JP2002528109A - Multi-domain polynucleotide molecule sensor - Google Patents

Abstract

  (57) [Summary] A multi-domain polynucleotide responsive to a signal agent is designed and constructed to have at least three domains, which may be partially or completely overlapping or non-overlapping. Yes: actuator (catalytic or reporter) domain, bridging domain and receptor domain. In an exemplary embodiment, a signaling agent, such as a chemical ligand, interacts with the receptor domain, which changes conformation or otherwise affects the cross-linking domain, such that the actuator The activity, catalytic or reporter function of the domain is stimulated or suppressed. In certain ribozyme embodiments, for example, the cross-linking of a ligand to a receptor domain functions to cause a conformational change within the cross-linking the pre-existing catalytic and receptor domains by a novel structural cross-link. The binding results in a ligand-specific molecular sensor composed of RNA, whose structural recognition is indicative of the activity of the adjacent ribozyme. Methods for allosterically selecting other multi-domain polynucleotides typically involve mixing and adapting the domains to optimize cross-linking or other signal response and / or reporter activity. .

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD OF THE INVENTION

The present invention relates to a special class of allosteric polynucleotides II and to methods for producing relatively specific and highly efficient polynucleotide sensors relatively easily and efficiently.

[0002]

BACKGROUND OF THE INVENTION, PRIOR ART

The expertise in molecular force dictating the folding and function of biological polymers allows molecular engineers to participate in the design of enzymes, a task that has so far been largely addressed by random methods of evolution. Would. The reward for acquiring this ability is, in many medical, industrial and biotechnology applications,
It is virtually believed that there is a need for a high speed enzyme that has a precisely tailored catalytic function. "Reasonable design of modules" is an effective means for referencing the additional chemical and dynamic complexity of existing proteins (eg 1-4) and RNA enzymes (5-9) It has been proven that This engineering strategy involves a number of protein (10) and RNA subdomains (11-13).
That can be incorporated with discretion to form new multifunctional constructs. A novel catalytic RNA motif (14,
15) and the recent discovery of novel ligand-binding motifs (16, 17) have greatly expanded the opportunities for ribozyme engineering.

[0003] The rational design of the module is that some artificial, activated or inactivated by the binding of specific small organic molecules such as ATP (5, 8) and flavin mononucleotide (FMN) (9). Ribozymes. Each of these allosteric ribozymes is composed of two independent structural domains: one is a ribozyme that cleaves RNA, and the other is a receptor (or "aptamer") for a specific ligand. By introducing ligands (22-25) that are "adaptive binding" at the ends, a number of different mechanisms ultimately affect ribozyme folding (7, 8) through conformational changes that occur in the aptamer domain. Dynamic regulation of adjacent catalytic domains can be triggered.

[0004] Several groups of researchers have suggested that ribozymes or other nucleic acids could be used in assays and the like. For example, diagnostics using ribozymes that catalyze the cleavage and release of a co-target marker of a non-complementary labeled nucleic acid in the presence of a specific nucleic acid target molecule have been disclosed (43). Nucleic acid molecules that do not have catalytic activity without specific protein or nucleic acid cofactors and that only exhibit catalytic activity in the presence of the same macromolecular cofactor have been disclosed to be useful early in therapy (44). ). Bioreactive allosteric polynucleotides that modify the function or conformation of a polynucleotide with chemical effectors and / or physical signals are disclosed for biosensors and / or enzymes for diagnostic and catalytic purposes. (45).

[0005] In almost all cases reported to date, allosteric ribozymes are generated by combining a ribozyme domain with a domain (or "aptamer") to which a pre-existing ligand is bound. Has produced a selective ligand-responsive construct (9,65). These methods require the use of structures to which pre-existing ribozymes and ligands are bound, thus limiting the number of currently available RNA domains, resulting in allosteric ribozyme engineering techniques. The range of applications is limited. Moreover, the rational design of modules, alone or in combination with in vitro selection techniques, has been successful in producing allosteric catalysts from pre-existing aptamers and ribozyme motifs, but the method is slow and tedious. Can be boring. Many previously described procedures required to identify nucleic acids with specified binding or catalytic properties require a stepwise interaction of binding, distribution and amplification (46-53). . Furthermore, the use of only rational design of the module has prevented the development of allosteric ribozymes controlled by effectors in the absence of aptamer motifs.

[0006]

[Problems to be solved by the invention]

Rational design of modules, in vivo selection, to provide an effective strategy to quickly generate accurate polynucleotide molecular sensors
It is an object of the present invention to use a combined application consisting of an allosteric selection. As a novel sensor and in vivo for gene expression regulation and / or reporting
It is another object of the present invention to provide a specific method using a polynucleotide as a vo gene regulator. It is a further object of the present invention to provide polynucleotide detectors for use in various clinical, industrial, agricultural and environmental assays.

[0007]

[Means for Solving the Problems]

These and many objects are achieved by the present invention, which consists of an actuator domain, a receptor domain, and a bridging domain, and depending on the result of a signal such as binding of a ligand to the receptor domain, the catalytic activity of the actuator domain and Provide a purified functional polynucleotide that causes a conformational change in the bridging domain, which then modulates reporter activity. Domains may be partially or completely overlapping or non-overlapping, so that the function of one or more domains may be partially encoded by the same polynucleotide sequence. The polynucleotide may consist of RNA and / or RNA analogs or DNA and / or DNA analogs; a three-part ribozyme is described in the examples.

[0008] Screening methods for multi-domain polynucleotide sensors using allosteric selection are also provided. In a typical method, the structural components of a multi-domain allosteric polynucleotide are replaced with domains of a random sequence, using in vitro selection to generate new receptor domains or even newer actuator domains. Briefly, using an exemplary method, randomization of the region of the polynucleotide to which the ligand is bound generates a new structurally distinct polynucleotide, which then interacts with the other ligand. To be screened.

[0009] The polynucleotide sensors of the present invention include, but are not limited to, organic and / or
Or to qualitatively or quantitatively measure various ligands, such as inorganic compounds, metal ions, drugs, metabolites of microorganisms or cells, components of blood or urine, components of other body fluids, and macromolecules. used. This sensor can also be used to respond to electromagnetic and / or physical signals such as temperature, light, sound, shock, pH and ionic state. The sensor is, in some embodiments, attached to a solid support. Biosensors having the multi-domain polynucleotides of the invention as a detection agent are also provided.

[0010] The polynucleotide sensors of the invention also regulate or report the expression of genes in response to ligands or signals, including non-invasive diagnostic and gene therapy strategies.
As a gene regulator, it can be used in vivo. In this aspect, the method of the present invention includes a method for regulating the expression of a gene in a cell by operably linking the polynucleotide of the present invention to the genetic molecule of the cell, thereby comprising: The biological or phenotypic activity encoded by the gene is modulated according to the modulation of the activity of the actuator domain. In embodiments involving the expression of a gene using RNA, the multi-domain polynucleotide sensor comprises mRN
A coding region or very close region, also 5'-leading region or 3 '
-Can be incorporated into the terminal region. In DNA embodiments, the polynucleotide sensor can be integrated into the region that disrupts the signal gene and expresses the gene.

[0011] The method of generating other multi-domain sensors in a ligand-responsive manner of the present invention is also provided by the generation of novel allosteric molecules using rational design strategies for modules. In an exemplary embodiment, the necessary structural components of an allosteric ribozyme are polymorphic with a binding site for a novel effector or a catalytic domain regulated by the novel effector, which can be screened using in vitro selection. To produce nucleotides, they are replaced with domains of random sequence. Briefly, in one embodiment, for example, by randomizing the region to which the ligand of the allosteric ribozyme binds, the novel structure changes and responds to ligand binding and / or
Or a family of structurally parallel polynucleotides that are screened for their efficiency in reporting. Using this allosteric selection strategy results in novel allosteric ribozymes with specificity for a wide variety of effector molecules. Methods using the multi-domain polynucleotide sensors of the invention are provided correspondingly, as are methods for preparing a polynucleotide that respond to the presence or absence of a signaling agent such as a chemical ligand that binds to the receptor domain. You. Analytical sensors having the multi-domain polynucleotides of the invention as detection agents are also provided.

[0012]

DESCRIPTION OF THE PREFERRED EMBODIMENTS

The present invention provides a polynucleotide actuator domain and a receptor domain,
It is also based on the finding that combining the bridging domains, which provides a link between the two, provides an accurate polynucleotide sensor.
By using a modular design strategy that mixes and coordinates domains, multi-domain polynucleotides are modified to give rise to a large number of structurally parallel sensors, and then optimal binding and / or reporting Screened to identify sensors that show activity.

In practicing the present invention, an actuator domain, a receptor domain, and
A purified functional polynucleotide consisting of a bridging domain is generated by a signaling agent, such as binding of a ligand to the receptor domain, to cause a conformational change in the bridging domain that regulates the activity of the actuator domain. Or selected. The overall structure may be such that the signal agent partially or completely “on” or “off” the reporter domain by interacting with the receptor domain.
Function as a molecular switch, and then are linked by a bridging domain. Molecular cross-linking in engineered sensors is a functional linking module that is not passive, but rather activates, accelerates, decelerates or causes the action of a catalytic or reporter actuator. Indeed, as will be discussed in more detail below, the present invention relates to the use of a receptor within a polynucleotide such that a sequence modulates the activity of an actuator domain when the receptor domain is acted upon by a ligand or a physical signal. Includes methods for imparting or enhancing allosteric properties to a polynucleotide by inserting into the polynucleotide a linking module sequence that bridges the domain and the actuator domain. In some embodiments, different coupling modules are further used to modify the properties of the catalyst or reporter actuator, such as altering the kinetics of the reaction rate. In other embodiments, a bridging domain may overlap a receptor or reporter domain such that it is no longer present as a whole different structure. The novel allosteric polynucleotides of the present invention are by altering the actuator domain or the receptor domain to screen sensors so generated to identify sensors with optimal detection and / or reporting activity. , Generated using the module's rational design strategy. The generation of some novel RNA sensors using this method is described in Example 3 below.

[0014] Other additional domains may also be part of the construct, such as, for example, multiple receptor domains for the measurement or detection of multiple components in a mixture being tested by a sensor. The two or more domains may be partially or completely overlapping or non-overlapping, i.e., of partially overlapping sequences and non-overlapping sequences. Both may be contained. Thus, as used herein, “domain” is in a functional sense, not a physical sense, and a sensor of the present invention may have at least three directly or indirectly bound together. It need not be composed of different combinations of the three different sequences, but instead some or all of the bases in the domain may be composed of sequences that overlap each other.

[0015] The multi-domain polynucleotide molecule sensor of the present invention can be RNA, RNA analog, DNA, DNA analog, or a mixture thereof. Analogs include chemically modified bases and unusual natural bases, including but not limited to 4-acetylcytidine, 5- (carboxyhydroxymethyl) uridine, 2′-O-methyl Cytidine, 5'-carboxymethylaminomethyl-2
-Thiolysine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2'-O-methyl pseudouridine, β-D-galactosylcuosin, 2
'-O-methylguanosine, inosine, N6-isopentenyladenosine, 1-
Methyladenosine, 1-methyl-pseudouridine, 1-methylguanosine, 1
-Methyl inosine, 2,2-dimethyl guanosine, 2-methyl guanosine, 2-
Methyladenosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxy-aminomethyl-2-thiouridine, β-D-mannosylcuosin, 5
-Methoxycarbonylmethyluridine, 5-methyloxyuridine, 2-methylthio-N6-isopentenyladenosine, N ((9-β-D-ribo-furanosyl-2-methylthiopurin-6-yl) carbamoyl) threonine, N- ((9-
β-D-ribofuranosyl-purin-6-yl) N-methyl-carbamoyl) threonine, uridine-5-oxyacetic acid methyl ester, uridine-5-oxyacetic acid, wibutoxocin, pseudouridine, cuocin, 2-thiocytidine, 5
-Methyl-2-thiouridine, 2-thiouridine, 4-thiouridine, 5-methyluridine, N-((9-β-D-ribofuranosylpurin-6-yl) carbamoyl) threonine, 2′-O-methyl- 5-methyluridine, 2'-O-methyluridine, wibutosin, and 3- (3-amino-3-carboxypropyl)
Uridine. Polynucleotides modified during or after preparation of the sensor using standard means are further encompassed by the present invention.

As summarized above, the polynucleotide sensor of the present invention has been designed,
An actuator domain, constructed independently or together, linked to a cross-linking domain such that binding of a ligand and / or signal to the receptor domain causes a conformational change in the cross-linking domain that regulates the activity of the actuator domain And a receptor domain. Because they are responsive to ligands and / or signals, the multi-domain polynucleotides of the invention can be used in a variety of applications, particularly as detectors in clinical, industrial, agricultural and environmental assays, and for gene expression. It has uses as a gene control or reporting factor.

The sensor of the present invention can be used in the form of a solution, a suspension, or attached to a solid carrier. The polynucleotide is used to detect the presence or absence of a ligand or signal in the sample, by contacting the sample with the polynucleotide, alone or as a component of an analysis kit or probe. In a typical implementation of these methods, the sample consists of the polynucleotide or polynucleotide as a detection agent for a period of time under conditions sufficient to observe the catalytic or reporter effect generated by the actuator domain. Incubate using the device. This includes measuring and / or observing autolysis or conjugation of the polynucleotide; binding of radioactive, fluorescent or chromophore tags; binding of monoclonal or fusion phage antibodies;
Alternatively, it is monitored using any method known to those skilled in the art, such as a change in component concentration, spectrophotometric or electrical properties. Current biosensor technology using potentiometric electrodes, FETs, various probes, redox-defining capabilities, and the like, provides a novel method for measuring changes in the function or conformation of a polynucleotide initiated by an actuator domain. It is an advantage of the present invention that it can be adapted for use in combination with a polynucleotide sensor.

The sensors of the present invention can be used to detect the presence or absence, as well as the concentration, of a compound or other ligand. Sensors include, but are not limited to, all types of organic and inorganic compounds, metal ions, minerals, macromolecules, polymers, oils,
Any type of ligand, such as metabolites of microorganisms or cells, components of blood or urine, other body fluids obtained from biological samples, pesticides, herbicides, toxins, non-living substances, and combinations of any of these Can also be engineered to detect. Organic compounds include various biochemical products in addition to those mentioned above, such as amino acids, peptides, polypeptides, nucleic acids, nucleosides, nucleotides, sugars, carbohydrates, polymers and lipids. One or more ligands may be sensed by the same sensor in some embodiments.

As described above, the sensor of the present invention can measure blood components such as glucose, electrolytes, metabolites, and gas; serum analysis measurement; bacterial and virus analysis; drug and drug analysis: drug design; It has broad clinical diagnostic and medical and veterinary applications, such as tissue compatibility; cell adhesion studies; bacterial and viral analysis; DNA probe design; gene identification; and hormone receptor binding. For industrial use,
Detection of vitamins and other components, toxins and microorganisms in food; military applications such as bar test; industrial emission control; pollution control and monitoring; remote detection; process control; separation chemistry; . Agricultural applications include farm and garden analysis, evaluation of gene regulation, and the effects of compounds, particularly low molecular weight compounds (including in vivo measurements), on transgenic plants and animals.
Multiple sensors can be placed on a single detector or chip as depicted in FIG. 16 to detect multiple ligands and other signaling agents.

In an alternative embodiment, or in combination with ligand detection, the multi-domain polynucleotide sensor of the present invention provides, but is not limited to, irradiation, such as UV irradiation of a confined effector depicted in FIG. Any change in molecular conformation, physical signal, electromagnetic signal, such as temperature change, pH, ionic concentration, impact, sound, and combinations thereof, and any energy reception measurable by the combination. It can be made to respond to changes.

Upon stimulation by a ligand or signal, the actuator domain modifies its catalytic or reporter function. Observation of changes in the conformation or function of the polynucleotide can be used to measure this. In many embodiments, standard assays are used to autolyze or ligate polynucleotides,
An observation of a chemical reaction is made, such as measuring and / or observing decomposition of a substrate or formation of a catalytic reaction product. In other words, simply binding radioactive, fluorescent or chromophore tags, binding monoclonal or fusion phage antibodies, or binding tagged antibodies is observed. Instead, ingredient concentration, temperature, pH,
Changes in aspects, spectrophotometric or electrical properties, etc. can be observed.

As mentioned above, the present invention accordingly provides for contacting a sample with a polynucleotide sensor of the present invention, which is responsive to ligands and / or signals, by contacting the sample with one or more ligands and / or Alternatively, a method for detecting a signal is provided. In many cases with a solid support, the use of sensors responsive to one or more ligands and / or signals, the use of an array of sensors responsive to different ligands and / or signals, respectively, and one or more The use of multiple sensors in tandem with a ligand and / or signal responsive sensor is encompassed by the present invention.

The multi-domain polynucleotide sensor of the present invention can also be used for controlling and / or reporting the expression of a gene in vivo. For example, ribozymes exhibiting novel allosteric binding specificities and exquisite kinetic properties can be generated using allosteric selection and function inside cells with levels of biologically important catalytic performance . In these embodiments, the regulation or reporting of the gene expression of the organism in the cell is such that the biological or phenotypic activity encoded by the gene is regulated according to the regulation of the activity of the actuator domain. This is achieved by operably coupling the sensor to the genetic molecule within. An RNA sensor encodes a gene of interest as long as the sensor functions to stimulate, terminate, or regulate the expression of gene translation in the presence of the sensor's corresponding ligand and / or signal. , MRNA coding region, or region very close to it, or 5'-leading region or 3
'-Terminal region can be incorporated anywhere. Similarly, a DNA sensor is capable of self-destruction of a gene as long as the sensor functions to stimulate, terminate, or regulate the expression of gene translation in the presence of the sensor's corresponding ligand and / or signal. The region encoding the gene of interest, the region upstream of gene expression, as well as the coding region of the gene, can be incorporated anywhere in the gene of interest or the gene that regulates it.

Sensors are inserted into genetic molecules for the control and / or reporting of gene expression using standard methods for introducing foreign genes into cells. The methodology depends on the gene of interest, but typically transfects cells, transforms cells using plasmids; herpes, adeno, adeno-associated, vaccinia, retroviruses and other inserted vector viruses and liposomes. Or transduction. Less commonly, the degradation of cellular genetic material, followed by the insertion of exposed RNA (or DNA) by ligation, may also be used.

[0025] Gene expression can be regulated or reported in any type of organism, including microorganisms, plants and animals. Modulation of a gene is achieved using standard methods by administering an appropriate ligand and / or signal to cells having a sensor attached to the genetic molecule. For example, administration of a ligand to a microorganism
It is typically achieved simply by adding or removing the ligand in the medium, or by sprinkling bacteria, yeast or fungi. The ligand can be administered to the plant by spraying or injecting the plant itself, or by applying it to the soil and / or with water.
The ligand may be administered to the animal orally, topically, intravenously, intravenously, and intraperitoneally, typically in combination with a pharmaceutically acceptable carrier. Reporting of gene expression is correspondingly determined by measuring the receptor binding to the ligand and is administered to or produced by organic matter, almost any biological or pharmaceutical of interest. It can be used for non-invasive diagnosis of compounds. In this context,
The multidomain polynucleotides of the present invention are useful both in non-invasive diagnostics, and for the control of therapeutic ribozymes.

The present invention accordingly provides for the actuation of the actuator domain, the receptor domain, the receptor domain, the receptor domain,
And providing a method for preparing a polynucleotide responsive to the presence or absence of a chemical effector or other ligand, a physical signal, an electromagnetic signal or a combination thereof, comprising binding the cross-linking domains together. I do. Other sensors can be developed by mixing and matching domains from different sensors.

Some sensors of the present invention are developed with an allosteric selection. Allosteric selection is an i.p. for the development of allosteric nucleic acid enzymes in which aptamers are controlled by previously unidentified ligands.
It is an n vitro selection technique. In this capacity, allosteric selection also represents a novel approach to aptamer generation over bound target ligand. To this end, a library of random sequences is typically attached to a catalytic nucleic acid motif, such as the hammerhead ribozyme depicted in FIGS. The random domain can be attached directly to the ribozyme (FIG. 1A) or by an existing “ligation module” (
1B and 8). In the latter case, the ligation module would suppress autolysis within the ribozyme domain in the absence of the target ligand. In this method, if ligand binding to a unique sequence derived from the random region causes a conformational change that aids in ribozyme degradation, in vitro selection for autolysis in the presence of the target ligand ,
New aptamers and allosteric ribozymes will result.

Using this selection strategy, four natural 3 ′, 5′-cyclic mononucleotides, including the second messengers cGMP and cAMP, are targeted by the hammerhead ribozyme of Example 3. Was. This collection of molecules provides a different set of targets that are biologically important and challenge the structure formation and molecular recognition capabilities of RNA. Only when cultured with their corresponding effector compounds, ribozymes that rapidly self-degrade were identified. Typical R
NA exhibits 5000-fold activation in the presence of cGMP or cAMP, and thus exhibits precise molecular recognition properties and operates at a catalytic rate consistent with that exhibited by the unaltered ribozyme. These findings indicate that ligand-responsive ribozymes with a vast number of dynamic structural properties can be generated in a massively parallel manner. Moreover, the optimized allosteric ribozymes provide a particularly selective sensor as a chemical reagent or genetic regulator for the programmed destruction of cellular RNA.

[0029] Allosteric selection of aptamers for small ligands has two significant advantages as compared to traditional affinity chromatography methods for aptamer selection. First, aptamers for many ligands can be generated in a single selection, rather than the laborious single ligand-single aptamer selection strategy provided by affinity chromatography. Second, the aptamer is covalently modified on a solid support and selected to bind free ligand in solution, rather than immobilized ligand. This aspect provides aptamers that may be fully accessible to the entire ligand. It is contemplated that any effector-ribozyme pair can be developed using this approach. Therefore, this unique method of nucleic acid development can be used to develop nucleic acids that interact with various ligands, such as small organic compounds, peptides or proteins, or other nucleic acids. In addition to the bound ligand, allosteric selection also provides a means to develop nucleic acid motifs that can detect various physical phenomena such as pH, temperature, ionic state or light.

Without wishing to be bound by any theory, the link module function provided by the bridging domain may be one or a combination of mechanisms such as the “slip structure” interconversion described in Example 1 below. Is believed to be achieved in the sensor of the present invention. Control also includes steric interactions such as binding of small compounds, structural stabilization such as unfolding or misfolding in the presence or absence of effectors, antisense effects based on simple nucleobase pairs, and / or quaternary interactions. This can be achieved using a graded structure. Any type of ligand binding relay, or physical or electromagnetic effect sensed by the receptor domain, can be used to transfer information to the actuator (reporter or catalytic) domain via the bridging domain.

It is an advantage of the present invention that the use of polynucleotides as sensors provides advantages over protein-based enzymes in many commercial and industrial methods. Protein stability, supply, substrate specificity, and
All issues, such as unchangeable reaction conditions, limit the practical implementation of natural biocatalysts. DNA can be engineered to act as a sensor under defined reaction conditions. Moreover, sensors made from DNA are considered to be much more stable and can be easily manufactured by automated oligonucleotide synthesis. In addition, both DNA and RNA sensors can be selected for their ability to function on a solid support, and when immobilized, their activities would be retained.

As noted, the present invention further encompasses the use of multi-domain polynucleotide molecule sensors on solid supports such as assays, diagnostics, catalytic processes, and the like. Immobilization of novel RNA or DNA enzymes to test ligand or chemical transformation in continuous flow reactors for testing individual samples or under both physiological and non-physiological conditions Novel features of the coated surface are provided for efficient detection. The fabrication of the new sensor can be tailored to respond efficiently to certain ligands or signals, respectively, under user-defined conditions. Due to the high stability of DNA phosphodiester bonds, multi-domain DN
It is believed that such surfaces when coated with the A sensor will remain active much longer than similar surfaces that can be coated with protein enzymes or ribozymes.

[0033] A variety of different chromatography resins and coupling methods can be used to immobilize the sensors of the present invention on a carrier. For example, as described previously (4
5), a simple non-covalent method utilizing the strong binding affinity of streptavidin for biotin can be used. In other embodiments, the sensor can be attached to the column carrier by covalent attachment to a matrix, thereby producing a long-lived biosensor. Various parameters of the system, such as temperature, sample preparation, sensor size and sensitivity, can be adjusted to provide optimal sensing characteristics. In fact, these parameters can be based on dynamic or other characteristics exhibited by the immobilized sensor.

In conclusion, the simultaneous use of rational combined approaches to enzyme engineering (41) provides a powerful approach to designing new ribozymes and other sensors. As described below, in some embodiments,
The three-part ribozyme construct generated using this strategy of polynucleotide engineering functions as a highly specific sensor for a variety of small organic compounds. A critical component of these constructs is a ligand-responsive crosslinker. These dynamic structural domains allow engineers to quickly use the novel RNA molecular sensors by simply swapping domains within the context of a three-part construct.
Works as a simple linking module. In addition, the introduction of mutations in the receptor domain of the construct should allow for the in vitro selection of the domain to which the new ligand is bound based on the regulation of catalytic or other reporter activity. is there. In a similar way, acting as a new accurate biosensor,
Or a novel R that functions in vivo as a gene regulator or reporter that regulates gene expression in response to the presence of many different types of effector molecules
NA molecular sensors can be manufactured.

[0035]

【Example】

 The following examples are provided to further describe and illustrate the present invention.
It should not be taken to be limited to any point.Embodiment 1 FIG. Engineeringly accurate RNA molecular sensors  The use of a novel molecular bridge specific to RNA-based ligands
By binding the pre-existing catalytic domain and receptor domain
(65). Coupling within the crosslinks by binding of the ligand to the receptor
A conformational change is caused, and this structural alteration is caused by the activity of adjacent ribozymes.
Command. Due to the nature of the modules of these three-part constructs,
Fast, accurate RNA molecular sensor triggered only in the presence of the corresponding ligand
It becomes possible to build well.

Materials and MethodsOligonucleotide  Synthetic DNA and 14-nucleotide substrate RNA were prepared by standard solid-phase methods.
(4), (8M urea) polyacrylamide gel as described previously.
Purified by denaturing electrophoresis (PAGE). The RNA substrate is
4 polynucleotide kinase and (γ-³²5) Using P) -ATP³²P
-Labeled and repurified by PAGE. Use T7 RNA polymerase
A double-stranded DNA template for in vivo transcription is constructed with a D
On the NA template, primer A (5'-TA-ATACGACTCACTATAGG
By extending GCCGACCCTGATGAG, SEQ ID NO: 32)
Was generated. The extension reaction was performed using reverse transcriptase (RT) as described previously.
) (7).

[0037]In vitro selection  Selection for allosteric activation was performed at 23 ° C. for 20 hours with 10 μL of
Reaction buffer (50 mM Tris-HCl (pH 7.5 at 23 ° C.))
M MgCl₂)) Without FMN, each successive for autolysis
Population (1 μM, internal³²P-labeled RNA; see Reference 5)
It was done by choosing. The pre-selection for G4-G6 was
Occasionally at 5-hour intervals by heating to 65 ° C for 1 minute to
The folded molecule was folded again. Undegraded RNA is converted to (8M
Gel purified and denatured by denaturing 10% (urea)
And precipitated with ethanol. When the obtained RNA is designated
By culturing in reaction buffer in the presence of 200 μM FMN during
did. Response to positive selection during subsequent iterations of the selective-amplification method
Time is advantageous for allosteric ribozymes with the fastest rate of autolysis.
To be reduced. Replicate the product separated by 10% PAGE
And PhosphorImager and ImageQuant software (M
Quantitative analysis was carried out using an E.co. The existence of FMN
The 5'-degraded fragment produced in the presence was isolated as described above.
RT-PCR (primer A and primer B: 5'-GGGGCAACCTAC)
GGCTTTCACCGTTTCG (5, 9, SEQ ID NO: 33))
Therefore, to amplify and obtain the resulting double-stranded DNA to generate the next RNA population
Transcribed in vitro (5). Selection for FMN suppression, FM
The same procedure was followed except that N was included in both transcription and preselection.
Exclusion was excluded. Individual molecules from the G6 population of both selections were
By cloning (TA cloning kit, Invitrogen)
) Isolated and analyzed by sequencing (ThermalSequena)
se kit, manufactured by Amersham).

[0038]Allosteric ribozyme assays  Inside³²A P-labeled autolytic ribozyme (100-500 nM),
And 200 μM FMN, 1 mM theophylline, or 1 mM ATP.
The reaction containing any is started by adding reaction buffer and
Cultured through several half-lives while sampling at PAGE of the product
Separated by denaturation and the yield quantified as described above. speed
The constant is plotted as the natural log of the fraction of RNA that has not been resolved over time.
And derived by establishing the negative slope of the resulting line. Given it
Each rate constant value is the lowest average of the three replication assays, each with 2
The fold was less different. Class I inducer and class II suppressor
The ribozyme having was arbitrarily selected for detailed analysis.

The assay consisting of two molecules was determined using the trace amount of 5′- ³² P-labeled substrate (〜
It was performed under a single round of metabolic conditions with an excess of ribozyme (5OnM) (500nM). The reaction was started by mixing the ribozyme and substrate separately pre-cultured in reaction buffer for 10 minutes at 23 ° C. Dynamic parameters were generated as described above. Product yields were corrected for the amount of substrate remaining undegraded after extensive culture with unmodified hammerhead ribozymes (5). The value for each given rate constant is
The lowest average of the two replication assays, differing by less than two folds.

Results and DiscussionIn vitro selection of allosteric ribozymes  Aptamers (26) with separate FMN binding and cross-linking of random sequences
Hammerhead ribozyme (27, 28) domains
,> 65,000 different RNA populations were generated (FIG. 2A). Cross-linking han
Merhead motif, a critical determinant of ribozyme activity (29, 30)
It replaces most of the natural "stem II" portion of the structure factor. 3 copies obtained
The randomized domain in the construct consisting of
Sampling alternative stem II factors that would respond to FMN binding in
Either positive or negative allosteric control on adjacent ribozyme domains
Will give. Two identical RNA pools (~ 6 x 10 each¹²Molecule)
, FMN-dependent allosteric induction (FIG. 2B) or allosteric inhibition (FIG.
In vitro selection was performed for either one of FIG. 2C). Riboza
To isolate the crosslinks that govern allosteric induction of the im, the absence of FMN
The "negative selection" for autolysis below was applied to the first pool. This
RNA that remained undegraded during the reaction was isolated and autolysed in the presence of FMN.
For a positive selection. This method is used when FMN is detected.
Is considered to be advantageous for the isolation of ribozymes that activate only when activated. Contrast
The second pool was subjected to both transcription and pre-selection in the presence of FMN.
Was. The remaining RNA precursor is then removed by positive selection in the absence of ligand.
Ribozyme to provide allosteric suppression
It is advantageous to isolate the commanding crosslinks.

Both RNA populations isolated after six rounds of selection (G6) were FM
High sensitivity to N, indicating that the combined engineering approach is an effective means to generate ribozymes that function as very specific molecular switches. In vitro selection methods can produce novel RNA structures that degrade by some other means under reaction conditions that permit replication. For example, the isoalloxazine ring or the like found in FMN has been shown to promote photodegradation of RNA molecule (31) and may work where it is thought to be a novel cofactor for FMN-dependent ribozymes. However, RNA isolated by selection appears to degrade in a reaction mediated solely by the original hammerhead ribozyme domain incorporated into each construct, as determined by the gel mobility of the RNase fragment. .

[0042]Sequence and functional properties of the isolated crosslinking factor  G6 populations from both selections were cloned, sequenced, and allosteried.
Assayed for specific function (FIG. 3). Shown as "Inducers" I-VIII
Different classes of cross-links identified within the FMN-inducible RNA population
did. Ribozymes with these different classes of inducers are free of ligand
Resident (K_obs-) Or in the presence (K_obs+) To set a unique rate constant for autolysis
(FIG. 2A). Most classes are allosteric larger than 100 folds
Activity (K_obs ⁺/ K_obs ⁻) (FIG. 2B), Class I, III and VII
Showed an FMN-dependent rate increase of ２270 fold. This allosteric
Induction is largely akin to the dynamic regulation found in some natural allosteric protein enzymes.
The magnitude is the same (32). Furthermore, K obtained in almost all classes_obs+ Value is
, The maximum K measured for the unmodified hammerhead ribozyme_obs
(1.1 minutes^-1) (FIG. 3A).

Similarly, five different classes of crosslinks were identified and designated as “suppressors” IV (FIG. 3C). FMN showing moderate response to in vitro selection
Unlike the population that can be induced with, no ligand-dependent suppression of ribozyme function was detected until G3 in this parallel selection. Interestingly, each of the five classes has a 1- or 2-nucleotide deletion in the randomized bridging domain, which indicates that all of the sequence variants consisting of the original RNA pool are allosteric. This suggests that it did not form enough ligand responsive factors to provide suppression. The relative slowness of the resulting population of FMN-suppressed RNA can necessitate the emergence of specific nucleotide deletions within the bridging domain (frequent deletions during selective amplification methods). Occurs depending on what happens). The fact that the sequences of the repressors are very homogeneous is consistent with this assumption, indicating that emergence and diversification of a single responsive cross-linking domain can occur in all classes tested. I have. All five classes show substantially allosteric inhibition (200-600 fold) in the presence of FMN (FIG. 3D).

[0044] Many of the cross-linking factors isolated by selection are unmodified hammers.
-At least 10-fold lower than the value measured for head ribozyme H1
The highest speed increase (FIG. 3). The largest rate constant for RNA degradation
The allosteric ribozymes shown are class II inducers (K_obs+ = 0.25 minutes
^-1) Or class II inhibitors (K_obs− = 0.45 minutes^-1). these
The highest rate constants for the two ribozymes are only 4-
Fold and 2-fold. Similar in vitro selection method
As described for RNAs sensitive to FMN,
A population of theophylline-dependent ribozymes using a three-part conformation has been isolated.
Was. Ribozymes sensitive to individual theophyllines from this population are:
Minute^-1A rate constant that exceeds the
Ribozymes actually function as efficiently as unmodified ribozymes
It was confirmed that it could be made to

[0045]Fast interconversion between active and inactive ribozyme structures  The inactive state for ribozymes with class I inducers (FIG. 4A)
It is maintained for a long time in the absence of MN and produces only 〜1% autolysis per hour (
(FIG. 4C). However, autolysis can increase the catalyst rate by about 270-fold.
In this case, which results in almost instantaneous response to the addition of ligand (FIG. 4C; inset)
Triggered intermittently. May be maintained by inducers in the absence of FMN
The “off” state is the ability to form a stable stem II structure required for ribozyme activity.
It lacks power. Instead, each factor has the form of this essential stem.
Form different structures that hinder growth. FMN binding binds the inducer to the ribozyme mechanism.
Conformational changes within aptamers that rapidly convert to structures compatible with
By triggering, the "on" state is determined. In contrast, class II factors
The ribozyme with () (FIG. 4B) rapidly autolyzes in the absence of FMN,
Rapid conversion to the inactive state by addition of ligand (FIG. 4D; inset). here,
Inhibitors reduce the specific cross-linking structure that binds FMN and interferes with ribozyme function.
By maintaining the "off" state. By releasing the ligand,
Rearrangement of the structure of the bridge occurs, establishing the "on" state of the adjacent ribozyme. I
However, when FMN is present, which structural state is seen as a class II inhibitor
It remains unclear why the rate of degradation is slow. FMN-Re
Whether the bozyme complex remains weakly active or under equilibrium binding conditions
Small number of FMN-free RNAs contributes to the observed RNA degradation rate
More experimentation is needed to determine if you are.

[0046]Mechanism of allosteric function  Rapid ligand-dependent activation or suppression of ribozyme function can modulate activity.
Conformational changes required for ligand binding with high responsiveness
It must be there. Several factors may make this allosteric
Transitions are caused by base pair changes localized within each bridging domain.
And the binding energy resulting from ligand-aptamer complex formation is
Appears to be used to cause this shift in the conformation of the structure.

A critical component of the proposed mechanism for both allosteric induction and repression is a single truncated AG located within the aptamer domain immediately adjacent to the bridge.
Base pairs, which only form when FMN is bound (33, 34).
For class I inducers, the presence of FMN stabilizes the AG base pair, which in turn establishes specific registration for base pairs within the bridge (FIG. 5A). In the absence of this FMN-dependent structural constraint, the base pairs in the bridge can slip one base pair for the AG interaction, thereby providing the GC bases required for ribozyme function. Will be replaced by a pair. This inactive conformation will be maintained if a single nucleotide does not protrude from the upper strand of the bridge. Symmetric internal ridges are known to be more stable than asymmetric or single nucleotide ridges (35). Hence, the registration determined by the truncated A and G base pairs will be faithfully inherited along the bridging factor when the presence of a symmetric internal ridge favors the continuously stacked stem II domain. Can be made to. Interestingly, all suppression modules obtained deletions that appeared to be essential for their function. In this case, when FMN is bound, this corresponds well to the slip-structure mechanism, since successively stacked bridges break the critical GC base pairs of the ribozyme. , The absence of FMN would allow proper ribozyme folding (FIG. 5B).

To further investigate this “slip structure” mechanism for allosteric regulation, several ribozyme constructs were generated using a stable stem-loop structure instead of the domain to which FMN is bound. (FIG. 5C). In its occupied state, FMN aptamers form small, almost A-shaped RNA structures (
34). Therefore, the stem-loop structure incorporated into the test construct is a slip structure that is presumed to be necessary for either stimulating the FMN-bound aptamer to induce or suppress ribozyme function. Should be implemented. For example, construct I-1 can be performed by performing the formation of a truncated AG pair.
It is designed to stimulate the structure of class I inducers bound to FMN. In fact, the K _obs for I-1 in the absence of FMN is the same as the rate constant for the FMN-induced form of the parent allosteric ribozyme (Table 1). Two additional constructs (I-2 and I-3) were used to determine the rate constant when opposing "slip" paradoxes were performed with progressively stronger base pairs. Construct I-2 is not significantly suppressed when the aptamer is replaced by a structure that should favor an inactive conformation. In this circumstance, a single raised nucleotide along the upper strand of the cross-link could possibly result, which would reverse proper ribozyme folding. However, consistent with the proposed mechanism for allosteric function, where the introduction of additional base pairs during the crosslinks forming construct I-3 would prevent the formation of possible bumps The activity of the adjacent ribozyme is substantially reduced.

Further evidence for a slip-structure mechanism was provided by examining class II inhibitors. Here, FMN binding enforces a base-pairing pattern that prevents the formation of an active ribozyme conformation (FIG. 5D). In the absence of FMN, the loss of AG base pairs can allow the remaining base pairs to slide by one nucleotide, thereby forming an active ribozyme conformation. Constructs II-1 and II-2, designed with a stem-loop structure that implements two different base pair conformers, provide values for the active and inactive states of the parent allosteric ribozyme, respectively. And a rate constant almost corresponding to (Table 1). In all examples, the cross-linking factor made the stem structure possibly unstable,
Contains unpaired bases that provide rapid interconversion between different structural states. A similar RNA switch mechanism could play an important role in the structure and function of 16S ribosomal RNA (35, 36), and findings pointing to this mechanism for allosteric function would not be without precedent. . Alternative mechanisms for allosteric function can be implemented, but all of these significant correlations are consistent with the proposed slip-structure mechanism. Similar studies with the remaining class of crosslinkers will reveal whether this mechanism also occurs more commonly.

[0050]Engineering allosteric ribozymes with novel ligand specificity  The binding energy provided by the ligand-aptamer complex is reduced by two slips.
Used to shift the thermodynamic balance between structural conformations
If applicable, then each crosslink is independent of the aptamer sequence and ligand specificity.
A reporter for the occupied genus of an adjacent aptamer domain
Can be used. To investigate this possibility, FMN aptamers must be sensitive to FMN.
Apta that binds theophylline by removing it from class I inducers of ribozymes
Substituted with either aptamer (37) or an aptamer (38) that binds ATP
(FIG. 6A). In each case, the binding of the ligand is
It is known to stabilize the base pair of nucleotides at the end of the tamer (33
, 38, 39). Therefore, binding that helps the aptamer to adapt the ligand to the environment
Causes allosteric transitions required for class I functions
Can be done. In fact, each ribozyme construct has a ligand of the same nature.
Autolyzes only in the presence (FIG. 6B). The dynamic analysis (FIGS. 6C and 6D) shows that the FMN
Induced ribozyme activity increases 270-fold in the presence of FMN
In contrast, ribozymes that can be induced by theophylline- and ATP-
110-fold and 40-fold, respectively, only by their corresponding ligands.
This indicates that it is activated. These findings suggest that ribozyme activity
The work of regulation is mainly based on cross-linking factors, which
It relays information about the binding state of the aptamer to the in.

Although class I inducers can be engineered to respond to some unrelated effector molecules, this feature is not generally applicable. For example, attaching an aptamer for arginine (40) to a class I inducer failed to produce a significant allosteric effect. 2 of 3 other classes tested
The two inducers (classes VI and VII) also exhibit modularity when engineered to have theophylline aptamers. However, class II
The I inducer and the class II repressor, when similarly attached to the same aptamer,
There was no response to the effector addition. These findings indicate that successful design of an allosteric ribozyme using this modular approach requires the fusion of a compatible "matched pair" of aptamers and bridging domains.

Table 1. Catalytic rate constants for the "on" and "off" states of class I (inducible) and class II (inhibited) ribozymes compared to constructs designed to mimic these states

[Table 1]

[0053]Example 2 Allosteric hammerhead ribozyme in sensitive to theophylline
vitro selection  Any number of aptamer-ribozyme combinations for the development of linking modules
To determine if it is also applicable to
Activated allosteric hammerhead ribozyme
An in vitro selection was performed. This selection is based on the combined module
To enable rational design and in vitro selection
A new linking module that challenges the allosteric limitations of nucleic acids
I was sought to emit. Riboza sensitive to allosteric theophylline
Early populations for the development of ims could be used to generate sensitive catalysts for FMN.
It is conceptually the same as the group shown so far. However, theophylline apta
The mer is a random-sequence consisting of 5 + 5 or a total of 10 nucleotide positions.
The region was attached to the hammerhead ribozyme stem II (FIG. 7A). Te
In vitro selection and amplification of ribozymes activated by ophylline
The RNA population from the eight rounds of
Shows a remarkable ability to catalyze the autolysis reaction in the presence of illin (G8,
(FIG. 7B). The overall population is an unmodified hammerhead ribozyme
(~ Min^-1) Is essentially the same as the rate constant observed for
The rate constant observed in the presence (K_obs+). Some individuals from the final population
Of the linkage module for isolated and ligand-activated catalysis
Characterized to determine sequence and kinetic parameters (Table 2).

Table 2. Sequence and dynamic parameters of a ligation module of an allosteric hammerhead ribozyme sensitive to theophylline isolated by in vitro selection

[Table 2]

Many isolates have been shown to achieve theophylline-dependent rate constants approaching or exceeding 1 min- ¹ . Allosteric activation ranged from hundreds of folds to thousands of folds. In this way, selection for an allosteric hammerhead ribozyme sensitive to theophylline provided a functionally superior catalyst without compromising the catalytic efficiency of the ribozyme motif. Thus, for the development of allosteric ribozymes sensitive to ligands,
The rational design of combined modules and the use of in vitro selection techniques may be widely adaptable to the development of new allosteric catalysts.

[0056]Example 3 Allosteric ribozyme responsive to cGMP and cAMP messengers
Collection  Example 1 uses a three domain construct to generate a series of allosteric ribozymes.
Im generation was described (FIGS. 1 and 8). For some of the identified bridging domains
Different aptamer domains with different ligand specificities during the course of the experiment
By replacing the original aptamer domain with the corresponding effector-dependent
It was observed that a novel allosteric ribozyme having the property was produced. Paraphrase
Then, a certain bridging domain or a class I connecting module (shown in FIG. 8)
cm + FMN1) and other linked modules, regardless of specific ligand specificity.
It appears to act as a reporter for the occupied genus of the aptamer attached.
This example illustrates the effector coupling of three-part RNA constructs with discretion.
When incorporated into a conjugation site, undiscovered aptamers can function ribozymes.
There are reports of further studies being conducted to investigate whether this could be caused.
The site to which all effectors bind is a 25-nucleotide consisting of a random sequence.
A new construct has been generated that is replaced by the c-domain (Figure 8). This R
The construction of the NA construct is based on a selective amplification method, the term "allosteric selection" herein.
Allosteric ribosa with novel effector specificity
It facilitated the isolation of the im (FIG. 9A). This process works in the absence of an effector
These ribosomes, which remain inactive but are activated by the addition of effectors
It is advantageous for enrichment of the RNA population for Zyme (73).

Materials and MethodsPreparation of RNA pool  DNA template for RNA pool described in FIG. 1B and used for RT-PCR
Oligonucleotides were prepared by automated DNA synthesis (Kec
k Biotechnology Resource Laboratory,
Yale University). Before using all DNA, use (8M urea) polyacrylic acid
Purified by denaturing mid-gel electrophoresis (PAGE). DNA template
5'-GGGCAACCTACGGCTTTCACCGT-TTCGACGT (
N₂₅) AAGGCTCCATCAGGGTCGCC (4.15 nmol, SEQ
 ID No .: 32 + ACGT and SEQ ID No .: 34) as “Primer
2 "(5'-TAATACGACTCACTATAGGGCACCCTGAT
GAG, 8.3 nmol, in the presence of SEQ ID NO: 32)
Therefore, it was double-stranded. In addition, it is T7 RNA polymerase (T7 RNAP)
A promoter is introduced for DNA extension reaction (300 μl)
According to Superscript II reverse transcriptase (RT, GibcoBRL)
Performed using

The resulting double-stranded DNA was recovered by precipitation using ethanol, and 50 mM Tris-HCl (pH 7.5 at 23 ° C.), 15 mM MgCl ₂
, Dithiothreitol 5 mM, spamidine 2 mM, 4 dNTPs 2 m each
^M, Ci (- 32 P) containing UTP200μ and T7 RNAP60000U, resuspended in transcription mixture of 2 ml. The transcription mixture was incubated at 37 ° C. for 1 hour and the resulting undegraded precursor RNA (internally- ³² P-labeled) was isolated by denaturing 10% PAGE. Note that purification of PAGE removes ribozymes that undergo autolysis during the in vitro transcription reaction. This essentially leads to a further negative selection step, which is not advantageous for isolating ribozymes that function without being activated by effectors. In addition, this step is performed with the intentional cNMP target effector
It is not advantageous for the isolation of allosteric ribozymes, which cannot be distinguished from the NTPs required for in vitro transcription.

[0059]Allosteric selection  in against allosteric ribozyme in response to cNMP (manufactured by Sigma)
Repeat the in vitro selection with a negative selection and a positive selection.
Performed using und. In the first round of negative selection, pre-RNA
Body (9.3 nmol, 5.6 × 10^FifteenMolecule) with 4 cNMPs
In the absence of Tris-HCl (pH 7.5) 50 mM and MgCl 2₂20m
The cells were cultured in a reaction mixture containing M (930 μl) at 23 ° C. for 5 hours. This culture
During this time, precursor RNA that resists degradation is denatured by 10% PAGE.
And isolated. The purified precursor RNA was then combined with 4 cNMPs each for 5
Positive selection in the same reaction buffer (930 μl) containing 00 μM at 23 ° C. for 30 minutes.
We received the first round of action. At this stage, the decomposed product is
% PAGE and denatured 5 'digested fragment
Recovered from the gel by crush-soak elution
Transcription was followed by amplification by PCR (RT-PCR). Reverse transcription is a manufacturing instruction
Using SuperScript II RT according to the cDNA, primer 1 (5
'-GGGGCAACCTACGGCTTTCACCGTTTCG, SEQ ID
 NO: 33) in reaction buffer (400 μl total). next
, Primers 1 and 2 (500 pmol each)
PCR amplification of Tris-HCl (pH 8.3 at 23 ° C.) 10 mM, KCl
 50 mM, MgCl₂1.5 mM, 0.01% gelatin, dNTP
0.2 mM each and 50 U of Taq polymerase (Promega)
The reaction was carried out in a reaction mixture containing (total 2 ml). The reaction was carried out at 94 ° C. for 30 seconds,
Thermal cycling was performed at the desired number of repetitions at 55 ° C. for 30 seconds and 72 ° C. for 60 seconds.
.

A further round of selective amplification was repeated in a similar manner using a 15 minute positive selection reaction until a sensitive ribozyme function was detected in the effector. Subsequent rounds of selection were performed as described above, using smaller RNA pools and correspondingly reduced reaction sizes.
It contained both negative and positive selections. In the first five rounds of selection, a 10-fold stock mixture of cNMP was added to the RNA pool before adding the remaining components of the reaction buffer. In the following round, cNMP
The mixture was added after the reaction buffer to prevent the isolation of acid sensitive ribozymes. In addition, negative selection to degrade slowly or to select more aggressively for ribozymes that partition between active and inactive conformations upon refolding. Changed selection. Negative selection times are reduced by 5 since this is not advantageous for slowly degrading ribozymes.
Extending from hours to up to 48 hours, multiple negative selection steps were sometimes used before making a positive selection. Use of periodic thermal cycling as previously described (65), or chemical denaturation using urea or mild alkali, may not be used to favor ribozyme misfolding.
Negative selection was used in an iterative fashion to induce multiple cycles of reconstitution and autolysis. Interestingly, ribozymes using a misholding strategy for survival also blocked a negative selection strategy that relied on heat and urea-mediated denaturation (unpublished observation). Therefore, using alkali denaturation proved to be most effective for negative selection.

[0061]Allosteric ribozyme characterization  An RNA population exhibiting cNMP-dependent autolysis was cloned (TOPOT
A cloning kit, manufactured by Invitrogen) and sequenced (Ther
Omo Sequenase Cycle Sequencing Kit, U
SB) and further determine effector-mediated regulation of ribozyme kinetics
Was analyzed by: For allosteric ribozyme clones
PCR of plasmid DNA using a single-stranded DNA template with primers 1 and 2
Either by amplification or by preparing a suitable synthetic DNA template
Therefore, it was prepared. Inside³²The P-labeled RNA is prepared as described above,
Prepared by in vitro transcription.

The initial rate constant for RNA autolysis was traced to the internal ³² P-labeled RNA precursor in selection buffer containing different concentrations of cNMP effector, as indicated for each experiment. The amount was determined by culturing in an amount (１００100 nM). The reaction was terminated by adding more 2x PAGE loading buffer containing EDTA. The Mg ²⁺ cofactor was blocked (65).
For each clone, a plot of the fraction of the resolved (<20% treated) precursor against time gave a straight line. The slope represents the initial rate constant for the ribozyme under the specific reaction conditions used. In all cases, duplicate experiments gave rate constants that were varied by less than 50%.

The entrapped cAMP analog, adenosine 3 ′, 5′-cyclic monophosphate, P1- (2-nitrophenyl) ethyl ester (Calbiochem) was resuspended in dimethyl sulfoxide (DMSO). This gave a 100 × stock solution (200 mM). The dissolved analog is delivered to the ribozyme reaction to give a final concentration of 2 mM and to the resulting reaction mixture is added DMSO to give a final concentration of 5% to prevent it from precipitating. Was. This concentration of DMSO is
It did not affect the function of clone cAMP-3. U of a sample contained in a polycarbonate microliter plate (manufactured by USA Scientific)
V-irradiation, producing a light centered at 312 nm, a UV transilluminator (Spect
roline TVC-312A). Under these conditions,
Over 80% of the analog is converted to cAMP.

The cAMP depletion reaction was performed using cAMP (500 μm) as indicated for each reaction.
M) 3 ′, 5′-cyclic nucleotide phosphodiesterase (activator insufficient from bovine brain, manufactured by Sigma) and calmodulin (3 ′, 5′-cyclic nucleotide phosphodiesterase activator, manufactured by Sigma) Prepared by delivery. Lyophilized phosphodiesterase and calmodulin samples were subjected to 50 mM MES (pH 6.5 at 23 ° C.), 100 mM NaCl and 60 mM NaCl.
Resuspended separately in buffer containing 5% glycerol. Phosphodiesterase was delivered as indicated to a final concentration of 5 × 10 ⁻⁴ Uμl ⁻¹ and calmodulin was delivered as indicated to a final concentration of 1.5 Uμl ⁻¹ . cA
The reaction for MP depletion studies was Tris-HCl (pH 7.5 at 23 ° C.) 50
mM, MgCl ₂ 20 mM, CaCl ₂ 30 μM, and 2.7% glycerol. ³² P-labeled cAMP-1 RN inside trace volume
A was added immediately (without pre-culture) or performed at 30 ° C.
Added after 0 or 80 minutes of pre-culture.

Results and Discussion Starting with a pool of 10 ¹⁵ RNA molecules representing almost all possible sequence variants within the random sequence domain of the construct, successive negative and positive selections were possible. As effector molecules, four natural 3 ', 5'-
The reaction was performed using a mixture of cyclic mononucleotides (cNMP; 500 μM each). Each RNA population was prepared by in vitro transcription in the absence of the cNMP mixture, and full-length precursor RNA was purified by denaturing 10% polyacrylamide gel electrophoresis (PAGE). The isolated RNA precursor is subjected to an effector under reaction conditions (reaction buffer: Tris-HCl, pH 7.5 at 23 ° C., 20 mM, and Mg ^{2 +20} mM) that allow different replication for a long period of time. Cultured in the absence of the mixture. The undegraded precursor from this negative selection reaction was again isolated by PAGE and cNM
By simply culturing under reaction requirements that allow replication containing the P mixture,
Received a positive selection. The resulting 5'-degradation products were purified by PAGE and amplified by reverse transcription followed by the polymerase chain reaction (RT-PCR). This selective-amplification method was repeated because it favored the enrichment of allosteric ribozymes in response to any of the four cNMPs.

[0066]Acid-sensitive and effector-dependent ribozymes  After only 6 rounds of selective-amplification (G6), the RNA pool was cNMP mixed
A remarkable positive response to the addition of the substance was shown (FIG. 9b). However, further fruit
G6 RNA population does not specifically recognize any of the cNMPs
But dominated by ribozymes triggered to function by simple acid treatment
It turned out that it was. For the first six rounds of selection, add reaction buffer.
By adding an acidic mixture consisting of cNMP just prior to addition,
PH dropped unintentionally. Used for positive selection to prevent acidification
Pooled RNA was combined with the cNMP mixture used to initiate the reaction and 2
0 mM Mg²⁺Prior to the addition of Tris-HCl (pH 7.5 at 23 ° C.) 50
Buffered using mM.

[0067] Two additional classes of selfish RNA molecules also emerged during the early stages of selection. One class of selfish ribozymes reduces RN while substantially reducing the catalytic rate in both the negative and positive selection steps.
The decomposition reaction of A is promoted. Other classes distribute to correctly folded and misfolded states. In both cases, the ribozyme is
It is not completely selfish during the negative selection reaction and is therefore enriched by the selective-amplification method without responding to the effector. These two types of selfish RNA were due to the high background levels of RNA catalysis observed in the positive selection reaction, which suboptimized the efficiency of the allosteric selection method.

Fortunately, ribozymes that specifically activate by recognizing effector molecules gain important selective advantages over ribozymes using the effector-dependent strategies described above. The use of longer incubation times for negative selection reactions further disadvantaged ribozymes, which degrade more slowly. However, ribozymes that survive using a misfolding strategy were more difficult to remove. Possibly, certain parts of these molecules, after the occurrence of each denaturation, split into an active and an inactive conformational state.
Therefore, only a part of the population decomposes during the negative selection. PAG
In purifying the undegraded precursor by denaturing E, the RNA refolds and has another opportunity to partition between the two conformational states. This allows a significant portion of the population to break down during the subsequent positive selection reaction. To round out ribozymes using this strategy, multiple rounds of negative selection and purification were performed. Instead, a negative selection reaction
The RNA was degraded and refolded by scattering in a heat denaturation step or a chemical denaturation step, respectively (see above materials and methods).

[0069]Isolation of cNMP-dependent hammerhead ribozyme  Selection of measurable responses to the cNMP mixture after a total of 14 rounds
The RNA population was again shown (FIG. 9B). G16 RNA pool was added to c
By an allosteric ribozyme specifically activated by the addition of GMP
Observed what is dominated. Therefore, only cGMP is used as effector
Then, two more rounds of selection were performed. Named G18 'RNA
The resulting population is very responsive to the addition of cGMP (FIG. 9C).

To recover the remaining ribozymes responsive to cNMP, cGMP was
7 were added to the negative selection reaction to provide the three effectors remaining in the positive selection reaction. By G19, the RNA pool no longer responds to cGMP, but shows specificity for cCMP. Therefore, cC as an effector
An additional round of selection was performed using only MP to produce G20 ′ RNA. This RNA population degrades preferentially in the presence of cCMP (FIG. 9C).

In an iteration of this strategy, both cGMP and cCMP were included in the negative selection starting with G20, while supplying cAMP and cUMP to the positive selection. By this method, at G22, which responds exactly to cAMP,
A population of RNA resulted. Further rounds of selection using cAMP alone yielded a G23 ′ RNA, a population that exhibited allosteric activation exclusively by this effector (FIG. 9C). However, after a further 6 rounds of selection using only cUMP in the positive selection reaction, no specific increase in RNA degradation by this effector was observed. This finding indicates that a ribozyme specific for cUMP was not present in the initial population and that ribozymes with this effector specificity were selective-
It was shown that mutations obtained during the amplification procedure did not occur by chance.

[0072]Dynamic regulation of ribozymes using cGMP, cCMP and cAMP  Clones from the G18 ', G20' and G23 'populations were
Arranged to further characterize features. Tested from G18 population
Of the 12 clones, 8 have significant structural variance within the original random-sequence domain
(Figure 10A). Interestingly, every individual defines a connection module
Maintain at least one mutation in the region, and all but one clone
Random-has a deletion in the sequence domain. With this discovery, the original pool was
Involved in our efforts to bias the design of RNA constructs for lossy function
Nevertheless, an important indication of allosteric ribozymes for cNMP targets
It will be shown not to give.

The clones cGMP-1 to cGMP-4 were tested for catalytic activity, each responding positively to the addition of cGMP with unique characteristics (FIG. 10B).
By comparison of the initial rates of hammerhead-type degradation measured in the absence and presence of the effector (regardless of nonlinear kinetics), cGMP-1 folds to 〜510 fold under the conditions used for allosteric selection. It is evident that it is activated up to (Fig. 10C). The remaining three clones are not activated significantly, however, each shows selective activation with cGMP and no cross-reactivity with the remaining non-cognate effector molecules.

Similarly, individual clones from the G20 ′ and G23 ′ populations respectively
Shows specific activation with P and cAMP effectors. RNA specific for cGMP
The sequence of the isolated G20 'RNA reveals that significant mutations or deletions are obtained in the course of the selection process, as these observations show that these changes result in an allosteric function, as observed in This indicates that it may be necessary (FIG. 10D). The catalytic performance of all seven clones sequenced from G20 ′ was examined, and only cCMP-1 and cCMP-2 were observed to be activated by their corresponding effectors (FIGS. 10E and 10F). . The remaining clones
Despite the presence of any effectors, they show weak catalytic activity, indicating that these RNAs survive to this stage in the selection method without utilizing an allosteric activation strategy.

Eight separate individuals were also identified among the thirteen clones sequenced from the G23 ′ population (FIG. 10G). Also, the clone experienced significant acquisition of mutations within the original joining module or deletion within the random-sequence domain. G
Each of the five clones examined from the 23 ′ population responded positively to the presence of cAMP (FIG. 10H). In addition, clones cAMP-1 to cAMP-4
Shows an allosteric kinetics similar to that observed with the previous allosteric construct (FIG. 10I). Although cUMP-dependent ribozymes have been isolated from this RNA population, due to sequence variability and the dynamic characteristics of the recovered allosteric ribozymes, a significant potential exists for the generation of novel effector-regulated RNAs. It is shown to be present.

[0076]Molecular recognition by effector binding sites  Representative cGMP-, cCMP- and cAMP-dependent ribozymes are
Whether the atomic structure of the corresponding effector is directly recognized, or
Respond to some other physicochemical signaling agent that can be unintentionally introduced into an object
That is the main concern. The first ribozyme that governs the RNA population is four cNMs
The observation that they do not respond specifically to any of the P
Alternative effectors to oxidation are given priority, but acidification of the reaction mixture
The sensitivity is high. The mechanism of ribozyme activation is direct molecular recognition of cNMP
To determine if mediated by adenosine 3 ', 5'-cycle
Monophosphate, P1- (2-nitrophenyl) ethyl ester, cAMP "closed"
A “recessed” configuration was used (FIG. 11A). The trapped cAMP is Ne
Tries of cAMP similar to those reported by rbone et al. (67).
Ter analogs, which have been added with phosphoester linkages by irradiation with ultraviolet light.
Released by disassembly. This confined effector allows individual
cAMP-dependent clones activate upon release of effector by irradiation
A means is provided for testing whether this is possible.

The cAMP-dependent clones cAMP-1, cAMP-2 and cAMP-
4 (FIG. 10I) each degrade when displayed with a confined effector (data not shown), which indicates that the allosteric binding site of these RNAs is due to the chemical nature of this analog of cAMP. It suggests adaptation to alteration. In contrast, the cAMP-3 clone shows the same rate constant whether it is cultured with 500 μM of trapped cAMP or in the absence of effectors (FIG. 11B). Presumably, the allosteric binding site of cAMP-3 does not allow room for the entrapped cAMP compound to bind and activate adjacent ribozymes. However, mixtures containing cAMP-3 RNA and entrapped cAMP were treated with a long-wavelength UV centered at ~ 312 nm.
Short irradiation with light results in significant activation of ribozyme function. The finding that UV-induced in situ production of cAMP causes ribozyme activation is consistent with the mechanism by which cAMP is directly recognized as an effector by this particular allosteric ribozyme.

To further investigate whether the molecular recognition of cNMP effectors by RNA mediates the function of allosteric ribozymes, an assay was established in which cAMP was depleted in situ from the reaction mixture (FIG. 12). In situ depletion of cAMP was achieved by using cyclic nucleotide phosphodiesterase (68) and its activator calmodulin. These proteins do not deplete effectors when cultured independently, but when combined, they efficiently hydrolyze 3 ', 5'-cyclic AMP to 5'-AMP. Under assay conditions, less than 10% of cAMP is destroyed during a 40 minute pre-incubation in the presence of phosphodiesterase alone, but in similar reactions containing calmodulin, an activator of cyclic nucleotide phosphodiesterase activity. More than 90% are destroyed.

The allosteric ribozyme cAMP-1 is 5′-AMP as an effector
(See FIG. 13). As a result, cAMP becomes phosphodiesterase /
The ribozyme should not be activated if it is initially consumed by the catalysis of the calmodulin complex. As expected, we find that neither phosphodiesterase nor calmodulin alone suppresses allosteric activation of cAMP-1 RNA (FIG. 12A, lines 5 and 6). In contrast, allosteric ribozymes are not significantly activated when added to reaction mixtures containing cAMP pre-cultured with both phosphodiesterase and calmodulin (FIG. 12A, line 7). Moreover, it was observed that the cAMP-1 ribozyme in the reaction mixture equivalent to that used in line 7 could be activated by the addition of a second aliquot of cAMP (FIG. 12B). This indicates that loss of ribozyme activation by preculture with both protein factors is caused by depletion of the cAMP effector and not due to the intrinsic inhibitory effect of the protein complex. By both studies described above, including either in situ production or depletion of cAMP, at least some of the many ribozymes isolated by allosteric selection have their corresponding cNMP effector molecules. Evidence of direct recognition is given.

[0080]Molecular recognition by allosteric binding sites  Preliminary investigations of molecular recognition determinants were performed using representative clones, cGMP-1, cC
Performed using MP-1 and cAMP-1. In each case, the RNA is
Shows significant recognition for highly related analogs of their corresponding effectors (
(FIG. 13). For example, cGMP-1 RNA comprises 3'-GMP and 5'-GMP,
That is, it shows a remarkable discrimination against the hydrolyzed analog of cGMP. Similarly, cC
MP-1 and cAMP-1 clones also have their corresponding cNMP effectors.
The cyclic phosphodiester structure of the compound has a 5'O-P or 3'O-P bond.
It shows this same ability to recognize whether it is opened by hydrolysis.

Further experimentation is needed to more clearly determine the determinants of molecular recognition for these allosteric ribozymes, but in each case the discrimination against the open-ring analog is determined by the steric interaction. It seems to be obtained by action. Supplied with the corresponding nucleoside and deoxynucleoside analogs of cNMP,
By the observation that all three clones at least partially remain active,
It has been shown that the phosphate site is not absolutely required for allosteric activation. In contrast, the modification of many functional groups on the nucleoside base of each effector adversely affects the function of the allosteric ribozyme (FIG. 13). Therefore, it appears that the base site of the cNMP effector is essential for molecular recognition by different effector-binding domains.

[0082]Fast activation of cNMP-dependent ribozymes  Common small molecule-dependent allosteric ribozymes caused to date
Characterized by the rapid activation or inactivation of ribozyme function by the addition of effectors.
(5, 7, 65). Fast allosteric response should find a real application
Certain dynamic features can be highly desirable for RNA molecular switches. Therefore, three
CGMP-1, cCMP-1 and cAMP-1 which are representative clones of
The kinetics of activation was investigated. In each case, the ribozymes have their counterparts
Appears to be activated within a few seconds after introducing the effector molecule (Figure 14).
. Fast activation of ribozyme function can be achieved by introducing appropriate signal agents.
Dynamic formation of rapid effector binding and ribozyme conformations
1 shows a simple RNA structure.

Each of the clones described above maintains a linear degradation kinetics for at least one half-life (FIG. 14), but this is due to the addition of the appropriate effector to the RNA of individual clones. This indicates that 50% or more is activated. However, autolysis for some individuals reaches a plateau after only a short reaction time. This can indicate a serious misfolding problem.
During allosteric activation, most of the clones examined are 20% -90% advanced before cessation of catalysis.

[0084]Binding affinity and dynamic range  The site to which the effector of each allosteric ribozyme is bound is R
Which can be described by the dissociation constant (KD) for the NA-ligand interaction.
Would bind its ligand with a single affinity. The effector
Occupancy of the site is the level of activation for a particular allosteric ribozyme
If it really correlates with the
By examining the dependence, the apparent KD for effector binding is
An interaction can be determined.

To comprehensively analyze the binding affinity exhibited by the allosteric ribozymes isolated in this study, the effector concentration-dependent activity of all ten allosteric ribozymes described in FIGS. It was measured. The apparent KD value was determined by determining the effector concentration, yielding a rate constant that was half of the maximum (1 / 2K _max ). In all cases, the apparent KD is in
Near the concentration of each effector used during the in vitro selection (FIG. 15). These constants range from ２００200 μM (cGMP-3) to ４4 mM (
cCMP-1). By comparison, the SELEX method (16, 46-53)
) Binds with higher affinity, indicating that increased sensitivity of these allosteric ribozymes to lower effector concentrations could be achieved. .

The plot used to define the apparent KD for each allosteric ribozyme (FIG. 11) also reveals the range of rate constants shown for different concentrations of effector. This "dynamic range" for allosteric responses is highly variable between different clones, suggesting that the variability of functional features that can be exhibited by allosteric ribozymes is substantial. As expected from preliminary analysis (FIG. 10B), cGMP-3 ribozymes have a poor rate increase or "allosteric response" to cGMP. As a result, this individual exhibits an overall dynamic range on the order of magnitude less than one. In contrast, the clone with the best dynamic range is cGMP-1, which maintains a linear increase in the log of its rate constant from 1 μM to 1 mM. The increase in rate constant for cGMP-1 under in vitro selection conditions is 〜500 fold, while the overall rate increase when the site where cGMP and effector bind is saturated is about 5,000 fold. . This corresponds to a dynamic range for cGMP-1 of size greater than three orders.

[0087]Engineering Novel RNA Molecular Sensor  According to the allosteric selection strategy used in this study (FIG. 9A),
For the isolation of novel multi-domain RNAs that function as molecular switches, and
Alternative methods are provided for the isolation of RNA structures to which new ligands bind
Can be Many allosteric ribozymes respond to specific cNMP targets
At the same time is reported herein. Similarly, allosteric
Selection as a candidate effector molecule in a positive selection reaction
, By using a mixture of metal ions or metal complexes, or
By using complex mixtures containing organic compounds, proteins or nucleic acids
Thus, it can be used to isolate molecular sensors on a massively parallel scale. In fact, RN
Any physicochemical impact that can affect the folding of the A structure
It may be a signal agent for the function of steric ribozymes.

[0088]RNA structure and function dispersibility  In contrast to the limited function of natural ribozymes, protein enzymes are exceptional
Accurate and extraordinary speed increase catalyzes the chemical transformation of numerous arrays
Use. Providing effector-dependent allosteric regulation in certain instances
Conformational changes are involved in the different biochemical functions of protein enzymes (
21). Unlike their protein counterparts, natural ribozymes are catalytically active.
It is not known to make allosteric adjustments. However, this research and
And the results of several previous studies (5, 6, 8, 9, 61-63, 65, 66)
Regulates catalytic activity in response to various effector compounds
There is evidence that it is extremely possible. These findings are
Is important for the catalytic function of the complex but could be underutilized
This is consistent with the previous suggestions (57-60). Maybe the real catalytic of nucleic acids
The potential is being exploited to construct synthetic ribozymes that enable unique biochemical applications.
obtain.

It is important to note that the allosteric ribozymes described in this study did not make any effort to optimize their allosteric response and catalytic function. Despite their dynamic characteristics, this initial in
Representative clones generated by the in vitro selection method are shown. The ribozymes described in this example should be considered to be the prototype, since in most cases their effector binding affinities and catalysis rates are almost inadequate to serve most applications. Perhaps the individual classes of allosteric ribozymes isolated by allosteric selection could be further optimized using similar in vitro selection strategies, similar to those used in this study. This would ultimately allow their development as efficient molecular sensors for various applications.

[0090]Implications for controlling gene expression  Precise control of gene expression is critical to the normal functioning of all cells.
Is important. Similarly, the expression of genes governed by precise temporal or spatial commands
Intentionally manipulating the present is for those who want to control biological systems at the molecular level.
That is very interesting. Possible regulation of gene expression
Is the signal transfer from DNA to RNA and from RNA to the final protein product
At any stage of the process. In fact, regulate the level of gene availability
Abundant warfare used to regulate the progress of molecules that occur after transcription
In short, natural systems have evolved (69). Many of these mechanisms regulate gene expression.
Has become a target for the development of small molecule modulators that can be used to control
70).

[0091] Some cellular genetic control mechanisms are exerted at the level of RNA. For example, natural antisense interactions and regulation of RNA stability are two mechanisms known to affect gene expression. Antisense oligonucleotides and ribozymes have been widely used by researchers to intentionally affect the expression of specific genes by exploiting these two mechanisms. These approaches modulate RNA function, either by sterically preventing access to the target of the RNA, or by targeting the RNA for destruction. Recently, it has been shown that translation of mRNA can be blocked by exploiting the specific interaction between aptamers and certain dye compounds (71). In particular, RNA aptamers that selectively bind Hoechst dyes H33258 and H33342 were incorporated into mRNA, resulting in selective inhibition of gene expression when these ligands were introduced into cells. Similarly, an allosteric ribozyme can be fused to mRNA such that the ribozyme domain modulates its catalytic activity when the corresponding effector molecule is introduced into a cell. Therefore, allosteric effector molecules can be used to modulate mRNA stability and thus affect the expression of the target gene.

[0092] The allosteric selection protocol described herein allows for the simultaneous selection of novel allosteric ribozymes that respond to any of hundreds or even thousands of compounds. This may allow autolyzing ribozymes, such as the hammerhead type, to be made responsive to a wide range of effector stimuli, and whether the resulting allosteric construct may be incorporated into mRNA as a novel gene regulator. A means is provided for testing. If this proves to be feasible, then almost any naturally or biologically available compound is a candidate for the purposeful control of gene expression in genetically transformed organic matter. is there.

The above description is for the purpose of teaching those skilled in the art how to practice the present invention, and will be apparent to those of skill in the art upon reading the detailed description. It is not intended to detail those obvious modifications and variations of the invention. However, all such obvious modifications and variations are intended to be included within the inventive concept as defined in the following claims. The claims are intended to include the claimed components and steps in any conclusions, unless the context indicates otherwise to the contrary, effective in meeting the intended purpose therein. I have. Literature:

[0094]

[Table 3]

[0095]

[Table 4]

[0096]

[Table 5]

[0097]

[Table 6]

[0098]

[Table 7]

[Sequence list]

[Brief description of the drawings]

FIG. 1 shows the design of an initial population for allosteric selection of aptamer domains and allosteric hammerhead ribozymes (SEQ.
ID NOs 1 and 2). A region of the random sequence that is x nucleotides (x can be of any length) is directly attached to the catalytic nucleic acid motif (A) or by an existing ligation module such as a class I induction module. (B). N represents the identity of any nucleotide;
Arrows indicate cleavage sites in the hammerhead ribozyme domain. In alternative embodiments (not shown), other ribozyme and deoxyribozyme motifs are used.

FIG. 2 illustrates the rational design of a combined module for FMN-sensitive allosteric ribozymes and in vivo selection. (A) cross-linking of a random sequence of eight nucleotides (N)
A three part construct consisting of a hammerhead ribozyme bound to an aptamer bound to FMN (in the box, SEQ ID NO: 3). The three stems forming the unmodified ribozyme are indicated by I, II and III, and R
The cleavage site of NA is indicated by an arrow. The randomized crosslink serves both as a partial replacement of the ribozyme stem II and as a flanking stem for the aptamer. GC base pairs immediately adjacent to the catalytic nucleus are required for hammerhead ribozymes to maximize catalytic activity (9,42)
. Selection for the FMN-inducible allosteric ribozyme (B) and the FMN-repressed allosteric ribozyme (C) resulted in an RNA population that responded either positively or negatively, respectively, to the presence of FMN.
An initial RNA pool (G0) and a contiguous RNA population (G1-G6) are identified.

FIG. 3 shows bridging sequences and kinetic parameters for individual allosteric ribozymes. (A) Sequence and corresponding ribozyme rate constants for eight classes of inducers isolated from G6. The log of the observed rate constant for autolysis in the absence (open circles) or presence (filled circles) of FMN is plotted for each class. The base pair diagram depicted for each bridge was generated by assuming that no base pair shift had occurred for the GC base pairs remaining in stem II. The class (*) indicating that the misfolding is 20% or more, and the class (+) in which a foreign mutation exists in the stem-loop region of the aptamer domain are shown. H1 is an unmodified hammerhead ribozyme (4, 7, 8) that shows maximum catalytic activity and remains unaffected by the presence of FMN. (B) Fold-activation of catalytic activity (K _obs ⁺ / K _obs ⁻ ) achieved in the presence of ligand for each class of ribozymes that can be induced with FMN. (C) Sequence and corresponding ribozyme rate constants for five classes of inducers isolated from G6. Nucleotide deletions are represented as dashes. (D) Fold-inhibition of catalytic activity (K _obs − / K _obs +) achieved in the presence of ligand for each class of ribozymes that are inhibited by FMN.

FIG. 4 illustrates fast ligand-dependent regulation of allosteric ribozymes.
3 having either a class I inducer (A) or a class II inhibitor (B)
A two-part ribozyme construct is shown. The sequences for the aptamer and ribozyme domains are shown in FIG. The performance of these ribozymes in the presence or absence of FMN is evident from plots (C) and (D), which show that
Time to MN addition versus natural log of fraction ribozyme remaining undegraded. The inserted plot gives an expanded view of the ribozyme response to FMN addition.

FIG. 5 shows a proposed “slip-structure” for allosteric regulation mediated by a class I inducer (A), which shows a class II inducer (
B) has been described. The second structure of the proposed stem II at the site where the FMN-regulated ribozyme ligand binds and where the ligand does not bind is shown. Left- and right-flanking sequences, consisting of aptamer and ribozyme domains, respectively, are not depicted. The asterisks represent the G and C residues of the hammerhead ribozyme that must be paired to support the catalyst, and the A and G residues of the FMN aptamer that pair when the ligand binds. Also, a class I guidance module (C; I-1 to I-3, SEQ ID
NO 4-6) or a class II suppression module (D; II-1 and II-2)
A two-molecule ribozyme construct containing Stem factor II designed to mimic active or inactive slip structures proposed for SEQ ID NO 7) is also shown. Bold lines identify nucleotides that form the cross-linking factor. Mutations made in 1-3 to reinforce the desired base pair conformation are boxed.

FIG. 6 illustrates the modular properties of class I inducers. (A) Sequence and second structure of an allosteric ribozyme construct containing any of FMN, theophylline, or ATP aptamer (constructs I (f), I (t), and I (a), respectively). The AG or GC base pair at the end of each aptamer (represented by an asterisk) is an interaction stabilized by ligand binding. (B) Qualitative assessment of the specificity of ligand-induced ribozyme autolysis. The internally ³² P-labeled construct was incubated for 15 minutes at 23 ° C. in the absence (−) or presence of FMN (F; 200 μM), theophylline (T; 1 mM), or ATP (A; 1 mM). Cultured. (C) Dynamic parameters K _obs ⁻ (open circles) and K _obs ⁺ (closed circles) measured for each allosteric ribozyme construct in the absence or presence of a ligand of the same nature, respectively. (D) Arostec activation of ribozyme function is described for each construct.

FIG. 7 (A) Initial population (G0) for in vitro selection of allosteric hammerhead ribozymes sensitive to theophylline. Theophylline aptamer (SEQ ID NO: 8) is attached to the hammerhead ribozyme stem II through a random sequence region of 10 nucleotides.
N represents the identity of any nucleotide. The site of autolysis is indicated by the arrow. (B) In vitro selection and amplification of an allosteric hammerhead ribozyme activated with theophylline. In the absence of theophylline (open bars) or in the presence of theophylline (closed bars)
The fraction of each population decomposed in is shown on the left axis,
The corresponding rate constants for autolysis are shown on the right axis.

FIG. 8 illustrates a three-part design for an allosteric ribozyme structure similar to that shown in FIG. (A) Sequence and second structure for allosteric ribozyme (66), which is highly sensitive to FMN. In this construct, cm +
The FMN1 ligation module (in the box) separates the ribozyme from the aptamer domain. This connection module (cm) is composed of flavin mononucleotide (FMN).
) Is the first sequence class (1) identified to date for performing allosteric activation (+) in the presence of (1). Base pair factors required for hammerhead ribozyme activity (I, II and III) were determined according to Hertel et al. (72).
Be labeled. Arrows identify sites of hammerhead-mediated degradation.
(B) Tripartite construct with a randomized aptamer domain used as a pool to initiate in vitro selection. N ₂₅ represents 25 nucleotides with random base identity.

FIG. 9 shows an allosteric selection scheme and isolation of RNA sensors with novel effector specificity. (A) Precursor RNA undergoes negative selection in the absence of effectors (1). Undegraded RNA is isolated by PAGE and undergoes a positive selection in the presence of a mixture of four cNMPs.
The degraded RNA was subjected to RT-PC to generate a double-stranded DNA template.
Amplified by R (II). The resulting DNA undergoes the next round of negative and positive selection (IV) to generate a new population of RNA molecules, bacteriophage T7 RNA polymerase (T7 RNA
Transferred using (P) (III). (V) Double-stranded DNA from the desired round of selection is generated as a clone and sequenced for further analysis. T7 in the box represents the double-stranded promoter sequence for T7RNAP. (B) Allosteric ribozyme emergencies of ligand specificity during the in vitro selection process were performed in each round of selection (G
1 to G28) is reflected by plotting the ratio of degradation yield (presence to absence of effector). The specificity of the population sensitive to ligands appearing during the selection is represented by bars. An asterisk indicates a change in the selection protocol to avoid acidifying the RNA sample before starting the positive selection reaction. The dagger identifies a round of selection in which the cNMP acting as an effector in the previous round is added to the negative selection reaction in the following round. The line indicates a degradation ratio of 1, which represents the expected value when the degradation activity of the population as a whole was shown not to favor the effector mixture. (C) Selective activation of RNA degradation by cNMPs. The interior representing groups G18 ', G20' and G23 'is ³² P
-Trace the amount of labeled RNA in the absence (-) or 500 (
3 ', 5'-cyclic mononucleotides A, G, C and U of M as indicated)
In the reaction buffer used for in vitro selection (50 m
M, Tris-HCl, pH 7.5, 23 ° C., and 20 mM MgCl ₂ ) for 15 minutes. Reaction products were separated by denaturing 10% PAGE and bands were visualized and quantified using PhosphorImager and ImageQuant software (Molecular Dynamics). Open and closed arrows identify the precursor and 5 ′ degradation product, respectively. The 3 'degradation products have significantly larger RNA and electrophoretic mobilities than the 5'-degraded fragments and are therefore not present on the image.

FIG. 10 shows allosteric regulation of hammerhead ribozymes by cNMPs. (A) Original linked module domains (in boxes) for eight different clones isolated from the G18 'RNA population (SEQ ID NOs 9-16)
And the sequence of the domain (N ₂₅ ) of the original random sequence. Dash N ₂₅ domain represents a nucleotide deletion occurring somewhere in this area. The number in parentheses reports the number of the same clone with the same sequence. All isolates were identified as having an effector-responsive allosteric function (+), indicating no response to effector addition (-), or no allosteric function was measured (ND) . Note that in almost all cases, the connecting module domain has at least one mutation. (B) G18 'RNA
Ligand-dependent degradation of individual allosteric ribozymes isolated from the population. R
The NA precursor (open arrow) has 500 μM of c compared to its absence.
In the presence of GMP, a higher amount of 5'-decomposition product (solid arrow) is produced. The assay is performed under in vitro selection conditions, and as a result, the yield of product in the presence of the effector relative to the absence of the effector has the advantage that each ribozyme maintains during the selective-amplification process. Express. The reaction products were separated and visualized as described in the legend above to FIG. 9C. (C) 5
The initial rate constant for the clone represented in B in the presence (K _obs +, closed circle) or absence (K _obs −, open circle) of the effector at 00 μM is shown on a logarithmic scale. These rate constants are less than 5 under in vitro selection conditions.
-Reveal the "on / off" ratio over the range of 510-fold. (D ~
F) Allosteric regulation of G20 'hammerhead ribozymes by cCMP (SEQ ID NOs 17-23). (GI) cAMP (SEQ ID N
O24-31) Allosteric regulation of G23 'hammerhead ribozymes. Details of the analysis of cCMP- and cAMP-dependent ribozymes are as described in AC.

FIG. 11 shows information related to the molecular recognition of cAMP by cAMP-3 RNA. (A) The trapped cAMP analog adenosine 3 ′, 5′-cyclic monophosphate, ie, P ′-(2-nitrophenyl) ethyl ester, is 3 ′, 5 ′ by simple irradiation with long wavelength UV light. Converted to 5'-cAMP. (B)
Allosteric activation of cAMO-3 RNA by unconfined cAMP. Plots show precursor RNA remaining undegraded at different incubation times in the presence (squares and circles) or absence (triangles) of 2 mM entrapped cAMP.
Represents the natural logarithm of the fraction. Shaded symbols and filled symbols represent data collected during or after UV irradiation, respectively. The irradiated mixture is
Exposure was between t = 3.5-4.5 minutes (dashed line). Ribozymes are only activated when irradiated in the presence of cAMP (closed symbols).

FIG. 12 provides data relating to the molecular recognition of cAMP by cAMP-1 RNA. (A) The effect of in situ depletion of cAMP from the reaction buffer before addition of cAMP-1 allosteric ribozyme was measured using 3 ', 5'-cyclic nucleotide phosphodiesterase and calmodulin. Precursor RNA (white arrow) is either when cultured in a reaction mixture containing cAMP (+, lanes 3 and 4) or contains cAMP and is either phosphodiesterase (pho) or calmodulin (cal) Is activated when cultured in a reaction mixture containing (lanes 5 and 6, respectively). When mixed, phosphodiesterase and its activator, calmodulin, form cAM
Pre-culture at 30 ° C. for 40 minutes (pr
5′-AMP occurs during einc). cAMP-1 RNA, which does not adapt 5'-AMP as an effector (see Figure 13 below), cAMP-1 RNA is no longer activated under these conditions (lane 7). The reaction product is separated,
It was visualized as described in the legend to FIG. 9C. (B) Plot showing cAMP-1 activation by adding cAMP (represented by an arrow) to 500 μM after exhaustion of the original sample of cAMP. This reaction was performed in lane 7 of A.
Derivative of the reaction represented by, but where a pre-culture of 80 minutes using a phosphodiesterase / calmodulin mixture was used to more completely deplete the initial input of cAMP. Solid and open circles are data points collected before and after addition of the second portion of cAMP, respectively.

FIG. 13 shows a pattern of selective molecular recognition by a cNMP-dependent allosteric ribozyme. Three allosteric ribozymes cGMP-1, cCMP
-1 and cAMP-1 were each determined in the absence of an effector (-), in the presence of 500 μM of a cNMP effector of the same nature, or with a panel of analogs of different effectors, similarly under in vitro selection conditions. For 15 minutes. The internal ³² P-labeled precursor RNA and the resulting 5'-degraded fragment are identified by white and black arrows, respectively. G, C and A represent the nucleosides guanosine, cytidine and adenosine, respectively. cIMP stands for inosine 3 ', 5'-cyclic monophosphate. The reaction products were separated and visualized as described in the legend to FIG. 9C.

FIG. 14 shows fast effector-mediated activation of allosteric ribozymes. Reactions containing ³² P-labeled precursor RNA internally as indicated are incubated for a short time in the absence of effectors and then their corresponding effectors 5
mM was added (dashed line) and the reaction continued. The x-axis represents time to effector addition. The precursor (white arrow) and the resulting 5'-degraded fragment (black arrow) were separated, visualized and quantified as described in the legend to Figure 9C. The natural log of the remaining precursor fraction is plotted for each data point that occurred before (open circles) or after (solid circles) addition of the effector. still,
Changes in slope represent the allosteric response of each ribozyme.

FIG. 15 is a graph of the effector binding affinities and dynamic ranges for various allosteric ribozymes. The log of the rate constant for ribozyme degradation versus the log of effector concentration is plotted for each of the 10 clones shown in FIG. The minimum possible value for the apparent KD for each clone is represented by the position of the shaded arrow on the x-axis of each plot (assuming K _obs at 10 mM effector represents K _max ). Have been forgotten. The difference in rate constants, largely due to the increasing concentration of effector, represents a dynamic range for each clone. For example,
logK _obs for cAMP-1 was -3 in the absence of effector (FIG. 31).
To -0.5 at effector saturation. The change in the rate constant, which is almost effected by different concentrations of the effector, is ~ 300 fold cAMP-1
Corresponding to the dynamic range for. The dashed line represents the effector (500 μM) concentration used during in vitro selection.

FIG. 16 depicts a reactive DNA biochip prepared using the highly selective multi-domain polynucleotides of the present invention in a grid assay. The sensors shown are applied to chips as shown, by arranging sensors sensitive to different ligands on the surface, using standard nucleic acid immobilization techniques, which chips have different potentials. Exposure to a sample containing effector molecules. B19,
Compounds responsive to sensors representing C3, G5, G9, P15 and S2 were found to be present at concentrations above the threshold level.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/566 C12N 15/00 ZNAA (81) Designated country EP (AT, BE, CH, CY, DE, DK) , ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), AU, CA, JP, US F term (reference) 2G045 AA40 DA12 DA13 DA14 FB02 4B024 AA11 AA19 BA07 CA04 CA11 GA30 HA14 HA19 4B033 NA01 NA22 NB12 ND03 ND08 NG09 4B050 CC03 CC04 DD20 LL03 4B063 QA01 QA13 QQ42 QQ52 QR01 QR32 QR55 QR62 QS02 QS34

Claims (20)

[Claims] 1. A purified functional polynucleotide comprising an actuator domain, a receptor domain, and a crosslinking domain, wherein the activity of the actuator domain is regulated by the interaction of the receptor domain having a signal agent. Characterized by causing a conformational change in
The polynucleotide. 2. The polynucleotide according to claim 1, wherein the signal agent is a ligand that binds to the receptor domain. 3. The method of claim 1, wherein the activity of the actuator domain is catalytic.
3. The polynucleotide according to item 1. 4. At least two domains do not overlap,
The polynucleotide according to claim 1. 5. The polynucleotide of claim 1, wherein the at least two domains partially or completely overlap. 6. The polynucleotide according to claim 1, which is an RNA. 7. The polynucleotide according to claim 6, which is a hammerhead ribozyme. 8. The polynucleotide according to claim 1, which is a DNA. 9. The polynucleotide of claim 1, wherein the actuator domain exhibits catalytic activity caused by binding of a chemical to the receptor domain. 10. A biosensor comprising the polynucleotide according to claim 1, 2, 3, 4, 5, 6, 7, 8, or 9. 11. The method of claim 1, wherein the polynucleotide is attached to a solid support.
The biosensor according to 0. 12. The presence or absence of a ligand in a sample, comprising contacting the sample with the polynucleotide according to claim 1, 2, 3, 4, 5, 6, 7, 8, or 9, or , A method for detecting its concentration. 13. The method according to claim 12, wherein the presence or absence or the concentration of the ligand is measured by observing a chemical reaction. 14. The method according to claim 12, wherein the presence or absence of the ligand or the concentration thereof is detected by observing a change in the configuration or function of the polynucleotide. 15. A method for preparing a polynucleotide that responds to the presence or absence of a signal agent, wherein the interaction between the receptor domain and the signal agent causes a conformational change in the cross-linking domain that regulates the activity of the actuator domain. The method wherein the polynucleotide actuator domain, the receptor domain, and the bridging domain are bound together to cause. 16. The receptor domain has a site to which a ligand binds, and the binding of the ligand causes a conformational change in the cross-linking domain that stimulates the catalytic activity of the actuator domain. The method described in. 17. A method for screening a polynucleotide having an actuator domain, a receptor domain, and a cross-linking domain and being responsive to a signal agent in a sample, wherein the polynucleotide is defined as a receptor domain having a random sequence. A cross-linking domain with defined properties is attached, which modulates the activity of a corresponding actuator domain with specific properties, and the sample is cultured with a polynucleotide so constructed to modulate the activity of the actuator domain. Identifying the polynucleotide responsive to the signal agent by observation. 18. The receptor domain having a site to which a ligand binds, and wherein binding of the ligand causes a conformational change in the bridging domain that stimulates the catalytic activity of the actuator domain. The method described in. 19. The method for preparing the RNA sensor according to claim 15, 16, 17, or 18. 20. The method for preparing a DNA sensor according to claim 15, 16, 17, or 18.