JP2002527757A - Methods for diagnosing, monitoring, staging, imaging and treating prostate cancer - Google Patents

Abstract

  (57) [Summary] The present invention provides novel methods for detecting, diagnosing, monitoring, staging, predicting, imaging and treating prostate cancer.

Description

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates, in part, to newly developed assays for detecting, diagnosing, monitoring, staging, predicting, imaging and treating cancer, especially prostate cancer.

BACKGROUND OF THE INVENTION Prostate cancer is the most common malignancy in adult men, except for skin cancer, in the United States and is an increasingly common health problem. In 1996,
It has been estimated that 41,400 deaths were attributed to the disease in the United States alone, indicating that prostate cancer is the most common cause of death after lung cancer in the same population. If diagnosed and treated early, the chances of cure are quite high when the cancer is still limited to the prostate.

[0003] Treatment decisions for an individual are related to the stage of prostate cancer present in the individual.
A common classification of the spread of prostate cancer is the American Urological Association (AUA)
Developed by The AUA system classifies prostate tumors into four stages, AD. Stage A is a microscopic cancer inside the prostate and is further subdivided into lower stages A1 and A2. Lower stage A1 is a well-differentiated cancer restricted to one site inside the prostate. Treatment is generally observation, radical prostatectomy, or radiation therapy.
Lower stage A2 is a moderately to poorly differentiated cancer at many sites inside the prostate. Treatment is radical prostatectomy or radiation therapy. Stage B is a palpable mass inside the prostate and is further subdivided into lower stages B1 and B2. Lower stage B1
In, the cancer forms small nodules in one lobe of the prostate. In lower stage B2, cancer forms large or multiple nodules or occurs in both lobes of the prostate. Treatment of lower stages B1 and B2 is radical prostatectomy or radiation therapy. Stage C is a large cancer mass that contains most or all of the prostate and is further subdivided into two stages. In lower stage C1, the cancer forms a continuous mass that may extend outside the prostate. In lower stage C2, the cancer forms a continuous mass that infiltrates the surrounding tissue. The treatment of both lower stages is radiation therapy, with or without drugs to address this cancer. The fourth stage, stage D, is metastatic cancer and is subdivided into two sub-stages. In lower stage D1, cancer appears in the pelvic lymph nodes. In lower stage D2, the cancer involves tissues outside the lymph nodes. Both lower stages of treatment are systemic drugs to address cancer as well as pain.

[0004] However, current staging methods for prostate cancer are limited. As many as 50% of prostate cancers initially staged as A2, B or C are stage D and metastatic. Finding metastases is important because patients with metastatic cancer have a worse prognosis than patients with localized cancer and require treatment that is significantly different from patients with localized cancer It is. The 5-year survival rates for patients with localized and metastatic prostate cancer are 93% and 29%, respectively.

[0005] Thus, prostate cancer in human patients is diagnosed and staged to determine if such cancer has metastasized and to determine the course of non-metastatic cancer with respect to the onset of metastasis. There is a great need for more sensitive methods for monitoring.

[0006] The present invention provides methods for detecting, diagnosing, monitoring, staging, predicting, imaging and treating prostate cancer with a cancer-specific gene referred to herein as CSG. CSG refers specifically to a native protein expressed by a gene comprising the polynucleotide sequence SEQ ID NO: 1. SEQ ID NO:
The amino acid sequence of the polypeptide encoded by
Expressed as EQ ID NO: 2. In addition, the CSG used herein
Means that the native mRNA or polynucleotide sequence SEQ ID NO: encoded by the gene comprising the polynucleotide sequence SEQ ID NO: 1
The level of the gene containing DNO: 1.

[0007] Other objects, features, advantages and aspects of the present invention will become apparent to those skilled in the art from the following description. However, it is to be understood that the following description and specific examples, while illustrating preferred embodiments of the present invention, are provided by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.

SUMMARY OF THE INVENTION [0008] In order to achieve the above and other goals, it is an object of the present invention to provide a method for altering the level of CSG in a cell, tissue or body fluid, preferably of the same cell, tissue or fluid type Providing a method for diagnosing the presence of prostate cancer by analyzing the level of CSG in normal human controls, wherein the level of CSG in patients versus normal human controls is analyzed. The change is associated with prostate cancer.

[0009] Further provided is a method of diagnosing metastatic prostate cancer in a patient having prostate cancer not known to have metastasized, the method comprising the steps of diagnosing a human suspected of having metastatic prostate cancer. Identifying a patient; analyzing a cell, tissue, or fluid sample from such a patient for CSG; determining the level of CSG in such cells, tissue, or fluid, preferably in the same cell, tissue, or fluid. By comparing with the levels of CSG in normal human controls of the type, wherein the increase in CSG levels in patients versus normal human controls is associated with metastatic prostate cancer.

[0010] Also provided by the present invention is a method of staging such cancer in a human having prostate cancer, the method comprising identifying a human patient having such cancer; A sample of cells, tissues, or fluids obtained from such a patient is analyzed for CSG; the level of CSG in such cells, tissues, or fluids is preferably determined by normal humans of the same cell, tissue, or fluid type. By comparing to the level of CSG in a control sample, where the increase in CSG levels in the patient versus normal human control is associated with ongoing cancer, the decrease in CSG levels is in decline or Associated with cancer in remission.

[0011] Further provided is a method of monitoring such cancer in a human having prostate cancer for the onset of metastasis. The method identifies human patients with such cancers that are not known to have metastasized; periodically analyzing samples of cells, tissues, or body fluids from such patients for CSG; Comparing the level of CSG in a healthy cell, tissue or body fluid with a level of CSG in a normal human control sample, preferably of the same cell, tissue or body fluid type, wherein the patient versus normal Increased CSG levels in human controls are associated with metastatic cancer.

[0012] Further provided is a method of monitoring the change in the stage of such a cancer in a human having such cancer by examining the level of CSG in the human having the prostate cancer. The method identifies a human patient having such a cancer;
Samples of cells, tissues, or body fluids obtained from such patients are periodically analyzed for CSG; CSG levels in such cells, tissues, or body fluids are preferably measured for the same cell, tissue, or body fluid type. Comprising comparing the level of CSG in a sample of a normal human control, wherein the increase in the level of CSG in the patient versus the normal human control is associated with ongoing cancer and the level of CSG is decreased. Is associated with declining or remissioning cancer.

[0013] Further provided is a CSG-targeted antibody or fragment of such an antibody that can be used to detect or image the localization of CSG in a patient for the purpose of detecting or diagnosing a disease or condition. It is. Such antibodies can be polyclonal, monoclonal, or omniclonal, or can be produced by molecular biology techniques. The term "antibody," as used throughout, is also intended to include aptamers and single-stranded oligonucleotides, such as those obtained from the in vitro evolution protocol known to those skilled in the art, referred to as SELEX. is there. Antibodies can be labeled with a variety of detectable labels, including, but not limited to, radioisotopes and paramagnetic metals. Such an antibody or fragment thereof may also be a C
It can be used as a therapeutic agent in the treatment of diseases characterized by SG expression. For therapeutic applications, the antibodies can be used with or without derivatization to cytotoxic agents such as radioisotopes, enzymes, toxins, drugs or prodrugs.

[0014] Other objects, features, advantages and aspects of the present invention will become apparent to those skilled in the art from the following description. However, it is to be understood that the following description and specific examples, while illustrating preferred embodiments of the present invention, are provided by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure.

DETAILED DESCRIPTION OF THE INVENTION [0015] The present invention relates to the level of CSG in a human patient in a normal human control.
To both quantitative and qualitative diagnostic assays and methods for detecting, diagnosing, monitoring, staging and predicting cancer by comparison with those of As used herein, the level of CSG refers to the polynucleotide sequence SEQ
The level of the native protein expressed by the gene containing ID NO: 1. The amino acid sequence of the polypeptide encoded by SEQ ID NO: 1 is represented herein as SEQ ID NO: 2. The natural protein to be detected may be whole, a degradation product, a complex of molecules or chemically modified. In addition, as used herein, the level of CSG refers to the level of the native mRNA encoded by the gene comprising the polynucleotide sequence SEQ ID NO: 1 or the polynucleotide sequence SEQ ID N
O: Level of DNA containing 1. Such levels are preferably measured in at least one cell, tissue and / or body fluid, including determination of normal and abnormal levels. Thus, for example, a diagnostic assay according to the invention for diagnosing CSG protein overexpression as compared to a normal control body fluid, cell or tissue sample may be used to diagnose the presence of prostate cancer. May be.

[0016] All of the methods of the present invention may optionally include measuring the level of CSG as well as other cancer markers. In addition to CSG, other cancer markers useful in the present invention depend on the cancer being tested and are well known to those skilled in the art. Diagnostic Assays The present invention relates to analyzing changes in the level of CSG in a cell, tissue or body fluid relative to the level of CSG in a cell, tissue or body fluid, preferably of the same type, obtained from a normal human control. Thereby provide a method for diagnosing the presence of prostate cancer, wherein increased levels of CSG in patients versus normal human controls are associated with the presence of prostate cancer.

Without limiting the invention, in general, in the case of a quantitative diagnostic assay, a positive result indicating that the patient to be tested has cancer has cells, tissues or cancer marker cancer markers such as CSG. A fluid level, preferably the same cells of a normal human control,
At least 2 times higher, most preferably at least 5 times higher than in tissues or body fluids.

[0018] The invention also provides a method of diagnosing metastatic prostate cancer with respect to onset of metastasis in a patient having prostate cancer that has not yet metastasized. In the method of the present invention, metastasis may have occurred (but metastasis is not known in advance).
A human cancer patient suspected of having prostate cancer is identified. This can be accomplished by various means known to those skilled in the art.

In the present invention, determining the presence of CSG levels in cells, tissues or body fluids is particularly useful for distinguishing between non-metastatic and metastatic prostate cancer. Existing techniques have difficulty distinguishing metastatic prostate cancer from non-metastatic prostate cancer. However, the choice of an appropriate treatment often depends on knowing such.

In the present invention, the level of a cancer marker measured in the above-mentioned cell, tissue or body fluid is CSG. The measured CSG level is compared to the level of CSG in a normal human control, preferably of the same cell, tissue or fluid type. That is, if the cancer marker being observed is exactly CSG in serum, this level is preferably compared to the level of CSG in serum of normal human patients. Increased levels of CSG in patients versus normal human controls are associated with metastatic prostate cancer.

Without limiting the invention, generally, in the case of a quantitative diagnostic assay, a positive result indicating that the cancer has metastasized in the patient being tested or monitored includes:
The cell, tissue or fluid level of a cancer marker such as CSG is at least two times higher, and most preferably at least five times higher than in a normal patient, preferably in the same cells, tissues or fluids.

A normal human control as used herein includes a human patient without cancer and / or a non-cancer sample obtained from this patient; in the method for diagnosing or monitoring for metastasis, A normal human control may also preferably include a sample obtained from a human patient that has been reliably determined to have prostate cancer that has not metastasized. Staging The invention also provides a method of staging prostate cancer in a human patient.
The method includes identifying a human patient with such a cancer and analyzing a sample of cells, tissue, or body fluid from such a human patient for CSG.
The measured CSG level in the patient is then compared to the level of CSG in a normal human control, preferably of the same cell, tissue or fluid type, wherein the CSG in a human patient versus a normal human control Increased levels are associated with ongoing cancer, and decreased levels of CSG (but still above true normal levels) are associated with declining or remissioning cancer. Monitoring Also provided is a method of monitoring such cancer in a human patient with prostate cancer for the onset of metastasis. The method identifies human patients with prostate cancer that is not known to have metastasized; periodically analyzes cells, tissues, or fluids from such human patients for CSG; Comparing the level of CSG in a normal human control, preferably of the same cell, tissue or fluid type, with a human patient versus a normal human. Elevated CSG levels in controls are associated with metastatic cancer. In this method, the normal human control sample may also include a previous patient sample.

[0023] Also provided by the present invention is a method of monitoring changes in the stage of a prostate cancer in a human patient having such cancer. The method identifies human patients with prostate cancer; and converts cells, tissues, or fluids from such human patients to CS
Analyze periodically for G; CSG levels in such cells, tissues, or fluids, preferably in normal human controls of the same cell, tissue, or fluid type.
Increasing the level of CSG in a human patient versus a normal human control is associated with an advanced stage of cancer, and decreasing the level of CSG is associated with a stage of SG. Associated with declining or remissioning cancer. In this method,
A normal human control sample may also include a previous patient sample.

[0024] Patient monitoring for the onset of metastases is regular, preferably performed quarterly. However, monitoring may be performed at different frequencies depending on the cancer, the individual patient, and the stage of the cancer. Assay Techniques Assay techniques that can be used to determine levels of expression (including protein levels) of a gene such as CSG of the present invention in a sample obtained from a patient are well-known to those of skill in the art. Such assay methods include, but are not limited to, radioimmunoassay, reverse transcription PCR (RT-PCR) assay, immunohistochemical assay,
In situ hybridization, competitive binding assays, western blot analysis, ELISA and proteomic approaches: include two-dimensional gel electrophoresis (2D electrophoresis) and non-gel based techniques such as mass spectrometry or protein interaction profiling. Of these, ELISA is often preferred for diagnosing expressed proteins of genes in biological fluids.

An ELISA involves first making an antibody specific to CSG, preferably a monoclonal antibody, if not readily available from commercial sources. In addition, a reporter antibody that specifically binds to CSG is generally generated. The reporter antibody is attached to a detectable reagent, such as a radioactive, fluorescent or enzymatic reagent. For example, detectable reagents such as horseradish peroxidase enzyme and alkaline phosphatase are commonly used in this type of assay.

To perform the ELISA, an antibody specific for CSG is incubated on a solid support surface, such as a polystyrene dish, that binds the antibody. The non-specific proteins, such as bovine serum albumin, are then incubated to cover the free protein binding sites on the dish surface. The sample to be analyzed is then incubated in the dish, during which time CSG binds to the specific antibody attached to the polystyrene dish. Wash away unbound sample with buffer. A reporter antibody specifically directed to CSG and conjugated to a detectable reagent such as horseradish peroxidase is placed in a dish, resulting in binding of the reporter antibody to the monoclonal antibody conjugated to CSG.
Unattached reporter antibody is then washed away. Reagents for detecting peroxidase activity, including a colorimetric substrate, are then added to the dish. Immobilized peroxidase bound to the CSG antibody produces a colored reaction product. The amount of color generated at a given time is proportional to the amount of CSG protein present in the sample. Quantitative results are generally obtained by reference to a standard curve.

A competition assay can also be used, in which an antibody specific for CSG is attached to a solid support. Next, the labeled CSG and a sample obtained from the host were
Pass over the solid support. The amount of label attached and detected on the solid support can be correlated with the amount of CSG in the sample.

[0028] Nucleic acid methods can be used to detect CSG mRNA as a marker for prostate cancer. The polymerase chain reaction (PCR), other nucleic acid methods such as ligase chain reaction (LCR) and nucleic acid sequence based amplification (NASABA)
It can be used to detect malignant cells for the purpose of diagnosing and monitoring various malignancies. For example, reverse transcription PCR (RT-PCR) is a powerful technology, with thousands of other
It can be used to detect the presence of a particular mRNA population in a complex mixture of RNA species. In RT-PCR, the mRNA species is first reverse transcribed using reverse transcriptase to complementary DNA (cDNA); the cDNA is then amplified as in a standard PCR reaction. RT-PCR can therefore reveal the presence of a single type of mRNA by amplification. Thus, if the mRNA is very specific for the cell that produces it, RT-PCR can be used to identify the presence of a particular type of cell.

Hybridization (ie, gridding) to clones or oligonucleotides arranged on a solid support surface can be used to detect expression of the gene and to quantify the level of expression of the gene. In this technique, a cDNA encoding the CSG gene is immobilized on a substrate. The substrate may be of any suitable type, including glass, nitrocellulose, nylon or plastic,
It is not limited to these. At least a portion of the DNA encoding the CSG gene is attached to a substrate and then isolated from the tissue of interest.
Incubate with the analyte, which may be NA or a complementary DNA (cDNA) copy of this RNA. Hybridization between the DNA bound to the substrate and the analyte can be detected and quantified by a number of means, such as those designed to detect radioactive or fluorescent labeling or hybrids of the analyte. A second molecule includes, but is not limited to. Quantification of the level of gene expression can be performed by comparing the intensity of the signal obtained from the subject with that obtained from a known standard sample. To obtain a standard sample, the target gene is transcribed in vitro, the yield is quantified, and the material is then used to generate a standard curve.

[0030] Among the proteomic approaches, 2D electrophoresis is a technique well known to those skilled in the art. Separation of individual proteins from a sample, such as serum, is accomplished using sequential separation of proteins, usually on a polyacrylamide gel surface, with various properties. First, proteins are separated by size using current. Because the current acts uniformly on all proteins, smaller proteins travel farther on the gel surface than larger proteins. In the second dimension, a current is passed perpendicular to the first dimension, separating the proteins not by size, but by the specific charge that each protein carries. The result of a 2D separation is a square gel in which each protein occupies a unique spot, as no two proteins with different sequences will be identical in both size and charge. Analysis of spots using chemical or antibody probes, or subsequent protein microsequencing, can reveal the relative abundance of a given protein and the identity of the protein in a sample.

The tests described above can be performed on samples obtained from various cells, body fluids and / or tissue extracts, including homogenates or solubilized tissues from human patients.
Tissue extracts can be obtained from tissue biopsies and dissection material. Body fluids useful in the present invention include blood, urine, saliva or any other bodily secretions or derivatives thereof. Blood is intended to include whole blood, plasma, serum or any derivative of blood. Use of Antibodies In Vivo Antibodies that specifically bind to CSG can also be used in vivo in patients suspected of having prostate cancer. Specifically, an antibody that specifically binds to CSG can be injected into a patient suspected of having prostate cancer for diagnostic and / or therapeutic purposes. The production and use of antibodies for in vivo diagnosis is well known in the art.
For example, antibody-chelators labeled with indium-111 have been described for use in radioimmunosyntographic imaging of tumors that express carcinoembryonic antigen (Sumerdon et al. Nucl. Med. Biol. 1990 17 : 247-254)
. In particular, such antibody-chelators have been used in the detection of tumors in patients suspected of having recurrent colorectal cancer (Griffin et al. J. Clin. Onc. 1
991 9: 631-640). Antibodies using paramagnetic ions as labels for use in magnetic resonance imaging have also been described (Lauffer, RB Magnetic Resonance i
n Medicine 1991 22: 339-342). Antibodies directed against CSG can be used in a similar manner. A labeled antibody that specifically binds to CSG is administered to a patient suspected of having prostate cancer.
It can be injected for the purpose of diagnosing or staging the disease state of the patient. The signs used are
Select according to the imaging format used. For example, radioactive labels such as indium-111, technetium-99m or iodine-131 can be used for planar scanning or single photon tomography (SPECT). Positron emitting labels such as fluorine-19 can be used in positron emission tomography. Paramagnetic ions such as gadolinium (III) or manganese (II) can be used in magnetic resonance imaging (MRI). Localization of the label allows measurement of the spread of the cancer. Also, the amount of label inside an organ or tissue makes it possible to determine whether cancer is present in this organ or tissue.

For patients diagnosed with prostate cancer, injection of an antibody that specifically binds to CSG may also have therapeutic benefit. Antibodies may be able to exert their therapeutic effects alone. Alternatively, the antibody can be conjugated to a cytotoxic agent such as a drug, toxin or radionuclide to enhance its therapeutic effect. Drug monoclonal antibodies have been described in the prior art, for example, in Garnett and Baldwin, Cancer Research 1986 46: 2407-.
2412. The use of toxins conjugated to monoclonal antibodies for the treatment of various cancers is also described in Pastan et al. Cell 1986 47: 641-648.
Yttrium-90 labeled monoclonal antibodies have been described for maximizing dose delivered to tumors and at the same time limiting toxicity to normal tissues (Goodwin an).
d Meares Cancer Supplement 1997 80: 2675-2680). Other cytotoxic radionuclides (
(Including, but not limited to, copper-67, iodine-131, and rhenium-186) can also be used for labeling antibodies to CSG.

[0033] Antibodies that can be used in such in vivo methods include polyclonal, monoclonal and omniclonal antibodies and antibodies produced by molecular biology techniques. Antibody fragments, as well as aptamers and single-stranded oligonucleotides, such as those obtained from in vitro evolution protocols well known to those skilled in the art, referred to as SELEX, can also be used.

The present invention is further described by the following examples. This example is provided only to illustrate the invention by reference to specific examples. Such exemplifications illustrate particular embodiments of the invention, but are not intended to be limiting or limiting of the disclosed invention.

EXAMPLES Unless otherwise described in detail, the examples are performed using standard techniques well known and routine to those skilled in the art. Common molecular biology techniques of the following examples are described in Sambrook et al., MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed .; Cold Spring Ha
It can be performed as described in standard laboratory manuals such as rbor Laboratory Press, Cold Spring Harbor, NY (1989). Example 1 Suppression Subtraction Hybridization (CLONTECH PCR-SELECT
) CLONTECH PCR-SELECT is a PCR-based subtractive hybridization method in which mRN differentially expressed between two mRNA populations.
A is designed to selectively enrich the cDNA corresponding to A (Diatchenko
Natl. Acad. Sci. USA, Vol. 93, pp. 6025-6030, 1996). In this method, differentially expressed mRNA is enriched based on selective amplification. cDNA is made from the two mRNA populations to be compared. These include a cDNA population called a tester population (in which we look for differentially expressed messages) and a cDNA population called a driver population (in which there are no differentially expressed transcripts or Less) is included. Separate the tester sample into two parts and ligate a different PCR adapter to the 5 'end. Each tester is annealed separately with the excess driver in a first anneal, then pooled and re-annealed with an excess driver in a second anneal. First
During annealing, sequences common to both populations anneal. Furthermore, the concentrations of the high and low abundance messages are normalized, because annealing is faster for abundant molecules because of the second order kinetics of hybridization. During the second anneal, the tester-specific or excess cDNA can be annealed together. Such a molecule is
It has a different adapter at its end. Adding additional drivers during the second anneal improves the enrichment of the desired differentially expressed sequence. During subsequent PCR, molecules with different adapters at each end will amplify exponentially. Molecules with identical adapters, or with adapters at only one end, or without adapters (driver sequences), either amplify or amplify linearly. The end result is an enrichment of the cDNA corresponding to the differentially expressed message that is tester specific or upregulated in the tester.

This approach is used to identify transcripts specific to cancerous tissue or messages that are overexpressed in the process of cancer. To do this, pairs of samples separated from cancerous tissue were used as "testers" and non-cancerous tissues as "drivers". Non-cancer "drivers" can be obtained from the same individuals and tissues as the tumor (matched)
. Alternatively, the "driver" can be obtained from a different individual but different from the tumor sample (unmatched). In some cases, a "driver" comprises a mixture of cDNAs from non-cancerous tissues different from cancerous tissues. This approach allows for the identification of transcripts whose expression is specific or up-regulated in cancerous tissue. Such a transcript may or may not be cancer-specific in its expression.

[0037] Subtractive hybridization was performed using a mixture of three RNAs obtained from human adenocarcinoma as a "tester" and five normal human tissues (spleen, pancreas,
It was performed using a mixture of RNA obtained from heart, kidney and small intestine).

The subtraction mixture was cloned and 200 clones were sequenced. One of the sequences matched Incyte clone ID 3966820. Electronic northern analysis of this clone showed the highest number of ESTs from the prostate compared to other tissues (107 for the prostate, then 20 for the uterus).

[0039] The PCR-selected clone detected a 1.9 kb transcript by hybridization on a Northern blot. Of the 17 tissues tested, the prostate was
It showed the highest abundance for this transcript. Example 2: Relative quantitation of gene expression Real-time quantitative PCR using a fluorescent Taqman probe was performed using Taq D
This is a quantitative detection system utilizing the 5'-3 'nuclease activity of NA polymerase.
This method uses an internal fluorescent oligonucleotide probe (Taqman) labeled with a 5 'reporter dye and a downstream 3' quencher dye. During PCR, the 5'-3 'nuclease activity of Taq DNA polymerase releases the reporter, and then the fluorescence of the reporter is measured using the model 7700 sequence detection system (PE applied
Biosystems, Foster City, CA, USA).

Using the amplification of the endogenous control, the amount of sample RNA added to the reaction is normalized and normalized for reverse transcriptase (RT) potency. Cyclophilin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) or 18S ribosomal RNA (rR
NA) is used as this endogenous control. To calculate the relative quantification between all the samples examined, the target RNA level of one sample was used as a reference for the comparison results (calibrators). Quantitation on a "calibrator" basis is obtained using the standard curve method or the comparison method (user magazine # 2: ABI PRI)
SM 7700 sequence detection system).

Tissue distribution and target gene levels were evaluated for all samples in normal and cancerous tissues. Total RNA was extracted from normal and cancerous tissues, and from cancer and corresponding matched adjacent tissues. Subsequently, first-strand cDNA was prepared using reverse transcriptase, and a polymerase chain reaction was performed using primers specific to each target gene and a Taqman probe. The results were from ABI PRISM 7700
Analyzed using a sequence detector. Anonymous numbers are the relative levels of target gene expression in a particular tissue compared to calibrator tissue.

[0042] Real-time quantitative PCR was performed using the following primers. Pro108 Reverse GCCTTCAGCCGTGGGGTAGT (SEQ
ID NO: 3) Pro108 Forward GACAGCGGCTTCACCCTTCTC (SE
Q ID NO: 4) The anonymous numbers shown in Table 1 represent Pr in the present specification in 11 normal different tissues.
The relative level of expression of CSG (SEQ ID NO: 1), referred to as o108. All values are relative to a normal pancreas (calibrator). This RNA sample is a commercially available pool and is derived from a pool sample of a particular tissue obtained from a different individual.

[0043]

[Table 1]

The relative levels of expression in Table 1 are based on the ovary (41
. 07) and the uterus (15.56) show the highest mRNA expression. Apart from the stomach (11.39), which shows high levels of Pro108 mRNA, other tissues, including the prostate, show equally low levels of expression.

The anonymous numbers in Table 1 were obtained by analyzing a pool of specific tissue samples from different individuals. This cannot be compared to the anonymous numbers derived from RNA from a single individual's tissue sample in Table 2.

The anonymous numbers shown in Table 2 represent CSG Pro108 in 70 pairs of matching samples.
Is the relative level of expression. All values are relative to a normal pancreas (calibrator). A matched pair is formed by mRNA from a cancer sample of a particular tissue and mRNA from a normal adjacent sample of the same tissue from the same individual. For prostatitis (prostatitis 1 and 2) and benign prostatic hyperplasia (BPH 1-6), unmatched samples were used.

[0047]

[Table 2]

[0048]

[Table 3]

[0049]

[Table 4]

[0050]

[Table 5]

Table 2 shows the results of an analysis of 148 samples distributed over 14 different tissue types. Tables 1 and 2 represent a total of 159 samples of 16 different tissue types. In analysis of matching samples, higher levels of expression were in the prostate, indicating a high degree of tissue specificity for prostate tissue. Of all samples analyzed different from prostate (57 matching samples), only a few (lung 10 and pancreas 4) were comparable to the median mRNA expression in prostate cancer (median: 539.32). Or showed higher expression.

In addition, the level of mRNA expression in the cancer sample was compared to isogenic normal adjacent tissues obtained from the same individual. This comparison indicates specificity for the cancer stage (eg, higher levels of mRNA expression in the cancer sample as compared to the normal flanking region).
Table 2 shows that overexpression of CSG Pro108 in 13 of 13 prostate cancer tissues,
The results (prostate samples # 1 to # 13) in comparison with the respective normal adjacent portions are shown. Thus, for 100% of the tested prostate matching samples,
There was overexpression in cancer tissue.

Overall, in addition to the level of tissue specificity, overexpression of mRNA in 100% of the tested prostate matching samples indicates that CSG Pro108 is a diagnostic marker for prostate cancer. .

[Sequence list]

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C07K 16/32 G01N 33/577 B C12N 15/09 ZNA A61K 49/02 B G01N 33/577 C C12N 15 / 00 ZNAA (72) Inventor San, Yongmin 95128, California, United States of America, San Jose, South Winchester Boulevard 869, Apartment 260 (72) Inventor Salceda, Suzana 95136, California, United States of America, San Jose, Crescent Avenue 4118 ( 72) Inventor Recipon, Harve 85, Fortuna Avenue, San Francisco, CA 94115, USA 85 (72) Inventor Kafferky, Robert Cali, USA 95134, State of Ornia, San Jose, Elan Village Lane 350, Apartment No. 218 F-term (reference) 4B024 AA01 AA12 BA36 CA04 CA09 CA12 HA13 HA14 4C085 AA14 AA21 BB01 CC03 DD61 HH03 HH07 JJ05 KA04 KA28 KB12 KB07 KB12 KB07 KB12 KB KB18 LL18 4H045 AA11 AA30 DA75 EA28 EA51 FA71

Claims (11)

[Claims] 1. A method for diagnosing the presence of prostate cancer in a patient, comprising: (a) measuring the level of CSG in cells, tissues or body fluids in the patient; and (b) measuring the CSG. Comparing the level to the level of CSG in cells, tissues or body fluids obtained from a normal human control, wherein the change in the measured level of CSG in said patient versus said normal human control is , Methods that are associated with the presence of prostate cancer. 2. A method of diagnosing prostate cancer metastasis in a patient, comprising: (a) identifying a patient with prostate cancer that is not known to have metastasized;
(B) measuring the CSG level in a cell, tissue or fluid sample obtained from the patient; and (c) measuring the CSG level in a normal human control cell, tissue or fluid. Comparing the CSG measured in said patient versus said normal human control.
The method wherein the increased level is associated with a metastatic cancer. 3. A method for staging prostate cancer in a patient with prostate cancer, comprising: (a) identifying a patient with prostate cancer; and (b) cells, tissue or fluid obtained from said patient. Measuring the CSG level in the sample of (c); and comparing the measured CSG level to the level of CSG in normal human control cells, tissues or body fluids. CSG measured in the patient versus the normal human control
The method wherein the increase in level is associated with an ongoing cancer and the decrease in the measured CSG level is associated with a declining or remissioning cancer. 4. A method of monitoring prostate cancer in a patient for the onset of metastasis, comprising: (a) identifying a patient with prostate cancer not known to have metastasized;
(B) periodically measuring the level of CSG in a sample of cells, tissue, or body fluid obtained from said patient; and (c) measuring said periodically measured CSG level in normal human control cells. Comparing the level of CSG in the tissue or body fluid to the patient or the normal human control. Related, method. 5. A method for monitoring a prostate cancer stage change in a patient, the method comprising: (a) identifying a patient with prostate cancer; and (b) cells, tissue, or fluid obtained from the patient. (C) comparing said periodically measured CSG level to the level of CSG in normal human control cells, tissues or body fluids; The method comprising any one increase in the regularly measured CSG level in the patient versus the normal human control is associated with an advanced stage cancer;
The method wherein the reduction is associated with a cancer whose stage is decreasing or in remission. 6. The method according to claim 1, wherein the CSG is SEQ ID NO: 1 or SEQ ID NO.
The method of claim 1, 2, 3, 4, or 5, comprising NO: 2. 7. An antibody that specifically binds to CSG. 8. A method of imaging prostate cancer in a patient, comprising administering the antibody of claim 7 to said patient. 9. The method of claim 8, wherein said antibody is labeled with a paramagnetic ion or a radioisotope. 10. A method of treating prostate cancer in a patient, comprising:
A method comprising administering to the patient the antibody of claim 1. 11. The method of claim 10, wherein said antibody is conjugated to a cytotoxic agent.