JP2002526510A - Pharmaceutical compositions for pre-treatment of patients in need of drugs or prodrugs - Google Patents

Abstract

  (57) [Summary] A pharmaceutical composition for pre-treatment of a patient in need of a drug or prodrug, wherein said drug or prodrug is metabolized excessively or poorly in said patient, and The use of such a pharmaceutical composition is provided.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION Field of the Invention The present invention is a manufacturing of a pharmaceutical composition for the pretreatment of a patient in need of drug or prodrug, excessive or poorly the drug or prodrug in the patient It relates to a manufacture characterized by being metabolized and to the use of such a pharmaceutical composition.

[0002] Over BACKGROUND past 20 years, has been increasingly recognized as an important cause of changes in genetic heterogeneity drug response. Certain drugs may work better or even be more toxic in some patients than in others, and these variations in patient response to drugs may be related to the molecular basis that It is disclosed in the scientific literature (Meyer, Ann. Rev. Pharmacol. Toxicol. 37 (1997), 269-296 and West, J. Clin. Pharmacol. 37 (1997), 635-648). This "drug genome (phar
The concept of `` macogenomic '' points out a correlation between the response to the drug and the genetic profile of the patient (Marshall, Nature Biotechnology, 15 (1997), 954-957; Mar
shall, Nature Biotechnology, 15 (1997), 1249-1252).

[0003] Drugs and prodrugs are metabolized when administered in vivo and excreted by excretion or by metabolism to one or more active or inactive metabolites (M
eyer, J. Pharmacokinet. Biopharm. 24 (1996), 449-459). The systems involved in these metabolisms are enzymatic pathways that are located in specific organs (primarily the liver) (eg,
Cytochrome P450, dehydrogenases, oxidases, esterases, reductases, and many coupled enzyme systems such as methyltransferase, glutathione-s-transferase, aryl hydrocarbon hydroxylase, sulfotransferase, glucuronyltransferase or N-acetyltransferase) (Ferrero). Pharmacol. 43 (1997), 131-169).

For example, cytochrome P45 is involved in the metabolism of most drugs administered to humans
The zero enzyme is challenged by loads that metabolize the drug into products that are more easily excreted in urine and feces. In addition, the concentrations of these enzymes can affect the rate of drug / prodrug metabolism, and these concentrations can be induced by certain drugs or correlate with genetic polymorphisms between individuals. (For example,
Amplification of the gene encoding the enzyme) is also well known. Similarly, inter-individual variability can result in genetic changes (eg, deletions) that result in low expression of the enzyme or expression of an incomplete isoform of the enzyme.
The metabolizing enzyme concentration is too high or the produced enzyme is an ultra-rapid metabolizer isoform (ultra-high metabolizer isoform compared to the wild-type isoform of the enzyme).
When rapid metabolizer isoforms), the rate of metabolism is also high, so that a) the drug is rapidly removed, rendering the drug concentration in the blood or tissue ineffective and resistant to the therapy given, or b) the prodrug Can be excessively converted to its active form, reaching toxic concentrations in patients. Conversely, when the concentration of this enzyme is too low or the produced enzyme is a non-metabolizer or a slow metabolizer (with reduced metabolic activity compared to the wild-type isoform of the enzyme)
Metabolic rates are also low, c) drug clearance becomes inefficient, drug concentrations in blood and tissues become toxic, or d) prodrug conversion is inefficient and the proportion of active drug is low. , Thus making treatment inefficient (for a review, Oz
ama, J. Toxicol. Sci. 21 (1996), 323-329).

[0005] P450 enzymes include steroids, fatty acids, prostaglandins, cytokines,
Involved in the metabolism of many physiological substances such as bile acids (Nebert and Nelson, 1991
, Methods in Enzymology, 206, 3-11). P450 enzymes are a superfamily of various enzymes, and many of these enzymes metabolize a wide variety of heterogeneous compounds such as drugs. Genetic polymorphisms such as CYP1A1, CYP2C9, CYP2C19, CYP2
Six P450 enzymes, termed E1, CYP3A4 and CYP2D6, have been identified that can alter the enzymatic response to drugs and define slow or ultra-rapid metabolizer isoforms (Guengerich, Chem. Biol. Interac).
t. 106 (1997), 161-182; Wrighton, J. Pharmacokinet. Biopharm. 24 (1996),
461-473). Similarly, by the N-acetyltransferase isoform,
Patients can be divided into slow, ultra-rapid, and medium-speed (wild-type) acetylators.

[0006] The expression level of the CYP enzyme can also enhance / suppress the metabolic rate of certain drugs and lower / increase blood levels of targeted drugs such as warfarin and quinidine. This enzyme expression can be induced / suppressed to some extent by other drugs such as phenobarbitol and rifampin, but this varies from patient to patient. In addition, for some administered drugs (eg, coumarin), a narrow therapeutic window and too slow metabolism can result in excessive anticoagulant effects.
Similarly, many of the harmful drug interactions can be caused by interactions with the same enzyme.

[0007] CYP3A is the major metabolic pathway of cyclosporine, quinidine, lovastatin, warfarin, nifedipine, lidocaine, astemizole, cysupride, methylprednisolone, carbamazepine, midazolam, triazolam or erythromycin. Inhibition of CYP3A by genetic alterations (slow isoforms) or inhibition of CYP3A gene expression by other drugs such as ketoconazole, itraconazole, fluconazole, diltiazepam, nicardipine or verapamil increases the side effects that can induce organ damage there is a possibility.

CYP2D6 is an antiarrhythmic drug (eg, propaferon, flecainide), β
-Adrenergic receptor blockers (e.g. timolol, metoprolol or alprenolol), tricyclic antidepressants (e.g. nortriptyline, imipramine or clomipramine), neuroleptics (e.g. perphenazine, thioridazine or haloperidol), selective It is a major metabolic enzyme of serotonin reuptake inhibitors (eg, fluoxetine or valoxetine) and opiates (eg, codeine or dextromethorphan). For example, poor metabolism of codeine impairs the production of the active metabolite, morphine, and reduces analgesic activity. Poor metabolism can cause systemic side effects for many drugs. For example, administration of thymilol to the ophthalmic arterial nerve in patients with the slow metabolizer CYP2D6 isoform may block β-adrenergic receptors. Twenty percent of Caucasians are drug slow metabolizers due to impaired CYP2D6 activity.

[0009] CYP2C19 metabolizes drugs such as mephenytoin, omeprazole, proguanil, diazepam or citalopram. Patients with the slow metabolizer isoform of CYP2C19 are 100-200 times less efficient than normal patients in metabolizing the drug. Administering a normal dose of mephenytoin to a slow metabolizer exacerbates the pharmacological response and toxicity at higher drug concentrations.
5% of Caucasians and 20% of Orientals are drug slow metabolizers due to impaired CYP2D19 activity.

[0010] Soiniazide, hydralazine, procainamide, and other drugs are metabolized by N-acetyltransferase in the liver. As the drug is converted to its active form or excreted by acetylation, the pharmacological response and toxicity are exacerbated in slow and ultra-rapid acetylator patients, respectively. 28% of Caucasians and 7% of Orientals are slow acetylators, 5% of Caucasians and 1% of Orientals.
5% represent different isoforms of N-acetyltransferase (NAT-1,
NAT-2) is an ultra-rapid acetylator.

[0011] With this population variation for drug therapy, pharmacogenomic (pharmacog) is a useful tool for identifying and selecting patients who can respond to a particular drug without side effects.
enomics) have been proposed. This identification / selection can be based, for example, on molecular diagnosis of genetic polymorphisms by genotyping DNA from leukocytes in the blood of the patient, and on characterization of the disease (Bertz, Clin. Pharmacokinet. 32 (1997). , 210-256; Eng
el, J. Chromatogra. B. Biomed. Appl. 678 (1996), 93-103). For founders of health care, such as the Healthcare Organization in the United States and the government's Public Health Service in many European countries, this pharmacogenomic approach can be a way to improve healthcare and reduce overhead costs. Yes, because unnecessary, ineffective, and side-effect drugs are costly (eg, drug interactions kill 106,000 people annually and 2 million Is hospitalized).

[0012] Nevertheless, the pharmacogenomic selection of patients who may be candidates for pharmacotherapy is not entirely satisfactory, as only therapeutic / drugs or patients are selected. Therefore, promising drugs / prodrugs may be excluded from the market because they are not universal or economically satisfactory because they target a limited number of patients and segmented markets, The drug / prodrug may be licensed, but its use may require the use of the wrong drug for the wrong patient without any assurance as to safety that may require titration depending on the group of patients considered. The product label should provide improved dosage recommendations by predicting that the prescriber does indeed have a risk of causing injury or death from prescribing in patients with slow or ultra-rapid metabolism. No solution has been proposed, for example, many drugs in the care of cancer are highly toxic, but cancer is a fatal disease and treatment is not known. However, in this particular case, the selection of the pharmacogenomic is useless and is therefore approved.

[0013]

Summary of the Invention

The present invention proposes a method for retrieving patients who overlooked a particular drug / prodrug therapy, reducing side effects related to altered metabolism of the drug / prodrug, and suppressing drug interactions.

[0014] Accordingly, the present invention firstly provides a function of said first enzyme for the manufacture of a pharmaceutical composition for gene therapy pretreatment of a patient in need of the first drug or prodrug. The use of a first polynucleotide that encodes or is complementary to a sequence encoding a specific isoform, wherein said first enzyme is involved in in vivo metabolism of a first drug or prodrug; The use of the first polynucleotide, wherein the first agent or prodrug is metabolized excessively or poorly by the first enzyme of the patient.

[0015]

DETAILED DESCRIPTION OF THE INVENTION

According to the present invention, "in vivo metabolism of a drug or prodrug" refers to the enzymatic conversion of a drug or prodrug into a soluble and excretable metabolite, which is removed from the body or produced by an inactive prodrug, respectively. It means processing from the drug form to the active form (Meyer, J. Pharmacokinet Biopharm. 24 (1996), 449-459, is included as part of the description in the present invention).

“Excessively metabolized” means that the drug / prodrug is very actively and rapidly excreted from the body (eg, in stool or urine), resulting in ineffective blood and tissue drug concentrations and It means that resistance to the administered therapy occurs or b) the prodrug is excessively converted to its active form and can reach toxic concentrations in the patient. This over-metabolism can be associated with over-expression of the metabolic enzyme (and thus over-concentration of this enzyme in blood or tissue) or with expression of the ultra-rapid enzyme isoform.

“Insufficiently metabolized” means that the drug / prodrug is poorly excreted from the body and the drug concentration becomes toxic, or the prodrug is poorly converted to its active form. Mean that the proportion of active agent in the blood or tissue is low, thus rendering treatment ineffective. This poor metabolism can be associated with poor expression of metabolic enzymes or the synthesis of altered enzyme isoforms (slow isoforms).

“Gene therapy” is understood as a method of introducing a polynucleotide into a cell. In particular, this relates to the case where the gene product (eg an enzyme) is expressed in the target tissue, as well as the case where the gene product is excreted, especially in the bloodstream.

Methods for delivering nucleic acids inside vertebrate cells in vivo have been extensively described in the literature on gene therapy. Gene therapy is well within the skill of the artisan. Most of the transmission mechanisms used so far include viral vectors, especially adeno and retroviral vectors. Viruses generate diverse and highly complex mechanisms to achieve this goal, including cross-linking of cell membranes, to avoid endosomal and lysosomal degradation, and to express the viral genome after their ultimate transfer to the nucleus of their genome. . As a result, the virus has been used for many gene transfer applications in vaccination or gene therapy applied to humans.

In 1990, Wolff (Science, 247, 1465-1468) expressed a reporter gene in muscle cells when naked RNA or DNA without any special transduction system was administered directly to mouse skeletal muscle. That was shown. Thus, these results indicate that the nucleic acid alone can result in certain cells in vivo.

Also, with the aim of improving the intracellular uptake of nucleic acids, which offers the potential advantages of large-scale production, safety, targeting, low immunogenicity, and the ability to transmit large fragments of DNA, of transfectable cells. Various methods based on the use of non-viral synthetic vectors have been proposed in the literature. For example, in 1989, Felgner (Nature, 33
7, 387-388) proposed the use of cationic lipids to facilitate the introduction of large anionic molecules, such as nucleic acids, into cells. These cationic lipids can form complexes with anionic molecules, neutralizing the negative charge of these molecules, making the complex compact and facilitating its introduction into cells. Examples of lipid-dependent transfection compounds are DOTMA (Felgner, PNAS 84 (1987), 7413-7417), DOG
S or Transfectam ™ (Behr, PNAS 86 (1989), 6982-6986), DMRIE
Or DORIE (Felgner, Methods 5 (1993), 67-75), DC-CHOL (Gao,
BBRC 179 (1991), 280-285), DOTAP ™ (McLachlan, Gene Therapy 2)
(1995), 614-622) or Lipofectamine ™.

Other non-viral transmission systems based on polymer-dependent transfection have been developed. For example, polyamidoamine (Haensler, Bioconjugate Chem. 4 (199
3), 372-379), dendritic polymers (WO95 / 24221), polyethyleneimine or polypropyleneimine (WO96 / 02655), polylysine (US-A-5,595,897 or FR) -A-271931
There are many reports on the use of anionic polymers for cellular delivery, such as in US Pat.

[0023] The successful transfer of antisense / ribozymes in vivo has been shown in many clinical trials using antisense oligonucleotides (eg, Guin
ot and Temsamani, Pathol.Biol. 46 (1998), 347-354; Normanno and Agrawal
, Mol. Med. Today 4 (1998), 514-516; Agrawal and Zhao, Curr. Opin. Chem.
Biol. 2 (1998), 519-528, U.S. Patent No. 5,578,716; U.S. Patent No. 5,773,601).

“Polynucleotides” are single- or double-stranded, linear or circular, natural or synthetic, modified or unmodified (for modifications, see US Pat. No. 5,525,7
No. 11, US Pat. No. 4,711,955 or EP 302
175) DNA and / or RNA fragments that define fragments or portions of nucleic acids and can be of any size. this is,
In particular, it can be genomic DNA, cDNA, antisense RNA, ribozyme, or DNA encoding these RNAs. “Polynucleotide” and “nucleic acid” are synonyms for the present invention. The polynucleotide is in the form of a plasmid or linear polynucleotide containing at least one coding sequence for the polynucleotide that can be transcribed and translated to produce an enzyme involved in the in vivo metabolism of the drug or prodrug. You can also. A polynucleotide can be, for example, an oligonucleotide that seeks to communicate to a cell for antisense or ribozyme function. According to the present invention, the polynucleotides described above can also be formulated with viral proteins, or cationic lipids, or cationic polymers as vectors that promote uptake of the polynucleotide into cells.

In a preferred embodiment, DNA and RNA can be transferred to a cell to form all or part of an enzyme therein, and the product is capable of metabolizing an in vivo drug or prodrug. . The product may remain in the cell or be secreted from the cell. In a more preferred embodiment, plasmid DNA is preferred. If the nucleic acids contain the appropriate genetic information, they dictate the synthesis of relatively large amounts of the encoded enzyme. Genetic information required for expression by target cells is described in the DN
A comprises all elements necessary for transcription of A into mRNA and translation of mRNA into polypeptide. Transcription promoters suitable for use in various vertebrate systems are well known. For example, suitable promoters include the viral promoters RSV, MPSV, SV40, CMV or 7.5k, vaccinia promoter, inducible promoter and the like. Nucleic acids can also include intron sequences, targeting sequences, transport sequences, sequences involved in replication or integration. Said sequences are described in the literature and can be readily obtained by those skilled in the art. Nucleic acids
It can be stabilized with a specific component such as spermine. According to the present invention, the polynucleotide can be homologous or heterologous to the target expressing cell.

“Functional enzyme isoforms” (“medium” or “wild-type isoforms”
) Refers to all or part of a polypeptide that exhibits enzymatic properties comparable to a functional enzyme (wild-type) that naturally participates in drug metabolism pathways.

“Slow metabolizer isoform”
of an enzyme) refers to an enzyme isoform with less or no ability to metabolize a drug as compared to a functional isoform.

“Patient pretreatment” refers to administering a pharmaceutical formulation of the invention to a patient in need of said drug / prodrug, together with or separately from drug / prodrug administration.
It means trying to administer to the patient at the same time or preferably before.

“Slow metabolizer patient” means that the drug / prodrug is poorly metabolized by the relevant metabolic enzymes in this patient. Conversely, an “ultra-rapid metabolizer patient” means that the drug / prodrug is excessively metabolized by the relevant metabolic enzymes in this patient.

According to a first aspect, the patient is an ultra-rapid metabolizer patient, in whom the first agent or prodrug has been treated with the pharmaceutical composition of the invention prior to pre-treatment. It is meant to be excessively metabolized by the first enzyme. An ultra-rapid metabolizer phenotype can correlate a gene encoding the first enzyme with enhanced expression in patient cells, or with enhanced activity of the first enzyme. Isoform). According to a preferred embodiment, the first polynucleotide is an antisense RNA complementary to all or part of the sequence encoding the first enzyme. In this specific case, the excess metabolism observed in the patient is associated with a high level expression of the enzyme. Antisense gene therapy is widely disclosed in the literature (for a review, see, for example, Gura, Science 270 (1995), 575-577).
Please refer to). Easily determine, by computerized analysis, an antisense sequence capable of binding in vivo to the gene or RNA encoding said first enzyme, blocking its synthesis and reducing its concentration in a patient Can be.

According to a preferred embodiment, said first drug or prodrug is poorly metabolized by said first enzyme in said patient. The patient is a slow metabolizer patient, in whom the first drug or prodrug is poorly metabolized by the first enzyme prior to pre-treatment with the pharmaceutical composition of the invention. Means to be done. Such cases occur more specifically when the first enzyme is poorly expressed or has low activity compared to the functional isoform (slow metabolizer enzyme isoform). In this embodiment of the invention, the polynucleotide encodes a functional isoform of said first enzyme.

[0032] The first enzyme may also be selected from the group comprising enzymes involved in acetylation, methylation, glucuronidation, sulfation or deesterification. In a preferred embodiment, the first enzyme is an enzyme produced in the liver, and more specifically consists of cytochrome p450, UDP-glucuronosyltransferase, methyltransferase and N-acetyltransferase, and isoforms thereof. Selected from the group.

According to a first aspect of the present invention, the first enzyme is CYP1A1, CYP2C9
, CYP2C19, CYP2E1, CYP3A4, and CYP2D6.

When the first enzyme is a cytochrome p450 enzyme called CYP2D6, the first drug or prodrug is propafenone, flecainide, trimolol, metropolol, alprenolol, nortriptyline, desipramine, imipramine, clomipramine, It is selected from the group consisting of perphenazine, thioridazine, haloperidol, fluoxetine, paroxetine, codeine, and dextromethorphan.

When the first enzyme is a cytochrome p450 enzyme called CYP3A, the first drug or prodrug is cyclosporine, erythromycin,
Methylprednisolone, carbasepine, midazolam, triazolam, quinidine,
It is selected from the group consisting of lovastin, warfarin, nifedipine, lidocaine, terfenadine, asternizolam and cysupride.

When the first enzyme is a cytochrome p450 enzyme called CYP2C19, the first drug or prodrug is selected from the group consisting of mephenytoin, omoprazole, proguanil, diazepam and citalopram.

When the first enzyme is N-acetyltransferase, the first drug or prodrug is selected from the group consisting of isoniazid, hydralazine and procainamide.

Although much effort has been concentrated on the liver in metabolic research and development, this organ has always been considered to be a major site of drug metabolism. However, for certain drugs, other tissues may be dominant (eg, kidney or digestive mucosa). Polynucleotides encoding functional isoforms of enzymes involved in organ-directed metabolic pathways are described in the literature and are readily available to those skilled in the art (see, eg, the nucleic acid sequences disclosed in the GenBank database). , Http: /
/Www.ncbl.nlm.nih.gov/genbank), ie CYP1A available in GenBank
1 coding sequence, accession number NM000499, CYPC19 coding sequence (GenBank
Accession number NM000769), CYP2E1 coding sequence (GenBank accession number AF)
0884225), CYP3A4 coding sequence (GenBank accession number NM000106)
) Or ADH3 coding sequence (GenBank accession number NM000669).

In addition, many enzymatic metabolic pathways of drug / prodrug efflux / conversion can be inhibited or triggered by co-treatment with another drug / prodrug.
As a result, drastic changes can occur with medications co-administered to individual patients. Such interactions can substantially reduce or increase blood and tissue concentrations of the drug / prodrug, or can accumulate toxic substances.

Thus, the present invention encodes a functional first enzyme isoform intended for the preparation of a pharmaceutical composition for pre-treatment of a patient in need of a first and second drug or prodrug. Using a first polynucleotide that encodes or is complementary to the first sequence, wherein the first enzyme is involved in in vivo metabolism of the first drug or prodrug, The agent or prodrug is involved in activating or inhibiting the expression of a second polynucleotide encoding a second enzyme involved in the in vivo metabolism of the second agent or prodrug; Wherein the first drug or the prodrug is poorly metabolized in the patient, wherein the prodrug is excessively or poorly metabolized by the second enzyme. I do.

By activating / inhibiting the metabolism of the second drug / prodrug, a) the second enzyme
Or b) enzymatic activity of said second enzyme can be activated / inhibited by the first agent / prodrug.

The second enzyme is defined as described above for the first enzyme. According to a first aspect, the first and second enzymes are CYP1A1, CYP2C9, CYP2C
19, selected from the group consisting of cytochrome p450 enzymes designated CYP2E1, CYP3A4 and CYP2D6. However, according to a preferred embodiment, the first and second enzymes are different and are involved in the metabolism of the different first and second drugs / prodrugs, respectively.

According to a particular embodiment, the first drug or prodrug is involved in the activation of said second enzyme. For example, the first drug or prodrug is phenobarbitol or rifampicin, and the second enzyme is a cytochrome P450 isoform. According to another particular embodiment, the first drug or prodrug is involved in inhibiting said second enzyme. For example, the first drug or prodrug is kinin, the second enzyme is a CYP2D6 isoform, and the first enzyme is CYP3A4. In another example, the first drug or prodrug is from the group consisting of cyclosporine, erythromycin, ketoconazole, itraconazole, fluconazole, dilticazone, nicardipine and verapamil, which is involved in inhibiting the second enzyme, which is a CYP isoform. The selected second agent is selected from the group consisting of cyclosporine, quinidine, lovastin, warfarin, nifectpine, loydkine, terfenadine, astemizole, cysupride, erythromycin, methylprednisolone, carbamazepine, midazolam and triazolam.

According to the present invention, the targeted patient requires at least one first drug / prodrug, but is also a slow or ultra-rapid metabolizer of said first drug / prodrug. Thus, administration of the drug / prodrug to the patient can be correlated with ineffective or toxic concentrations of the active drug in blood or tissue, and thus with potential organ damage or toxicity. The invention also relates to the use as disclosed above for the purpose of preventing or treating organ damage or toxicity in a patient, more specifically liver or kidney damage or toxicity. According to a particular aspect, said liver damage is alcoholism. Alcoholism could be a side effect of drug / prodrug delivery and ineffective metabolism. This may result from the deleterious effects of alcohol caused by alcohol metabolism. For example, Brown (
Pharmacogenetics 8 (1998), 335-342) focused on genes encoding ethanol metabolizing enzymes. They found that the locus-cytochrome p4502E1 (CYP2E1
) And related polymorphisms in alcohol dehydrogenase 3 (ADH3). In this special case, ethanol could be considered an equivalent even when the drug was not administered for therapeutic purposes.

According to particular embodiments, the targeted patient can be an opiate or cocaine user. For example, ibogaine is a psychoactive alkaloid with potential as a drug for treating opiates or cocaine addiction. The primary metabolite is generated by O-demethylation at position 12, producing 12-hydroxyibogamine. Obach (Drug Metab. Dispos. 26 (1998), 764-768) states that O-demethylation of ibogane found in the liver is mainly due to the polymorphically expressed cytochrome p4502D.
6 (CYP2D6). Thus, excessive or insufficient metabolism of ibogaine or related drugs / prodrugs involved in the treatment of drug addiction could have an effect on said treatment.

The present invention also relates to the use of the first and / or second drug / prodrug to improve or enable the effect.

The present invention relates to the production of therapeutic compositions for administration to vertebrate target tissues, and more specifically to the liver. This administration can be by various routes of transport (systemic and targeted transport). According to the present invention, the manufactured therapeutic composition is preferably administered to an organ involved in drug / prodrug metabolism, while the administration of the manufactured therapeutic composition is performed in muscle, skin, brain, lung, liver, spleen. Vertebrate bodies such as, bone marrow, thymus, heart, lymph, bone, cartilage, pancreas, kidney, gallbladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eyes, glands, connective tissue, blood, tumor It can be done by other organizations.
For example, an enzyme encoding a polynucleotide can be excreted in body fluids (eg, blood) and transported to metabolic organs, or can bind the polynucleotide to a targeting molecule that can be taken up by targeted cells. Can be done. The gene therapy literature offers many mechanisms for the efficient and targeted transmission and expression of genetic information in living cells (eg, European Patent Application EP-040110).
8.0). The administration may be performed intradermally, subcutaneously, intravenously, intramuscularly, intranasally, intracerebrally, intratracheally, intraperitoneally, intravesically, intrapleurally, using a syringe or other device.
It can be performed by intracoronary or intratumoral administration. Transdermal administration, such as inhalation or aerosol routes, is also contemplated.

The present invention relates to a pharmaceutical composition for pre-treatment of a patient in need of a drug or a prodrug, wherein the drug or the prodrug is excessively or poorly metabolized by a natural enzyme of said patient, The composition comprises a polynucleotide encoding or complementary to a sequence encoding a functional enzyme isoform,
It also relates to a pharmaceutical composition, characterized in that said enzyme is involved in the in vivo metabolism of a drug or a prodrug.

Pharmaceutical compositions according to the invention include polynucleotides that encode or are complementary to a sequence encoding a functional isoform of an enzyme produced in the liver, more specifically cytochrome p450, UDP-glu. A polynucleotide selected from the group consisting of chronosyltransferase, methyltransferase, N-acetyltransferase, and alcohol dehydrogenase 3 (ADH3).

According to a preferred embodiment of the present invention, the enzyme comprises CP1A1, CYP2C9,
It is selected from the group consisting of cytochrome p450 enzymes called YP2C19, CYP2E1, CYP3A4 and CYP2D6.

According to a specific embodiment, the pharmaceutical composition comprises an antisense RNA complementary to all or part of the sequence encoding the first enzyme.

[0052] In another preferred embodiment, the polynucleotide contained in the pharmaceutical composition is DN
A. Another embodiment of the present invention relates to a pharmaceutical composition, wherein said polynucleotide is naked, bound to a viral polypeptide, or complexed with a cationic component, more preferably a cationic lipid. is there. Generally, the concentration of polynucleotide in the pharmaceutical composition will be from about 0.1 μg / ml to about 20 mg / ml.

In a further preferred embodiment, the pharmaceutical composition also comprises a pharmaceutically acceptable injectable carrier. The carrier is preferably isotonic, hypotonic or slightly hypertonic, and has a relatively low ionic strength as provided by the sucrose solution.
Carriers include any relevant solvents, aqueous or partially aqueous liquid carriers comprising sterile pyrogen-free water, dispersion media, coatings, and the like. The pH of the pharmaceutical formulation is appropriately adjusted and buffered.

In another embodiment, the pharmaceutical composition of the present invention uses the pharmaceutical composition according to the present invention, ie, in the preliminary treatment of a patient in need of said first drug or prodrug, And instructions for using the pharmaceutical composition (eg, a flyer) stating that the first drug or prodrug is excessively or poorly metabolized by the first drug in the patient. In another embodiment, the instructions provide that the pharmaceutical composition of the present invention is used for pre-treatment of a patient in need of said first and second drugs or prodrugs, and wherein the second drug or prodrug is used. Is metabolized excessively or poorly by the second enzyme and the first drug or prodrug is poorly metabolized in the patient.

While the invention has been described by way of example, it should be understood that the terminology that has been used is intended to express the nature of the written word rather than the limitation. Many modifications and variations of the present invention are possible in light of the above teachings. Therefore, it is to be understood that within the scope of the appended claims, the invention may be practiced otherwise than as specifically described.

[0056]

【Example】

 The present invention is further described with reference to the following non-limiting examples.

Example: Adenovirus vector expressing cytochrome p450CYP1A1 (A
Construction of dCYP1A1) The following construct was constructed using Maniatis et al. (1989, Laboratory Manual),
(Cold Spring Harbor, Laboratory Press, Cold Spring Harbor, New York). The homologous recombination step is preferably performed in E. coli strain BJ 5183 (Hanahan, J. Mol. Biol. 166 (1983), 557-580). The used adenovirus fragment was obtained from GenBank, accession number M732.
60 with respect to their position in the Adenovirus 5 genomic sequence. The cells are transfected and cultured according to techniques widely used in the art.

The coding region of CYP1A1 is defined by the human cDNA library and the EcoR defined for the CYP1A1 sequence available at GenBank, accession number NM000499.
Amplified by PCR using primer oligonucleotides comprising I and XbaI restriction sites. From 5 'end 5' GGCAGCCAGAATTCCTGAAGGTGAC 3 'From 3' end 5 'GGCTGTCAGTGGGATCTAGACTAAGAGCGCAGC 3'

The EcoRI and XbaI restriction sites were added to the 5 of the CYP1A1 coding sequence, respectively.
'And 3' ends. The PCR fragment was then digested with EcoRI and Xb.
digested with aI, inserted into pCI-neo plasmid (Promega Corp),
eoCYP1A1. PCI-neoCYP containing CYP1A1 coding sequence
The vector p1 was isolated from the fragment XhoI-XbaI of 1A1 and linearized with the same enzymes.
It is subcloned into TG6600 (Lathe et al, 1987, gene 57, 193-201). The resulting transfer vector was transferred to pTG6600.
Named CYP1A1. The adCYP1A1 adenovirus vector is pTG
Produced by homologous recombination in E. coli strain BJ 5183 between the PacI-BstEII of 6600CYP1A1 and the vector pTG6624 linearized with ClaI.
The final construct AdCYP1A1 is composed of E1 (nucleotides 459-3328) and E3 (nucleotides 459-3328).
Nucleotides 28249-30758), and the E1 region has an expression cassette containing a CYP1A1 coding sequence controlled by a CMV promoter. Adenovirus particles are produced after transfection of the 293 cell line. The recombinant adenovirus vector described above can be used in the manufacture of a composition of the invention by combining it with a sucrose solution known as a pharmaceutically acceptable injectable carrier.

Using the teachings readily available on GenBank and the methods described above, the skilled person can use the CYP2C19 coding sequence (GenBank accession number NM000769), CYP2C19
2E1 (GenBank accession number D11131), CYP2D6 coding sequence (GenBank accession number NM000106) or ADH3 coding sequence (GenBank accession number NM0)
[0066] can be produced.

The CYP1A1 coding sequence available on GenBank (accession number NM000499)
, CYP2C19 coding sequence (GenBank accession number NM000769), CYP2
E1 coding sequence (GenBank accession number AF084225), CYP3A4 coding sequence (GenBank accession number D11131), CYPD6 coding sequence (GenBank accession number NM000106), or ADH3 coding sequence (GenBank accession number NM000)
669).

[Procedural Amendment] Submission of translation of Article 34 Amendment of the Patent Cooperation Treaty

[Submission date] October 19, 2000 (2000.10.19)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] Claims

[Correction method] Change

[Correction contents]

[Claims]

[Procedure amendment 2]

[Document name to be amended] Statement

[Correction target item name] 0009

[Correction method] Change

[Correction contents]

[0009] CYP2C19 metabolizes drugs such as mephenytoin, omeprazole, proguanil, diazepam or citalopram. Patients with the slow metabolizer isoform of CYP2C19 are 100-200 times less efficient than normal patients in metabolizing the drug. Administering a normal dose of mephenytoin to a slow metabolizer exacerbates the pharmacological response and toxicity at higher drug concentrations.
5% of Caucasians and 20% of Orientals are drug slow metabolizers due to impaired CYP2D19 activity. Cytochrome P450 (CYP) has previously been used in anti-tumor gene therapy mechanisms. U.S. Patent Nos. 5,688,773 and WO 97/35994 describe suicide gene therapy that demonstrates the ability to convert a normally inactive cancer chemotherapeutic prodrug to an active agent with a therapeutic effect. The tumor cells that do not have the selected C
Disclosed are methods that have been genetically modified by introducing the YP gene. Tumors that have been modified by gene transfer are thus able to express the CYP enzyme, thereby allowing antitumor agents (eg, oxazaphosphorins)
Is specifically sensitive to These studies may indicate that the drug-activated CYP gene may be useful in the development of novel chemotherapeutic / gene therapy combinations for the targeted treatment of cancer with established cancer chemotherapeutic agents.

Claims (32)

[Claims] 1. Encoding a sequence encoding a functional isoform of a first enzyme for the manufacture of a pharmaceutical composition for pre-treatment of a patient in need of the first drug or prodrug, or Use of a first polynucleotide that is complementary thereto, wherein said first enzyme is involved in in vivo metabolism of a first drug or prodrug,
Use of a first polynucleotide, wherein the first drug or prodrug is over- or poorly metabolized by a first enzyme of the patient. 2. The method of claim 1, wherein the first drug or prodrug is excessively metabolized by the first enzyme of the patient, and wherein the first polynucleotide comprises all or one of the sequences encoding the first enzyme. The use according to claim 1, which is an antisense RNA complementary to the part. 3. The first drug or prodrug is poorly metabolized by the first enzyme of the patient, and the first polynucleotide encodes a functional isoform of the first enzyme. The use according to claim 1, wherein 4. The use according to claim 1, wherein said first enzyme is a liver enzyme. 5. The method according to claim 1, wherein the first enzyme is selected from the group consisting of cytochrome p450, UDP-glucuronosyltransferase, methyltransferase, N-acetyltransferase or alcohol dehydrogenase 3 (ADH3) or any isoform thereof. The use according to claim 4, wherein 6. The method according to claim 1, wherein the first enzyme is cytochrome p450CYP1A1, CYP2C9, CYP
6. A CYP2E6, CYP2E1, CYP3A4, or CYP2D6.
Use as described in. 7. The method according to claim 1, wherein the first enzyme is cytochrome p450CYP1A1, and the first drug or prodrug is propafenone, flecainide, trimolol, metropolol, alprenolol, nortriptyline, desipramine, imipramine, clomipramine, perm 7. The use according to claim 6, wherein the use is phenazine, thioridazine, haloperidol, fluoxetine, paroxetine, codeine, ibogaine, or dextromethorphan. 8. The method according to claim 1, wherein the first enzyme is cytochrome p450CYP3A, and the first drug or prodrug is cyclosporine, erythromycin, methylprednisolone, carbazepine, midazolam, triazolam, quinidine, lovastin, warfarin, nifedipine, lidocaine, The use according to claim 6, which is terfenadine, asternizolam or cisapride. 9. The method according to claim 9, wherein the first enzyme is cytochrome p450CYP2C19, and the first drug or prodrug is mephenytoin, omoprazole, proguanil,
The use according to claim 6, which is diazepam or citalopram. 10. The use according to claim 6, wherein said first enzyme is N-acetyltransferase and said first drug or prodrug is isoniazid, hydralazine, or procainamide. 11. Encoding a sequence encoding a functional first enzyme isoform intended for the preparation of a pharmaceutical composition for pre-treatment of a patient in need of the first and second drugs or prodrugs. Or a first polynucleotide that is complementary thereto, wherein said first enzyme is involved in in vivo metabolism of said first agent or prodrug, and wherein said first agent or prodrug is Is involved in activating or inhibiting the expression of a second polynucleotide encoding a second enzyme involved in in vivo metabolism of the second drug or prodrug, wherein the second drug or prodrug is A first polynucleotide characterized in that it is over- or under-metabolized by a second enzyme and the first drug or prodrug is poorly metabolized in the patient Use of de. 12. The first and second enzymes are selected from the group consisting of cytochrome p450, UDP-glucuronosyltransferase, methyltransferase, alcohol dehydrogenase 3 (ADH3) and N-acetyltransferase, and isoforms thereof. The use according to claim 11, which is performed. 13. The method according to claim 13, wherein the first and second enzymes are cytochrome p450CYP1A1, CYP2C
13. The use according to claim 12, wherein the use is selected from the group consisting of CYP2C19, CYP2E1, CYP3A4 and CYP2D6. 14. Use according to claim 12 or 13, wherein said first and second enzymes are different. 15. The use according to any one of claims 11 to 14, wherein said first agent or prodrug is involved in activating said second enzyme. 16. The method of claim 16, wherein the first drug or prodrug is involved in inhibiting the second enzyme.
Use according to any one of claims 11 to 14. 17. The method of claim 1 for preventing or treating organ damage or toxicity in said patient.
Use according to any one of the preceding claims. 18. The use according to claim 17, wherein said organ is a liver. 19. The use according to claim 17, wherein said organ is a kidney. 20. The use according to claim 18, wherein the organ damage is alcoholism. 21. The method according to claim 21, wherein the first and / or second enzyme is alcohol dehydrogenase 3 (ADH).
The use according to claim 20, which is 3) or cytochrome p450CYP2E1. 22. Use according to any one of claims 1 to 16 for improving or enabling the efficacy of a first and / or second drug / prodrug. 23. The pharmaceutical composition of claim 1, wherein the pharmaceutical composition is for administration to a vertebrate target tissue.
23. Use according to any one of to 22. 24. The use according to claim 23, wherein the vertebrate target tissue is the liver. 25. The use according to claim 6, wherein said first agent or prodrug is an agent for treating opiates or cocaine addiction. 26. A pharmaceutical composition for pre-treatment of a patient in need of a drug or prodrug, wherein said drug or prodrug is excessively or poorly metabolized by the patient's natural enzymes. Comprising a polynucleotide according to any one of claims 1 to 6, optionally comprising a pharmaceutically acceptable injectable carrier. 27. The pharmaceutical composition according to claim 26, wherein said polynucleotide is DNA. 28. The pharmaceutical composition according to claim 26, wherein the polynucleotide is a naked nucleic acid. 29. The pharmaceutical composition according to claim 26, wherein the polynucleotide is a polynucleotide associated with a viral polypeptide. 30. The pharmaceutical composition according to claim 26, wherein the polynucleotide is a polynucleotide complexed with a cationic component, more preferably a cationic lipid. 31. The pharmaceutical composition according to claim 26, wherein the concentration of the polynucleotide is about 0.1 μg / ml to about 20 mg / ml. 32. A pharmaceutical composition for the treatment of a patient, wherein ethanol is poorly metabolized by said patient's natural enzymes, said composition comprising alcohol dehydrogenase 3 (ADH3).
And / or a pharmaceutical composition comprising a polynucleotide encoding a functional isoform of CYP2E1.