CA2343321A1 - Pharmaceutical composition for the pre-treatment of a patient in need of drug or pro-drug - Google Patents
Pharmaceutical composition for the pre-treatment of a patient in need of drug or pro-drug Download PDFInfo
- Publication number
- CA2343321A1 CA2343321A1 CA002343321A CA2343321A CA2343321A1 CA 2343321 A1 CA2343321 A1 CA 2343321A1 CA 002343321 A CA002343321 A CA 002343321A CA 2343321 A CA2343321 A CA 2343321A CA 2343321 A1 CA2343321 A1 CA 2343321A1
- Authority
- CA
- Canada
- Prior art keywords
- drug
- enzyme
- pro
- patient
- polynucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/44—Oxidoreductases (1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/44—Oxidoreductases (1)
- A61K38/443—Oxidoreductases (1) acting on CH-OH groups as donors, e.g. glucose oxidase, lactate dehydrogenase (1.1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/30—Drugs for disorders of the nervous system for treating abuse or dependence
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/30—Drugs for disorders of the nervous system for treating abuse or dependence
- A61P25/32—Alcohol-abuse
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/30—Drugs for disorders of the nervous system for treating abuse or dependence
- A61P25/36—Opioid-abuse
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0077—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with a reduced iron-sulfur protein as one donor (1.14.15)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
Abstract
Provided are pharmaceutical compositions for the pre-treatment of a patient in need of a drug or a pro-drug wherein said drug or pro-drug is over or under metabolized in said patient, and uses of such pharmaceutical composition.</S DOAB>
Description
Pharmaceutical Composition For The Pre-Treatment Of Patient In Need Of A Drug Or Pro-Drug The present invention concerns the preparation of a pharmaceutical composition io for the pre-treatment of a patient in need of a drug or a pro-drug wherein said drug or pro-drug is over or under metabolized in said patient, and uses of such pharmaceutical composition.
Over the past 20 years, genetic heterogeneity has been increasingly recognized as is a significant source of variation in drug response. Many scientific communications (Meyer, Ann. Rev. Pharmacol. Toxicol. 37 (1997), 269-296 and West, J. Clin.
Pharmacol. 37 (1997), 635-648) have clearly shown that some drugs work better or may even be highly toxic in some patients than in others and that these variations in patient's responses to drugs can be related to molecular basis. This 20 "pharmacogenomic" concept spots correlations between responses to drugs and genetic profiles of patient's (Marshall, Nature Biotechnology, 15 (1997), 954-957;
Marshall, Nature Biotechnology, 15 (1997), 1249-1252}.
Drugs or pro-drugs after their in vivo administration are metabolized in order to be 2s eliminated either by excretion or by metabolism to one or more active or inactive metabolites (Meyer, J. Pharmacokinet. Biopharm. 24 (1996), 449-459). The systems which are involved in these metabolisms are enzymatic pathways (involving for example, cytochrome P450, dehydrogenases, oxidases, esterases, reductases and a number of conjugating enzymatic systems including methyl 3o transferase, glutathione-s-transferase, arylhydrocarbon hydroxylase, sulfotransferase, glucuronyl transferase or N-acetyl transferase) localized in specific organs (mainly in the liver) (Ferrero, Adv. Pharmacol. 43 (1997), 131-169}.
WO 00/17366 PCT/EP99/069~3 For example, the cytochrome p450 enzyme, which is responsible for the metabolism of the majority of drugs given to human, bears the brunt of the load metabolizing drugs into products that are more readily excreted into the urine and feces. It is furthermore well known that the level of these enzymes can affect the s rate of metabolism of drugslpro-drugs and that these levels can be induced by certain drugs or be correlated to genetic polymorphisms between individuals (e.g.
amplification of the genes encoding said enzymes). Similarly, inter-individual variability can result of genetic alterations (e.g. deletions) that lead to low expression of the enzymes or expression of deficient isoforms of the enzymes.
1o When the level of metabolizing enzymes is too high or when the produced enzymes are ultrarapid metabolizes isoforms (showing an increased metabolism activity compared with the wild type isoform of the enzyme), the metabolism rate is also high and therefore a) the drug is rapidly cleared leading to an inefficient concentration of the drug in blood or tissue and to a resistance to the implemented 15 therapy or b) the pro-drug is excessively converted into its active form which can reach toxic levels in the patient. Conversely, when the level of said enzymes is too low or when the produced enzymes are non metabolizes or slow metabolizes isoforms (showing a decreased metabolism activity compared with the wild type isoform of the enzyme), the metabolism rate is also low leading to c) an inefficient 2o drug clearance, toxic drug concentration in the blood and tissue or d) an inefficient pro-drug conversion, low rate of active drug and therefore inefficient treatment {see, for review, Ozama, J. Toxicol. Sci. 21 (1996), 323-329).
P450 enzymes are involved in the metabolism of numerous physiological 25 substrates such as steroids, fatty acids, prostaglandins, cytokines, bile acids (Nebert and Nelson, 1991, Methods in Enzymology, 206, 3-11 ). P450 enzyme is a super-family of various enzymes, many of which metabolize a wide range of foreign chemicals including drugs. Genetic polymorphisms have been identified, for example among six of the P450 enzymes named CYP1A1, CYP2C9, CYP2C19, 3o CYP2E1, CYP3A4 and CYP2D6 which can alter enzymatic response to drugs and define slow or ultrarapid metabolizes isoforms (Guengerich, Chem. Biol.
Interact.
106 (1997), 161-182; Wrighton, J. Pharmacokinet. Biopharm. 24 (1996), 461-473).
Over the past 20 years, genetic heterogeneity has been increasingly recognized as is a significant source of variation in drug response. Many scientific communications (Meyer, Ann. Rev. Pharmacol. Toxicol. 37 (1997), 269-296 and West, J. Clin.
Pharmacol. 37 (1997), 635-648) have clearly shown that some drugs work better or may even be highly toxic in some patients than in others and that these variations in patient's responses to drugs can be related to molecular basis. This 20 "pharmacogenomic" concept spots correlations between responses to drugs and genetic profiles of patient's (Marshall, Nature Biotechnology, 15 (1997), 954-957;
Marshall, Nature Biotechnology, 15 (1997), 1249-1252}.
Drugs or pro-drugs after their in vivo administration are metabolized in order to be 2s eliminated either by excretion or by metabolism to one or more active or inactive metabolites (Meyer, J. Pharmacokinet. Biopharm. 24 (1996), 449-459). The systems which are involved in these metabolisms are enzymatic pathways (involving for example, cytochrome P450, dehydrogenases, oxidases, esterases, reductases and a number of conjugating enzymatic systems including methyl 3o transferase, glutathione-s-transferase, arylhydrocarbon hydroxylase, sulfotransferase, glucuronyl transferase or N-acetyl transferase) localized in specific organs (mainly in the liver) (Ferrero, Adv. Pharmacol. 43 (1997), 131-169}.
WO 00/17366 PCT/EP99/069~3 For example, the cytochrome p450 enzyme, which is responsible for the metabolism of the majority of drugs given to human, bears the brunt of the load metabolizing drugs into products that are more readily excreted into the urine and feces. It is furthermore well known that the level of these enzymes can affect the s rate of metabolism of drugslpro-drugs and that these levels can be induced by certain drugs or be correlated to genetic polymorphisms between individuals (e.g.
amplification of the genes encoding said enzymes). Similarly, inter-individual variability can result of genetic alterations (e.g. deletions) that lead to low expression of the enzymes or expression of deficient isoforms of the enzymes.
1o When the level of metabolizing enzymes is too high or when the produced enzymes are ultrarapid metabolizes isoforms (showing an increased metabolism activity compared with the wild type isoform of the enzyme), the metabolism rate is also high and therefore a) the drug is rapidly cleared leading to an inefficient concentration of the drug in blood or tissue and to a resistance to the implemented 15 therapy or b) the pro-drug is excessively converted into its active form which can reach toxic levels in the patient. Conversely, when the level of said enzymes is too low or when the produced enzymes are non metabolizes or slow metabolizes isoforms (showing a decreased metabolism activity compared with the wild type isoform of the enzyme), the metabolism rate is also low leading to c) an inefficient 2o drug clearance, toxic drug concentration in the blood and tissue or d) an inefficient pro-drug conversion, low rate of active drug and therefore inefficient treatment {see, for review, Ozama, J. Toxicol. Sci. 21 (1996), 323-329).
P450 enzymes are involved in the metabolism of numerous physiological 25 substrates such as steroids, fatty acids, prostaglandins, cytokines, bile acids (Nebert and Nelson, 1991, Methods in Enzymology, 206, 3-11 ). P450 enzyme is a super-family of various enzymes, many of which metabolize a wide range of foreign chemicals including drugs. Genetic polymorphisms have been identified, for example among six of the P450 enzymes named CYP1A1, CYP2C9, CYP2C19, 3o CYP2E1, CYP3A4 and CYP2D6 which can alter enzymatic response to drugs and define slow or ultrarapid metabolizes isoforms (Guengerich, Chem. Biol.
Interact.
106 (1997), 161-182; Wrighton, J. Pharmacokinet. Biopharm. 24 (1996), 461-473).
Similarly, N-acetyltransferase isoforms can divide patients into slow acetylators, ultrarapid acetylators and moderate acetylators (wild type).
The level of expression of the CYP enzymes can also enhancelinhibit the rate of metabolism of specific drugs and lowerlimprove plasma levels of targeted drugs, such as warfarin or quinidin. This enzyme expression can furthermore be inducedlinhibited to an extent which varies from patient to patient by other drugs, such as phenobarbitol or rifampin. Moreover, some administered drugs (e.g.
coumarin) have a narrow therapeutic window which, if metabolism is too slow, can 1o result in excessive anticoagulation effect. Similarly, many of the adverse drug interactions can occur due to mutual interaction with the same enzymes.
CYP3A is a major route of metabolism for cyclosporine, quinidine, lovastatin, warfarin, nifedipine, lidocaine, terfenadine, astemizole, cisapride, ~5 methylprednisolone, carbamazepine, midazolam, triazolam or erythromycin, for example. Inhibition of CYP3A by gene alteration (slow isoform) or inhibition of CYP3A gene expression with another drug, such as ketoconazole, itraconazole, fluconazole, diltiazem, nicardipine or verapamil, can result in increased side effects which can induce organ damages.
CYP2D6 is the main metabolizing enzyme for antiarrhythmic agents (e.g.
propaferone, flecainide), beta-adrenoreceptor blockers (e.g. timolol, metoprolol or alprenolol}, tricyclic antidepressants (e.g. nortriptyline, desipramine, imipramine or clomipramine), neuroleptic drugs (e.g. perphenazine, thioridazine or haloperidol), 2s selective serotonin reuptake inhibitors (e.g. fluoxetine or paroxetine) and opiates (e.g. codeine or dextromethorphan). For example, poor ability to metabolize codeine translates into impaired production of the active metabolite morphine resulting in a lower analgesic effect. Poor ability to metabolize can also result in systemic side effects for many of drugs. For example, ophtalmic administration of 3o timilol in a patient with slow metabolizer CYP2D6 isoform can result in systemic beta-adrenoreceptor blockade. 20% of Caucasians are slow metabolizers of drugs due to impaired CYP2D6 activity.
The level of expression of the CYP enzymes can also enhancelinhibit the rate of metabolism of specific drugs and lowerlimprove plasma levels of targeted drugs, such as warfarin or quinidin. This enzyme expression can furthermore be inducedlinhibited to an extent which varies from patient to patient by other drugs, such as phenobarbitol or rifampin. Moreover, some administered drugs (e.g.
coumarin) have a narrow therapeutic window which, if metabolism is too slow, can 1o result in excessive anticoagulation effect. Similarly, many of the adverse drug interactions can occur due to mutual interaction with the same enzymes.
CYP3A is a major route of metabolism for cyclosporine, quinidine, lovastatin, warfarin, nifedipine, lidocaine, terfenadine, astemizole, cisapride, ~5 methylprednisolone, carbamazepine, midazolam, triazolam or erythromycin, for example. Inhibition of CYP3A by gene alteration (slow isoform) or inhibition of CYP3A gene expression with another drug, such as ketoconazole, itraconazole, fluconazole, diltiazem, nicardipine or verapamil, can result in increased side effects which can induce organ damages.
CYP2D6 is the main metabolizing enzyme for antiarrhythmic agents (e.g.
propaferone, flecainide), beta-adrenoreceptor blockers (e.g. timolol, metoprolol or alprenolol}, tricyclic antidepressants (e.g. nortriptyline, desipramine, imipramine or clomipramine), neuroleptic drugs (e.g. perphenazine, thioridazine or haloperidol), 2s selective serotonin reuptake inhibitors (e.g. fluoxetine or paroxetine) and opiates (e.g. codeine or dextromethorphan). For example, poor ability to metabolize codeine translates into impaired production of the active metabolite morphine resulting in a lower analgesic effect. Poor ability to metabolize can also result in systemic side effects for many of drugs. For example, ophtalmic administration of 3o timilol in a patient with slow metabolizer CYP2D6 isoform can result in systemic beta-adrenoreceptor blockade. 20% of Caucasians are slow metabolizers of drugs due to impaired CYP2D6 activity.
CYP2C19 metabolizes drugs such as mephenytoin, omeprazole, proguanil, diazepam or citalopram. Patients with the slow metabolizer isoform of. CYP2C19 are 100 to 200 fold less efficient than normal patients at metabolizing said drugs. A
regular dose of mephenytoin to slow metabolizers will result in higher drug levels, s exaggerated pharmacologic responses and toxicity. 5% of Caucasians and 20%
of Orientals are slow metabolizers due to impaired CYP2C19 activity.
The cytochrome P450 (CYP) genes have been previously used in the frame of anti-tumoral gene therapy. US 5,688,773 and WO 97/35994 disclose a suicide gene io therapy strategy wherein the tumor cells, which ordinarily do not have the capacity to convert inactive cancer chemotherapeutic pro-drugs into active drugs having therapeutic effects, have been genetically modified by introducing a selected CYP
gene. The tumor modified by gene transfer becomes thus able to express the CYP
enzyme and thereby becomes specifically sensitive to antitumoral drugs (for is example oxazaphosphorines). These studies have shown that drug-activating CYP
genes may be useful for the development of novel combined chemotherapy/gene therapy strategies for the targeted treatment of cancer utilizing established cancer chemotherapeutic agents.
2o Isoniazid, hydralazine, procainamide as well as other drugs are metabolized in the Diver by N-acetyltransferase. If a drug is , converted into its active form or is eliminated by acetylation, the pharmacologic response and toxicity wilt be exaggerated -in the slow and ultrarapid acetylator patients subsets, respectively.
28% of Caucasians and 7% of Orientals are slow acetylators while 5% of 2s Caucasians and 15% of Orientals are ultrarapid acetylators due to different isoforms of N-acetyltransferase (NAT-1, NAT-2).
In this context of population variability with regard to drug therapy, pharmacogenomics has been proposed as a tool useful in the identification and 3o selection of patients which can respond to a particular drug without side effects.
This identification/selection can be based upon molecular diagnosis of genetic polymorphisms by genotyping DNA from leukocytes in the blood of patient, for example, and characterization of disease (Benz, Clin. Pharmacokinet. 32 (1997), AMENDED SHEET
4a 210-256; Engel, J. Chromatogra. B. Biomed. Appf. 678 (1996), 93-103). For the founders of health care, such as health maintenance organizations in the US
and government pubiic health services in many European countries, this pharmacogenomics approach can represent a way of both improving health care and reducing overheads ~~because there is a large cost to unnecessary drugs, ineffective drugs and drugs with side effects (for example, 106 000 die in US
and 2 millions are hospitalized by year due to drug interaction).
AMENDED SHEET
Nevertheless, this pharmacogenomic selection of patients which are possible candidates to drug therapy is not fully satisfactory because it only results in druglpro-drug or patients selection that are treatable. Therefore - a promising druglpro-drug could be cleared from the market because it is not s universal or economically not satisfactory because targeted to a restricted patient population and segmented market;
- a drug/pro-drug can be approvable but its use should provide improved dosing recommendations in product labeling by allowing the prescriber to anticipate, without any guarantee related to the security, necessary to dose 1o adjustments depending on the considered patient group, with a real risk of causing harm or death by prescribing the wrong drug to the wrong patients at the wrong dose;
- no solution are proposed for patients with slow or ultrarapid metabolism ;
- many drugs in cancer care, for example, are quite toxic, but they are 1s approvable because cancer is a fatal illness with no known cure and in this particular case, pharmacogenomic selection presents no utility.
The present invention proposes a way to recapture missed patients for a particular drug/pro-drug therapy, to decrease side effects related to altered metabolism of drug/pro-drug and to inhibit drug interaction.
Thus, the present invention first concerns the use of a first polynucleotide which encodes or is complementary to the sequence which encodes a functional first enzyme isoform, said first enzyme being involved in in vivo metabolism of a first drug or pro-drug, for the preparation of a pharmaceutical composition for the pre-2s treatment by gene therapy of a patient in need of said first drug or pro-drug wherein said first drug or pro-drug is over or under metabolized by said first enzyme in said patient.
According to the present invention, "in vivo metabolism of a drug or pro-drug"
3o means that the drug or pro-drug are enzymatically transformed into soluble and excretable metabolites in order to clear it from the body or processed from an inactive pro-drug form into an active one, respectively (Meyer, J.
Pharmacokinet Biopharm. 24 (1996), 449-459, is herein included as part of the description).
"Over metabolized" means that the drug/pro-drug is very actively and rapidly cleared from the body (eg. in feces or urine) leading to an inefficient concentration of the drug in blood or tissue and to a resistance to the implemented therapy;
or that the pro-drug is excessively converted into its active form which can reach toxic levels in the patient. This over metabolization can be associated with an over expression of the metabolizing enzyme (and therefore over concentration of this enzyme in blood or tissue); or with the expression of an ultrarapid enzyme isoform.
"Under metabolized" means that the druglpro-drug is insufficiently cleared from the body leading to toxic drug level; or that the pro-drug is insufficiently converted into its active form leading to a low rate of active drug in blood or tissue and therefore inefficient treatment. This under metabolization can be associated with an under ~s expression of the metabolizing enzyme or with synthesis of altered enzyme isoform (slow isoform).
"Gene therapy" is understood as a method for the introduction of a polynucleotide into cells. In particular, it concerns the case where the gene product (enzyme for example) is expressed in a target tissue as well as the case where the gene 2o product is excreted, especially into the blood stream.
Methods for delivering a nucleic acid to the interior of a cell of a vertebrate in vivo has been widely described in literature related to gene therapy. Gene therapy methods are well within the skill of those in the art. Most delivery mechanisms used to date involve viral vectors, especially adeno- and retroviral vectors.
Viruses have 25 developed diverse and highly sophisticated mechanisms to achieve this goal including crossing of the cellular membrane, escape from endosomes and lysosomal degradation, and finally delivery of their genome to the nucleus followed by expression of the viral genome. In consequence, viruses have been used in many gene delivery applications in vaccination or gene therapy applied to humans.
3o In 1990, Wolff, {Science, 247, 1465-1468) have shown that injection of naked RNA
or DNA, without any special delivery system, directly into mouse skeletal muscle results in expression of reporter genes within the muscle cells. Therefore, these results indicate that nucleic acid by itself is capable of end-up in certain cells in vivo.
Various methods have also been proposed in the literature based on the use of non-viral synthetic vectors to improve intracellular uptake of nucleic acids which present potential advantages with respect to large-scale production, safety, targeting of transfectable cells, low immunogenicity, and the capacity to deliver large fragments of DNA. Thus, in 1989, Felgner, (Nature, 337, 387-388) proposed the use of cationic lipids in order to facilitate the introduction of large anionic molecules such as nucleic acids into cells. These cationic lipids are capable of forming complexes with anionic molecules, thus tending to neutralize the negative charges of these molecules allowing to compact the complex, and favoring its introduction into the cell. Example of lipid-mediated transfection compounds are DOTMA (Felgner, PNAS 84 (1987), 7413-7417), DOGS or TransfectamT"' (Behr, PNAS 86 (1989), 6982-6986), DMRIE or DORIE (Felgner, Methods 5 (1993), 67-is 75), DC-CHOL (Gao, BBRC 179 (1991 ), 280-285), DOTAPT"" (McLachlan, Gene Therapy 2 (1995), 614-622) or LipofectamineT"".
Other non-viral delivery systems have been developed which are based on polymer-mediated transfection. There have been many reports on the use for cellular delivery of anionic polymers such as, for example, polyamidoamine 20 (Haensler, Bioconjugate Chem. 4 (1993), 372-379), dendritic polymer (WO
95/24221 ), polyethylene imine or polypropylene imine {WO 96/02655), polylysine (US-A-5,595,897 or FR-A-2 719 31fi).
The successful in vivo delivery of antisenselribozyme compounds, has been shown in many clinical trials using antisense oligonucleotides (for example, Guinot and 25 Temsamani, Pathol. Biol. 46 (1998), 347-354; Normanno and Agrawal, Mol.
Med.
Today 4 (1998), 514-516; Agrawal and Zhao, Curr. Opin. Chem. Biol. 2 (1998), 519-528), US 5,578,716; US 5, 773,601 ).
"Polynucleotide" may be a DNA andlor RNA fragment, single or double-stranded, linear or circular, natural or synthetic, modified or not (see US 5,525,711;
US
30 4,711,955 or EP 302 175 for modification examples) defining a fragment or a portion of a nucleic acid, without size limitation. It may be, infer alia, a genomic DNA, a cDNA, a mRNA, an antisense RNA, a ribozyme, or DNA encoding such RNAs. "Polynucleotides" and "nucleic acids" are synonyms with regard to the present invention. The polynucleotide may also be in the form of a plasmid or linear polynucleotide which contains at feast one coding sequence of polynucleotide that can be transcribed and translated to generate enzyme involved in in vivo metabolism of drug or pro-drug. The polynucleotide can also be an oligonucleotide which is to be delivered to the cell, e.g., for antisense or ribozyme functions.
According to the invention, said polynucleotide can also be formulated with viral proteins, or cationic lipids, or cationic polymers as vectors facilitating polynucleotide uptake into cells.
to In a preferred embodiment, both DNA and RNA can be delivered to cells to form therein all or part of enzyme, this product being able to metabolize in vivo drug or pro-drug. This product may further stay within the cell or be secreted from the cell.
In a more preferred embodiment, plasmid DNA is preferred. If the nucleic acids contain the proper genetic information, they will direct the synthesis of relatively is large amounts of the encoded enzyme. The genetic information necessary for expression by a target cell comprise all the elements required for transcription of said DNA into mRNA and for translation of mRNA into polypeptide.
Transcriptional promoters suitable for use in various vertebrate systems are well known. For example, suitable promoters include viral promoters RSV, MPSV, SV40, CMV or 20 7.5k, vaccinia promoter, inducible promoters, etc. Nucleic acids can also include intron sequences, targeting sequences, transport sequences, sequences involved in replication or integration. Said sequences have been reported in the literature and can be readily obtained by those skilled in the art. Nucleic acids can also be stabilized with specific components such as spermine. According to the invention, 25 the polynucleotide can be homologous or heterologous to the target expressing cells.
"A functional enzyme isoform" (also called "moderate" or "wild type isoform") designates all or part of a polypeptide showing enzymatic properties comparable to those of the functional enzyme (wild type) naturally involved in drug metabolism 3o pathway.
"Slow metabolizers isoforms of an enzyme" designates enzyme isoforms which have low or no ability to metabolize drugs compared to the functional isoform.
"Pre-treatment of patient" means that the pharmaceutical preparation of the present invention is intended to be administered to patients in conjunction with or separately, simultaneously or preferably prior, to a druglpro-drug administration to patients in need of said druglpro-drug treatment.
s "Slow metabolizes patient" means that in said patient druglpro-drug is under metabolized by the related metabolizing enzyme. Conversely, "ultrarapid metabolizes patient" means that in said patient drug/pro-drug is over metabolized by the related metabolizing enzyme.
According to a first embodiment, the patient is an ultrarapid metabolizes patient to which means that in this patient, before pre-treatment with the pharmaceutical composition of the invention, said first drug or pro-drug is over metabolized by said first enzyme. The ultrarapid metabolizes phenotype can be correlated to an enhanced expression of the gene encoding said first enzyme into the patient cells or to an enhancement of the activity of said first enzyme (ultrarapid first enzyme is isoform). According to a preferred embodiment, said first polynucleotide is an antisense RNA complementary to all or part of the sequence which encodes said first enzyme. In this specific case, the observed over metabolism in the patient is associated to high level expression of said enzyme. Antisense gene therapy has been widely disclosed in literature (for a review see for example Gura, Science 270 20 (1995), 575-577). By computerized analysis, antisense sequences can easily be determined which can bind in vivo to the gene or the RNA encoding said first enzyme in order to block its synthesis and reduce its level into the patient.
According to a preferred embodiment, said first drug or pro-drug is under 25 metabolized by said first enzyme in said patient. This patient is a slow metabolizes patient which means that in this patient, before pre-treatment with the pharmaceutical composition of the invention, said first drug or pro-drug is under metabolized by said first enzyme. This case occurs more specifically when the first enzyme is under expressed or has a lower activity compared to the functional 3o isoform (slow metabolizers enzyme isoforms). In this specific embodiment of the invention, the polynucleotide encodes a functional isoform of said first enzyme.
This first enzyme can also be selected in the group including enzymes responsible for acetylation, methylation, glucuronidation, sulfation or de-esterification.
In a preferred embodiment, said first enzyme is an enzyme produced by the liver, and more specifically is selected in the group consisting in cytochrome p450, UDP-5 glucuronosyl transferase, methyl transferase and N-acetyl transferase and their isoforms.
According to a first embodiment of the invention, said first enzyme is selected in the group consisting in cytochrome p450 enzymes named CYP1A1, CYP2C9, to CYP2C19, CYP2E1, CYP3A4 and CYP2D6.
When said first enzyme is the cytochrome p450 enzyme named CYP2D6, said first drug or pro-drug is selected from the group consisting in propafenone, flecainide, trimolol, metropolol, alprenolol, nortriptyiine, desipramine, imipramine, clomipramine, perphenazine, thioridazine, haloperidol, fluoxetine, paroxetine, codeine and dextromethorphan.
When said first enzyme is the cytochrome p450 enzyme named CYP3A, said first drug or pro-drug is selected from the group consisting in cyclosporine, 2o erythromycin, methylprednisolone, carbazepine, midazolam, triazolam, quinidine, lovastin, warfarin, nifedipine, lidocaine, terfenadine, asternizolam and cisapride.
When said first enzyme is the cytochrome p450 enzyme named CYP2C19, said first drug or pro-drug is selected from the group consisting in mephenytoin, omoprazole, proguanil, diazepam and citalopram.
When said first enzyme is the N-acetyl transferase, said first drug or pro-drug is selected from the group consisting in isoniazid, hydralazine and procainamide.
3o Much emphasis in metabolic research and development has focused on the liver because this organ has always been regarded as the principal site of drug metabolism. However, for particular drugs, other tissues may predominate (e.g., the kidney or gastrointestinal mucosa). Polynucleotides encoding functional isoform of enzymes involved in organ directed metabolism pathways have been reported in the literature and can be readily obtained by those skilled in the art (see, for example, nucleic acid sequences disclosed in GenBank data basis, s http:liwww.ncbl.nlm.nih.gov/genbank), i.e., CYP1A1 coding sequence available on GenBank, Accession number NM 000499, CYPC19 coding sequence (GenBank Accession number NM 000769), CYP2E1 coding sequence (GenBank Accession number AF 084225), CYP3A4 coding sequence (GenBank Accession number NM
000106) or ADH3 coding sequence (GenBank Accession number NM 000669).
Moreover, many enzymatic metabolic routes of eliminationlconversion of a druglpro-drug, can be inhibited or induced by concomitant treatment with another drug or pro-drug. As a result, abrupt changes can occur with co-administered agent in a single patient. Such interaction can lead to a substantial decrease or increase 1s in the blood and tissue concentrations of a drug/pro-drug or cause the accumulation of a toxic substance.
The invention is therefore further directed to the use of a first polynucleotide which encodes or is complementary to the sequence which encodes a functional first 2o enzyme isoform, said first enzyme being involved in in vivo metabolism of a first drug or pro-drug, said first drug or pro-drug being involved in activation or inhibition of the expression of a second polynucleotide which encodes a second enzyme involved in a second drug or pro-drug in vivo metabolism, for the preparation of a pharmaceutical composition for the pre-treatment of patient in need of said first and 2s second drug or pro-drug wherein said second drug or pro-drug is over or under-metabolized by said second enzyme and said first drug or pro-drug is under-metabolized in said patient.
The activation/inhibition of the second druglpro-drug metabolism can result of 3o activation/inhibition by a first druglpro-drug a) of the expression level of the polynucleotide encoding said second enzyme or b) of the enzymatic activity of said second enzyme.
The second enzyme is defined as previously described for the first one.
According to a first embodiment, the first and second enzymes are selected in the group consisting in cytochrome p450 enzymes named CYP1A1, CYP2C9, CYP2C19, s CYP2E1, CYP3A4 and CYP2D6. However, according to a preferred embodiment, said first and second enzymes are different and are involved in metabolism of different first and second drug/pro-drug, respectively.
According to a particular embodiment, the first drug or pro-drug is involved in to activation of said second enzyme. For example, said first drug or pro-drug is phenobarbitol or rifampicin and said second enzyme is a cytochrome P450 isoform.
According to another particular embodiment, the first drug or pro-drug is involved in inhibition of said second enzyme. For example, said first drug or pro-drug is quinine, said second enzyme is a CYP2D6 isoform and said first enzyme is is CYP3A4. In another example, said first drug or pro-drug is selected in the group consisting in cyclosporine, erythromycine, ketoconazole, itraconazole, fluconazole, diltiazen, nicardipine and verapamil involved in inhibition of said second enzyme which is a CYP isoform and said second drug is selected in the group consisting in cyclosporine, quinidine, lovastine, warfarin, nifectipine, loidocaine, terfenadine, 2o astemizole, cisapride, erythromycin, methylprednisolone, carbamazepine, midazolam and triazolam.
According to the invention, the targeted patient is in need of at least a first druglpro-drug but is also a slow or ultrarapid metabolizer for said first druglpro-2s drug. Therefore, administration of said druglpro-drug to said patient can be correlated to inefficient or toxic level of active drug in blood or tissue and consequently to possible organ damages or toxicity. The invention further relates to uses as previously disclosed to prevent or to treat organ damage or toxicity in patient, and more particularly hepatic or renal damages or toxicity. According to a so particular embodiment, said hepatic damage is alcoholism. Alcoholism could be a side effect of drug/pro-drug delivery and inefficient metabolism. It can also result from the deleterious effects of alcohol which are caused by its metabolism.
For example, Brown, (Pharmacogenetics 8 (1998), 335-342) have focused their attention upon gene encoding ethanol metabolizing enzymes. They have identified related polymorphisms in gene loci-cytochrome p4502E1 (CYP2E1) and alcohol dehydrogenase 3 (ADH3). In this special case, ethanol could be considered as a drug equivalent even when this drug is not administered with therapeutic prospect.
According to a specific embodiment, the targeted patient can be an opiate or cocaine user. Ibogaine, for example, is a psychoactive alkaloid that possesses potential as an agent to treat opiate or cocaine addiction. The primary metabolite to arises via O-demethylation at the 12-position to yield 12-hydroxyibogamine.
Obach, (Drug ~etab. Dispos. 26 (1998), 764-768) have presented evidence that the O-demethylation of ibogaine observed in the liver is catalyzed primarily by the polymorphically expressed cytochrome p4502D6 (CYP2D6). Therefore, over- or under-metabolism of ibogaine, or related druglpro-drug involved in treatment of is drug addiction, could have effect in said treatment.
The invention is also related to uses to improve or enable efficacy of first and or second drug/pro-drug.
2o The present invention concerns preparation of therapeutic composition for administration into vertebrate target tissues, and more specifically into the liver.
Said administration can be performed by different delivery routes (systemic delivery and targeted delivery). According to the present invention, the prepared therapeutic composition is preferably administered into organ involved in druglpro-drug 25 metabolism, however prepared therapeutic composition administration can also occur in other tissues of the vertebrate body including those of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, connective tissue, blood, tumor, etc. The polynucleotide 3o encoded enzyme can thus be excreted in body fluids (e.g., blood) allowing its delivery in metabolizing organs or said polynucleotide can be associated with targeting molecules which are capable to point its uptake into targeted cells.
Gene therapy literature provides many mechanisms for efficient and targeted delivery and expression of genetic information within the cells of a living organism (see for example 'European patent application EP-0 401 108.0). Said administration may be made by intradermal, subdermal, intravenous, intramuscular, intranasal, s intracerebral, intratracheal, intraarterial, intraperitoneal, intravesical, intrapleural, intracoronary or intratumoral injection, with a syringe or other devices.
Transdermal administration is also contemplated, as are inhalation or aerosol routes.
The invention also pertains to a pharmaceutical composition for the pre-treatment of patient in need of a drug or pro-drug wherein said drug or pro-drug is over or under metabolized by a natural enzyme in said patient, said composition comprising a polynucleotide which encodes or is complementary to the sequence which encodes a functional enzyme isoform, said enzyme being involved in in vivo metabolism of a drug or pro-drug .
~5 The pharmaceutical composition in accordance with the present invention comprises a polynucleotide which encodes or is complementary to the sequence which encodes a functional isoform of an enzyme produced by the liver, and more specifically which is selected in the group consisting in cytochrome p450, UDP
2o glucuronosyl transferase, methyl transferase, N-acetyl transferase and alcohol dehydrogenase 3 (ADH3).
According to a preferred embodiment of the invention, said enzyme is selected in the group consisting in cytochrome p450 enzymes named CYP1A1, CYP2C9, 25 CYP2C19, CYP2E1, CYP3A4 and CYP2D6.
According to a specific embodiment, the pharmaceutical composition comprises an antisense RNA complementary to all or part the sequence which encodes said first enzyme.
In another preferred embodiment, the polynucleotide which is contained in the pharmaceutical composition is a DNA. Other particular embodiments of the invention are pharmaceutical compositions wherein said polynucleotide is naked, associated with viral polypeptides or complexed with cationic components, more preferably with cationic lipids. In general, the concentration of polynucleotide in the pharmaceutical compositions is from about 0.1 pglml to about 20 mglml.
s In a further preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable injectable carrier. The carrier is preferably isotonic, hypotonic or weakly hypertonic and has a relatively low ionic strength, such as provided by a sucrose solution. It includes any relevant solvent, to aqueous or partly aqueous liquid carrier comprising sterile, pyrogen-free water, dispersion media, coatings, and equivalents. The pH of the pharmaceutics!
preparation is suitably adjusted and buffered.
In another embodiment, the pharmaceutical composition of the present invention 15 comprises an instruction for use of said pharmaceutical composition (e.g., a leaflet) describing that said pharmaceutical composition is used according to the present invention, i.e. for the pre-treatment of a patient in need of above said first drug or pro-drug, wherein said first drug or pro-drug is over or under metabolized by above said first enzyme in said patient. In another embodiment said instruction for use 2o describes that the pharmaceutical composition of the present invention is used for the pre-treatment of a patient in need of above said first and second drug or pro-drug, wherein said second drug or pro-drug is over or under metabolized by said second enzyme and said first drug or pro-drug is under metabolized in said patient.
2s The invention has been described in an illustrative manner, and it is to be understood that the terminology which has been used is intended to be in the nature of words of description rather than of limitation. Obviously, many modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the 3o claims, the invention may be practiced otherwise than as specifically described.
The present invention is further illustrated by reference to the following non-limiting example:
Example: Construction of an adenoviral vector expressing cytochrome p450 s CYP1 A1 (Ad CYP1 A1 ).
The constructs below described have been made according to the molecular cloning methods described in Maniatis et al., (1989, Laboratory Manual, Cold Spring Harbor, Laboratory Press, Cold Spring Harbor, NY). The homologous 1o recombinant steps are preferably realized in E. toll BJ 5183 strain (Hanahan, J.
Mol. Biol. 166 (1983), 557-580). The adenovirai fragments used are defined with reference to their position in the Adenovirus 5 genome sequence as disclosed in GenBank, Accession number M73260. Cells are transfected and cultured according to technique widely used in the art.
The coding region of CYP1A1 has been amplified by PCR using a human cDNA
library and primer oligonucleotides, defined with reference to CYP1A1 sequence available on GenBank, Accession number NM 000499, and comprising EcoRl and Xbal restriction sites:
from 5' end 5' GGCAGCCAGAATTCCTGAAGGTGAC 3' from 3' end 5'GGCTGTCAGTGGGATCTAGACTAAGAGCGCAGC 3' EcoRl and Xbal restriction sites have been respectively introduced in 5' and 3' end 2s of the CYP1A1 coding sequence. The PCR fragment is then digested with EcoRl and Xbal, and inserted into pCl-neo plasmid (Promega Corp) leading to pCl-neoCYP1A1. The fragment Xhol Xbal of pCl-neoCYP1A1 including the CYP1A1 coding sequence is isolated and subcloned into the vector pTG6600 (Lathe et al, 1987, Gene 57, 193-201 ) linearized wit the same enzymes. The resulting transfert 3o vector is named pTG6600 CYP1A1. The adenoviral vector Ad CYP1A1 is produced by homologous recombination in E. toll BJ 5183 strain between the Pacl-8stEll fragment of pTG6600 CYP1 A1 and vector pTG6624 finearized with Clal. The final construct Ad CYP1A1 comprises the E1 (nucleotides 459 to 3328) and E3 (nucleotides 28249 to 30758) deleted AdS, comprising in the E1 region an expression cassette containing CYP1A1 coding sequence under the control of CMV promoter. Adenoviral particles are produced after transfection of 293 cell line (ATCC CRL1573). Said recombinant adenoviral vector might be used for preparing the composition of the present invention by combining it with a sucrose solution which is known as a pharmaceutically acceptable injectable carrier.
Using teachings readily available on GenBank and the methodology above-to described or equivalent one, skilled man can prepare recombinant vectors comprising CYP2C19 coding sequence (GenBank Accession nurnber NM 000769), CYP2E1 (GenBank Accession number D11131 ), CYP2D6 coding sequence (GenBank Accession number NM 000106) or ADH3 coding sequence {GenBank Accession number NM 000Ei69}.
CYP1A1 coding sequence available on GenBank, Accession number NM 000499, CYP2C19 coding sequence (GenBank Accession number NM 000769), CYP2E1 coding sequence (GenBank Accession number AF 084225), CYP3A4 coding sequence (GenBank Accession number D11131 ), CYP2D6 coding sequence (GenBank Accession number NM 000106) or ADH3 coding sequence (GenBank Accession number NM 000669).
regular dose of mephenytoin to slow metabolizers will result in higher drug levels, s exaggerated pharmacologic responses and toxicity. 5% of Caucasians and 20%
of Orientals are slow metabolizers due to impaired CYP2C19 activity.
The cytochrome P450 (CYP) genes have been previously used in the frame of anti-tumoral gene therapy. US 5,688,773 and WO 97/35994 disclose a suicide gene io therapy strategy wherein the tumor cells, which ordinarily do not have the capacity to convert inactive cancer chemotherapeutic pro-drugs into active drugs having therapeutic effects, have been genetically modified by introducing a selected CYP
gene. The tumor modified by gene transfer becomes thus able to express the CYP
enzyme and thereby becomes specifically sensitive to antitumoral drugs (for is example oxazaphosphorines). These studies have shown that drug-activating CYP
genes may be useful for the development of novel combined chemotherapy/gene therapy strategies for the targeted treatment of cancer utilizing established cancer chemotherapeutic agents.
2o Isoniazid, hydralazine, procainamide as well as other drugs are metabolized in the Diver by N-acetyltransferase. If a drug is , converted into its active form or is eliminated by acetylation, the pharmacologic response and toxicity wilt be exaggerated -in the slow and ultrarapid acetylator patients subsets, respectively.
28% of Caucasians and 7% of Orientals are slow acetylators while 5% of 2s Caucasians and 15% of Orientals are ultrarapid acetylators due to different isoforms of N-acetyltransferase (NAT-1, NAT-2).
In this context of population variability with regard to drug therapy, pharmacogenomics has been proposed as a tool useful in the identification and 3o selection of patients which can respond to a particular drug without side effects.
This identification/selection can be based upon molecular diagnosis of genetic polymorphisms by genotyping DNA from leukocytes in the blood of patient, for example, and characterization of disease (Benz, Clin. Pharmacokinet. 32 (1997), AMENDED SHEET
4a 210-256; Engel, J. Chromatogra. B. Biomed. Appf. 678 (1996), 93-103). For the founders of health care, such as health maintenance organizations in the US
and government pubiic health services in many European countries, this pharmacogenomics approach can represent a way of both improving health care and reducing overheads ~~because there is a large cost to unnecessary drugs, ineffective drugs and drugs with side effects (for example, 106 000 die in US
and 2 millions are hospitalized by year due to drug interaction).
AMENDED SHEET
Nevertheless, this pharmacogenomic selection of patients which are possible candidates to drug therapy is not fully satisfactory because it only results in druglpro-drug or patients selection that are treatable. Therefore - a promising druglpro-drug could be cleared from the market because it is not s universal or economically not satisfactory because targeted to a restricted patient population and segmented market;
- a drug/pro-drug can be approvable but its use should provide improved dosing recommendations in product labeling by allowing the prescriber to anticipate, without any guarantee related to the security, necessary to dose 1o adjustments depending on the considered patient group, with a real risk of causing harm or death by prescribing the wrong drug to the wrong patients at the wrong dose;
- no solution are proposed for patients with slow or ultrarapid metabolism ;
- many drugs in cancer care, for example, are quite toxic, but they are 1s approvable because cancer is a fatal illness with no known cure and in this particular case, pharmacogenomic selection presents no utility.
The present invention proposes a way to recapture missed patients for a particular drug/pro-drug therapy, to decrease side effects related to altered metabolism of drug/pro-drug and to inhibit drug interaction.
Thus, the present invention first concerns the use of a first polynucleotide which encodes or is complementary to the sequence which encodes a functional first enzyme isoform, said first enzyme being involved in in vivo metabolism of a first drug or pro-drug, for the preparation of a pharmaceutical composition for the pre-2s treatment by gene therapy of a patient in need of said first drug or pro-drug wherein said first drug or pro-drug is over or under metabolized by said first enzyme in said patient.
According to the present invention, "in vivo metabolism of a drug or pro-drug"
3o means that the drug or pro-drug are enzymatically transformed into soluble and excretable metabolites in order to clear it from the body or processed from an inactive pro-drug form into an active one, respectively (Meyer, J.
Pharmacokinet Biopharm. 24 (1996), 449-459, is herein included as part of the description).
"Over metabolized" means that the drug/pro-drug is very actively and rapidly cleared from the body (eg. in feces or urine) leading to an inefficient concentration of the drug in blood or tissue and to a resistance to the implemented therapy;
or that the pro-drug is excessively converted into its active form which can reach toxic levels in the patient. This over metabolization can be associated with an over expression of the metabolizing enzyme (and therefore over concentration of this enzyme in blood or tissue); or with the expression of an ultrarapid enzyme isoform.
"Under metabolized" means that the druglpro-drug is insufficiently cleared from the body leading to toxic drug level; or that the pro-drug is insufficiently converted into its active form leading to a low rate of active drug in blood or tissue and therefore inefficient treatment. This under metabolization can be associated with an under ~s expression of the metabolizing enzyme or with synthesis of altered enzyme isoform (slow isoform).
"Gene therapy" is understood as a method for the introduction of a polynucleotide into cells. In particular, it concerns the case where the gene product (enzyme for example) is expressed in a target tissue as well as the case where the gene 2o product is excreted, especially into the blood stream.
Methods for delivering a nucleic acid to the interior of a cell of a vertebrate in vivo has been widely described in literature related to gene therapy. Gene therapy methods are well within the skill of those in the art. Most delivery mechanisms used to date involve viral vectors, especially adeno- and retroviral vectors.
Viruses have 25 developed diverse and highly sophisticated mechanisms to achieve this goal including crossing of the cellular membrane, escape from endosomes and lysosomal degradation, and finally delivery of their genome to the nucleus followed by expression of the viral genome. In consequence, viruses have been used in many gene delivery applications in vaccination or gene therapy applied to humans.
3o In 1990, Wolff, {Science, 247, 1465-1468) have shown that injection of naked RNA
or DNA, without any special delivery system, directly into mouse skeletal muscle results in expression of reporter genes within the muscle cells. Therefore, these results indicate that nucleic acid by itself is capable of end-up in certain cells in vivo.
Various methods have also been proposed in the literature based on the use of non-viral synthetic vectors to improve intracellular uptake of nucleic acids which present potential advantages with respect to large-scale production, safety, targeting of transfectable cells, low immunogenicity, and the capacity to deliver large fragments of DNA. Thus, in 1989, Felgner, (Nature, 337, 387-388) proposed the use of cationic lipids in order to facilitate the introduction of large anionic molecules such as nucleic acids into cells. These cationic lipids are capable of forming complexes with anionic molecules, thus tending to neutralize the negative charges of these molecules allowing to compact the complex, and favoring its introduction into the cell. Example of lipid-mediated transfection compounds are DOTMA (Felgner, PNAS 84 (1987), 7413-7417), DOGS or TransfectamT"' (Behr, PNAS 86 (1989), 6982-6986), DMRIE or DORIE (Felgner, Methods 5 (1993), 67-is 75), DC-CHOL (Gao, BBRC 179 (1991 ), 280-285), DOTAPT"" (McLachlan, Gene Therapy 2 (1995), 614-622) or LipofectamineT"".
Other non-viral delivery systems have been developed which are based on polymer-mediated transfection. There have been many reports on the use for cellular delivery of anionic polymers such as, for example, polyamidoamine 20 (Haensler, Bioconjugate Chem. 4 (1993), 372-379), dendritic polymer (WO
95/24221 ), polyethylene imine or polypropylene imine {WO 96/02655), polylysine (US-A-5,595,897 or FR-A-2 719 31fi).
The successful in vivo delivery of antisenselribozyme compounds, has been shown in many clinical trials using antisense oligonucleotides (for example, Guinot and 25 Temsamani, Pathol. Biol. 46 (1998), 347-354; Normanno and Agrawal, Mol.
Med.
Today 4 (1998), 514-516; Agrawal and Zhao, Curr. Opin. Chem. Biol. 2 (1998), 519-528), US 5,578,716; US 5, 773,601 ).
"Polynucleotide" may be a DNA andlor RNA fragment, single or double-stranded, linear or circular, natural or synthetic, modified or not (see US 5,525,711;
US
30 4,711,955 or EP 302 175 for modification examples) defining a fragment or a portion of a nucleic acid, without size limitation. It may be, infer alia, a genomic DNA, a cDNA, a mRNA, an antisense RNA, a ribozyme, or DNA encoding such RNAs. "Polynucleotides" and "nucleic acids" are synonyms with regard to the present invention. The polynucleotide may also be in the form of a plasmid or linear polynucleotide which contains at feast one coding sequence of polynucleotide that can be transcribed and translated to generate enzyme involved in in vivo metabolism of drug or pro-drug. The polynucleotide can also be an oligonucleotide which is to be delivered to the cell, e.g., for antisense or ribozyme functions.
According to the invention, said polynucleotide can also be formulated with viral proteins, or cationic lipids, or cationic polymers as vectors facilitating polynucleotide uptake into cells.
to In a preferred embodiment, both DNA and RNA can be delivered to cells to form therein all or part of enzyme, this product being able to metabolize in vivo drug or pro-drug. This product may further stay within the cell or be secreted from the cell.
In a more preferred embodiment, plasmid DNA is preferred. If the nucleic acids contain the proper genetic information, they will direct the synthesis of relatively is large amounts of the encoded enzyme. The genetic information necessary for expression by a target cell comprise all the elements required for transcription of said DNA into mRNA and for translation of mRNA into polypeptide.
Transcriptional promoters suitable for use in various vertebrate systems are well known. For example, suitable promoters include viral promoters RSV, MPSV, SV40, CMV or 20 7.5k, vaccinia promoter, inducible promoters, etc. Nucleic acids can also include intron sequences, targeting sequences, transport sequences, sequences involved in replication or integration. Said sequences have been reported in the literature and can be readily obtained by those skilled in the art. Nucleic acids can also be stabilized with specific components such as spermine. According to the invention, 25 the polynucleotide can be homologous or heterologous to the target expressing cells.
"A functional enzyme isoform" (also called "moderate" or "wild type isoform") designates all or part of a polypeptide showing enzymatic properties comparable to those of the functional enzyme (wild type) naturally involved in drug metabolism 3o pathway.
"Slow metabolizers isoforms of an enzyme" designates enzyme isoforms which have low or no ability to metabolize drugs compared to the functional isoform.
"Pre-treatment of patient" means that the pharmaceutical preparation of the present invention is intended to be administered to patients in conjunction with or separately, simultaneously or preferably prior, to a druglpro-drug administration to patients in need of said druglpro-drug treatment.
s "Slow metabolizes patient" means that in said patient druglpro-drug is under metabolized by the related metabolizing enzyme. Conversely, "ultrarapid metabolizes patient" means that in said patient drug/pro-drug is over metabolized by the related metabolizing enzyme.
According to a first embodiment, the patient is an ultrarapid metabolizes patient to which means that in this patient, before pre-treatment with the pharmaceutical composition of the invention, said first drug or pro-drug is over metabolized by said first enzyme. The ultrarapid metabolizes phenotype can be correlated to an enhanced expression of the gene encoding said first enzyme into the patient cells or to an enhancement of the activity of said first enzyme (ultrarapid first enzyme is isoform). According to a preferred embodiment, said first polynucleotide is an antisense RNA complementary to all or part of the sequence which encodes said first enzyme. In this specific case, the observed over metabolism in the patient is associated to high level expression of said enzyme. Antisense gene therapy has been widely disclosed in literature (for a review see for example Gura, Science 270 20 (1995), 575-577). By computerized analysis, antisense sequences can easily be determined which can bind in vivo to the gene or the RNA encoding said first enzyme in order to block its synthesis and reduce its level into the patient.
According to a preferred embodiment, said first drug or pro-drug is under 25 metabolized by said first enzyme in said patient. This patient is a slow metabolizes patient which means that in this patient, before pre-treatment with the pharmaceutical composition of the invention, said first drug or pro-drug is under metabolized by said first enzyme. This case occurs more specifically when the first enzyme is under expressed or has a lower activity compared to the functional 3o isoform (slow metabolizers enzyme isoforms). In this specific embodiment of the invention, the polynucleotide encodes a functional isoform of said first enzyme.
This first enzyme can also be selected in the group including enzymes responsible for acetylation, methylation, glucuronidation, sulfation or de-esterification.
In a preferred embodiment, said first enzyme is an enzyme produced by the liver, and more specifically is selected in the group consisting in cytochrome p450, UDP-5 glucuronosyl transferase, methyl transferase and N-acetyl transferase and their isoforms.
According to a first embodiment of the invention, said first enzyme is selected in the group consisting in cytochrome p450 enzymes named CYP1A1, CYP2C9, to CYP2C19, CYP2E1, CYP3A4 and CYP2D6.
When said first enzyme is the cytochrome p450 enzyme named CYP2D6, said first drug or pro-drug is selected from the group consisting in propafenone, flecainide, trimolol, metropolol, alprenolol, nortriptyiine, desipramine, imipramine, clomipramine, perphenazine, thioridazine, haloperidol, fluoxetine, paroxetine, codeine and dextromethorphan.
When said first enzyme is the cytochrome p450 enzyme named CYP3A, said first drug or pro-drug is selected from the group consisting in cyclosporine, 2o erythromycin, methylprednisolone, carbazepine, midazolam, triazolam, quinidine, lovastin, warfarin, nifedipine, lidocaine, terfenadine, asternizolam and cisapride.
When said first enzyme is the cytochrome p450 enzyme named CYP2C19, said first drug or pro-drug is selected from the group consisting in mephenytoin, omoprazole, proguanil, diazepam and citalopram.
When said first enzyme is the N-acetyl transferase, said first drug or pro-drug is selected from the group consisting in isoniazid, hydralazine and procainamide.
3o Much emphasis in metabolic research and development has focused on the liver because this organ has always been regarded as the principal site of drug metabolism. However, for particular drugs, other tissues may predominate (e.g., the kidney or gastrointestinal mucosa). Polynucleotides encoding functional isoform of enzymes involved in organ directed metabolism pathways have been reported in the literature and can be readily obtained by those skilled in the art (see, for example, nucleic acid sequences disclosed in GenBank data basis, s http:liwww.ncbl.nlm.nih.gov/genbank), i.e., CYP1A1 coding sequence available on GenBank, Accession number NM 000499, CYPC19 coding sequence (GenBank Accession number NM 000769), CYP2E1 coding sequence (GenBank Accession number AF 084225), CYP3A4 coding sequence (GenBank Accession number NM
000106) or ADH3 coding sequence (GenBank Accession number NM 000669).
Moreover, many enzymatic metabolic routes of eliminationlconversion of a druglpro-drug, can be inhibited or induced by concomitant treatment with another drug or pro-drug. As a result, abrupt changes can occur with co-administered agent in a single patient. Such interaction can lead to a substantial decrease or increase 1s in the blood and tissue concentrations of a drug/pro-drug or cause the accumulation of a toxic substance.
The invention is therefore further directed to the use of a first polynucleotide which encodes or is complementary to the sequence which encodes a functional first 2o enzyme isoform, said first enzyme being involved in in vivo metabolism of a first drug or pro-drug, said first drug or pro-drug being involved in activation or inhibition of the expression of a second polynucleotide which encodes a second enzyme involved in a second drug or pro-drug in vivo metabolism, for the preparation of a pharmaceutical composition for the pre-treatment of patient in need of said first and 2s second drug or pro-drug wherein said second drug or pro-drug is over or under-metabolized by said second enzyme and said first drug or pro-drug is under-metabolized in said patient.
The activation/inhibition of the second druglpro-drug metabolism can result of 3o activation/inhibition by a first druglpro-drug a) of the expression level of the polynucleotide encoding said second enzyme or b) of the enzymatic activity of said second enzyme.
The second enzyme is defined as previously described for the first one.
According to a first embodiment, the first and second enzymes are selected in the group consisting in cytochrome p450 enzymes named CYP1A1, CYP2C9, CYP2C19, s CYP2E1, CYP3A4 and CYP2D6. However, according to a preferred embodiment, said first and second enzymes are different and are involved in metabolism of different first and second drug/pro-drug, respectively.
According to a particular embodiment, the first drug or pro-drug is involved in to activation of said second enzyme. For example, said first drug or pro-drug is phenobarbitol or rifampicin and said second enzyme is a cytochrome P450 isoform.
According to another particular embodiment, the first drug or pro-drug is involved in inhibition of said second enzyme. For example, said first drug or pro-drug is quinine, said second enzyme is a CYP2D6 isoform and said first enzyme is is CYP3A4. In another example, said first drug or pro-drug is selected in the group consisting in cyclosporine, erythromycine, ketoconazole, itraconazole, fluconazole, diltiazen, nicardipine and verapamil involved in inhibition of said second enzyme which is a CYP isoform and said second drug is selected in the group consisting in cyclosporine, quinidine, lovastine, warfarin, nifectipine, loidocaine, terfenadine, 2o astemizole, cisapride, erythromycin, methylprednisolone, carbamazepine, midazolam and triazolam.
According to the invention, the targeted patient is in need of at least a first druglpro-drug but is also a slow or ultrarapid metabolizer for said first druglpro-2s drug. Therefore, administration of said druglpro-drug to said patient can be correlated to inefficient or toxic level of active drug in blood or tissue and consequently to possible organ damages or toxicity. The invention further relates to uses as previously disclosed to prevent or to treat organ damage or toxicity in patient, and more particularly hepatic or renal damages or toxicity. According to a so particular embodiment, said hepatic damage is alcoholism. Alcoholism could be a side effect of drug/pro-drug delivery and inefficient metabolism. It can also result from the deleterious effects of alcohol which are caused by its metabolism.
For example, Brown, (Pharmacogenetics 8 (1998), 335-342) have focused their attention upon gene encoding ethanol metabolizing enzymes. They have identified related polymorphisms in gene loci-cytochrome p4502E1 (CYP2E1) and alcohol dehydrogenase 3 (ADH3). In this special case, ethanol could be considered as a drug equivalent even when this drug is not administered with therapeutic prospect.
According to a specific embodiment, the targeted patient can be an opiate or cocaine user. Ibogaine, for example, is a psychoactive alkaloid that possesses potential as an agent to treat opiate or cocaine addiction. The primary metabolite to arises via O-demethylation at the 12-position to yield 12-hydroxyibogamine.
Obach, (Drug ~etab. Dispos. 26 (1998), 764-768) have presented evidence that the O-demethylation of ibogaine observed in the liver is catalyzed primarily by the polymorphically expressed cytochrome p4502D6 (CYP2D6). Therefore, over- or under-metabolism of ibogaine, or related druglpro-drug involved in treatment of is drug addiction, could have effect in said treatment.
The invention is also related to uses to improve or enable efficacy of first and or second drug/pro-drug.
2o The present invention concerns preparation of therapeutic composition for administration into vertebrate target tissues, and more specifically into the liver.
Said administration can be performed by different delivery routes (systemic delivery and targeted delivery). According to the present invention, the prepared therapeutic composition is preferably administered into organ involved in druglpro-drug 25 metabolism, however prepared therapeutic composition administration can also occur in other tissues of the vertebrate body including those of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, connective tissue, blood, tumor, etc. The polynucleotide 3o encoded enzyme can thus be excreted in body fluids (e.g., blood) allowing its delivery in metabolizing organs or said polynucleotide can be associated with targeting molecules which are capable to point its uptake into targeted cells.
Gene therapy literature provides many mechanisms for efficient and targeted delivery and expression of genetic information within the cells of a living organism (see for example 'European patent application EP-0 401 108.0). Said administration may be made by intradermal, subdermal, intravenous, intramuscular, intranasal, s intracerebral, intratracheal, intraarterial, intraperitoneal, intravesical, intrapleural, intracoronary or intratumoral injection, with a syringe or other devices.
Transdermal administration is also contemplated, as are inhalation or aerosol routes.
The invention also pertains to a pharmaceutical composition for the pre-treatment of patient in need of a drug or pro-drug wherein said drug or pro-drug is over or under metabolized by a natural enzyme in said patient, said composition comprising a polynucleotide which encodes or is complementary to the sequence which encodes a functional enzyme isoform, said enzyme being involved in in vivo metabolism of a drug or pro-drug .
~5 The pharmaceutical composition in accordance with the present invention comprises a polynucleotide which encodes or is complementary to the sequence which encodes a functional isoform of an enzyme produced by the liver, and more specifically which is selected in the group consisting in cytochrome p450, UDP
2o glucuronosyl transferase, methyl transferase, N-acetyl transferase and alcohol dehydrogenase 3 (ADH3).
According to a preferred embodiment of the invention, said enzyme is selected in the group consisting in cytochrome p450 enzymes named CYP1A1, CYP2C9, 25 CYP2C19, CYP2E1, CYP3A4 and CYP2D6.
According to a specific embodiment, the pharmaceutical composition comprises an antisense RNA complementary to all or part the sequence which encodes said first enzyme.
In another preferred embodiment, the polynucleotide which is contained in the pharmaceutical composition is a DNA. Other particular embodiments of the invention are pharmaceutical compositions wherein said polynucleotide is naked, associated with viral polypeptides or complexed with cationic components, more preferably with cationic lipids. In general, the concentration of polynucleotide in the pharmaceutical compositions is from about 0.1 pglml to about 20 mglml.
s In a further preferred embodiment, the pharmaceutical composition further comprises a pharmaceutically acceptable injectable carrier. The carrier is preferably isotonic, hypotonic or weakly hypertonic and has a relatively low ionic strength, such as provided by a sucrose solution. It includes any relevant solvent, to aqueous or partly aqueous liquid carrier comprising sterile, pyrogen-free water, dispersion media, coatings, and equivalents. The pH of the pharmaceutics!
preparation is suitably adjusted and buffered.
In another embodiment, the pharmaceutical composition of the present invention 15 comprises an instruction for use of said pharmaceutical composition (e.g., a leaflet) describing that said pharmaceutical composition is used according to the present invention, i.e. for the pre-treatment of a patient in need of above said first drug or pro-drug, wherein said first drug or pro-drug is over or under metabolized by above said first enzyme in said patient. In another embodiment said instruction for use 2o describes that the pharmaceutical composition of the present invention is used for the pre-treatment of a patient in need of above said first and second drug or pro-drug, wherein said second drug or pro-drug is over or under metabolized by said second enzyme and said first drug or pro-drug is under metabolized in said patient.
2s The invention has been described in an illustrative manner, and it is to be understood that the terminology which has been used is intended to be in the nature of words of description rather than of limitation. Obviously, many modifications and variations of the present invention are possible in light of the above teachings. It is therefore to be understood that within the scope of the 3o claims, the invention may be practiced otherwise than as specifically described.
The present invention is further illustrated by reference to the following non-limiting example:
Example: Construction of an adenoviral vector expressing cytochrome p450 s CYP1 A1 (Ad CYP1 A1 ).
The constructs below described have been made according to the molecular cloning methods described in Maniatis et al., (1989, Laboratory Manual, Cold Spring Harbor, Laboratory Press, Cold Spring Harbor, NY). The homologous 1o recombinant steps are preferably realized in E. toll BJ 5183 strain (Hanahan, J.
Mol. Biol. 166 (1983), 557-580). The adenovirai fragments used are defined with reference to their position in the Adenovirus 5 genome sequence as disclosed in GenBank, Accession number M73260. Cells are transfected and cultured according to technique widely used in the art.
The coding region of CYP1A1 has been amplified by PCR using a human cDNA
library and primer oligonucleotides, defined with reference to CYP1A1 sequence available on GenBank, Accession number NM 000499, and comprising EcoRl and Xbal restriction sites:
from 5' end 5' GGCAGCCAGAATTCCTGAAGGTGAC 3' from 3' end 5'GGCTGTCAGTGGGATCTAGACTAAGAGCGCAGC 3' EcoRl and Xbal restriction sites have been respectively introduced in 5' and 3' end 2s of the CYP1A1 coding sequence. The PCR fragment is then digested with EcoRl and Xbal, and inserted into pCl-neo plasmid (Promega Corp) leading to pCl-neoCYP1A1. The fragment Xhol Xbal of pCl-neoCYP1A1 including the CYP1A1 coding sequence is isolated and subcloned into the vector pTG6600 (Lathe et al, 1987, Gene 57, 193-201 ) linearized wit the same enzymes. The resulting transfert 3o vector is named pTG6600 CYP1A1. The adenoviral vector Ad CYP1A1 is produced by homologous recombination in E. toll BJ 5183 strain between the Pacl-8stEll fragment of pTG6600 CYP1 A1 and vector pTG6624 finearized with Clal. The final construct Ad CYP1A1 comprises the E1 (nucleotides 459 to 3328) and E3 (nucleotides 28249 to 30758) deleted AdS, comprising in the E1 region an expression cassette containing CYP1A1 coding sequence under the control of CMV promoter. Adenoviral particles are produced after transfection of 293 cell line (ATCC CRL1573). Said recombinant adenoviral vector might be used for preparing the composition of the present invention by combining it with a sucrose solution which is known as a pharmaceutically acceptable injectable carrier.
Using teachings readily available on GenBank and the methodology above-to described or equivalent one, skilled man can prepare recombinant vectors comprising CYP2C19 coding sequence (GenBank Accession nurnber NM 000769), CYP2E1 (GenBank Accession number D11131 ), CYP2D6 coding sequence (GenBank Accession number NM 000106) or ADH3 coding sequence {GenBank Accession number NM 000Ei69}.
CYP1A1 coding sequence available on GenBank, Accession number NM 000499, CYP2C19 coding sequence (GenBank Accession number NM 000769), CYP2E1 coding sequence (GenBank Accession number AF 084225), CYP3A4 coding sequence (GenBank Accession number D11131 ), CYP2D6 coding sequence (GenBank Accession number NM 000106) or ADH3 coding sequence (GenBank Accession number NM 000669).
Claims (32)
1. Use of a first polynucleotide which encodes or is complementary to the sequence which encodes a functional isoform of a first enzyme, said first enzyme being involved in in vivo metabolism of a first drug or pro-drug, for the preparation of a pharmaceutical composition for the pre-treatment of a patient in need of said first drug or pro-drug wherein, before said pre-treatment;
(i) said first drug or pro-drug is over metabolized by said first enzyme in said patient leading to an inefficient or toxic concentration of the drug or pro-drug in the patient's blood or tissue;
(ii) said first drug is under metabolized by said first enzyme in said patient leading to a toxic concentration of the drug in the patient's blood or tissue; or (iii) said first pro-drug is under metabolized by said first enzyme in said patient leading to an inefficient concentration of the drug in the patient's blood or tissue.
(i) said first drug or pro-drug is over metabolized by said first enzyme in said patient leading to an inefficient or toxic concentration of the drug or pro-drug in the patient's blood or tissue;
(ii) said first drug is under metabolized by said first enzyme in said patient leading to a toxic concentration of the drug in the patient's blood or tissue; or (iii) said first pro-drug is under metabolized by said first enzyme in said patient leading to an inefficient concentration of the drug in the patient's blood or tissue.
2. The use of claim 1, wherein said first drug or pro-drug is over metabolized by said first enzyme in said patient and said first polynucleotide is an antisense RNA complementary to all or part the sequence which encodes said first enzyme.
3. The use of claim 1, wherein said first drug or pro-drug is under metabolized by said first enzyme in said patient and wherein said first polynucleotide encodes a functional isoform of said first enzyme.
4. The use of any one of claims 1 to 3, wherein said first enzyme is an hepatic enzyme.
5. The use of claim 4 wherein said first enzyme is selected in the group consisting of cytochrome p450, UDP-glucuronosyl transferase, methyl transferase, N-acetyl transferase or alcohol dehydrogenase 3 (ADH3) or any of their isoforms.
6. The use of claim 5 wherein said first enzyme is cytochrome p450 CYP1A1, CYP2C9, CYP2C19, CYP2E1, CYP3A4 or CYP2D6.
7. The use of claim 6 wherein said first enzyme is the cytochrome p450 CYP2D6 and said first drug or pro-drug is propafenone, flecainide, trimolol, metropolol, alprenolol, nortriptyline, desipramine, imipramine, clomipramine, perphenazine, thioridazine, haloperidol, fluoxetine, paroxetine, codeine, ibogaine or dextromethorphan.
8. The use of claim 6, wherein said first enzyme is the cytochrome p450 CYP3A
and said first drug or pro-drug is cyclosporine, erythromycin, methylprednisolone, carbazepine, midazolam, triazolam, quinidine, lovastin, warfarin, nifedipine, lidocaïne, terfenadine, astemizolam or cisapride.
and said first drug or pro-drug is cyclosporine, erythromycin, methylprednisolone, carbazepine, midazolam, triazolam, quinidine, lovastin, warfarin, nifedipine, lidocaïne, terfenadine, astemizolam or cisapride.
9. The use of claim 6, wherein said first enzyme is the cytochrome p450 CYP2C19 and said first drug or pro-drug is mephenytoin, omoprazole, proguanil, diazepam or citalopram.
10. The use of claim 6, wherein said first enzyme is N-acetyl transferase and said first drug or pro-drug is isoniazid, hydralazine or procainamide.
11. Use of a first polynucleotide which encodes or is complementary to the sequence which encodes a functional first enzyme isoform. said first enzyme being involved in in vivo metabolism of a first drug or pro-drug, said first drug or pro-drug being involved in activation or inhibition of the expression of a second polynucleotide which encodes a second enzyme involved in a second drug or pro-drug in vivo metabolism, for the preparation of a pharmaceutical composition for the pre-treatment of a patient in need of said first and second drug or pro-drug wherein, before said pre-treatment, said second drug or pro-drug is over or under-metabolized by said second enzyme and said first drug or pro-drug is under-metabolized in said patient leading to an inefficient or toxic concentration of said first or second drug or pro-drug in the patient's blood or tissue.
12. The use of claim 11, wherein said first and second enzymes are selected in the group consisting in cytochrome p450, UDP-glucuronosyl transferase, methyl transferase, alcohol dehydrogenase 3 (ADH3) and N-acetyl transferase and their isoforms.
13. The use of claim 12, wherein said first and second enzymes are selected in the group consisting in cytochrome p450 CYP1A1, CYP2C9, CYP2C19, CYP2E1, CYP3A4 and CYP2D6.
14. The use of claims 12 and 13, wherein said first and second enzymes are different.
15. The use of any one of claims 11 to 14, wherein said first drug or pro-drug is involved in activation of said second enzyme.
16. The use of any one of claims 11 to 14, wherein said first drug or pro-drug is involved in inhibition of said second enzyme.
17. The use of any one of claims 1 to 16 to prevent or to treat organ damage or toxicity in said patient.
18. The use of claim 17 wherein said organ is liver.
19. The use of claim 17 wherein said organ is kidney.
20. The use of claim 18 wherein said organ damage is alcoholism.
21. The use of claim 20, wherein said first and/or second enzyme is alcohol dehydrogenase 3 (ADH3) or cytochrome p450CYP2E1.
22. The use of any one of claims 1 to 16 to improve or enable efficacy of first and or second drug/pro-drug.
23. The use of any one of claims 1 to 22, wherein said pharmaceutical composition is for administration into a vertebrate target tissue.
24. The use of claim 23, wherein said vertebrate target tissue is liver.
25. The use of claim 6 to treat opiate or cocaine addiction wherein said first drug or pro-drug is an agent to treat said addiction.
26. A pharmaceutical composition for the pre-treatment of a patient in need of a drug or pro-drug wherein, before said pre-treatment;
(i) said drug or pro-drug is over metabolized by a natural enzyme in said patient leading to an inefficient or toxic concentration of the drug or pro-drug in the patient's blood or tissue;
(ii) said drug is under metabolized by said enzyme in said patient leading to a toxic concentration of the drug in the patient's blood or tissue; or (iii) said pro-drug is under metabolized by said enzyme in said patient leading to an inefficient concentration of the drug in the patient's blood or tissue, said composition comprising a polynucleotide as defined in any one of claims 1 to 6, and optionally comprising a pharmaceutically acceptable injectable carver.
(i) said drug or pro-drug is over metabolized by a natural enzyme in said patient leading to an inefficient or toxic concentration of the drug or pro-drug in the patient's blood or tissue;
(ii) said drug is under metabolized by said enzyme in said patient leading to a toxic concentration of the drug in the patient's blood or tissue; or (iii) said pro-drug is under metabolized by said enzyme in said patient leading to an inefficient concentration of the drug in the patient's blood or tissue, said composition comprising a polynucleotide as defined in any one of claims 1 to 6, and optionally comprising a pharmaceutically acceptable injectable carver.
27. The pharmaceutical composition of claim 26, wherein said polynucleotide is a DNA.
28. The pharmaceutical composition of claim 26. or 27, wherein said polynucleotide is a naked nucleic acid.
29. The pharmaceutical composition of claim 26 or 27, wherein said polynucleotide is a polynucleotide associated with viral polypeptides.
30. The pharmaceutical composition of claim 26 or 27, wherein said polynucleotide is a polynucleotide complexed with cationic components, more preferably with cationic lipids.
31. The pharmaceutical composition of any one of claims 26 to 30, wherein the concentration of said polynucleotide is from about 0.1 µg/ml to about 20 mg/ml.
32. A pharmaceutical composition for the treatment of a patient wherein ethanol is, before said treatment, under metabolized by a natural enzyme in said patient, leading to a toxic concentration of ethanol in the patient's blood or tissue, said composition comprising a polynucleotide encoding a functional isoform of alcohol dehydrogenase 3 (ADH3) or/and CYP2E1.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15736698A | 1998-09-21 | 1998-09-21 | |
| US09/157,366 | 1998-09-21 | ||
| PCT/EP1999/006973 WO2000017366A2 (en) | 1998-09-21 | 1999-09-21 | Pharmaceutical composition for the pre-treatment of a patient in need of drug or pro-drug |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2343321A1 true CA2343321A1 (en) | 2000-03-30 |
Family
ID=22563414
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA002343321A Abandoned CA2343321A1 (en) | 1998-09-21 | 1999-09-21 | Pharmaceutical composition for the pre-treatment of a patient in need of drug or pro-drug |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1115871A2 (en) |
| JP (1) | JP2002526510A (en) |
| AU (1) | AU6328099A (en) |
| CA (1) | CA2343321A1 (en) |
| WO (1) | WO2000017366A2 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2408746C (en) * | 2000-05-17 | 2010-09-21 | Patrick L. Iversen | Antisense phosporodiamidate morpholino oligonucleotide inhibition of cytochrome p450 to modulate drug pharmacokinetics |
| TWI326214B (en) | 2002-07-17 | 2010-06-21 | Avanir Pharmaceuticals Inc | Pharmaceutical compositions comprising dextromethorphan and quinidine for the treatment of neurological disorders |
| US9561233B2 (en) | 2014-03-13 | 2017-02-07 | Demerx, Inc. | Use of ibogaine for the treatment of pain |
| US9592239B2 (en) | 2014-09-12 | 2017-03-14 | Demerx, Inc. | Methods and compositions for ibogaine treatment of impulse control disorder, anxiety-related disorders, violence and/or anger, or regulating food intake |
| US20230100844A1 (en) * | 2021-09-10 | 2023-03-30 | ATAI Life Sciences AG | Ibogaine combination treatment |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5688773A (en) * | 1994-08-17 | 1997-11-18 | The General Hospital Corporation | Method of selectively destroying neoplastic cells |
| CA2250173A1 (en) * | 1996-03-27 | 1997-10-02 | Bavarian Nordic Research Institute | Cytochrome p450 transducing retroviral vectors |
| AU4821697A (en) * | 1996-10-18 | 1998-05-15 | Wayne State University | 6',7'-dihydroxybergamottin, a cytochrome p450 ihnibitor in grapefruit juice |
-
1999
- 1999-09-21 EP EP99950530A patent/EP1115871A2/en not_active Withdrawn
- 1999-09-21 JP JP2000574265A patent/JP2002526510A/en active Pending
- 1999-09-21 AU AU63280/99A patent/AU6328099A/en not_active Abandoned
- 1999-09-21 CA CA002343321A patent/CA2343321A1/en not_active Abandoned
- 1999-09-21 WO PCT/EP1999/006973 patent/WO2000017366A2/en not_active Application Discontinuation
Also Published As
| Publication number | Publication date |
|---|---|
| EP1115871A2 (en) | 2001-07-18 |
| JP2002526510A (en) | 2002-08-20 |
| WO2000017366A2 (en) | 2000-03-30 |
| AU6328099A (en) | 2000-04-10 |
| WO2000017366A3 (en) | 2000-07-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP4321877B2 (en) | Therapeutic molecules produced by trans-splicing | |
| Boado et al. | The Trojan horse liposome technology for nonviral gene transfer across the blood-brain barrier | |
| US20180258429A1 (en) | Sarna compositions and methods of use | |
| US11377643B2 (en) | Therapeutics for glycogen storage disease type III | |
| US20110039785A1 (en) | Polypeptide-nucleic acid conjugates and uses thereof | |
| EP1495769B1 (en) | Mannose-6-phosphate receptor mediated gene transfer into muscle cells | |
| US7279326B2 (en) | Composition for delivery of a mitochondrial genome to a cell | |
| JP2018127463A (en) | Administration of kynurenine depleting enzymes for tumor therapy | |
| NZ500694A (en) | Use of chimeric mutational vector (CMV), a macromolecule and a ligand for cell surface receptor adhesion molecule (clatherin) in gene therapy; the CMV vector derived from REC2 homologous pairing with Ustilago maydis | |
| CN102282259A (en) | Use of SIRNA to achieve down regulation of an endogenous gene in combination with the use of a sense construct to achieve expression of a desired polynucleotide | |
| CN114846139A (en) | Method and composition for treating MPS IH based on LEAPER technology | |
| US9593335B2 (en) | Small interference RNAs, uses thereof and method for inhibiting the expression of PLK1 gene | |
| JP2002316997A (en) | Complex for transducing objective anionic substance into cell | |
| CA2343321A1 (en) | Pharmaceutical composition for the pre-treatment of a patient in need of drug or pro-drug | |
| US11939600B2 (en) | Compositions and methods for treating phenylketonuria | |
| JP2011504375A (en) | Pharmaceutical composition and method for introducing nucleic acid into cells | |
| WO2011087804A2 (en) | Peptide-polynucleotide compositions, and methods for transfecting a cell with dna and treatment of neurodegenerative disease | |
| Córdoba et al. | Messenger RNA as a personalized therapy: The moment of truth for rare metabolic diseases | |
| EP1890711A1 (en) | Compounds for treating or preventing amine oxidase related diseases or disorders | |
| US5959078A (en) | Isolated polysialyl transferases | |
| WO2019207167A1 (en) | Therapy of sulfatase deficiencies | |
| US8093369B2 (en) | Compositions for silencing the expression of VDAC1 and uses thereof | |
| EP4197559A1 (en) | Immunomodulatory protein-sirna complex having anticancer activity | |
| JP4330269B2 (en) | Compositions and methods for facilitating paracellular transport across cell layers | |
| CA2949345C (en) | Small interfering rna (sirna) for the therapy of type 2 (ado2) autosomal dominant osteopetrosis caused by clcn7 (ado2 clcn7-dependent) gene mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Dead |