Supra.

[Procedure amendment 18]

[Document name to be amended] Statement

[Correction target item name] Brief description of drawings

[Correction method] Change

[Correction contents]

[Brief description of the drawings]

FIG. 1 is a plasmid map of pTAT / pTAT-HA.

FIG. 2 shows the nucleotide and amino acid sequences of the pTAT linker and the pTAT HA linker. The minimum TAT area is bold. The underlined sequence illustrates the minimal TAT region flanked by glycine residues.

FIG. 3 shows a TAT-HSV TK fusion protein vector among exemplary DNA vectors according to the present invention based on the pTAT / pTAT-HA plasmid. HIS indicated by a square is 6 × HIS tag, protein transduction region (
PTD), HIV protease-RT cleavage site ( HIV ₁ ), herpes simplex virus thymidine kinase (HSV TK), large caspase-3 region (Lg), small caspase-3 region (Sm), HIV p17-p24 protease cleavage site ( H IV _2), indicating selective addition of p16 (mutant or wild-type p16 protein). Describe the approximate molecular weight of the vector.

FIG. 4 according to the invention based on the pTAT / pTAT-HA plasmid.
Among the exemplary DNA vectors, a TAT-caspase-3 fusion protein vector
Is shown. HIS indicated by a square is 6 × HIS tag, protein transduction region
(PTD), HIV protease-RT cleavage site (HIV ₁ ), Herpes simplex
Ilstymidine kinase (HSV TK), large caspase-3 region (Lg), small
Caspase-3 region (Sm), HIV p17-p24 protease cleavage site ( HIV ₂  ), Selective addition of p16 (mutant or wild-type p16 protein)
Show. Describes the approximate molecular weight of the vector.

FIG. 5 shows a TAT-p16 fusion protein vector among exemplary DNA vectors according to the present invention based on the pTAT / pTAT-HA plasmid. HIS indicated by a square is 6 × HIS tag, protein transduction region (PTD
), HIV protease-RT cleavage site ( HIV ₁ ) , herpes simplex virus thymidine kinase (HSV TK), large caspase-3 region (Lg), small caspase-3 region (Sm), HIV p17-p24 protease cleavage site ( HIV ₂ ) shows selective addition of p16 (mutant or wild-type p16 protein). Describe the approximate molecular weight of the vector.

FIG. 6 shows a PTD-p16 fusion vector among exemplary DNA vectors according to the present invention based on the pTAT / pTAT-HA plasmid. HIS shown in squares is 6 × HIS tag, protein transduction region (PTD), HIV
Protease-RT cleavage site ( HIV ₁ ), herpes simplex virus thymidine kinase (HSV TK), large caspase-3 region (Lg), small caspase-3 region (Sm), HIV p17-p24 protease cleavage site ( HIV ₂ ), p16
4 shows the selective addition of (mutant or wild-type p16 protein). Describe the approximate molecular weight of the vector.

FIG. 7 is a diagram schematically illustrating cell killing with a fusion protein containing an enzyme capable of converting a prodrug into an active agent. HIV _{1 and 2} are defined in FIGS.

FIG. 8 shows the construction of a TAT-CPP32 fusion protein according to the present invention.
FIG. 3 is a schematic diagram showing two methods.

FIG. 9 is a bar graph showing the percentage of viable cells after transduction of various TAT fusion proteins and treatment with anti-HIV agents.

FIG. 10 is a table showing the ratio of living cells (column 2 and below) used in the bar graph of FIG. 9;

FIG. 11 shows a spiral projection of a preferred transducing protein of the invention. “TAT (47-57)” is a TAT peptide (SEQ ID NO:
: 2) shows amino acids 47-57. "SFD" represents the transduced region sequence specified. The phrase “relative intracellular concentration (relative intrac) in FIG.
"ellar concentration" refers to the intracellular amount of transduced peptide sequence related to the TAT peptide.

FIG. 12 shows a spiral projection of a preferred transducing protein of the invention. "SFD" represents the transduced region sequence specified. The phrase “
Relative intracellular conc
"entration""refers to the intracellular amount of the transduced peptide sequence associated with the TAT peptide.

FIG. 13 illustrates one of various protein constructs, p5
FIG. 2 is a diagram of a bid protein in which the p15 region and the p15 region are emphasized. The caspase cleavage site at Arg ⁵⁹ is shown.

FIG. 14 illustrates one of various protein constructs, TA
The cloning of a T-p5-HIV-p15 fusion protein is outlined. Iris square = overhang between primers 2R and 2F indicating HIV cleavage.

FIG. 15 illustrates one of various protein structures, TA
Figure 2 shows a T-HIV-p15 fusion protein. See primer design description.

FIG. 16 shows the generation and transduction of a TAT fusion protein, showing the caspase 3 (Caps3) protein and various TAT / HIV fusion proteins made using the caspase 3 p17 and p12 regions.

FIG. 17 shows FAC of fluorescein (FITC) -labeled TAT fusion protein.
It is a graph showing S analysis.

FIG. 18 shows FAC of fluorescein (FITC) -labeled TAT fusion protein.
It is a graph showing S analysis.

FIG. 19 shows FAC of fluorescein (FITC) -labeled TAT fusion protein.
It is a graph showing S analysis.

FIG. 20 shows the FAC of fluorescein (FITC) -labeled TAT fusion protein.
It is a graph showing S analysis.

FIG. 21 is a representation of an immunoblot showing in vivo treatment of a TAT fusion protein with Jurkat T cells. Immunoblots were probed with anti-p16.

FIG. 22 is a representation of an immunoblot showing in vivo treatment of a TAT fusion protein with Jurkat T cells. The immunoblot shows anti-caspase-
Probed with 3 antibodies.

FIG. 23 is a graph showing the activation of TAT-Casp3 and apoptosis induction in co-transduced cells, showing the HIV protease inhibitor, ritokivir (
(Ritonavir (Rit)) together with cell viability after transduction with various TAT fusion proteins.

FIG. 24 is a graph showing activation of TAT-Casp3 and apoptosis induction in co-transduced cells, showing cell viability after transduction with various TAT fusion proteins.

FIG. 25 is a graph showing that HIV protease activates TAT-Casp3 ^wt protein, and TUNEL using TAT fusion protein.
The result of a positive cell (the apoptosis end marker) is shown.

FIG. 26 is a graph showing that HIV protease activates TAT-Casp3 ^wt protein, and shows the results of a caspase-3 enzyme assay using a TAT fusion protein.

FIG. 27 is a graph illustrating specific killing of HIV infected cells.

FIG. 28 is a diagram showing a plasmid map for pTAT-p53 WT and pTAT-p53 1-364. p53 ORF full length wild type (a
a 1-393) and the C 'truncated (aa 1-364) form
TW300 (R. Brachman, Washington University)
ty, St. Louis, MO, unpublished data).
T-HA (Ezhevsky et al. And Nagahara et a.
l. ), Resulting in plasmids pTAT-p53 WT and pTAT-p53 1-364.

FIG. 29 shows a Coomassie blue stained gel of TAT-p53 WT protein purified using a Ni-NTA column. The TAT-p53 WT protein was expressed in insoluble form in E. coli cells. The insoluble protein was pelleted and 6 M GuHCl / 20 mM HEPES / 100 mM Na
Suspended in Cl and sonicated. A 1 mL fraction of the TAT-p53 WT protein was eluted from the Ni-NTA column with increasing imidazole concentrations as indicated. High concentrations of TAT-p53 WT were obtained with Ni-N in the presence of 6M GuHCl.
Bound to TA.

FIG. 30 shows purified TAT-p53 WT and purified TAT-p53 1-3 eluted from a Ni-NTA column with increasing concentrations of imidazole (as shown).
64 is a p53 immunoblot of 64 proteins, panel A shows TAT-p53 WT
3 shows a blot for the protein.

FIG. 31 shows purified TAT-p53 WT and purified TAT-p53 1-3 eluted from a Ni-NTA column with increasing concentrations of imidazole (as shown).
64 is a p53 immunoblot of 64 proteins, panel B shows TAT-p53 1-
4 shows a blot for the 364 protein.

FIG. 32 is a graph of the cell viability of tumor cells (shaded bars) compared to normal cells (open bars) 48 hours after transduction with the TAT-p53 1-364 protein. Human leukemia Jurkat T cells and normal diploid fibroblasts were treated with various concentrations of TAT-p53 1-364 protein at time = 0 and 24 hours. Cells were then assayed for viability at 48 hours using trypan blue exclusion dye. PBS-only control (Ctrl) and 200
Includes nM TAT-Bid MUT protein.

FIG. 33 shows tumor cell killing by forced cell cycle arrest for transduction of Cdk inhibitor protein. Panel A shows treatment with a PTD-Cdk inhibitor protein fusion (TAT-p27, TAT-Cdk2-DN (dominant negative) and / or TAT-p16), where tumor cells are susceptible to cell cycle arrest-mediated apoptosis, 5 is a schematic diagram showing that normal cells are resistant.

FIG. 34 shows tumor cell killing by forced cell cycle arrest for transduction of Cdk inhibitor protein. Panel B is a graph showing the% cell viability of tumor cells at 48 hours after addition of the indicated PTD-fusion protein. Leukemia Jurkat T cells were collected at time = 0 and 24 hours at 2 hours.
Treated with 00nM TAT-p27, TAT-Cdk2-DN or TAT-p16. Cells were assayed for viability at 72 hours using trypan blue exclusion dye.

FIG. 35 is a graph showing cell viability of tumor cells (shaded bars) versus normal cells (open bars) 48 hours after transduction with TAT-p16 peptide. Human leukemia Jurkat T cells and normal diploid fibroblasts were treated with various concentrations of TAT-p16 peptide at time = 0 and 24 hours. Cells were then assayed for viability at 48 hours using trypan blue exclusion dye.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 31/708 A61K 39/00 Z 4C085 38/00 39/04 4C086 38/21 39/106 4C206 38/55 48/00 4H045 39/00 A61P 31/00 39/04 31/10 39/106 31/12 48/00 31/18 A61P 31/00 31/20 31/10 31/22 31/12 35/00 31 / 18 43/00 105 31/20 111 31/22 C07K 7/06 35/00 14/47 43/00 105 19/00 111 C12Q 1/37 C07K 7/06 C12N 15/00 ZNAA 14/47 5/00 E 19/00 A61K 37/02 C12N 5/06 37/64 C12Q 1/37 37/66 (81) Designated countries EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG , CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, TZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, C U, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ , TM, TR, TT, UA, UG, UZ, VN, YU, ZA, ZWF terms (reference) 4 B024 AA01 BA10 BA14 BA38 BA80 CA04 HA17 4B063 QA01 QA07 QQ08 QQ36 QQ98 QR16 QR68 QR77 QX01 4B065 AA90X BD13 BD21 CA44 4C076 AA24 BB01 BB25 CC27 CC29 CC31 CC35 FF16 4C084 AA02 AA03 DCA MA03 DC NA14 NA15 ZB212 ZB262 ZB312 ZB332 ZB352 ZB382 ZC202 4C085 AA03 AA05 BA10 BA19 BA20 CC07 CC08 CC12 DD22 DD32 DD42 DD43 EE01 GG08 4C086 AA01 AA02 CB07 EA17 EA18 MA01 MA02 MA03 MA04 MA13 MA52 ZB21 Z33B33 Z14 MA01 MA02 MA03 MA04 MA11 MA33 MA72 MA79 NA14 NA15 ZB21 ZB26 ZB31 ZB33 ZB35 ZB38 ZC20 4H045 AA10 AA30 BA10 BA15 BA16 BA41 CA40 DA83 EA29 FA74

Claims (119)

[Claims] 1. A transduction system comprising a fusion protein comprising a covalently linked protein transduction domain and a cytotoxic domain. 2. The protein transduction system according to claim 1, wherein the cytotoxic domain further comprises at least one pathogen-specific protease cleavage site. 3. The fusion protein comprises, covalently linked, 1) a transduction domain, 2) a first pathogen-specific protease cleavage site, and 3) a sequence comprising a zymogen. The protein transduction system according to claim 2. 4. The fusion protein is covalently linked: 1) a transduction domain, 2) a first pathogen-specific protease cleavage site, 3) a zymogen fragment as a catalyst, and 4) a first zymogen fragment. Zymogen
3. The protein transduction system of claim 2, comprising a sequence comprising a subunit. 5. The fusion protein as claimed in claim 1, wherein the fusion protein comprises a C-zyme of the first zymogen subunit.
5. The method of claim 4, further comprising a 5) second pathogen-specific protease cleavage site, and 6) a second zymogen subunit, covalently attached to the termini.
2. The protein transduction system according to claim 1. 6. The protein transduction system according to claim 3, wherein the zymogen is caspase, thrombin, bacterial exotoxin, granzasim B or invertebrate toxin. 7. The caspase is caspase-3 (CPP32 apopain (a
popain), Yama), Caspase-5 (ICE _rel- III, TY)
, Caspase-4 (ICE _rel -II TX, ICH-2), caspase-1 (
ICE), caspase-7 (Mch3, ICE-LAP3, CMH-1), caspase-6 (Mch2), caspase-8 (MACH, FLICE, Mch5)
7. Caspase-10 (Mch4), Caspase-2 (ICH-1), Caspase-9 (ICH-LAP6, Mch6), or a zymogen having catalytic-like activity. Protein transduction system. 8. The caspase is caspase-3 (CPP32 apopain,
The protein transduction system according to claim 7, wherein the protein transduction system is Jana) or a fragment thereof having a catalytic activity. 9. The fusion protein of claim 2, wherein the fusion protein comprises covalently linked sequences comprising 1) a transduction domain, 2) a pathogen-specific protease cleavage site, and 3) an enzyme. Protein transduction system. 10. The protein transduction system according to claim 9, wherein the enzyme is thymidine kinase, cytosine deaminase, or an enzyme fragment thereof having catalytic activity. 11. The protein transduction system according to claim 10, wherein the enzyme is thymidine kinase. 12. The pathogen-specific protease cleavage site may be cytomegalovirus (CMV), herpes simplex virus type-1 (HSV-1), hepatitis C virus (HCV), Plasmodium falciparum (P. falciparum), HIV-1, HI
The protein transduction system according to claim 2, which is selected from the group consisting of V-2 and Kaposi's sarcoma-associated herpesvirus (KSHV) protease cleavage site. 13. The fusion protein is covalently linked, 1) TA
T or its protein transducing fragment, 2) caspase-3 prodomain, 3) first HSV-1 protease cleavage site, 4) caspase-3 large subunit, 5) second HSV-1 protease cleavage site, and 6 ) Caspase-
3. The protein trait of claim 2, comprising a sequence comprising three small subunits (where the large and small subunits are capable of dimerizing to form cytotoxicity). Introduction system. 14. The protein transduction system according to claim 2, wherein the protein transduction domain is TAT, Antennapedia homeodomain, HSV VP22 or a fragment thereof. 15. A substantially pure fusion protein comprising a covalently linked protein transduction domain and a cytotoxic domain. A segment of a nucleic acid encoding the fusion protein of claim 1. 17. A DN comprising a segment of the nucleic acid according to claim 16.
A vector. 18. A method for suppressing a pathogen-infected disease in a mammal, comprising administering to the mammal a therapeutically effective amount of the medicament comprising the protein transduction system according to claim 1. 19. The method according to claim 18, further comprising administering a therapeutically effective amount of a medicament comprising a reverse transcriptase inhibitor, a cytokine, or an immunomodulator. 20. The medicament further to be administered is AZT, ddI, ddC, d.
4T, 3TC, FTC, DAPD, 1592U89, CS92, acyclovir,
20. The method of claim 19, comprising at least one of ganciclovir, penciclovir, or interferon. 21. The method of claim 18, wherein the protein transduction system is administered as an aerosol. 22. The method according to claim 21, wherein the method of administration is oral or nasal. 23. A method for inducing apoptosis in a predetermined population of cells, comprising administering to a mammal a therapeutically effective amount of the protein transduction system of claim 1 in the presence of a pathogen. 24. The method of claim 23, wherein the pathogen is attenuated. 25. transducing a population of cells with the fusion protein of claim 1 and infecting said cells with a pathogen capable of expressing or inducing a pathogen-specific protease;
And expressing the protease, contacting the fusion protein with a pathogen-specific protease sufficient to produce a cytotoxin, and treating any cytotoxic effect of the candidate compound that modulates the pathogen-specific protease. A method of screening for a candidate compound that can effectively inhibit a pathogen-specific protease consisting of: 26. The method according to claim 25, wherein the protein transduction domain is TAT, Antennapedia homeodomain, HSV VP22 or a fragment thereof. 27. The method of claim 26, wherein the cytotoxic domain comprises a caspase and one or more protease cleavage sites. 28. The method wherein the cytotoxic domain comprises one or more HIV-1
26. The method of claim 25, comprising a protease cleavage site, thymidine kinase or cytosine deaminase. 29. The fusion protein of claim 1, further comprising a protein purification or identification tag. 30. A protein purification or identification tag comprising polyhistidine, E
2. The fusion protein according to claim 1, which is an E, MYC or HA sequence. 31. A protein transduction domain for introducing a fusion protein into a cell, and responsive to infection by one or more pathogens (resp.
a protein transduction system comprising a fusion protein comprising a cytotoxic domain that specifically produces a cytotoxin. 32. administering to a mammal a therapeutically effective amount of a protein transduction system comprising a fusion protein comprising a covalently linked protein transduction domain and a cytotoxic domain; Transducing the fusion protein, cleaving the fusion protein, sufficiently releasing the cytotoxic domain from the fusion protein, enriching the cytotoxic domain in cells, and sufficient to suppress a pathogenic infection in a mammal. Producing a different cytotoxin,
A method for suppressing pathogen infection in a mammal, comprising: 33. The cytotoxin is thrombin, fibrin, trypsin, chymotrypsin, diphtheria toxin, ricin, shiga toxin, abrin, cholera toxin, saponin, pseudomonas exotoxin (PE), pokeweed antiviral protein, gelonin, diphtheria toxin A 33. The method of claim 32, wherein the method is selected from the group consisting of a chain, ricin A chain, phospholipase C or cytosine deaminase, or a fragment thereof having catalytic-like activity. 34. The method of claim 32, further comprising administering a prodrug and contacting the prodrug with the enriched cytotoxic domain to produce a cytotoxin. 35. The method of claim 34, wherein the prodrug is acyclovir and the enriched cytotoxic domain is HSV-1 thymidine kinase. 36. The protein transduction system according to claim 2, wherein the protein transduction domain is a synthetic peptide or another transduction protein. 37. The method according to any one of claims 18, 19, 20, 21 or 22, wherein the mammal has, or is susceptible to, a viral infection or a virus-related disease. 38. The method of claim 37, wherein the mammal has a retroviral infection. 39. The method of claim 38, wherein the mammal has an HIV infection. 40. The mammal of claim 18, 19, 20, 21 or 22, wherein the mammal has or is susceptible to Plasmodium infection or a disease associated with Plasmodium infection. Method. 41. The method of claim 23 or 24, wherein the mammal has or is susceptible to a viral infection or a virus-related disease. 42. The method of claim 41, wherein the mammal has a retroviral infection. 43. The method of claim 42, wherein the mammal has an HIV infection. 44. The method of claim 23 or 24, wherein the mammal has or is susceptible to Plasmodium infection or a disease associated with Plasmodium infection. 45. The mammal according to claim 32, 33, 34 or 3 wherein the mammal has or is susceptible to a viral infection or a virus-related disease.
5. The method according to any one of 5. 46. The method of claim 45, wherein the mammal has a retroviral infection. 47. The method of claim 46, wherein the mammal has an HIV infection. 48. The method of any one of claims 32, 33, 34 or 35, wherein the mammal has or is susceptible to Plasmodium infection or a disease associated with Plasmodium infection. 49. The method of any one of claims 37, 41 or 45, wherein the mammal has or is susceptible to a herpes infection. 50. The method of claim 37, 41 or 45, wherein the mammal has or is susceptible to a hepatitis infection. 51. The virus is a cytomegalovirus (CMV), a herpes simplex virus, for example, type-1 (HSV-1), a hepatitis virus, for example,
46. Any of the claims 37, 41 or 45, which is selected from the group consisting of type C (HCV), Kaposi's sarcoma-associated herpesvirus (KSHV or human herpesvirus 8), yellow fever virus, flavivirus, and rhinovirus. The method described in. 52. The retroviral infection is a human immunodeficiency virus type 1 (HIV-1, HTLV-III, LAV or HTLV-III / LAV).
46. The method of any of claims 38, 41 or 45, wherein the method is associated with human immunodeficiency virus type 2 (HIV-2). 53. The method of any one of claims 40, 40 or 48, wherein the Plasmodium infection is associated with any one or more of the following Plasmodium: Plasmodium falciparum, Plasmodium vivax, Oval malaria parasite, or Plasmodium vivax. 54. A fusion protein comprising a covalently linked protein transduction domain and a cytotoxic domain, isolated from a host cell,
A method for introducing a fusion protein into a cell, comprising misfolding the fusion protein and then transducing the fusion protein into the cell. 55. A protein transduction domain comprising at least one peptide represented by the formula: B ₁ -X ₁ -X ₂ -X ₃ -B ₂ -X ₄ -X ₅ -B _{3 wherein} : B ₁ , B ₂ and B ₃ each independently represent the same or different basic amino acids; X ₁ , X ₂ , X ₃ , X ₄ and X ₅ each independently represent the same or different α-helix enhancing amino acids . 56. A protein transduction domain represented by the following formula: B ₁ -X ₁ -X ₂ -X ₃ -B ₂ -X ₄ -X ₅ -B _{3 wherein} B ₁ , B ₂ and B ₃ are X ₁ , X ₂ , X ₃ , X ₄ and X ₅ are each independently the same or different and represent an α-helix enhancing amino acid. 57. The protein transduction domain according to claim 55, wherein the at least one basic amino acid is arginine. 58. The protein transduction domain of claim 55 or 56, wherein the at least one α-helix enhancing amino acid is alanine. 59. The method according to claim 55, wherein the at least one α-helix enhancing amino acid is alanine and the plurality of basic amino acids is arginine substantially arranged along at least one surface of the peptide. Protein transduction domain. 60. A protein transduction domain comprising at least one peptide represented by the following formula: B ₁ -X ₁ -X ₂ -B ₂ -B ₃ -X ₃ -X ₄ -B _{4 wherein} : B ₁ , B ₂ , B ₃ and B ₄ each independently represent the same or different basic amino acids; X ₁ , X ₂ , X ₃ and X ₄ each independently represent the same or different α-helix enhancing amino acids . 61. A protein transduction domain represented by the following formula: B ₁ -X ₁ -X ₂ -B ₂ -B ₃ -X ₃ -X ₄ -B _{4 wherein} B ₁ , B ₂ , B ₃ and B ₄ each independently represents the same or different basic amino acid; X ₁ , X ₂ , X ₃ and X ₄ each independently represent the same or different α-helix enhancing amino acid. 62. The protein transduction domain according to claim 60 or 61, wherein the at least one basic amino acid is arginine. 63. The protein transduction domain according to claim 60 or 61, wherein the at least one α-helix enhancing amino acid is alanine. 64. The at least one α-helix enhancing amino acid is alanine, and the plurality of basic amino acids is arginine substantially arranged along at least one surface of the peptide. Protein transduction domain. 65. A protein transduction domain comprising at least the following sequence: AGRKKRRQRRR (SEQ ID NO: 2). 66. A protein transduction domain comprising at least the following sequence: YARKARRQQARR (SEQ ID NO: 3). 67. A protein transduction domain comprising at least the following sequence: YARAAARQARA (SEQ ID NO: 4). 68. A protein transduction domain comprising at least the following sequence: YARAARRAARR (SEQ ID NO: 5). 69. A protein transduction domain comprising at least the following sequence: YARAARRAARA (SEQ ID NO: 6). 70. A protein transduction domain comprising at least the following sequence: YARRRRRRRRRR (SEQ ID NO: 7). 71. A protein transduction domain comprising at least the following sequence: YAAARRRRRRRR (SEQ ID NO: 8). 72. The transduction domain is AGRKKRRQRRR (SEQ ID NO: 2), YARKARRQARRR (SEQ ID NO: 3), YARAAARQARA (SEQ ID NO: 4), YARAARRAARR (SEQ ID NO: 5), YARAARRAARA (SEQ ID NO: 6), and YARRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR 73. The protein transduction domain according to any one of claims 65 to 71, which comprises YAAARRRRRRRR (SEQ ID NO: 8). 73. A protein transduction domain comprising at least one of the following sequences: YARAARRRRRRR; YARAPRRRRRR; YARAPRRPRRR; YARAAARPARA; 74. The molecular weight of the transduction domain is from about 1 kDa to 50 k
74. The protein transduction domain of any of claims 58-73, which is Da. 75. The protein of any one of claims 58 to 73, wherein the protein transduction domain increases transduction efficiency by about 5 to about 10 to about 100 times when quantified by a transduction efficiency assay. Protein transduction domain. 76. The protein transduction domain of claim 75, wherein the transduction efficiency is expressed as an increase in the intracellular concentration of the transduction domain. 77. A DNA segment encoding any one of the protein transduction domains according to any of claims 58-73. 78. A fusion molecule comprising any one of the protein transduction domains according to any of claims 58-73. 79. The fusion molecule of claim 78, wherein the fusion molecule comprises an amino acid sequence genetically linked to the transduction domain as an in-frame fusion. 80. The method according to claim 58, comprising providing a fusion molecule and transducing the fusion molecule into a cell, wherein the fusion molecule is covalently bound to the molecule to be transduced into the cell. 74. A method for transducing a fusion molecule into a cell, comprising any one of the protein transduction domains according to any one of claims 73 to 73. 81. A fusion protein comprising, in sequence, 1) a transduction domain, 2) a first zymogen subunit, 3) a protease cleavage site, and 4) a second zymogen subunit covalently linked. 3. The protein transduction system of claim 2, comprising a fusion protein comprising: 82. The transduction domain is TAT, the first zymogen subunit is p5 Bid, and the protease cleavage site is HI.
V protease cleavage site and the second zymogen subunit is p1
82. The protein transduction system according to claim 81, which is 5 bids (p15 bid). 83. The fusion protein comprises, in sequence, 1) a transduction domain, 2) a first protease cleavage site, 3) a first zymogen subunit,
The protein transduction system according to claim 2, which is a fusion protein comprising 4) a second protease cleavage site and 5) a second zymogen subunit bound by a covalent bond. 84. The transduction domain is TAT, the first protease cleavage site is an HIV p7-p1 protease cleavage site, the first zymogen subunit is p17 caspase-3, and the second protease cleavage site is Is H
84. The protein transduction system of claim 83, which is an IV p17-p24 protease cleavage site and wherein the second zymogen subunit is p12 caspase-3. 85. p17 caspase-3 converts Cys ¹⁶³ to Met ¹⁶
85. The protein transduction system of claim 84 comprising a mutation to ³ . 86. Contacting a cell with an effective dose of a fusion protein, wherein the fusion protein has within the sequence: 1) a transduction domain;
Or a fusion protein comprising a first zymogen subunit, 3) a protease cleavage site, and 4) a covalently linked second zymogen subunit, or 1) a transduction domain, 2) a first protease cleavage. A site 3) a first zymogen subunit, 4) a second protease cleavage site, and 5) a fusion protein covalently linked to the second zymogen subunit, H
A method of killing IV infected cells. 87. The protein transduction system of claim 1, wherein the cytotoxicity further comprises at least one cell-specific or disease-specific protease cleavage site. 88. A sequence wherein the fusion protein comprises covalently linked 1) a transduction domain, 2) a first cell-specific or disease-specific protease cleavage site, and 3) a zymogen. 89. The protein transduction system according to claim 87, comprising: 89. The fusion protein is covalently linked: 1) a transduction domain, 2) a first cell-specific or disease-specific protease cleavage site, 3
88. The protein transduction system of claim 87, comprising: (1) a zymogen fragment as a catalyst; and (4) a sequence comprising a first zymogen subunit. 90. The fusion protein further covalently attached to the C-terminus of the first zymogen subunit, 5) a second cell-specific or disease-specific protease cleavage site, and 6) a second zymogen. 90. The protein transduction system of claim 89 comprising a (zymogen) subunit. 91. The zymogen is caspase, thrombin, bacterial exotoxin, granzasim B or invertebrate toxin.
2. The protein transduction system according to item 1. 92. The caspase is caspase-3 (CPP32 apopain, Yama), caspase-5 (ICE _rel- III, TY
), Caspase-4 (ICE _rel -II TX, ICH-2), caspase-1
(ICE), caspase-7 (Mch3, ICE-LAP3, CMH-1), caspase-6 (Mch2), caspase-8 (MACH, FLICE, Mch5)
92. The method according to claim 91, wherein the caspase is selected from the group consisting of caspase-10 (Mch4), caspase-2 (ICH-1), caspase-9 (ICH-LAP6, Mch6), or zymogen having catalytic-like activity. A protein transduction system according to any one of the preceding claims. 93. The protein transduction system according to claim 92, wherein the caspase is caspase-3 (CPP32 apopain, yama) or a fragment thereof having catalytic activity. 94. The fusion protein further comprising a covalently bound 1
A) transduction domain, 2) cell-specific or disease-specific protease cleavage site,
And 3) the protein transduction system of claim 87, comprising a sequence comprising an enzyme. 95. The protein transduction system according to claim 94, wherein the enzyme is thymidine kinase, cytosine deaminase, or an enzyme fragment thereof having catalytic activity. 96. The protein transduction system according to claim 95, wherein the enzyme is thymidine kinase. 97. The cell-specific or disease-specific protease cleavage site comprises:
Cytomegalovirus (CMV), herpes simplex virus type-1 (HSV-
1), hepatitis C virus (HCV), Plasmodium falciparum (P. falciparum), H
88. The protein transduction system of claim 87, wherein the protein transduction system is selected from the group consisting of IV-1, HIV-2 and Kaposi's sarcoma-associated herpesvirus (KSHV) and protease-specific antigen (PSA) protease cleavage sites. 98. The fusion protein is covalently linked, 1) TA
T or its protein transducing fragment, 2) caspase-3 prodomain, 3) first HSV-1 protease cleavage site, 4) caspase-3 large subunit, 5) second HSV-1 protease cleavage site, and 6 ) Caspase-
89. The protein trait of claim 87, comprising a sequence comprising three small subunits (where the large and small subunits are capable of dimerizing to form cytotoxicity). Introduction system. 99. The protein transduction system according to claim 87, wherein the protein transduction domain is TAT, Antennapedia homeodomain, HSV VP22 or a fragment thereof. 100. The following sequence to which the fusion protein is covalently bound: 1) PSA-
Bid-TAT, 2) PSA-caspase 3-TAT, 3) TAT / STD-U
B-HSV TK-PSA, 4) TAT / STD-17 Casp3-E71T
fF, 5) TAT / STD-p12 Casp3-E7 / TfF, 6) TAT-
p53 WT, 7) TAT-p53 1-364, 8) TAT-p27, 9) T
The protein transduction system according to claim 1, which is AT-Cdk2DN or 10) TAT-p16. 101. A method for administering a therapeutically effective amount of the protein transduction system according to any one of claims 87 to 99 to a mammal, wherein the disease is caused by a disease-specific cell expressing a cell-specific or disease-specific protease. A method for treating a mammal having a disease. 102. The method of claim 101, wherein said mammal is a human. 103. The method according to claim 101, wherein the disease is cancer. 104. The method of claim 103, wherein the cancer is prostate cancer. 105. Expressing a cell-specific property specifically to a target cell, comprising administering a therapeutically effective amount of the protein transduction system according to any one of claims 87 to 99 to a mammal. A method for treating a mammal suffering from a disease caused by a target cell. 106. The method of claim 105, wherein said mammal is a human. 107. The cell-specific property is a high level of heavy metal.
5. The method according to 5. 108. The method according to claim 107, wherein the heavy metal is zinc. 109. The method of claim 107, wherein the high level of heavy metal promotes the conversion of the inactive monomeric protein to an active dimer. 110. The method according to claim 109, wherein the inactivated monomeric protein is a dimerizable transcription factor or a fragment thereof. 111. The method of claim 109, wherein the inactive monomeric protein is a dimerizable HPV E7 protein or a fragment thereof. 112. The method of claim 105, wherein said disease is cancer. 113. The method of claim 105, wherein the transduced protein is a cell cycle inhibitor. 114. The method of claim 105, wherein the transduced protein promotes cell cycle arrest in apoptosis mediated. 115. A p-protein wherein the transduced protein can act as a tumor suppressor
115. The method of claim 114, which is 53 or a fragment thereof. 116. The method of claim 113, wherein said cell cycle inhibitor is p16, p27 or Cdk2DN. 117. The method of claim 112, further comprising administering a chemotherapeutic agent. 118. The method of claim 117, wherein said chemotherapeutic agent is a DNA synthesis inhibitor or a DNA damaging initiator. 119. The method of claim 118, wherein said DNA synthesis inhibitor is a chemotherapeutic agent that interacts with the S-phase of the target cell.