JP2002522082A - Compositions and methods for identifying inhibitors, agonists and antagonists of mammalian malonyl-CoA decarboxylase - Google Patents

Abstract

  (57) [Summary] The present invention relates to the field of fatty acid oxidation, generally to compositions and methods for identifying and testing fatty acid oxidation inhibitors, and, in particular, to novel cardiac isoforms of MCD that have been identified as key to fatty acid oxidation in the heart. A composition comprising the composition. In addition, the nucleic acid sequence of the malonyl-CoA decarboxylase gene from rat pancreas, heart and liver is described. These sequences and products derived therefrom are useful in screening methods for the identification and testing of agonists and antagonists of the MCD pathway.

Description

DETAILED DESCRIPTION OF THE INVENTION

FIELD OF THE INVENTION The present invention relates to the field of fatty acid oxidation, generally to compositions and methods for identifying and testing fatty acid oxidation inhibitors, and in particular to malonyl-CoA which has been found to be a basic regulator of fatty acid oxidation in the heart. Related to compositions comprising a novel cardiac isoform of decarboxylase (MCD). Furthermore, the present invention is directed to the identification and testing of compositions comprising mammalian cDNA sequences of malonyl-CoA decarboxylase from rat islets, heart and liver, and of these sequences and their derivatives, as fatty acid oxidizing agents and antagonists. Related to the use of

BACKGROUND OF THE INVENTION [0002] Most energy production in organs such as the heart, liver, etc. derives from the oxidation of fatty acids [Bing et al., Am. J. Med. 15: 284-296, (1953)]. Another important energy source is the oxidation of carbohydrates, and to a lesser extent, the production of ATP from glycolysis. The contribution of these pathways to overall ATP production largely depends on the carbon composition of the energy substrate transported to organs such as the heart, and the presence or absence of latent pathologies in the target organ. Much research has been done on the individual pathways of energy substrate metabolism, but relatively little, for example, on the overall regulation of carbohydrate and fatty acid oxidation in the heart.

[0003] The mechanism by which fatty acids inhibit carbohydrate oxidation (ie, the Randle cycle) has been elucidated, but little is known about how carbohydrates regulate heart fatty acid oxidation. It is clear that increased mitochondrial acetyl-CoA from carbohydrate oxidation (via the pyruvate dehydrogenase system) may suppress β-oxidation of fatty acids, The mechanism by which fatty acid acyl groups are inhibited from being incorporated into mitochondria is unknown.

[0004] An important protein found to be involved in the suppression of fatty acid oxidation in the heart, liver and pancreas is carnitine palmitoyltransferase 1 (CPT1). This protein is located in the outer mitochondrial membrane and is a basic regulatory enzyme involved in the definitive first step in fatty acid oxidation [McGarry and Foster, Am. Rev. Biochem.
., 49: 395-420 (1980); McGarry et al., Diabetes 5: 272-284 (1989)]. Malonyl-CoA produced by acetyl-CoA carboxylase (ACC) is a potent inhibitor of CPT1 [McGarry and Foster, Ann. Rev. Biochem., 49: 395-420 (1980);
McGarry et al., J. Biol. Chem., 253: 4128-4136 (1978)].

[0005] Unlike the liver, where the 88 kDa homologous CPT1 is dominant, the heart is mainly composed of the 82 kDa homologous CPT.
It expresses PT1 [Esser et al., J. Biol. Chem., 268: 5810-5816 (1993)], which is much more sensitive (10-50 fold) to inhibition by malonyl-CoA [McGar
ry and Foster, Ann. Rev. Biochem., 49: 395-420 (1980); McGarry et al., J.
Biol. Chem., 253: 4128-4136 (1978); McGarry et al., Biochem. J., 214: 21-28.
(1983)]. Also, malonyl-CoA under conditions such that fatty acid oxidation can vary significantly
It has also been observed that the IC ₅₀ of mitochondria CPT1 corresponding unchanged [Kudo
et al., J. Biol. Chem. 270: 17513-17520 (1995); Lopaschuk et al., J. Biol.
Chem., 269: 25871-25878 (1994)].

[0006] For example, in the post-ischemic heart of rats, the sensitivity of CPT1 to malonyl-CoA inhibition does not change despite the extremely rapid rate of fatty acid oxidation [Kudo et al.,
J. Biol. Chem. 270: 17513-17520 (1995); Lopaschuk et al., J. Biol. Chem.,
269: 25871-25878 (1994)]. Rather, the actual malonyl-CoA levels are reduced, resulting in increased CPT1 activity. Thus, existing evidence suggests that changes in actual malonyl-CoA levels, but not changes in CPT1 sensitivity to malonyl-CoA, are fundamental factors in regulating changes in cardiac fatty acid oxidation.

The latest work [Kudo et al., J. Biol. Chem. 270: 17513-17520 (1995); Lopasc
huk et al., J. Biol. Chem., 269: 25871-25878 (1994); Kudo et al., Biochim.
Biophys. Acta., 1301: 67-75 (1996); Kudo et al., Circulation 92: 1-771 (19
96); Awan and Saggerson, Biochem. J. 295: 61-66 (1993)].
C plays a fundamental role in regulating fatty acid oxidation through the production of malonyl-CoA. For example, in rabbit hearts, ACC activity decreases from 1 to 7 days after birth [Lopaschuk et al., J. Biol. Chem., 269: 25871-25878 (1994)]. This is accompanied by a dramatic decrease in malonyl-CoA levels and an increase in the rate of fatty acid oxidation [Lopaschuk et al., J. Biol.
Chem., 269: 25871-25878 (1994)].

[0008] It is one of the key enzymes responsible for the feedback circuit that reduces acyl-CoA transport into mitochondria when carbohydrate oxidation rates increase. Thus, ACC
Plays an important role in regulating the metabolic balance of carbohydrates and lipids in the heart. Even in post-ischemic hearts, reduced ACC activity is accompanied by reduced malonyl-CoA levels and increased rates of fatty acid oxidation [[Kudo et al., J. Biol. Chem. 270: 17513-17520 (1995)]. These increased rates of fatty acid oxidation can meet 90-100% of the heart's energy needs, but unfortunately sacrifice glucose oxidation, which is essential for the heart's normal contractile function.

[0009] Previous reports indicate that low glucose oxidation rates during ischemia heart reperfusion are prone to contractile dysfunction, and glucose oxidation is increased by inhibiting fatty acid oxidation, reducing the degree of ischemic damage. I was told that These points have already been confirmed by numerous clinical trials, and medicines that specifically inhibit fatty acid oxidation, such as ranolazine and trimetazidine, are currently being approved for clinical use.

[0010] Thus, in pathological environments characterized by abnormal fatty acid metabolism, enzymes that regulate fatty acid or glucose oxidation may be targets for drug development. In addition, fluoroxylan carboxylate as a therapeutic agent for hypoglycemia has been used as a fatty acid oxidation inhibitor. Such fatty acid oxidation inhibitors act by inhibiting CPT1 and preventing fatty acid transport into mitochondria [see US Pat. No. 4,788,306, which is incorporated herein by reference]. These compounds are particularly effective in treating glucose and fatty acid metabolic disorders such as diabetes and appear to significantly reduce the potential for impairing normal cardiac function.

[0011] The liver is thought to be primarily a biosynthetic organ, but also oxidizes fatty acids as an energy source [Goodridge, Fatty acid synthesis in eucaryotes, In: Biochemis.
try of lipids, liposomes and membranes.Ed.Vance and Vance 111-139 (1991
) (Goodridge “Synthesis of Fatty Acids in Eukaryotes”, edited by Vance and Vance, “Biochemistry of Lipids, Liposomes and Membrane”). Malonyl-CoA is important in this process. Malonyl-CoA inhibits carnitine palmitoyltransferase 1 (CPT), a rate-limiting enzyme involved in mitochondrial fatty acid uptake [McGarry and Brown, Eur. J. Biochem., 244: 1-14 (1997). ; Alam and Sagge
rson, Biochem. J. 334: 233-241 (1998); Bird And Saggerson, Biochem 222: 639-
647 (1984)].

[0012] Inhibition of CPT1 reduces mitochondrial fatty acid uptake, thereby slowing mitochondrial fatty acid oxidation [Lopaschuk et al., J. Biol. Che.
m., 269: 25871-25878 (1994)]. Lower malonyl-CoA levels during periods of malnutrition or diabetes can result in reduced fatty acid synthesis and increased fatty acid oxidation. The question remains about how malonyl-CoA degrades in the liver when fatty acid synthesis is not active.

[0013] Kolattukudy and co-workers [Kolattukudy et al., Methods Enzymol., 71: 150-
153 (1981); Jang et al., J. Biol. Chem., 264: 3500-3505 (1989)] previously
Enzymes involved in the decarboxylation of malonyl-CoA to acetyl-CoA were identified in tissues of both birds and mammals. The enzyme, named malonyl-CoA decarboxylase (MCD), first began by converting certain mitochondrial enzymes, such as methylmalonyl-CoA mutase and pyruvate carboxylase, into malonyl-Co
Described as a mitochondrial enzyme that protects against inhibition by A [Jang et al., J. B.
iol. Chem., 264: 3500-3505 (1989)].

In mitochondria, propionyl-CoA carboxylase may use acetyl-CoA as a substrate for malonyl-CoA production with low efficiency [Jang
et al., J. Biol. Chem., 264: 3500-3505 (1989)]. However, this appears to be a fraction of the total cellular CoA produced. The major source of malonyl-CoA may be derived from the conversion of cytosolic acetyl-CoA by ACC. Recently, it has been proposed that MCD has the function of regulating not only malonyl-CoA in mitochondria but also malonyl-CoA in cytosol [Alam and Saggerson, Bi
ochem. J., 334: 233-241 (1998); Dyck et al., Am. J. Physiology, 275: H2122-
H2129 (1998)].

[0015] Our study shows that reduced malonyl-CoA levels and increased rates of fatty acid oxidation in both postpartum and reperfused ischemic hearts may be due to increased or maintained MCD activity and decreased ACC activity. [Dyck et al., Am. J. Physiology,
275: H2122-H2129 (1998)]. Alam and Saggerson similarly provide indirect evidence that cytosolic MCD activity may alter cytosolic CoA levels in rat skeletal muscle [Alam and Saggerson, Biochem. J., 334: 233-241 (1998)]
. Thus, these studies suggest MCD as a fatty acid oxidation regulator.
It is unclear whether the observed decrease in cytosolic malonyl CoA levels is due to cytoplasmic MCD or to some unknown process.

There is a need to identify substances without side effects that modulate MCD pathway activity in the heart, liver, pancreas or other organs. Accordingly, what is needed is a cost-effective method for assaying compounds that identify targets for pharmacological intervention that do not impair or cause toxicity in the heart, liver, or pancreas while simultaneously functioning as fatty acid oxidation inhibitors without impairing the function of the heart, liver or pancreas. This is an assay method suitable for realizing high-productivity screening.

SUMMARY OF THE INVENTION The present invention generally relates to compositions and methods for identifying and testing malonyl-CoA decarboxylase (hereinafter MCD) inhibitors, particularly novel cardiac isoforms of the MCD enzyme, a basic fatty acid oxidation regulator. Or a composition consisting of: This enzyme is useful for identifying compounds that inhibit the conversion of malonyl-CoA to acetyl-CoA (the converted acetyl-CoA produces ^14C- labeled citrate upon mixing with ^14C- labeled oxaloacetate). Furthermore, the invention relates to the isolation and determination of the DNA sequence of the rat heart, liver and pancreas genes encoding MCD.

It is not intended that the present invention be limited to any particular MCD protein. A variety of closely related MCD homologs are expected to be involved in regulating fatty acid oxidation in various species of vertebrates. The MCD is, in one embodiment, a part of a full-length native enzyme rather than a full-length native polypeptide. Preferably, this part or fragment comprises an active binding site. For example, but not by way of limitation, the invention contemplates a substrate-MCD complex in which the MCD is partially purified. In yet another embodiment, the MCD has a mutant polypeptide from a wild-type sequence.

Similarly, the invention is not limited to native sequence MCDs. Even when parts or fragments are used, those parts or fragments may have altered amino acid sequence.
Thus, the present invention also contemplates a substrate-enzyme complex consisting of MCD or an analog thereof. The present invention also allows for compound screening by various assay methods. In one embodiment, the present invention contemplates a compound screening method comprising the following steps:
a) providing: i) a purified preparation comprising malonyl-CoA decarboxylase, ii) a substrate, and iii) a test compound; b) the malonyl-CoA decarboxylase and the substrate Mixing in the presence and absence of the test compound under conditions such that it acts on the substrate to produce the product; andc) the amount of product produced in the presence and absence of the test compound. To measure both directly and indirectly.

The invention also generally relates to compositions and methods for identifying and testing agents and antagonists of the malonyl CoA decarboxylase pathway. Furthermore, the present invention relates to a method for identifying normal or mutant homologs of MCD that are unique to other tissues or cell types. The invention also relates to a method for identifying a tissue harboring a homologous or mutant MCD gene. The present invention also relates to a method for producing a reagent derived from the present invention.

The present invention provides a composition comprising a wild-type rat MCD gene derived from the heart (SEQ ID NO: 1), from the liver (SEQ ID NO: 2) or from the pancreas (SEQ ID NO:
3) Expect. The present invention also contemplates the use of such sequences in screening methods.
In one embodiment, the invention contemplates the use of such genes in screening for compounds that are agonists or antagonists of MCD. In one preferred embodiment, a construct containing either sense or antisense MCD DNA or a fragment thereof is introduced into a cell. Although such DNAs can be easily inserted into expression constructs, the present invention contemplates such constructs and their uses.

Next, a compound suspected of being an agonist or antagonist of MCD activity is added, and the MCD activity is measured by a method well known in the art. The present invention also relates to an RNA transcribed from the cDNA and a protein translated from the RNA (generally a purified protein)
Anticipate. Further, the invention contemplates antibodies produced from immunization with the translated protein. The invention also contemplates transgenic animals having the DNA (ie, the transgene) or a fragment thereof. In one aspect, transgenic animals of the invention could be generated from a transgene with an inducible, tissue-specific promoter.

The present invention also contemplates the use of the compositions described above in screening assays. The present invention is not limited by a particular screening method. In one embodiment, mammalian cells will be used. The invention is not limited to the nature of the transfer construct. The transfection construct used will be the optimal construct for the cell line chosen at the time of assay design. The present invention, in one embodiment, allows for screening of candidate compounds by a system utilizing a transfected cell line. In one embodiment, the introduction into the cells is performed temporarily. In another embodiment, the introduction into the cell is performed stably. The construct used for stable introduction into cells may or may not utilize an inducible promoter. In yet another embodiment, the translation products of the invention are used in a cell-free assay system. In yet another embodiment, antibodies raised against the translation products of the invention are used for immunoprecipitation.

The present invention will also be used to screen for tumors that express mutations in genes similar to the cDNA encoding MCD. In one embodiment, the cDNA encoding the MCD
Are used for the microchip assay. The present invention contemplates a method of screening for tumors comprising the following steps: a) providing in any order: i) cDNA encoding at least a portion of the oligonucleotide sequence of SEQ ID NO: 1, 2 or 3.
A microassay microchip comprising: ii) DNA from at least one tissue sample suspected of having a mutation in a gene similar to SEQ ID NO: 1, 2 or 3; b) the microassay microchip Contacting the chip with the DNA, and c) detecting hybridization between the cDNA and the tissue sample DNA.
The isolated DNA will then be subjected to sequencing for genetic mutations.

The gene sequences of the present invention are also used for homolog screening. In one embodiment, the cDNA encoding the MCD is used in a microchip assay. The present invention contemplates a method of screening for homologues comprising the following steps: a) providing in any order: i) preparing a cDNA encoding at least a portion of the oligonucleotide sequence of SEQ ID NO: 1, 2 or 3; A microassay microchip comprising: ii) DNA from at least one tissue sample suspected of having a mutation in a gene similar to SEQ ID NO: 1, 2 or 3; b) said microassay microchip. Tip
Contacting with DNA and c) detecting hybridization between the cDNA and the tissue sample DNA. The isolated DNA will then be subjected to sequencing for genetic mutations.

The invention may also be used to identify new or mutated components of the MCD pathway. In one embodiment, antibodies raised against the translation products of the present invention will be used in immunoprecipitation experiments to isolate novel MCD pathway components or natural variants thereof. In another embodiment, the invention will be used for the purification of fusion proteins which can also be used for the isolation of novel MCD pathway members or natural variants thereof. In yet another embodiment, screening using a yeast protein complex detection system will be performed. The present invention also contemplates screening for homologs using standard molecular biology techniques. In one embodiment, screening is performed using the Northern and Southern methods.

The present invention contemplates a method for screening compounds comprising the following steps: a) providing in any order: i) comprising at least a portion of the oligonucleotide sequence of SEQ ID NO: 1, 2 or 3. A first group of cells comprising a recombinant expression vector, i
i) a second group of cells comprising said expression vector which does not comprise any part of the oligonucleotide sequence of SEQ ID NO: 1, 2 or 3; and iii) at least one that is likely to be capable of modulating MCD pathway activity Species compounds; b) contacting said first and second cell populations with said compound; and c) detecting inhibition or promotion of MCD activity of said compound.

The present invention also contemplates a homolog screening method comprising the following steps:
The following are provided in any order: i) a first nucleic acid comprising at least a portion of the sequence of SEQ ID NO: 1, 2 or 3, and ii) DNA from a cell or tissue suspected of containing said homolog. A library, and b) the nucleic acid and the DNA of the library
Under conditions such that the DNA suspected of encoding the homolog is detected.

The present invention also contemplates a method for screening for interacting peptides comprising the following steps: a) providing in any order: i) the peptide sequence encoded by SEQ ID NO: 1, 2 or 3 (Including, but not limited to, a fusion protein, ie, a protein with another portion, eg, a portion useful for protein purification), and ii) a source suspected of having said interacting peptide (E.g., an extract from a cell or tissue), and b) mixing the peptide and the extract under conditions such that the interacting peptide is detected.

The present invention contemplates another method for screening an interacting peptide comprising the following steps: a) providing in any order: i) the sequence of the peptide encoded by SEQ ID NO: 1, 2 or 3. An antibody that reacts at least partially (and usually specifically) with ii) a source suspected of having said interacting peptide (
For example, extracts from cells or tissues) and b) mixing the antibody and the extract under conditions such that the interacting peptide is detected.

Meaning of Terms In order to facilitate understanding of the invention, a number of terms are defined below. Abbreviations used in this document are as follows: MCD (malonyl-CoA decarboxylase), ATP (adenosine triphosphate), FA (fatty acid), FAS (fatty acid synthesis), ACC (acetyl-CoA carboxylase), CPT1 (carnitine palmitoyl) Transferase 1). As used herein, the term "indicator" does not refer to the product itself, but rather indirectly indicates the presence of the product, more preferably the level of the product. For example, in one embodiment, the indicator is citrate.

As used herein, the term “label” refers to any atom or molecule that can be used to deliver a detectable (preferably quantifiable) signal and that can be attached to a nucleic acid or protein. The label will deliver a signal that can be detected by fluorescence, radiometry, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzyme activity, and the like. As used herein, the term “substrate” refers to a molecule that is affected by an enzyme. For example, in one embodiment, the substrate is malonyl CoA.

As used herein, the term “homologue” (homologue) refers to a molecule that differs in structure from a parent or reference molecule, but with a similar function. For example, homologs of the enzymes have the same general enzymatic activity (although the specificity and level of activity may be different) but differ in structure (eg, amino acid modifications or substitutions). Homologs can be obtained by various techniques, such as introducing a new base into the DNA sequence, resulting in an amino acid substitution.
It can be produced by using primers in a PCR reaction. Such primers can be designed to hybridize to the cardiac homolog of MCD via the terminal amino acid sequence of a protein purified in the manner described herein. Alternatively, a primer complementary to a non-human enzyme (eg, goose MCD (GenBank accession number 104482)) can be used.

The term “gene” refers to a DNA sequence with regulatory and coding sequences necessary for the production of a polypeptide or its precursor. A polypeptide may be encoded by a full-length coding sequence, or it may be encoded by any portion of such a coding sequence. The term "nucleic acid sequence of interest" refers to a nucleic acid sequence whose manipulation may be deemed preferable for some reason by those skilled in the art.

The term “wild-type” when used in the context of a gene refers to a gene that has the characteristics of a gene isolated from a native source. The term "wild-type", when used in the context of a gene product, refers to a gene product that has the characteristics of a gene product isolated from a native source. The wild-type gene is the gene most frequently observed in the population, and is therefore arbitrarily referred to as the "normal" or "wild-type" form of the gene. In contrast, the terms “altered” or “mutated” when used in reference to a gene or gene product, respectively, alters the sequence or functional property (ie, alteration) when compared to a wild-type gene or gene product. ) Indicates a gene or gene product. Of course, naturally occurring mutants may be isolated, which are identified by the fact that they have altered properties as compared to the wild type gene or gene product.

The term “recombinant,” when used in reference to a DNA molecule, refers to a DNA molecule consisting of DNA fragments joined by molecular biological techniques. The term "recombinant", when used in reference to proteins or polypeptides, refers to a protein molecule that is expressed using a recombinant DNA molecule. As used herein, the terms "vector" and "vehicle" are used interchangeably with respect to a nucleic acid molecule that transfers a DNA fragment from one cell to another.

As used herein, the term “expression construct”, “expression vector” or “expression cassette” refers to the preferred coding sequences and appropriate nucleic acids necessary for the expression of an operably linked coding sequence in a particular host organism. A recombinant DNA molecule containing a sequence. Nucleic acid sequences required for expression in prokaryotes usually include a promoter, an operator (
(Optional), and a ribosome binding site, often accompanied by other sequences. Eukaryotic cells are known to utilize promoters, enhancers, and transcription termination and polyadenylation signals.

As used herein, the terms “operably combined,” “in operable state,” and “operably linked” refer to the transcription of a given gene and / or the synthesis of a desired protein molecule. Refers to the joining of nucleic acid sequences in such a way that a conductable nucleic acid molecule is produced. The term also refers to the joining of nucleic acid sequences in such a way that a functional protein is produced. As used herein, the term "hybridization" refers to the process by which a single-stranded nucleic acid binds to a complementary strand through base pairing.

As used herein, the terms “complementary” or “complementarity” when used in reference to polynucleotides refer to polypeptides that are related by base pairing rules. For example, the sequence 5'-AGT-3 'is complementary to the sequence 5'-ACT-3'. Complementarity may be "partial," in which case only a portion of the nucleobases will pair according to the base pairing rules. Alternatively, there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands significantly affects the efficiency and strength of hybridization between nucleic acid strands. This is particularly important in amplification reactions and in detection methods that rely on binding between nucleic acids.

The term “homology” when used in reference to nucleic acids refers to a degree of complementarity.
Homology may be partial or complete (ie, identical). The term "substantially homologous" is used for partially complementary sequences that inhibit hybridization of a completely complementary sequence to the target nucleic acid. Inhibition of hybridization of a sequence that is perfectly complementary to the target sequence may be determined by a hybridization assay (Southern or Northern method, solution hybridization method, etc.) under low stringency conditions.

A sequence or probe that is substantially homologous will compete for and inhibit the binding (ie, hybridization) of a sequence that is completely homologous to the target under low stringency conditions. This does not mean that non-specific binding is tolerated under low stringency conditions. Under low stringency conditions, the interconnection of the two sequences is required to be a specific (ie, selective) interaction. The absence of non-specific binding could be tested by using a second target that lacks even partial complementarity (eg, less than 30% identity). In the absence of non-specific binding, the probe is non-complementary
Will not hybridize to two targets.

Low stringent conditions, when used in connection with nucleic acid hybridization, include 5X SSPE (43.8 g / l NaCl, 6.9 g / l NaH ₂ PO ₄ .H ₂ O and 1.85 g).
/ l EDTA, pH adjusted to 7.4 with NaOH), 0.1% SDS, 5X Denhardt reagent [50X Denhardt reagent
/ 500 ml: 5 g Ficoll (Type 400, Pharmacia), 5 g BSa (fraction V, Sigma)]
And hybridization at 42 ° C. in a solution consisting of 100 μ / ml denatured salmon sperm DNA, followed by a solution consisting of 5 × SSPE, 0.1% SDS when an approximately 500 nucleotide long probe is used. Refers to conditions equivalent to washing at 42 ° C.

High stringent conditions, when used in connection with nucleic acid hybridization, include 5X SSPE (43.8 g / l NaCl, 6.9 g / l NaH ₂ PO ₄ .H ₂ O and 1.85 g / l l EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt reagent and 100 μg
Binding / Hybridization at 42 ° C. in a solution consisting of / ml denatured salmon sperm DNA, followed by 42 ° C. with a solution consisting of 0.1 × SSPE, 1.0% SDS when a probe of about 500 nucleotides length is used. Refers to conditions equivalent to cleaning in

With regard to low or high stringency conditions, when used in connection with nucleic acid hybridization, a number of equivalent conditions can be employed, as is well known. Probe length and properties (DNA, RNA, base composition) and target properties (DNA, RNA,
Factors such as base composition, whether present or fixed in solution, etc., concentrations of salts and other components (eg, the presence or absence of formamide, dextran sulfate, polyethylene glycol) are taken into account, and hybridization solutions are also considered. May be varied to create low or high stringency hybridization conditions that differ from, but correspond to, the above conditions.

“Strict” when used in the context of nucleic acid hybridization generally ranges from about Tm-5 ° C. (Tm of the probe minus 5 ° C.) to Tm minus about 20-25 ° C. As will be appreciated by those skilled in the art, stringent hybridization could be used to identify or detect identical polynucleotide sequences, or to identify or detect similar or related polynucleotide sequences. Under "strict conditions"
The nucleic acid sequence of interest will hybridize to its strictly complementary and closely related sequences.

As used herein, the term “fusion protein” refers to a chimeric protein comprising a protein of interest bound to a foreign protein fragment (a fusion partner consisting of non-MCD sequences). The fusion partner will provide a detectable moiety, allow purification of the recombinant fusion protein from the host cell, or both. If you want
The fusion protein could be removed from the protein of interest by enzymatic or chemical means well known in the art. As used herein, the term "purified" or "to purify" refers to the removal of impurities from a sample. The present invention contemplates a purified composition (as described above).

As used herein, the term “portion” when used in reference to a protein (as in “a portion of a given protein”) refers to a fragment of that protein. Fragment sizes will range from four amino acid residues to the entire amino acid sequence minus one amino acid. An "antibody" is a glycoprotein produced by a B cell that has caused the production thereof (usually, but not always, a peptide) or a structurally similar agent. A substance that binds very specifically. Antibodies can be produced by any well-known technique, and may be polyclonal or monoclonal.

A “mutant” is any change, natural or artificial, to a wild-type nucleotide sequence, including but not limited to specificity for various interacting molecules, kinetics, and life span of the mutated molecule. At least one of them produces a translation product with improved or reduced functional efficiency.

SUMMARY OF THE INVENTION The present invention generally relates to compositions and methods for identifying and testing malonyl-CoA decarboxylase (MCD) inhibitors, particularly those of MCDs which have been found to be basic cardiac fatty acid oxidation modulators. It relates to a composition comprising a novel heart homolog. Further, the present invention relates to M
The present invention relates to compositions and methods for identifying CD pathway agonists and antagonists, particularly compositions comprising novel DNA sequences of rat heart, liver and pancreatic DNA. A review of the invention consists of (A) changes in fatty acid oxidation during cardiac reperfusion after myocardial ischemia, (B) malonyl-CoA in the heart, and (C) malonyl-CoA in the liver and pancreas.

A. Changes in Fatty Acid Oxidation During Cardiac Reperfusion After Myocardial Ischemia The energy substrate preference of the heart during and after ischemia is an important determinant of post-ischemic functional recovery. For example, high rates of fatty acid oxidation after ischemia can reduce cardiac function and efficiency during reperfusion. This high fatty acid oxidation rate can be explained by a decrease in malonyl-CoA, a potent inhibitor of mitochondrial fatty acid uptake.

This reduction in malonyl-CoA appears to be due in particular to activation of 5′-AMP-activated protein kinase and inhibition of acetyl-CoA carboxylase. Therefore, inhibition of 5'-AMP activated protein kinase and / or activation of acetyl-CoA carboxylase is likely to be a pharmacological approach to inhibiting myocardial fatty acid oxidation during reperfusion. Inhibition of fatty acid oxidation is accompanied by a parallel increase in glucose oxidation, which results in increased function and efficiency of the reperfused ischemic heart [Lopaschuk,
Am. J. Cardiol., 80: 11A-16A (1997)].

B. Malonyl-CoA in the Heart The high rate of fatty acid oxidation in the post-ischemic heart is primarily due to a dramatic decrease in myocardial malonyl-CoA levels. Malonyl-CoA is carnitine palmitoyltransferase 1 (CP
It is a potent inhibitor of T1) and is important in regulating fatty acid uptake into mitochondria. The depletion of malonyl-CoA after ischemia is also due in part to reduced malonyl-CoA synthesis. Although the synthesis of intracardiac malonyl-CoA by the cardiac-specific ACC has been well described, no information is available on how malonyl-CoA is degraded in the heart.

The present invention relates to the active malonyl-Co that converts malonyl-CoA to acetyl-CoA in the heart.
Indicates that A decarboxylase (MCD) is present. Inspired by this discovery was the development of a novel and robust assay for measuring malonyl-CoA decarboxylase (MCD) activity that did not require extensive protein purification. Using this assay, MCD activity was characterized in the rat heart and elucidated to play an important role in regulating fatty acid oxidation. The MCD enzyme is phosphorylated and can be activated under experimental conditions that result in dephosphorylation of the enzyme. The majority of cardiac MCD is associated with mitochondria, and treatment of mitochondria with octylglucoside results in a 14-fold increase in MCD activity.

[0054] Partial purification of cardiac MCD yielded a protein of approximately 45 kDa, which migrated as a quadrant complex on polyacrylamide gel electrophoresis. MCD has previously been described as a mitochondrial enzyme involved in protecting certain mitochondrial enzymes, such as methylmalonyl-CoA mutase and propionyl-CoA, from inhibition by mitochondrial malonyl-CoA [Kim and Kolattukudy,
Arch. Biochem. Biophys., 190: 234-246 (1978); Scholte, Biochim. Biophys.
Acta., 178: 137-144 (1969); Landriscina et al., Eur. J. Biochem., 19: 573-5.
80 (1971); Koeppen et al., Biochemistry 13: 3589-3595 (1974)].

Little is known about mammalian MCD, but two MCD homologs have been identified in the tail glands of geese [Courchesne-Smith et al., Arch. Biochem. Biophy.
s., 298: 576-586 (1992)]. These proteins are derived from the same gene, but each have a separate transcription / translation initiation site. These alternate start sites create two proteins, one directed to the mitochondrial substrate and one directed to the cytoplasm. Apart from this tail gland, low levels of non-mitochondrial MCD have also been detected in the liver. To date, MCD activity and subcellular localization in the heart has not been revealed.

In the present invention, the role of MCD in regulating fatty acid oxidation was also studied using reperfused hearts from newborn rabbits and adult rats. In newborn rabbit hearts, fatty acid oxidation was dramatically enhanced at 1-7 days of age, with concomitant reductions in both ACC activity and malonyl-CoA levels. At the same time, MCD in 7-day-old hearts
An increase in activity was also observed. Aerobic reperfusion of adult rat hearts after 30 minutes of ischemia-free ischemia resulted in a dramatic decrease in malonyl-CoA levels and a concomitant increase in fatty acid oxidation rates. Malonyl-CoA reduction during reperfusion decreases ACC activity and MC
This can be explained by maintaining D activity. This data suggests that there is active MCD in the heart that plays a key role in regulating the rate of fatty acid oxidation.

MCD also appears to be a major enzyme that may play a role in lowering malonyl-CoA levels after birth in rabbit hearts or after myocardial ischemia in rat hearts. Inhibition of this enzyme has great clinical potential. This is because the enzyme represents a potentially important site for pharmacological intervention in the pathological environment characterized by abnormal fatty acid metabolism. Pharmacological inhibition of MCD will result in increased myocardial malonyl-CoA levels in reperfused ischemic hearts. This will slow down the rate of fatty acid oxidation, increase glucose oxidation, and improve the contractile function of reperfused ischemic hearts.

C. Malonyl-CoA of the liver and pancreas The liver is thought to be primarily a biosynthetic organ, but also oxidizes fatty acids as an energy source [Goodridge, Fatty acid synthesis in eucaryotes, In: Biochemis].
try of lipids, liposomes and membranes.Ed.Vance and Vance 111-139 (1991
) (Goodridge “Synthesis of Fatty Acids in Eukaryotes”, edited by Vance and Vance, “Biochemistry of Lipids, Liposomes and Membrane”). Malonyl-CoA is important in this process.

This is because malonyl-CoA inhibits carnitine palmitoyltransferase 1 (CPT), the rate-limiting enzyme involved in mitochondrial fatty acid uptake [McGarry and Brown, Eur. J. Biochem., 244: 1-14. (1997); Alam and Sagg
erson, Biochem. J. 334: 233-241 (1998); Bird And Saggerson, Biochem 222: 63
9-647 (1984)]. By inhibiting CPT1, mitochondrial fatty acid uptake is reduced, thereby also mitochondrial fatty acid oxidation [Lopaschuk et al.
, J. Biol. Chem., 269: 25871-25878 (1994)]. Lower malonyl-CoA levels during periods of malnutrition or diabetes can result in reduced fatty acid synthesis and increased fatty acid oxidation. The question remains about how malonyl-CoA degrades in the liver when fatty acid synthesis is not active.

In pancreatic β-cells, as in the heart and liver, malonyl-CoA / CPT1 interaction is a central element of the “fuel crosstalk” signal network, and also short-term and / or short-term insulin secretion in pancreatic β-cells. May be involved in long-term control [Chen et al., D
iabetes 43: 878-883 (1994); Prenki et al., J. Biol. Chem., 267: 5802-5810 (
1992)]. It is believed that the malonyl-CoA concentration in lipogenic and adipose tissues, such as the liver, is dictated by its rate of formation by acetyl-CoA carboxylase and its consumption by fatty acid synthesis (FAS).

However, other tissues such as pancreatic islets (Brun et al., Diabetes 45: 190-198) also express FAS at very low levels and have various experimental conditions, such as increasing or decreasing concentrations. The malonyl-CoA concentration changes rapidly below. The fate of malonyl-CoA in beta cells is unknown, but the intracellular concentration of this metabolic signaling molecule is at least FAS
The notion that it is controlled by another enzyme in the expressed non-lipogenic tissue is attractive. A promising candidate for such a role is MCD.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Generally, the predicates used below and the cell culture, molecular genetics,
And experimental methods of nucleic acid chemistry / hybridization are well known, common predicates and methods. Standard techniques are used for nucleic acid recombination, polynucleotide synthesis, and culture and transformation of microorganisms (electroporation, lipofection, etc.). Generally, enzymatic reactions and production steps are performed according to the manufacturer's instructions. Various techniques and procedures are performed according to conventional technical methods and various general reference materials [in general, Sambrock et al., Molecular Cloning: A Laboratory Manual, 2d.
ed. (1989), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.
Y., and Current Protocols in Molecular Biology (1996), John Wiley and S
ons, Inc., NY].

Oligonucleotides can be synthesized on an Applied BioSystems oligonucleotide synthesizer (see Sinha et al., Nucleic Acid Res. 12: 4539 (1984) for details) according to the manufacturer's instructions. Annealing of the complementary oligonucleotide is performed by heating to 90 ° C. in a 10 mM Tris-HCl buffer (pH 8.0) containing NaCl (200 mM), and then slowly cooling to room temperature. For binding and rotation assays, double-stranded DNA is purified by native agarose (15% w / v) gel electrophoresis.

The band corresponding to the double-stranded DNA is cut out and soaked overnight in a 0.30 M sodium acetate buffer containing EDTA (1 mM). After soaking, the supernatant is extracted with phenol / chloroform (1/1 v / v) and precipitated with ethanol. DNA substrate [g- ³² P] ATP
And T4 polynucleotide kinase to radiolabel the 5'-OH group. Salts and unbound nucleotides are chromatographed on a Sephadex Q column.

The present invention provides (1) the design and implementation of a screen to identify proteins or small molecules that inhibit MCD activity and thereby activate or prevent the degradation of malonyl-CoA to acetyl-CoA, (2) ) Development of high productivity screens for rational drug design, and (3) identification of intra- and inter-species MCD homologs and mutants. Furthermore, the present invention contemplates assay methods for detecting the ability of various substances to inhibit or enhance MCD activity. The assay uses a high productivity screening method and a large-scale agent bank (compound library, peptide library, etc.) to identify an agent or antagonist. Such MCD pathway agonists and antagonists may be therapeutic agents, and diagnostic or prognostic tools with subsequent development.

Screening Assays The screening assays of the present invention comprise isolated or partially purified assay components (
Or MCD enzyme) can be used. “Purified” refers to that the enzyme has been separated from its natural environment (eg, as a cytoplasmic or nuclear fraction of cells, yeast cytoplasm, or by recombinant production). Preferably, the enzyme is purified to at least about 10-50% purity.

A substantially pure composition comprises an MCD enzyme or complex that is substantially homogeneous, ie, on the order of 70-90% pure. A “pure” preparation refers to a purity of more than 90%, more preferably a purity of more than 95%. Preferred embodiments include binding assays using recombinant or chemically synthesized cardiac MCD. In one embodiment, in addition to MCD and the substrate malonyl-CoA in the screening method, ¹⁴ C-labeled oxalooxalic acid is used to produce ¹⁴ C-labeled citric acid.

The screening assay of the present invention is expected to identify substances that inhibit MCD activity. Such inhibitors are effective in treating ischemia (pharmacological inhibition of MCD should lead to increased myocardial malonyl-CoA levels in reperfused ischemic hearts)
It is also expected to be effective in treating other diseases. This will reduce the rate of fatty acid oxidation, enhance glucose oxidation, and improve the contractile function of reperfused ischemic hearts.

The present invention contemplates compound screening by various assay formats. In one embodiment, the invention contemplates a compound screening method comprising the following steps: a) providing the following materials: i) a purified preparation comprising malonyl-CoA decarboxylase, ii) a substrate, and iii) a test. B) mixing the malonyl-CoA decarboxylase and the substrate in the presence and absence of the test compound under conditions such that malonyl-CoA decarboxylase acts on the substrate to produce a product; And c) directly or indirectly measuring the amount of product produced in the presence and absence of said test compound. In one embodiment, the inhibitory effect is measured by detecting acetyl-CoA formation as estimated from a decrease in [ ¹⁴ C] citrate levels.

Malonyl-CoA decarboxylase assay: In the present invention, to measure MCD activity, a novel MCD assay was developed to detect acetyl-CoA in the MCD reaction product. MCD-derived acetyl-CoA was kept at a constant temperature in the presence of [ ¹⁴ C] oxaloacetate and citrate synthase (0.73 μU / μL) to form citrate. [ ¹⁴ C] oxaloacetic acid is obtained from a 20-minute transamination reaction performed at room temperature using L- [ ¹⁴ C] aspartic acid (2.5 μCi / ml) and 2-oxoglutarate (2 mM). Was. This test method requires advanced
There were advantages that there was no need to perform MCD purification and that the in vitro measurement of enzyme activity reflected the in vivo enzyme activity rate (see also Scheme A).

[0071]

Embedded image

1. Screening to Identify Agents or Antagonists of MCD The present invention allows for several approaches to searching for substances that specifically inhibit or enhance MCD activity. One is that the expression construct containing the nucleic acid encoding MCD is introduced into a cell, and the cell is contacted with a compound that is thought to regulate MCD activity. Is an approach of measuring The construct may be transiently introduced into the cell, or may be introduced constantly under the control of an inducible promoter.

Expression of superphysiological levels of MCD (superphysiological levels of expression is a normal expression that cells are expected to express without the introduction and expression of said genes into the cells. The expression of the gene product at a level exceeding the level)
Let's significantly enhance the normal, yet subtle, cellular MCD interaction so that we can investigate phenomena that were previously untestable.

Another embodiment would involve the translation of the corresponding RNA and the purification of the peptide produced thereby. The use of purified peptides could be used to test for specific compound: protein interactions. In addition, antibodies to the protein of the invention produced by translation may be generated to allow the development of various immunoassays, such as RIA, ELISA or Western. In addition, transgenic animals can be created to enable in vivo assays to be performed.

A. Transfection Assays Transfection assays provide a great deal of flexibility in assay development. Since commercially available transfer vectors are diverse, the MC of the present invention can be used in a wide variety of cell types.
The D gene could be expressed. In one embodiment, an expression construct comprising 1) a nucleic acid encoding MCD and 2) an operable combination of an inducible promoter is transiently introduced into a cell. The cells are contacted with a substance that is thought to regulate MD activity. MCD expression begins, and then MCD activity is measured. The MCD activity rate of cells expressing the recombinant MCD is compared with the MCD activity rate of cells into which a control expression vector (eg, an empty expression vector) has been introduced. The MCD activity rate can be quantified by any of a variety of methods that are reported in the literature and are also well known in the art.

In another embodiment, a stably transfected cell line, ie, a
Develop cell lines that stably express the MCD gene. These systems use an inducible promoter. Screening assays for compounds that appear to modulate MCD activity will be performed in the same manner as the transient transfection assay. The use of a stably transfected cell line will increase the consistency between experiments and allow for comparisons between experiments.

2. Screening to Identify Tissues Expressing Mutants of Similar or Homologous Genes In one embodiment, the tissue screening is configured using a microassay microchip method. This would allow the development of high productivity screens to identify tissues expressing mutant genes similar or homologous to the sequenced MCD gene.

3. Screening to Identify MCD Signal Pathway Components a. In Vitro Assays There are several approaches for identifying MCD interacting molecules. The present invention will allow the identification of proteins that are only associated with inactive (or less active) or constitutively active MCD molecules. Such proteins could regulate MCD function. Techniques that can be used include, for example, immunoprecipitation of MCD with antibodies generated against the transcript of the present invention. This approach will precipitate any associated binding proteins. Another method produces a fusion protein comprising a mutant MCD coupled to a generally accepted pull-down protein such as glutathione S-transferase. Thereafter, the bound protein can be eluted and analyzed.

I) Immunoprecipitation After generation of antibodies against wild-type and mutant MCD, cells expressing the recombinant MCD are lysed and incubated with one type of antibody. The antibody is then combined with the bound MCD and any associated proteins using standard techniques for protein-A Sepharose or protein-G
It can be pulled down by Sepharose beads.

Ii) Fusion protein pull-down (Pull-Down) A method similar to immunoprecipitation is to construct a fusion protein of MCD and glutathione S-transferase (GST). The MCD fusion protein is incubated with the cell extract and then removed with glutathione Sepharose beads. Analyze any bound MCD protein.

4. Screening to Identify MCD Homologues Standard molecular biology techniques can be used to identify rat, human or other species of MCD homologs. For example, the present invention contemplates various approaches, including DNA-DNA hybridization methods (such as the Southern method) and DNA-RNA hybridization methods (such as the Northern method). Other examples include immunoscreening of proteins made from library stocks with antibodies raised against the translation product of SEQ ID NO: 1, 2 or 3. In addition, following immunoprecipitation of proteins known or suspected to be MCD interacting proteins, SEQ ID NOs: 1, 2
Alternatively, a mutant MCD homolog can be identified by an antibody generated against the 3 translation product.

[0082] The following examples are intended to illustrate certain preferred embodiments of the present invention and are not intended to limit the scope of the present invention. In the following experimental disclosure, the following methodology is applied.

Method materials: L- [14C (U)] aspartate and [1,10-14C] palmitate were purchased from Mandel, and were prepared from hyamine hydroxide (methylbenzethonium; 1
M dissolved in a methanol solution) was purchased from ICN. Bovine serum albumin (fraction V) was obtained from Boehringer (Mannheim / Germany). Dowex 50W-X8 cation exchange resin (100-200 mesh, hydrogen form) was obtained from Bio-Rad Laboratories (Richmond, CA). ACS aqueous scintillant is available from Amersham Canada.
m Canada. (Oakville, Ontario). All other chemicals are for reagents.

1. Preparation of Rat Heart Malonyl-CoA Decarboxylase Male Sprague-Dawley rats (300-350 g) were anesthetized with sodium pentobarbitol, and the heart was quickly removed. The removed heart was immediately homogenized to prepare for MCD measurement, used immediately for mitochondrial preparation (described below), frozen in liquid nitrogen, or used for perfusion testing of isolated moving hearts.

Hearts were also anesthetized and removed from 1-day and 7-day-old New Zealand white rabbits for isolated cardiac perfusion, as described further below. Fresh or frozen hearts (10-15 mg of tissue) used for MCD measurement were purified from KCl (75 mM), sucrose (20 mM).
, HEPES (10 mM), EGTA (1 mM), ± [NaF (50 mM) and NaPPi (5 mM)], and homogenized twice for 15 seconds in a buffer solution. The minutes were used for MCD measurements.

[0086] Isolation of rat heart mitochondria and purification of malonyl-CoA decarboxylase: The rat heart was excised and detached from the atrium. The atrium was then chopped into 1 mm squares, and ice-cooled mannitol / sucrose / EFTA (MSE) buffer (225 mM mannitol, 7
5 mM sucrose, 1 mM EGTA. pH 7.5). Prepare a 2: 1 weight ratio of MSE buffer: moist tissue mixture and run on Teflon pestle / glass homogenizer
5 strokes. The homogenate was diluted with MSE to 10 ml / g-moist tissue and
Centrifuged at xg for 5 minutes. The supernatant is filtered through two layers of cheesecloth, then 10,000 x
Centrifuged at g for 30 minutes.

A 10 mM sodium phosphate buffer (pH 7) containing 0.5 mM dithioerythritol (DTE)
.6) the pellet was resuspended (50 mL / g-wet mitochondrial pellet). Triton X-100 (0.1%) was added to the suspension, and the slurry was stirred at 4 ° C. for 16 hours to dissolve mitochondria. The solution was centrifuged at 24,000 xg for 10 minutes, and the supernatant was saturated with ammonium sulfate powder to 40% and stirred for 1 hour while cooling with ice. Precipitated proteins were removed by centrifugation at 24,000 xg for 10 minutes. The supernatant was saturated with ammonium sulfate powder to 55%, stirred on ice for 1 hour, and centrifuged at 24,000 xg for 10 minutes. The pellet was resuspended in 0.1 M potassium phosphate (pH 7.4), 1 mM DTT and 1 M ammonium sulfate buffer.

Chromatography on Butyl Sepharose 650M: The potassium phosphate / MCD solution was then pre-equilibrated with 0.1 M potassium phosphate buffer (pH 7.4) containing 1 mM DTT and 1 M ammonium sulfate. Injected into a mL Butyl-Sepharose 650M column. Wash the column with 3 column volumes of the above buffer to remove protein from 1 M
Eluted with a linear gradient of M ammonium sulfate to a total volume of 500 mL and collected as a 10 mL fraction. Fractions containing MCD activity were pooled and concentrated by ultrafiltration using a Millipore Ultrafree 15 mL centrifugal filter device Biomax 10K NMWL. The obtained 1 mL solution is
It was dissolved in a buffer of .1 M potassium phosphate (pH 7.4), 1 mM DTT and 1 M ammonium sulfate to make 50 mL.

Chromatography on Phenyl Sepharose HP: The enzyme solution is then
The column was injected onto a 25 mL Phenyl Sepharose HP column that had been equilibrated with 0.1 M potassium phosphate buffer (pH 7.4) containing DTT and 1 M ammonium sulfate. The column was washed with 3 column volumes of the above buffer, and the protein was eluted with a linear gradient of 1 M to 0 M ammonium sulfate to a total volume of 500 mL and collected as a 10 mL fraction. Fractions containing MCD activity were pooled and concentrated by ultrafiltration as described above. The obtained 1 mL solution is
It was dissolved in 20 mM Bis-Tris (pH 7) buffer containing 1 mM DTT to make 50 mL.

Chromatography on Q Sepharose HP: The enzyme solution was then equilibrated with 10 mL QSe previously equilibrated with 20 mM Bis-Tris (pH 7) buffer containing 1 mM DTT.
Injected into a pharose HP column. The column was washed with 3 column volumes of the same buffer and the bound protein was eluted with a linear gradient from 0 M to 0.3 M NaCl to a total volume of 100 mL. 5 mL fractions were collected and fractions containing MCD activity were pooled and concentrated as described above. The concentrated pool was resuspended in 50 mL of 50 mM malonate (pH 5.6) containing 1 mM DTT.

Chromatography on SP Sepharose HP: The enzyme solution is then transferred to 1 mM DTT
5 mL SP previously equilibrated with 50 mM malonate (pH 5.6) buffer containing
Injected into a Sepharose HP column. The column was washed with 3 column volumes of the same buffer and the bound protein was eluted with a linear gradient from 0 M to 0.3 M NaCl to a total volume of 50 mL. Two mL fractions were collected, fractions containing MCD activity were pooled, neutralized to pH 7.0 and concentrated as described above. The concentrated pool was resuspended in 5 mL of 50 mM malonate (pH 5.6) containing 1 mM DTT.

Malonyl-CoA affinity elution from SP Sepharose HP: This enzyme solution was then
The column was reapplied to a 0.5 mL SP Sepharose HP column that had been previously equilibrated as described above. The column was washed to remove unbound protein and then eluted with 50 mM malonate (pH 5.7) containing 1 mM DTT and 10 μM malonyl-CoA. This allowed for high specificity elution of MCD. The protein fraction eluted from the second SP Sepharose HP column was
Separated on a 0% SDS-polyacrylamide gel, stained with Coomassie solution and visualized. MCD band proteins were excised from the gel and digested "in gel" with trypsin. After digestion, the tryptic peptides were separated by microbore HPLC, and the amino acid sequences of the selected peptides were determined by Edman degradation.

[0093] Malonyl-CoA decarboxylase assay: In the present invention, a novel MCD assay was developed to measure MCD activity to detect the product of the MCD reaction, acetyl-CoA. MCD-derived acetyl-CoA [ ^14C ] oxaloacetate and citrate synthase (0.73 μU / μL)
Citrate formation was maintained at constant temperature in the presence of. [ ¹⁴ C] oxaloacetate is L- [ ¹⁴ C (
[U)] aspartate (2.5 μCi / ml) and 2-oxoglutarate (2 mM) from a 20-minute transamination reaction performed at room temperature. This assay has the advantage that it does not require a high degree of MCD purification before the assay and that the in vitro measurement of enzyme activity reflects the in vivo enzyme activity rate.

At the beginning of the MCD assay, cardiac homogenate or mitochondrial preparation is added to 210 μl reaction mixture (0.1 M Tris (pH 8.0), 0.5 mM dithiothreitol, 1 mM malonyl-CoA) and NaF (50 mM) For 10 minutes in the presence or absence of NaPPi (5 mM)
Maintained at 37 ° C. The reaction was stopped by adding 40 μl of perchloric acid (0.5 mM) and 10 μl of 2.2
After neutralization with M KHCO ₃ (pH 10), the mixture was centrifuged at 10,000 × g for 5 minutes to remove precipitated proteins. By keeping this heart sample at a constant temperature together with malonyl-CoA, malonyl-CoA could be converted to acetyl-CoA.

[0095] the conversion to acetyl CoA mix ^[14 C] oxaloacetate ^{(0.17 μCi / ml) [14} C]
Citrate was formed. Next, in order to remove unreacted [ ¹⁴ C] oxaloacetate from the reaction mixture, sodium glutamate (6.8 mM) and aspartate aminotransferase (0.533 μU / μl) were added, and the mixture was kept at room temperature for 20 minutes. This enabled the transamination reaction to convert the unreacted [ ¹⁴ C] oxaloacetate back to [ ¹⁴ C] aspartate. To the resulting solution, add Dowex 50W-8X (100-200 mesh) to 1:
The mixture was suspended in a ratio of 2, stirred, and centrifuged at 400 xg for 10 minutes.

[ ¹⁴ C] aspartate is removed by the pelleted Dowex fraction,
[ ¹⁴ C] citrate was retained in the supernatant. Was then measured in the form of ^[14 C] Citrate for supernatant fraction ^[14 C]. The amount of acetyl-CoA produced by the MCD was then quantified by comparison to an acetyl-CoA standard curve to which the same assay conditions had been applied as described above. A standard acetyl-CoA concentration curve was constructed using each experiment. These curves were always found to be linear (r = 0.99).

Determination of CoA ester: CoA ester was extracted from powdered tissue into 6% perchloric acid,
The improved high performance liquid chromatography (HPLC) method described above [Lopaschuk et al., J.
Biol. Chem. 269: 25871-25878 (1994)]. In principle, each sample (100 μl each) was pre-columned on a Beckman System Gold HPLC (C18,
(Size 3 cm, 7 μm) and a Microsorb short one column (type C18, particle size 3 μm, size 4.6 × 100 mm). The adsorption was set at 254 mM and the flow rate was set at 1 ml per minute.

The gradient was 80:20 (v / v) using buffer A (0.2 M NaH ₂ PO ₄ , pH 5.0) and buffer B (0.25 M NaH ₂ PO ₄ and acetonitrile, pH 5.0). Started with The initial conditions (97% A and 3% B) were maintained for 2.5 minutes, followed by 18% using Beckman curve 3
Changed to B over 5 minutes. Fifteen minutes after the start, the gradient was changed linearly to 18% B over 3 minutes and then to 90% B over 17 minutes. 0.5% to 3% B 42 minutes after start
Minutes returned to linear and column equilibration was completed 50 minutes after the start. Peaks were integrated with the Beckman System Gold software package.

Acetyl-CoA carboxylase assay: Approximately 200 mg of frozen new tissue was prepared as previously described [Lopaschuk et al., J. Biol. Chem.
269: 25871-25878 (1994)], homogenizer, centrifuged and dialyzed. 25 μl of the dialysate was added to the reaction mixture (60.6 mM Tris acetate (pH 7.5); 1 mg / ml bovine serum albumin; 1.32 μM β-mercaptoethanol; 2.12 mM ATP; 1.06 mM acetyl C
oA; 5.0 mM magnesium acetate; 18.2 mM NaHCO ₃ ; and 10 mM magnesium citrate) (160 μl final volume). The samples were maintained at 37 ° C. for 0, 1, 2, 3 or 4 minutes before stopping the reaction by adding 25 μl of 10% perchloric acid. Sample at 13,000 rpm for 2
After centrifugation for 1 minute, the concentration of malonyl-CoA in the supernatant was measured by the aforementioned HPLC method.

Western blot analysis: [Lopaschuk et al., J. Biol. Che
m. 269: 25871-25878 (1994)]. Samples were subjected to native polyacrylamide gel electrophoresis or SDS-PAGE and transferred to nitrocellulose membranes. For immunoblotting of membranes, rat anti-MCD antibody or bovine anti-catalase antibody (Chemicon
Was used. Antibodies were visualized using the Amersham Enhanced Chemiluminescence Western blotting / detection system according to the manufacturer's instructions.

Perfusion of the heart: Isolation and perfusion of the heart were performed using newborn (1 day and 7 day old) New Ze
aland white rabbits or adult Sprague-Dawley rats were used. One day old rabbit hearts were isolated as described [Lopaschuk et al., J. Biol. Chem. 269: 25871-25878 (1994)] and perfused at a coronary perfusion pressure of 30 mm Hg. The heart of a 7-day-old rabbit was also prepared as described [Lopaschuk et al., J. Biol. Chem. 269: 25871-25878 (1994)], 7.5 m
Perfusion was performed with mHg left atrial preload and 30 mm Hg aortic afterload. Rat heart is 11.5
Perfusion with mm Hg left atrial preload and 80 mm Hg aortic afterload [Lopaschuk et al.
J. Biol. Chem. 269: 25871-25878 (1994)].

[0102] newborn rabbit hearts 3% bovine serum albumin in perfused, 0.4 mM [9,10- ¹⁴ C] palmitate, Krebs consisting 11 mM glucose and 100 μU / ml insulin
-Henseleit solution was used. After perfusing the heart for 40 minutes, fatty acid oxidation was measured as described below. Rat heart contains 11 mM glucose, 1.2 mM palmitate and 100 mM
A Krebs-Henseleit solution consisting of μU / ml insulin was used. Perfusion of the heart was performed during either the 60 min aerobic phase, the 30 min aerobic phase and the 30 min complete ischemia, or the 30 min aerobic phase, the 30 min complete ischemia and the 60 min perfusion phase.

At the end of each perfusion, the heart was frozen with tongs chilled to liquid nitrogen temperature. Frozen ventricular tissue from the perfused heart was weighed and ground with a mortar and pestle cooled to liquid nitrogen temperature. A portion of the powdered tissue was used to determine the dry-wet ratio of the ventricle. The atrial tissue remaining on the cannula was removed, oven dried at 100 ° C. for 12 hours and weighed. Total dry weight of the heart was determined from dry atrial tissue, total frozen ventricular weight, and ventricular dry-moisture ratio.

Assay for Palmitate Oxidation: A routine method by quantitatively recovering ¹⁴ CO ₂ produced from hearts perfused with [ ^1-14 C] palmitate (about 50,000 dpm / ml buffer). State palmitate oxidation rates were measured in both newborn rabbit hearts and aerobic and reperfused hearts. ¹⁴ CO ₂ released as gas to the oxygenation chamber and N in the perfusate
aHCO3 recovery of trapped ¹⁴ CO ₂ in was performed in the manner previously described [Lopaschuk et al.,
J. Biol. Chem. 269: 25871-25878 (1994)].

Statistical analysis: Unpaired t-test was used to determine the deviation of the mean of the two groups. For the group of three, analysis of variance + Nemine-Kees test was used. A value of p <0.05 was considered significant.
All data presented are presented as mean ± SEM (standard error of the mean).

2. Preparation of rat liver / pancreatic malonyl-CoA decarboxylase Male Sprague-Dawley rats (300-350 g) were anaesthetized with sodium pentobarbitol and the liver / pancreas was quickly removed. Fifty rat livers were cut into 1 mm squares and rinsed with ice-cold MSE buffer (225 mM mannitol, 75 mM sucrose, 1 mM EGTA, pH 7.5). A 2: 1 weight ratio of MSE buffer: moist tissue mixture was prepared for each liver and applied to a Teflon pestle / glass homogenizer for 5 strokes. This homogenate is treated with MSE at 10 ml / g-
Diluted to wet tissue and centrifuged at 480 xg for 5 minutes. The supernatant was filtered through two-layer cheesecloth and then centrifuged at 10,000 xg for 30 minutes.

A 10 mM sodium phosphate buffer (pH 7) containing 0.5 mM dithioerythritol (DTE)
.6) the pellet was resuspended (5 mL / g-wet mitochondrial pellet). Triton X-100 (0.1%) was added to the suspension, and the slurry was stirred at 4 ° C. for 16 hours to dissolve mitochondria. The solution was centrifuged 10 min at 24,000 xg, the supernatant (NH ₄₎ was saturated 40% with ₂ SO _4, and stirred for 1 hour while cooling with ice. Precipitated proteins were removed by centrifugation at 24,000 xg for 10 minutes. The supernatant was saturated with (NH ₄ ) ₂ SO ₄ to 55%, stirred on ice for 1 hour, and centrifuged at 24,000 × g for 10 minutes. The pellet enriched in MCD activity was resuspended in 0.1 M potassium phosphate (pH 7.4), 1 mM DTT and 1 M (NH ₄ ) ₂ SO ₄ buffer, ready for use on the first column. .

Malonyl-CoA decarboxylase assay: MCD activity was measured using a fluorimetric assay following acetyl-CoA formation from malonyl-CoA in a coupled assay using citrate synthase and malate dehydrogenase. 1.4 mL reaction mixture is 0.1 M Tris-HC
l (pH 8.0), 1 mM DTE, 0.01 M malic acid, 0.17 mM NAD ⁺ , 0.136 mM malonyl-CoA,
Consisted of 11 U malate dehydrogenase, 0.44 U citrate synthase. The reaction was started by adding a variable amount of MCD (10-50 μL) according to the enzyme activity. Using a Shimadzu spectrofluorometer RF-5000, the formation of NADH from NAD + was measured for 4 minutes.
NADP formation was measured at an excitation wavelength of 340 nm and an emission wavelength of 460 nm [Sherwin an
d Natelson, Clin. Chem. 21: 230-234 (1975)].

A radiometric MCD assay was also used to measure MCD activity in all tissues [Dyke et al., Am.
Physiology 275: H2122-H2129 (1998)]. MCD-derived acetyl-CoA was kept at a constant temperature in the presence of [ ¹⁴ C] oxaloacetate and citrate synthase (0.73 μU / μL) to form citrate. [ ¹⁴ C] oxaloacetate is L- [ ¹⁴ C] aspartate (2.5 μCi / m
l) and 2-oxoglutarate (2 mM) obtained from a transamination reaction performed at room temperature for 20 minutes. At the beginning of the MCD assay, the preparation is added to the 210 μl reaction mixture (
In addition to 0.1 M Tris (pH 8), 0.5 mM dithiothreitol (DTT), 1 mM malonyl-CoA), keep at 37 ° C for 10 minutes in the presence or absence of NaF (50 mM) and NaPPi (5 mM). Was.

The reaction was stopped by adding 40 μl of perchloric acid (0.5 mM) and 10 μL of 2.2 M KHCO ₃ (pH 1
After neutralization with 0), the mixture was centrifuged at 10,000 xg for 5 minutes to remove precipitated proteins. By keeping this tissue sample at a constant temperature together with malonyl-CoA, malonyl-CoA is converted to acetyl-Co.
I was able to convert to A. [ ¹⁴ C] oxaloacetate (0.17
μCi / ml) to produce [ ¹⁴ C] citrate. All reactions were performed in the presence of N-ethylmaleimide, which removes excess CoA remaining in the later stages of the reaction, thus producing acetyl-CoA of non-MCD origin in the presence of citrate It is not possible.

Next, in order to remove unreacted [ ¹⁴ C] oxaloacetate from the reaction mixture, sodium glutamate (6.8 mM) and aspartate aminotransferase (0.53
3 μU / μl) and kept at room temperature for 20 minutes. This enabled the transamination reaction to convert the unreacted [ ¹⁴ C] oxaloacetate back to [ ¹⁴ C] aspartate. Dowex 50W-8X (100-200 mesh) was suspended in the resulting solution at a ratio of 1: 2, stirred, and centrifuged at 400 × g for 10 minutes. [ ¹⁴ C] aspartate was removed by the pelleted Dowex fraction, while the supernatant retained [ ¹⁴ C] citrate.

The supernatant fraction was then measured for [ ¹⁴ C] present in the form of [ ¹⁴ C] citrate. The amount of acetyl-CoA produced by the MCD was then quantified by comparison to an acetyl-CoA standard curve to which the same assay conditions had been applied as described above. Evaluation of the standard acetyl-CoA concentration curve was performed for each experiment. These curves were always found to be linear (r = 0.99) (data not shown).

Chromatography on Butyl Sepharose 650 M: M adjusted to 1 M (NH ₄ ) ₂ SO ₄
The CD solution was added to a 0.1 M potassium phosphate buffer (pH 7.4) containing 1 mM DTT and 1 M (NH ₄ ) ₂ SO _4.
100 mL Butyl-Sepharose 650M column (2.6 cm
× 40 cm). Wash the column with 3 column volumes of the buffer and remove the protein.
Elution with a linear gradient of 1 M to 0 M (NH ₄ ) ₂ SO _{4 to} a total volume of 150 mL was collected as a 9 mL fraction. Fractions containing MCD activity were pooled and 0.1 M potassium phosphate (pH 7.4), 1 mM DTT
And 1 M (NH ₄ ) ₂ SO _{4 in} a buffer to make 100 mL.

Chromatography on Phenyl Sepharose HP: This enzyme solution was
And a 0.1 M potassium phosphate buffer (pH 7.4) containing 1 M (NH ₄ ) ₂ SO ₄ and a 25 mL Phenyl Sepharose HP column (2.6 cm × 20 cm) which had been equilibrated in advance.
Washed with the buffer solution of 3 column volumes, proteins were eluted in 1 M~0 M (NH ₄₎ total volume 175 mL with a linear gradient of ₂ SO ₄ and was recovered as a 9 mL fractions. Fractions containing MCD activity were pooled and concentrated by ultrafiltration. The resulting 1 mL solution contains 1 mM DTT
Dissolved in 20 mM Bis-Tris (pH 7) buffer to make 50 mL.

Chromatography on Q Sepharose HP: This enzyme solution contains 1 mM DTT
10 mL Q Sephar, pre-equilibrated with 20 mM Bis-Tris (pH 7) buffer
Injected into an ose HP column (1.5 cm × 20 cm). The column was washed with 3 column volumes of the same buffer and the bound protein was eluted with a linear gradient from 0 M to 0.3 M NaCl to a total volume of 80 mL.
4 mL fractions were collected, fractions containing MCD activity were pooled and concentrated by ultrafiltration. The concentrated pool was resuspended in 50 mL of 50 mM MES (pH 5.5) buffer containing 1 mM DTT.

Chromatography on SP Sepharose HP: The enzyme solution was pre-equilibrated with 50 mM MES (pH 5.5) buffer containing 1 mM DTT, 5 mL SP Sepharose.
Injected into an HP column (1.5 cm × 20 cm). The column was washed with 3 column volumes of the same buffer and the bound protein was eluted with a linear gradient from 0 M to 0.4 M NaCl to a total volume of 150 mL. Four
mL fractions were collected, fractions containing MCD activity were pooled, neutralized to pH 7.0 and concentrated by ultrafiltration. Concentrate pool was adjusted to 5 mM 50 mM malate (pH 5.6) containing 1 mM DTT
Resuspended in L.

[0117] Malonyl-CoA affinity elution from SP Sepharose HP: The enzyme solution was washed with a 0.5 mL SP Sepharose HP column (0.5 cm ×
10 cm) again. Wash the column with 50 mM malate (pH 5.6) buffer containing 1 M DTT to remove unbound proteins, and then add 50 mM malate (pH 5.6) buffer containing 1 mM DTT and 10 μM malonyl-CoA. Eluted. The eluted fraction was neutralized to pH 7.0. This affinity elution protocol enabled highly specific elution of MCD.

Protein sequencing: Affinity-eluted protein fractions from a SP Sepharose HP column were separated by 9% SDS-PAGE and visualized by staining with Coomassie blue solution. Since the large protein of about 52 kDa was considered to be MCD, it was excised from the gel and digested with endoLys C. The digested protein was subjected to HPLC and the appropriate peptide was subjected to amino acid N-terminal sequencing. The amino acid sequences of the two internal peptides were obtained. Protein digestion and amino acid N-terminal sequencing are described in Eastern Quebec P
Held at the eptide Sequencing Facility (Quebec, Canada).

Production of antibodies against rat liver MCD: Affinity-eluted proteins from SP Sepharose columns were subjected to SDS-PAGE, stained with Coomassie, and 52 kDa excised from the gel. Rabbits were injected with the protein (3 μg) eluted from the gel fraction. Similarly, another fraction of the protein (6 μg) eluted from the S Sepharose column was injected into rabbits omitting the gel separation step. Rabbits were injected at 2-week intervals for 2 months before using the serum.

3. Probe Synthesis, Library Screening and DNA Sequencing of Rat Pancreatic β-Cell MCD RT-PCR was performed on INS-1 complete mRNA using Superscript reverse transcriptase and Taq polymerase (GIB
CO) according to the manufacturer's protocol. The annealing temperature was 55 ° C. In the PCR, the denatured oligonucleotide was replaced with a goose MCD sequence [Jang e
tal., J. Biol. Chem. 264: 3500-3505 (1989)]. The sense primer located at base 547 of this goose sequence is 5 'GANTSTGAR GCTGTGCAYCCTGT3' (SEQ ID NO: 4), and the antisense primer starting at base 1102 is 5 'TACARRTACCA
GGCRCACARY CTCAT 3 '(SEQ ID NO: 5). The 580 bp fragment was converted to pBluscript (Stratage
ne), sequenced, digested with restriction enzymes, purified and prepared for use as a probe.

A pancreatic β (INS) cell cDNA library constructed in Lambda ZAPExpress (Stratagene) was screened by random priming using a purified 580 bp PCR fragment labeled with α- [ ³² P] -dCTP. After a second round of screening, 4 this clone was excised in vivo and transfected by calcium phosphate precipitation [24] (5
was examined MCD activity at [mu] g / 10 24 hours after 293 cells ¹⁰⁶ cells). For the clone showing the highest enzyme activity, the deletion method (Erase-a-Base, Promega) and the staining-primer sequencing method (Autoread Sequencing Kit and ALF DNA sequencer, Pharmacia
Was performed in both directions.

The size of this DNA was 2020 bp. The sequence of the other positive clone was also determined to confirm the sequence obtained from the clone showing the highest enzymatic activity by introducing DNA into 293 cells. DNA transfer of the β-galactosidase gene under the control of the CMV promoter is a negative control for MCD activity, and the transfer efficiency (
About 20%) worked as a positive control. Ins-1 cells [Asfarai et al., Endocr
inology 130: 167-178 (1992)] and human kidney 293 cells [Becker et al., J. Biol. Chem.
269: 21234-21238 (1994)] was cultured as described in the cited reference.

Measurement of β-cell MCD mRNA: Northern blots were performed using standard gel preparation and transfer techniques [Sambrook et al., Molecular Cloning, Cold Spring Harbor Laborat.
ory Press, New York (1989)]. Briefly, 20 μg of complete mRNA per lane was separated on a 1% agarose gel in the presence of formaldehyde, transferred to a Zeta probe QT membrane (Biorad) using capillary action, and fixed with UV light After pre-hybridization, the labeled 580 bp MCD c
Hybridization was performed in the presence of the DNA fragment, and washing was performed according to the manufacturer's protocol.

The signal was expressed by Fuji phosphorimager. Control hybridization with an 18S ribosomal precursor probe (0.77 kb EcoR1-BamH1 fragment of mouse 18S ribosomal rRNA cDNA subcloned into pUC830, position 1-1780) was also performed on the same membrane, and staining of this RNA with ethidium bromide was confirmed. RT-PCR is based on the guanidinium isothiocyanate acid phenol method [Chomczinsky and Sacchi, An
al. Biochem. 162: 156-160 (1987)] using complete RNA obtained from rat tissues. Reverse transcription was performed as above using 5 μg RNA. Preparation of cDNA from sorted pancreatic α and β cells was performed as described in the literature [Heimberg et al., Proc. Nat. Acad. Sci. USA 93: 7036-7041 (1996)]. .

The PCR reaction was performed in one third of the RT reaction using the same primers and conditions as described above. These conditions were compared to PCR performed on the same material using rat β-actin oligonucleotide primers [Heimberg et al., Proc. Nat. Acad. Sci. USA 93: 7036-7041 (1996)]. The reaction was monitored after 15, 25, and 35 cycles and analyzed on a 1% agarose gel stained with ethidium bromide.

Cloning of rat liver / heart MCD: To amplify the 900 bp MCD product from rat liver cDNA by PCR, the cloned sequence of rat β-cell MCD [Voilley et al., Bioch.
em. J. Submitted (1999)]. In one PCR reaction, the forward primer PMCDF1 (5'TGGTCGACGGCTTCCTGAACCTG; SEQ ID NO: 6) was used in combination with the reverse primer PMCDR (5'TCCCTAGAGTTTGCTGTTGCTCTG; SEQ ID NO: 7).
This 900 bp fragment was used in a SuperScript rat liver cDNA library (Gibco, Life Technol.
ogies) were used as probes to screen. This full-length cDNA
Clones were sequenced in both directions using internal primers and compared to rat islet cDNA sequences. Rat heart MCD RNA was similarly cloned using techniques well known in the art.

Immunocytochemistry: Double-label immunocytochemistry was used to determine the cellular localization of MCD. McArdle RH-7777 hepatoma cells were grown on sterile coverslips immersed in α-MEM supplemented with 20% fetal calf serum (pH 7.4) (degree of fusion 60%) and then incubated in a humidified atmosphere supplemented with 5% CO _2. And cultured at 37 ° C. Anti-MCD antibodies formed in rabbits were used against the MCD antigen, and anti-Hsp (heat shock protein) 60 antibodies formed in mice were used against the Hsp 60 antigen. Hsp60 is mainly composed of a specific mitochondrial substrate chaperone protein [Stuart et al., Trends Biochem. Sci. 19: 87-92 (1994)].

At 60% confluence, coverslips were washed three times with 1 × phosphate buffered saline (PBS), pH 7.4, and then fixed in 4% paraformaldehyde for 10 minutes. The immobilization reaction was stopped by replacing the fixative with 100 mM glycine in 1 × PBS for 15 minutes. The cells were then washed twice with a solution of 0.1% Triton-X 100 and 0.1% BSA in 1 × PBS (TA-PBS) for 1 minute each time, exchanging the solution, and then using the same medium. The culture was clarified by culturing for 30 minutes. Next, cover glass with TA-PBS
Washing three times with changing fluids was followed by blocking with 5% fetal calf serum for 20 minutes to prevent non-specific binding of the selected antibody.

After washing three times with TA-PBS, the cover glass was washed with a rabbit polyclonal anti-MCD antibody (diluted).
1: 100) for 2 hours at room temperature (RT). At the end of this reaction, the coverslips were washed three times with TA-PBS while changing the solution and kept at RT for 1 hour with mouse anti-Hsp60 monoclonal antibody (dilution 1: 1000, Stress Gen Biotechnologies, Canada). Was. The coverslip was then washed three times with 1 × PBS (pH 7.4) and the goat anti-mouse rhodamine (RH; Jackson Immuno Research Laboratories, USA)
Conjugate (dilution 1: 200) and goat anti-rabbit fluorescein thioisocyanate (FITC; Jackson Immuno Research Laboratories, USA) conjugate (dilution 1: 2)
00) for 1 hour at RT.

When the secondary antibody reaction was completed, the cover glass was washed with 1 × PBS (pH 7.4) and immersed in 50% glycerol containing 1% propyl gallate (anti-fluorescent light bleach) under a microscope. They were mounted on slides and stored in the dark. All slides are Silicon Grap
Examination was performed with an Olympus fluorescence microscope and / or a laser confocal microscope (Leica) connected to a hics computer.

In another experiment, a new mitochondrial selection dye, Mito-Traker Red CMXRos (Mole
mitochondria in the cultured cells were labeled using Chromatic Probes. Fusion degree 60
At%, the medium was replaced with pre-warmed medium (37 ° C.) containing 200 nM Mito-Traker Red CMXRos and kept at 37 ° C. in a humidified atmosphere supplemented with 5% CO ₂ for 20 minutes. The cells are then 1x PB
Wash with S, fix in 4% paraformaldehyde for 10 minutes, and remove intracellular M
Processing was performed in preparation for probing with an anti-MCD antibody to localize the CD.

Western method: [Dyck et al., Am. J. Physiology 275: H2122-H
2129 (1998)] The sample was subjected to SDS-PAGE and transferred to nitrocellulose. To the membrane
Immunoblot with anti-MCD antibody dissolved in 1% milk powder (dilution 1: 500). Antibody is Pharmaci
Visualization was performed using Enhanced Chemiluminescence Western Blotting and Detection System from a. Statistical analysis: Unpaired t-test was used to determine the mean deviation of the two groups. For the group of three, analysis of variance + Nemine-Kees test was used. A value of p <0.05 was considered significant.
All data presented are presented as mean ± SEM (standard error of the mean).

Example 1 This example describes the characteristics of a rabbit heart MCD. Assay of cardiac MCD activity as described above,
Examination using spectroscopy, for example, has shown that the variability in the results is extremely large, and also high background values in heart tissue [Kolatt
ukudy et al., Meth. Enzymol. 71: 150-163 (1981)]. Such an assay also
Lack of sensitivity to accurately measure MCD of cardiac tissue, and spectroscopic readings were not much different from high background absorption values. Also, ¹⁴ C-malonyl
Radiotracer assays using CoA are expensive. Therefore, a new assay was developed to quantify acetyl-CoA formed by MCD (see “Methodology”).

The assay was optimized for use with cardiac homogenates and isolated mitochondrial preparations. Tissue protein standard curve using heart homogenate was 2 mg
MCD activity was found to occur in these tissues, which was also found to be linear up to an incubation time of up to 20 minutes. Similarly, the time course standard curve using a 10 minute incubation time also showed a linear MCD activity rate using 0-10 mg of tissue.
Therefore, an incubation time of 10 minutes with 2 mg of tissue homogenate was adopted. This resulted in an acetyl-CoA value located at the center of the acetyl-CoA standard curve. Similar time and protein dependent experiments were performed on isolated mitochondrial preparations.

Using this MCD assay, the presence of MCD activity in rat-derived heart homogenates was confirmed (Table 1). The MCD activity rate was found to be much higher than the past measured ACC activity rate [Lopaschuk et al., J. Biol. Chem. 269: 25871-25878 (1994)].
Since malonyl-CoA synthesis from ACC is under the control of phosphorylation, experiments were performed to determine whether MCD was also under the control of phosphorylation.

Isolation of tissue under conditions that preserve the phosphorylation state of this enzyme,
There was no change in the MCD activity ratio as compared to the enzyme isolated under conditions that did not care about the preservation of the phosphorylated state (Table 1). However, in vitro incubation of cardiac homogenates with alkaline phosphatase resulted in increased MCD activity. This suggested that MCD was under the control of the phosphorylation reaction, and that phosphorylation of this enzyme resulted in reduced enzymatic activity.

MCD activity was also measured on crude homogenate, isolated mitochondria, and post-centrifuged mitochondrial supernatant (Table 2). Measurable levels of all these heart fractions
MCD activity was detected. The MCD activity levels observed in these fractions have been suggested previously [Jang, SH. Et al., J. Biol. Chem. 264: 3500-3505 (1989).
The same fraction was treated with octyl glycoside to determine if it was due to mitochondrial substrate localization of MCD. The addition of octyl glycoside increased the relative MCD activity level of the crude homogenate by about 6-fold.

The isolated mitochondrial fraction had a 14-fold MC increase compared to the untreated mitochondrial fraction.
D activity increased. This increase in MCD activity strongly suggested that solubilization of the mitochondrial membrane allowed release of MCD from the substrate or contact with extramitochondrial space. This confirmed that most of the cardiac MCD was localized to the mitochondrial matrix. To examine the properties of MCD, Western method was performed using MCD antibody [Kim an
d Kolattukudy, Arch. Biochem. Biophys. 190: 234-246 (1978)]. In rat heart and kidney tissue, this antibody cross-reacted with high affinity with at least one other protein. Since the other protein was found to be catalase, the results of the test using the MCD antibody were further clarified by using an antibody against catalase. Rat liver MCD was partially purified using the method described above. The partially purified protein was subjected to electrophoresis on a 2-lane non-denaturing gel. After electrophoresis, one lane was transferred to nitrocellulose and blotted with MCD, and the other lane was stored in water for future use.

In a Western blot from a non-denaturing gel (see FIG. 1A), the MCD antibodies were Kim and Kola
ttukudy [Arch. Biochem. Biophys. 190: 234-246 (1978)]. About 16 as predicted
Reacted with one large band from 0 to 190 kDa. The position of this band was aligned with the non-transfer lane of the non-denaturing gel, and the region containing MCD was cut out from the gel. Elute the protein from this gel slice (to make it a substantially pure preparation)
Measure MCD activity or run SDS-PAGE, transfer to nitrocellulose,
Blotted with anti-MCD antibody (see lane 2 in FIG. 1A). The eluted protein showed extremely high MCD activity and reacted with the MCD antibody when subjected to the Western method.

The blot formed was stripped and reprobed with an anti-catalase antibody to confirm which band corresponded to the catalase protein (see FIG. 1, lane 3).
In this experiment, the molecular weight of rat liver MCD was found to be about 45 kDa. This result is based on the previous conclusion that this natural enzyme was a tetramer [Kim and Kolattukudy, Arc
h. Biochem. Biophys. 190: 234-246 (1978)]. The Western method was also performed on denatured semi-purified heart samples (see FIG. 1B). Under these conditions, a 45 kDa band was identified in both liver and heart tissue samples (see FIG. 1B, lanes 1 and 2). Treatment of the sample with alkaline phosphatase followed by SDS-PAGE and Western analysis did not change the molecular weight of the protein.

[0141]

[Table 1]

[0142]

[Table 2]

[0143]

[Table 3]

In this example, a control heart MCD activity was demonstrated, and an approximately 45 kDa MCD heart allogeneic that could be phosphorylated and inhibited by an unidentified kinase was identified.

Example 2 This example describes the role of MCD in regulating fatty acid oxidation. Comparison of 1-day and 7-day-old rabbit hearts has shown previous studies that myocardial fatty acid oxidation dramatically increases with age [Lopaschuk et al., J. Biol. Chem. 269 : 25871-2
5878 (1994)]. As shown in Table 3, the 7-day-old heart has a significantly higher fatty acid oxidation rate than the 1-day-old heart. This was accompanied by reduced malonyl-CoA levels and reduced ACC activity. However, in order for cardiac malonyl-CoA levels to decrease, the rate of synthesis must be reduced and the degradation or metabolic utilization of malonyl-CoA must proceed in parallel. Therefore, MCD activity was measured in the hearts of 1-day and 7-day-old rabbits.

As shown in FIG. 2, the MCD activity of the 7-day-old heart was significantly higher than that of the 1-day-old heart. This high MCD activity rate indicates that malonyl-CoA
Suggested a rapid rotation of A. In vitro dephosphorylation of heart extract with alkaline phosphatase did not alter MCD activity. This suggested that MCD activity was not as regulated by phosphorylation in newborn rabbit hearts as in adult rat hearts.

When adult rats' hearts are reperfused after 30 minutes of complete avascular ischemia (complete avascular ischemia refers to a cessation of blood flow to each part of the rat heart for a specified period of time), malonyl-CoA levels are dramatically reduced. Results (data not shown). In parallel, a decrease in ACC activity and a slight decrease in the rate of fatty acid oxidation was also observed. However, during reperfusion of the ischemic heart, the amount of fatty acid oxidation per cardiac work is greatly increased because the cardiac work is significantly reduced. FIG. 3 is a graph showing the measured values of the MCD activity of the aerobic heart, the ischemic heart, and the reperfused heart. MCD activity levels were maintained at the end of ischemia and / or reperfusion. Alkaline phosphatase treatment of samples was also
The result was an increase in MCD activity.

FIG. 4 shows MCD protein levels in samples taken from the aerobic, ischemic, and reperfused hearts of rats. MCD protein levels did not change during the reperfusion protocol, and there was no change in MCD molecular weight between groups, suggesting that MCD does not undergo post-translational modification by phosphorylation. In addition, using the whole heart extract for the Western method, another protein with a slightly higher molecular weight than that seen in semi-purified MCD of mitochondrial origin was detected (see Figure 4, lanes 3-8).

A sample containing a cytoplasmic extract rather than a pure mitochondrial extract may also have a cytoplasmic form of MCD. In goose tail gland, cytoplasmic MCD is about 55
The mitochondrial form has a molecular weight of 50 kDa due to post-translational processing.
[Courchesn-Smith et al., Arch. Biochem. Biophys. 298:
576-586 (1992)]. Western analysis suggested that similar processing could occur in rat hearts.

Example 3 In this example, based on the results shown in FIG. 3, one model is proposed for a mechanism for enhancing ischemic damage of the myocardium (FIG. 5B). AMPK is activated during ischemia. Activated AMPK activates ACC during reperfusion, which results in reduced malonyl-CoA synthesis [Lopaschuk et al., J. Biol. Chem. 269: 25871-25878 (1994)]. MCD
While activity is maintained, a reduction in cardiac malonyl-CoA levels occurs. Malonyl C
As oA levels decrease, CPT1 becomes more active as its inhibitors are removed. This leads to an increase in the rate of fatty acid oxidation, resulting in increased ischemic damage. This model suggests that MCD is a key factor in causing reperfusion injury in ischemic hearts. Therefore, pharmacological modifications of MCD would also be an effective approach to the treatment of ischemic heart disease.

Thus, the present invention demonstrates that the heart expresses a 45 kDa MCD isoform that plays a key role in regulating cardiac malonyl CoA levels. Increase or maintenance of MCD activity
Combined with a decrease in ACC activity, this can lead to a decrease in cardiac malonyl-CoA levels and an increase in the rate of fatty acid oxidation. Drug screening using the novel MCD compositions and assays of the present invention will help identify such potential compounds. Such inhibitors are expected to be effective in treating ischemia.

Example 4 In this example, Kolattukudy et al. [Kolattukudy et al., J. Biol. Chem. 71: 150-163
(1981)] developed a rat liver MCD purification system that was substantially different from that originally described. Both butyl sepharose and phenyl sepharose columns are hydrophobic resins that separate proteins based on their hydrophobicity. Since MCD elutes much later from the column, it is likely that there is a very strong interaction between the column and the MCD. Q-Sepharose columns are strong anion exchange resins, and as the salt concentration gradient increases, the peak of MCD activity splits into two at different ionic strengths.

The MCDs contained in these two peaks have the same kinetic characteristics but are clearly separated. Our goal was to purify a sufficiently large amount of MCD for the specific application at a later stage, so all active fractions from both peaks were pooled and applied to the next column. These fractions were applied to a SP-Sepharose cation exchange column. In this case, the MCD eluted relatively early in the salt gradient, suggesting a relatively weak interaction with the resin (FIG. 7C).

Due to this weak interaction with the SP-Sepharose column, MCD can be easily eluted from this resin by its negatively charged substrate, malonyl-CoA. This probably changes the conformation and / or final charge of the MCD,
It seemed that H 5.5 would no longer be able to meet with SP-Sepharose. The outline of this purification method is shown in FIG.

In the method of the present invention, MCD could be purified more than 1200 times from the original 55% ammonium sulfate pellet (Table 4). This purification profile only shows an increase in purity starting with mitochondrial preparations, as our fluorometry did not allow detection of MCD activity from whole cell extracts. For this reason, we believe we have indeed achieved much higher MCD purifications than those shown here. The pooled column fractions were subjected to SDS-PAGE and stained with the photosensitive dye Coomassie to detect two proteins with molecular weights of 52 kDa and 65 kDa.

Previous studies on mammalian MCD have shown that the 52 kDa protein we
Suggests that it was a CD [Dyck et al., Am. J. Physiology 275: H2122-H
2129 (1998); Voilley et al., Biochem. J. Submitted (1999)]. Immunoblot experiments revealed that the second protein (co-purified with MCD) was catalase, suggesting that our first isolated mitochondria also contained peroxisomes.

Example 5 In this example, in order to amplify a 900 bp MCD product from rat liver cDNA by PCR, rat pancreatic islet MCD cDNA [Voilley et al., Biochem. J. Submitted (1999)]
An oligonucleotide was designed based on the cloned sequence of This 900 bp fragment was used as a probe in screening a rat liver cDNA library. Full length (
A 2.2 Kb) clone was obtained, sequenced in both directions, and compared to the rat islet MCD sequence. The cDNA sequence encoding rat liver MCD is as shown in FIG. Comparison of liver-type and islet-type MCD shows that both types are the same (not shown).

[0158] Potential phosphorylation sites remain with potential peroxisomal targeting sequences (SKL). The sequences of both peptides obtained by amino acid sequence analysis are numbered and highlighted in bold. A leucine zipper motif was also identified (underlined and black dots), but this is an MCD similar to phenylalanine hydroxylase.
It may govern the protein-protein interactions required for tetrameric structures [Hufton et al., Biochem Biophys. Acta. 1382: 295-304 (1998)].
.

Example 6 This example describes the characteristics of rat liver MCD. SP showing the highest MCD-specific activity
-The affinity eluted fractions on the Sepharose column were pooled and aliquoted. The first fractionation
It was subjected to SDS-PAGE. Cut the 52 kDa band from the gel, digest with endoLys C,
C and the appropriate peptides were subjected to amino acid N-terminal sequencing. Since the amino acid difference sequences of the two internal peptides were obtained, they were compared and confirmed with cDNA sequences obtained from rat liver cDNA clones. The second fraction was used for kinetic analysis. MCD activity was measured at various malonyl-CoA concentrations to determine Km values.

FIG. 9A shows that two Km values, as determined by Lineweaver-Burke plots, can be present at about 1-2 μM and another at 30-40 μM. This latter value is similar to published Km values obtained from rat liver MCD crude [Kim and Kolattuku
dy, Arch. Biochem. Biophys. 190: 234-246 (1978)]. To determine the optimal pH at which liver MCD is most active, a pH-dependent curve was also evaluated (FIG. 9B). In our fluorescence measurement, the optimal pH is 7-8. Both of these results indicate that rat liver MCD
[Kim and Kolattukudy, Arch. Biochem. Biophys.
190: 234-246 (1978)].

Our previous studies have shown that cardiac MCD is regulated by phosphorylation [Dyck et al., Am. J. Physiology 275: H2122-H2129 (1998)]. The use of our purified liver MCD and various kinases and phosphatases could only identify alkaline phosphatase as a potential modulator of MCD activity (Table 5). Similar experiments were performed to dephosphorylate and activate the MCD using alkaline phosphatase and then try to inactivate the MCD using various kinases. All of these experiments were unsuccessful. The kinases or phosphatases tested were casein kinase II, cAMP-dependent protein kinase, protein kinase C, 5 'AMP activated protein kinase, protein phosphatase 2A and protein phosphatase 2C.

Another group of affinity-eluting fraction pools on the SP-Sepharose column was subjected to SDS-PAGE, stained with Coomassie, and the 52 kDa band excised from the gel. The protein was eluted from the gel fragments and injected into rabbits to form MCD antibodies. Similarly, S-
Another fraction from the affinity elution of the Sepharose column was injected into rabbits omitting the gel separation step. This method allowed us to reliably obtain antibodies formed against both denatured and non-denatured MCD proteins.

According to the Western method using rat liver mitochondria, both antibodies were
It was found to recognize a 52 kDa protein (FIG. 10A). Antibodies formed using non-denatured MCD (MCD240) also recognized catalase, whereas antibodies formed using denatured MCD (MCD239) appeared to be more MCD-specific (FIG. 10A). MCD240
Was able to immunoprecipitate a protein with a molecular weight of 52 kDa, but could not detect MCD from this immunoprecipitated protein.

To confirm that the antibodies formed against the purified MCD were indeed able to recognize MCD in solution, we performed an immunoinhibition test (FIG. 10B). Purified rat liver MCD activity was measured by the fluorometric MCD assay described in the "Method" section. Purified MCD to MCD239, M
Pre-incubated with CD240 or appropriate pre-immune serum. 30 minutes after the mixture M
CD activity was measured and expressed as a percentage of the activity of MCD pre-incubated without serum for the same amount of time. FIG. 10B shows that only MCD240 was able to inhibit MCD. This finding that MCD240 inhibits MCD activity seems to explain why MCD240 was able to immunoprecipitate MCD, but no MCD activity was detected from the sedimented pellet.

Example 7 In this example, Western blotting and MCD240 were used to demonstrate MCD in various rat tissues.
The distribution situation was measured. All tissues tested expressed relatively high levels of MCD protein. Oxidizing tissues, such as the liver and heart, express the highest levels of MCD protein and the idea that MCD plays a role in regulating fatty acid oxidation [Dyck et al.
al., Am. J. Physiology 275: H2122-H2129 (1998)]. In these experiments, total MCD levels were measured using detergent solubilized whole tissue homogenates. This method prevented MCD protein loss due to cell localization.

To determine the subcellular localization of hepatic MCD, double-labeled immunocytochemistry was performed on rat hepatoma cells, McArdle RH-7777, using two separate approaches. First, antibodies against MCD or the mitochondrial substrate-specific protein Hsp60 were used [Stuart et al., Trends Biochem Sci. 19: 87-92 (1994)]. Both fluorescence and confocal analyzes showed that MCD co-localized with Ksp60 (FIGS. 11B, 1-3).
Similar studies using a mitochondrial-specific dye (Mito-Tracker Red CMXRos) and MCD antibody also confirmed these results (FIG. 11B, 4-6). It is unknown whether MCD is localized to other organelles than mitochondria. However, it is clear that many liver MCDs are mitochondrial.

Example 8 In this example, MCD expression and activity was measured in three animal models that were previously characterized for changes in fatty acid metabolism. Two of them are diabetes models, in which liver fatty acid biosynthesis is inhibited (6 week-old streptozotocin-diabetic rats) or enhanced (JCR: LA obese insulin-resistant rats). Table 6 shows the changes in both plasma glucose and fatty acid levels found in various rat models.

[0168] Serum fatty acid levels are increased 3-fold in 6-week-old streptozotocin-diabetic rats and 1.75-fold in JCR: LA obese (Cp / Cp) rats compared to lean controls.
Similarly, serum glucose levels are increased 2.2-fold in 6-week-old streptozotocin-diabetic rats compared to lean controls. In contrast, serum glucose levels in Cp / Cp rats were not different from the lean control group. These changes in serum glucose and fatty acid levels are consistent with the pathophysiology of these animals [Russel
l et al., Metabolism 43: 538-543 (1994); Topping and Tang, Horm. Res. 6:12
9-137 (1975); Mathe, Diabete Metab. 21: 106-111 (1995)].

MCD activity was increased about 2-fold in 6-week-old streptozotocin-diabetic rats compared to the control group (FIG. 12), but there was no change in MCD activity in Cp / Cp rats (FIG. 13).
). To determine whether the change in activity was due to a phosphorylation of MCD and / or an increase in the relative abundance of MCD, a Western method was performed using our MCD antibodies. MCD protein levels were approximately twice as high in the liver of 6-week-old streptozotocin-diabetic rats as in the control group, but not in the liver of Cp / Cp rats.
No change was seen in MCD levels (Figure 13).

The catalase antibody was used as a control to prove that almost the same amount of protein was loaded and transferred in all lanes. However, in the Western method, Cp / C
It turned out that there was no change in the MCD protein level of p rats (Fig.
13). This suggests that changes in MCD activity seen in Cp / Cp rats may be due to changes in the phosphorylation state of the enzyme rather than changes in protein levels.

Both phosphorylation control and elevated MCD protein levels appear to be involved in the regulation of MCD activity in the liver of diabetic rats. Treatment of liver MCD from both 6-week-old streptozotocin-diabetic rats and Cp / Cp rats with alkaline phosphatase increased MCD activity in all groups (Table 5). Alkaline phosphatase treatment of liver MCD appears to consistently produce about 11,000-15,000 nmol / g-dry wt / min MCD enzyme activity, which is sufficient to produce maximally active enzyme. Suggest that there is. Only streptozotocin-diabetic rats have increased MCD activity, presumably due to a two-fold increase in MCD protein expression.

Another known protocol for altering hepatic fatty acid biosynthesis and oxidation is fasting and refeeding rats [Porter and Swenson, Mol. Cell.
Biochem. 53: 307-325 (1983); Clarke et al., J. Natr. 120: 218-224 (1990); W
itters et al., Arch. Biochem. Biophys. 308: 413-419 (1994)]. Table 6 shows a significant decrease in glucose and an increase in serum fatty acid levels at this time. Similarly, 48
MCD activity also increased during the hour fasting period (FIG. 14A).

Refeeding rats after 48 hours of fasting for 72 hours reduced MCD activity (
(Figure 14A). MCD activity levels begin to approach levels of control rats that did not apply the same fasting or refeeding protocol (FIG. 14A). MCD activity changed during these various nutritional states, but there was no significant change in MCD protein levels (as compared to FIG. 12). This also suggests that MCD activity undergoes post-translational regulation, probably through phosphorylation.

Example 9 Cloning of rat pancreatic β-cell cDNA was performed using denatured oligonucleotides
A phased approach was used. One of the selection pairs tested on INS cell mRNA was goose cD
Generated a single product with the expected size of 580 bp as expected from the NA comparison (Figure 15)
. This fragment was shown by sequencing to be 67% identical to the goose nucleotide sequence, but did not match any other sequence obtained on the blast server. This fragment was used as a probe to screen an INS-1 cell cDNA library. Only one of the four in vivo excised clones showed significant MCD activity after introduction into 293 cells.

The 239 cells did not express detectable levels of the enzyme even after the β-galactosidase gene was introduced, even in the untransfected state. Sequencing of this 2020 bp clone revealed an amino acid sequence of 491 residues and an open reading frame corresponding to the predicted protein of about 52 kDa. There was also a poly A sequence with a polyadenylation signal at the end of the 3 'non-coding region. Previous studies on MCD enzyme purified from various mammalian cells estimated the total molecular weight to be about 170 kDa, suggesting that the enzyme may multimerize in vivo. The predicted rat protein was 69% identical to the goose sequence from methionine at amino acid 39 to the end.

The nucleotide sequence surrounding this methionine (AGCGCCATGG; SEQ ID NO: 8)
Significantly matches the ak consensus sequence site (GCCA / GCCATGG; SEQ ID NO: 9), suggesting that it may be the translation initiation site. In the same open reading frame, a sequence of 38 amino acids exists at the N-terminal side of this methionine. The first amino acid group (MRGL) of this sequence (starting with methionine) is consistent with the goose sequence. However, the remainder of this sequence, from amino acids 5 to 38, has relatively little homology to the goose sequence.

This part of the rat protein is characterized by a mitochondrial targeting sequence. This is because they are rich in positively charged amino acids (eight arginines) and hydroxylated amino acids, and lack acidic amino acids. Therefore, it is likely that it is a cleavable NH ₂ -terminal targeting sequence belonging to a larger MCD precursor. The common cleavage site (R / KRAXSS / T; SEQ ID NO: 10) in the preceding sequence is M
It does not exist around et39. However, another cleavage site motif defined by Y. Gavel (PRLCSG; SEQ ID NO: 11) is predicted around position 31, and the predecessor sequence may have been removed by the substrate protease, and β (INS) indicates that cellular MCD is at least partially a mitochondrial substrate enzyme.

A motif analysis of rat MCD performed by the Web PSORT and PROSITE programs revealed interesting features. Apart from the NH ₂ -mitochondrial substrate targeting sequence, the C-terminal part of this enzyme terminates in a peroxisomal targeting motif characterized by the SKL signature. On this protein there are potential phosphorylation sites for protein kinase C and casein kinase II (3 and 7, respectively). Therefore, MCD may be regulated by phosphorylation or dephosphorylation. This is because both kinases are present in mitochondria. Because rat MCD does not contain an acylation site (N-myrist dolphin, glycosylphosphatidylinositol, isoprenylation, farnesylation), it is unlikely that it will be a membrane-bound protein modified by one of these lipid anchors.

Example 10 The tissue distribution of MCD mRNA was examined by the Northern method and complemented by a semi-quantitative RT-PCR method (FIG. 16).
). The approximately 2.2 kb mRNA is present in all rat tissues tested and is expressed at relatively high levels in liver, kidney, heart and adipose tissue. The broad signal is obtained because MCD transcripts co-migrate with 18S ribosomal RNA. To confirm this ubiquitous distribution, RT-PCR was performed on the same tissue and specific pancreatic α and β cells.

The relative signal between tissues after 25 cycles of PCR was almost the same as that after 35 cycles, except that the band intensity was weak. Various comparisons were possible thanks to β-actin control PCR with the same sample. Non-reverse transcript control PCR produced no signal apart from genomic DNA contamination of the RNA preparation. Thus, the RT-PCR results not only confirm the results of the Northern method, but also show that MCD mRNA is expressed in α and β cells to the same extent as in β (INS) cells.

Example 11 The presence of active enzyme was measured in tissue extracts. The result is liver, heart and pancreatic β
(INS) A wide range of activities, from high levels of activity in cells to low levels of activity in the brain and spleen, as well as undetectable MCD activity in duodenum, untransfected 293 cells and RSV-βgal transfected 293 cells Is shown. The tissue distribution of MCD mRNA (FIG. 15) did not closely correspond to the measured enzyme activity.
This discrepancy may be due to differences in the translation control of the MCD gene between tissues.

Another consideration is the possibility that MCD is an allosteric enzyme that is regulated by covalent modification, and that there is a difference between tissues in how MCD is phosphorylated. Consistent with this notion, the rat MCD sequence contains numerous potential phosphorylation sites, and treatment of tissue extracts with alkaline phosphatase prior to activity measurement resulted in increased MCD activity.

[Brief description of the drawings]

FIG. 1 shows the biochemical properties of rat liver malonyl CoA decarboxylase (MCD). (A) is a representative photograph showing immunoblot analysis of rat liver MCD (non-denaturing polyacrylamide gel electrophoresis: lane 1) and SDS-polyacrylamide gel electrophoresis: lane 2), and anti-MCD antibody and irrelevant Anti-catalase antibody: lane 3)). (B) is a representative photograph of immunoblot analysis using an anti-MCD antibody, comparing MCDs derived from rat liver (lane 1) and rat heart (lane 2).

FIG. 2 is a graph showing malonyl-CoA decarboxylase activity in 1- and 7-day-old rabbit hearts. Values are the mean ± SE (standard error) of eight hearts from both age rabbits
It is.

FIG. 3 is a graph showing malonyl-CoA decarboxylase activity in aerobic, ischemic and reperfused hearts of rats. The numerical value is the mean ± SE of 5 to 10 hearts in each group.

FIG. 4 is a representative photograph of an immunoblot analysis using an anti-MCD antibody, showing the levels of malonyl-CoA carboxylase protein in aerobic, ischemic and reperfused ischemic hearts of rats.

FIG. 5 shows (A) neonatal heart and (B) 5′AMP-activated protein kinase (AMPK), acetyl-CoA carboxylase (ACC), and malonyl-CoA decarboxylase (ACC) in regulating fatty acid oxidation in reperfused ischemic heart 3 is a diagram showing the role of MCD). (A) shows that both AMPK and MCD are activated in the neonatal period, and (B) shows that ischemia activates AMPK while MCD activity is maintained.

FIG. 6 shows a DNA sequence encoding rat heart malonyl CoA decarboxylase (SEQ ID NO: 1).
D NO.1) is shown.

FIG. 7 shows the chromatographic purification of rat liver malonyl CoA decarboxylase. 40-50% of a (NH ₄₎ mitochondrial protein precipitation with ₂ SO ₄ Butyl Sepharos
It poured into e 650 M column and eluted with a gradient of _{(NH 4) 2 SO 4 1~0} M. (A) shows that the fractions containing MCD activity were pooled and injected on a Phenyl Sepharose HP column, and the protein was eluted with the same concentration gradient as above. (B) shows chromatography on a Q Sepharose HP column. (C) shows the chromatography with SP Sepharose HP column. (D) Run 7B and 7C to bind the bound proteins to NaCl 0-0.3 M and 0, respectively.
Elution was performed with a concentration gradient of 0.40.4 M. MCD activity is expressed as changes in relative fluorescence units (RFU) per minute and is not normalized to protein concentration.

FIG. 8 shows the DNA sequence encoding rat liver malonyl CoA decarboxylase (SEQ
D NO.2).

FIG. 9 shows the reaction characteristics of purified rat liver malonyl CoA decarboxylase. 9A shows the effect of malonyl-CoA concentration on the activity of purified rat liver MCD (expressed as% of maximum MCD activity), and 9B shows the effect of changes in assay buffer pH on MCD activity.

FIG. 10 shows the properties of a malonyl-CoA decarboxylase antibody. (A) Polyclonal antibodies against rat liver MCD were tested using protein from rat liver mitochondrial fraction. MCD 239 antibody (lane 1) recognized only MCD, but MCD240
The antibody (lane 2) recognized both catalase and MCD. MCD and catalase are shown on the left. (B) An immunosuppression test was performed using both MCD antibodies. MCD activity was measured on MCD antibodies or pre-immune serum mixtures and expressed as% of MCD pre-cultured without serum for the same period (30 minutes).

FIG. 11 shows the tissue distribution and cell localization of malonyl-CoA decarboxylase. (
A) MCD240 antibody was used to measure protein levels of MCD in various rat tissues. 150 μg heart (lane 1), skeletal muscle (lane 2), liver (lane 3), kidney (lane 4), lung (lane 5), pancreas (lane 6), brain (lane 7) tissue with 2% SDS
Boiled in gel loading buffer and subjected to Western analysis. (B) The localization of MCD cells in McArdle RH7777 rat hepatoma cells was determined using double label immunocytochemistry. Colocalization was examined (Box 3) by combining the image from the MCD239 antibody (Box 1) and the image from the anti-Hsp60 antibody (Box 2). Similarly, images from the MCD240 antibody and images from Mito-Tracker Red CMXRos (Box 6) were combined to determine co-localization (Box 7).

FIG. 12 shows rat liver malonyl-CoA decarboxylase activity and protein levels of control rats and 6-week-old streptozotocin-treated rats. MCD activity on rat liver from 6-week-old control rats and 6-week-old streptozotocin-treated rats (
A) and MCD protein (B) were quantified. MCD protein is included in the bottom panel of each group, and catalase protein levels are included in the top panel as loading and transfer controls. The Western blot was subjected to densitometric analysis to quantify MCD protein levels (C).

FIG. 13 shows rat liver malonyl-CoA decarboxylase activity and protein levels in control and JCA: LA obese rats. MCD activity (A) and MCD protein (B) were quantified in rat livers derived from lean control rats and JCR: LA obese (Cp / Cp) rats. MCD protein is included in the bottom panel of each group, and catalase protein levels are included in the top panel as loading and transfer controls. The Western blot was subjected to densitometric analysis to quantify MCD protein levels (C).

FIG. 14 shows rat liver malonyl-CoA decarboxylase activity and protein levels of control, fasted, and re-fed rats. MCD activity (A) and MCD protein (B) were quantified in rat livers from control, fasted and re-fed rats. MCD protein is included in the bottom panel of each group, and catalase protein levels are included in the top panel as loading and transfer controls. The Western blot was subjected to densitometric analysis to quantify MCD protein levels (C).

FIG. 15 shows a DNA sequence encoding rat pancreatic malonyl-CoA decarboxylase (SEQ.
ID NO.3).

FIG. 16 shows Northern blot and RT-PCR analysis of MCD mRNA of various tissues. (A)
Is a northern blot analysis of various rat tissues using a rat MCD probe.
S ribosomal RNA cDNA fragment is used as RNA gel loading control. (B) shows ethidium bromide-stained agarose gel of an RT-PCR experiment performed with MCD primers (upper) and β-actin primer (lower) using total RNA isolated from various rat tissues and specific islet cells.

[Procedure amendment]

[Submission date] March 6, 2001 (2001.3.6)

[Procedure amendment 2]

[Document name to be amended] Drawing

[Correction target item name] Fig. 1

[Correction method] Change

[Correction contents]

FIG.

[Procedure amendment 3]

[Document name to be amended] Drawing

[Correction target item name] Fig. 2

[Correction method] Change

[Correction contents]

FIG. 2

[Procedure amendment 4]

[Document name to be amended] Drawing

[Correction target item name] Figure 3

[Correction method] Change

[Correction contents]

FIG. 3

[Procedure amendment 5]

[Document name to be amended] Drawing

[Correction target item name] Fig. 5

[Correction method] Change

[Correction contents]

FIG. 5

[Procedure amendment 6]

[Document name to be amended] Drawing

[Correction target item name] Fig. 6

[Correction method] Change

[Correction contents]

FIG. 6

[Procedure amendment 7]

[Document name to be amended] Drawing

[Correction target item name] Fig. 7

[Correction method] Change

[Correction contents]

FIG. 7

[Procedure amendment 8]

[Document name to be amended] Drawing

[Correction target item name] Fig. 8

[Correction method] Change

[Correction contents]

FIG. 8

[Procedure amendment 9]

[Document name to be amended] Drawing

[Correction target item name] Fig. 9

[Correction method] Change

[Correction contents]

FIG. 9

[Procedure amendment 10]

[Document name to be amended] Drawing

[Correction target item name] FIG.

[Correction method] Change

[Correction contents]

FIG. 10

[Procedure amendment 11]

[Document name to be amended] Drawing

[Correction target item name] FIG.

[Correction method] Change

[Correction contents]

FIG.

[Procedure amendment 12]

[Document name to be amended] Drawing

[Correction target item name] FIG.

[Correction method] Change

[Correction contents]

FIG. 13

[Procedure amendment 13]

[Document name to be amended] Drawing

[Correction target item name] FIG.

[Correction method] Change

[Correction contents]

FIG. 14

[Procedure amendment 14]

[Document name to be amended] Drawing

[Correction target item name] FIG.

[Correction method] Change

[Correction contents]

FIG.

[Procedure amendment 15]

[Document name to be amended] Drawing

[Correction target item name] FIG.

[Correction method] Change

[Correction contents]

FIG. 16

──────────────────────────────────────────────────の Continuation of front page (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE ), AU, CA, JP, KR, US (72) Inventors Ropastuk, Gary Dee. Alberta Tea 6G 1H4, Edmonton, Promontory Point 9 Canada 72 Inventor Dick, Jason Alberta Tea 8G 1A4, Sherwood Park, Range Road 52122 # 210, Callebo Estates 217F Terms (reference) 4B024 AA01 AA11 BA07 CA04 EA04 GA11 HA01 HA11 4B050 CC03 DD11 LL03 4B063 QA19 QQ02 QQ38 QR32 QR41 QS03 QS32 4H045 AA11 CA40 DA75 EA50 FA74

Claims (25)

[Claims] 1. A compound screening method comprising the steps of: a) i) providing a purified preparation comprising malonyl-CoA decarboxylase, ii) a substrate, and iii) a test compound; b) Mixing the malonyl-CoA decarboxylase and the substrate in the presence or absence of the test compound under conditions such that the malonyl-CoA decarboxylase can act on the substrate to produce a product; and c. ) Directly or indirectly measuring the amount of said product produced in the presence or absence of said test compound. 2. The method according to claim 1, wherein the substrate is malonyl-CoA. 3. The method of claim 1, wherein said preparation is purified from heart tissue. 4. The method of claim 1, wherein said product comprises acetyl-CoA. 5. The method according to claim 4, wherein said acetyl-CoA is measured directly. 6. The method according to claim 4, wherein acetyl-CoA is measured indirectly by detecting the magnitude of the indicator. 7. The method of claim 6, wherein the indicator is citrate. 8. The method according to claim 7, wherein citrate is indexed. 9. The method of claim 8, wherein the citrate is labeled with a radioisotope. 10. The method according to claim 9, wherein the citrate labeled with a radioisotope is [ ¹⁴ C] citrate. 11. A compound screening method comprising the steps of: a) i) a malonyl-CoA decarboxylase homolog, ii) a substrate, and iii) providing a test compound; b) said malonyl-CoA decarboxylase homolog. And the substrate, the malonyl C
mixing in the presence or absence of the test compound under conditions such that the oA decarboxylase homolog can act on the substrate to produce a product; and c) in the presence or absence of the test compound. Measuring, directly or indirectly, the amount of said product produced in. 12. The method according to claim 11, wherein said substrate is malonyl-CoA. 13. The method of claim 11, wherein said homologue differs from malonyl-CoA decarboxylase purified from heart tissue by amino acid substitution. 14. The method of claim 11, wherein said product comprises acetyl-CoA. 15. The method according to claim 14, wherein said acetyl-CoA is measured directly. 16. The method of claim 14, wherein said acetyl-CoA is measured indirectly by detecting an amount of said indicator. 17. The method of claim 16, wherein said indicator comprises citrate. 18. The method according to claim 17, wherein said citrate is indexed. 19. The method of claim 18, wherein said citrate is labeled with a radioisotope. 20. The citrate labeled with a radioisotope is [ ¹⁴ C]
20. The method according to claim 19, which is a citrate. 21. A composition comprising isolated and purified DNA having an oligonucleotide sequence selected from the group consisting of: a) a cardiac MCD having the nucleotide sequence of SEQ ID NO: 1; b) Liver MCD having the nucleotide sequence of SEQ ID NO: 2; c) pancreatic MCD having the nucleotide sequence of SEQ ID NO: 3. 22. An RNA transcribed from the DNA according to claim 21. 23. A protein translated from the RNA according to claim 22. 24. An antibody produced from the protein according to claim 23. 25. An expression construct comprising the DNA according to claim 21.