JP2002519008A - Methods for inhibiting TEF-3 activity - Google Patents

Abstract

  (57) [Summary] The present invention provides a method for screening for an inhibitor of TEF-3 activity in vivo or in vitro. The invention further provides a method for identifying a TEF-3 interacting activator. The present invention still further provides methods of treating matrix metalloproteinase-mediated diseases, including musculoskeletal and myocardial and growth-related skeletal diseases.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001] This application is filed under US Code Title 35, 119 (e), June 30, 1998.
Claims the priority of provisional application No. 60 / 091,318 filed on the date of this publication.

TECHNICAL FIELD The present invention relates to proteins, TEF-3, fragments, variants, and splice variants thereof, their use in screening for inhibitors of TEF-3 activity, deformability characterized by upregulation of matrix metalloproteases. The present invention relates to treatment of diseases including arthropathy and the like.

BACKGROUND [0003] Gene transcription is the result of the binding and activity of a wide variety of proteins known as transcription factors. These factors bind to the promoter / enhancer region of the gene. Gene activity is modulated by a mix of transcription factors that bind to a particular promoter, the abundance of transcription factors, and the degree of post-translational modification to transcription factors. These modifications include covalent modifications, ligand binding, phosphorylation, dephosphorylation, and proteolytic cleavage. Various transcription factors linked to a gene promoter must interact with each other to modulate gene activity. Inhibiting the activity of one or more transcription factors is an effective means of inhibiting gene activity and therefore
Increased gene expression is an attractive therapeutic intervention point for treating related diseases.

[0004] Transcriptional enhancer factors (TEFs) are a family of transcription factors that regulate tissue-specific gene expression. For example, the expression of cardiac myosin heavy chain is dependent on TEF-1 (Gupta, MP et al., Mole. Cell. Biochem. (19)
96) 157: 117-124), and expression of skeletal muscle myosin heavy chain
R-1 (Yockey, CE et al., J. Biol. Chem. (1)
996) 271 (7): 3727-3736). The expression of certain TEFs is highest in heart, skeletal muscle, and lung.

[0005] Most pathological conditions are characterized by alterations in gene expression, often as a result of altered gene transcription. Genes are switched on or off (
turned on of off) or up-regulated or down-regulated. For example, many forms of cancer are characterized by increased expression of so-called one or more oncogenes (oncogenes). Similarly, osteoarthritis (OA) is characterized by increased transcription of matrix metalloproteases (MMPs).

[0006] The expression of many enzymes that affect the destruction of structural proteins is regulated by transcription factors. These include several structurally related metalloproteases, including human dermal fibroblast collagenase, human dermal fibroblast gelatinase, human sputum collagenase and gelatinase, and MMP-3. These and other related enzymes are described in Rheumatoid Arthritis (Mullins, DE et al., Bioche).
m Biophys Acta (1983) 695: 117-214); Osteoarthritis (Henderson, B. et al., Drugs of the Futur.
e (1990) 15: 495-508); tumor cell translocation (ibid., Broadhu).
rst, M .; J. Et al., European Patent Application 276,436 (issued 1987), Rei.
ch, R.C. Et al., 48 Cancer Res. 3307-3312 (1988)
And is important in mediating the symptomatic manifestations of many diseases, including various ulcer conditions such as Crohn's disease and ulcerative cornea.

[0007] The matrix metalloprotease (MMP) family consists of matrix-degrading proteases that share sequence homology and common structural domains between members. Generally, these enzymes are expressed at low levels and are secreted as zymogens. Upon activation, MMPs can degrade various extracellular matrix (ECM) components, thus providing not only degradation but also matrix remodeling when improperly activated.

[0008] MMPs are used for primary osteoarthritis (OA), secondary OA, rheumatoid arthritis (RA)
Leads to cartilage destruction in degenerative diseases of hyaline cartilage such as ankylosing spondylitis, gouty arthritis, inflammatory arthritis, Lyme disease, and other arthropathy. For example, osteoarthritis is a slowly progressive degenerative disease of the synovial joint. The disease is characterized by destruction of articular cartilage, resulting in deprivation of the joint surface and exposure of the underlying bone. The proximal mediator of cartilage degeneration is MMP. Many studies indicate that the MMP gene is up-regulated in OA at both mRNA and protein levels. Inhibition of MMP gene transcription inhibits articular cartilage destruction and is effective in treating OA and other joint diseases characterized by loss of articular cartilage. Thus, an effective therapy would inhibit the up-regulation of MMPs at the transcriptional level.

SUMMARY OF THE INVENTION The present invention provides a method for screening for a TEF-3 activity inhibitor in vivo or in vitro. The invention further provides a method for identifying a TEF-3 interactor. The present invention further provides musculoskeletal systems, as well as growth-related skeletal disorders,
And methods for treating matrix metalloproteinase-mediated diseases, including diseases of the myocardium.

DETAILED DESCRIPTION OF THE INVENTION Surprisingly, TEF-3 is a member of the TEF family of transcription factors.
(Once called CSTF-1) is expressed in articular chondrocytes. Even more surprising is that TEF-3 is a matrix metalloprotease (MMP) gene, in particular collagenase-1 (MMP-1), stromelysin-1 (MMP-3).
), And part of the transcription machinery for the expression of collagenase-3 (MMP-13).

[0011] Reducing the level of MMPs produced by chondrocytes is believed to reduce the rate of cartilage destruction, and thus is effective in treating or preventing OA and other arthropathy. Inhibiting TEF-3 activity is further believed to reduce the level of MMPs produced by chondrocytes. Therefore, the present invention is directed to a screening method for pharmaceutically active compounds that inhibit TEF-3 activity. The present invention is further directed to a method of treating or preventing osteoarthritis and other diseases of hyaline cartilage by administering a TEF-3 activity inhibitor.

Definitions and Usage of Terms “Antibody” refers to an antibody or fragment thereof that is elevated or active against TEF-3, a fragment thereof, a variant thereof, or a splice variant thereof. These may be monoclonal or polyclonal. Antibodies may be from any of several animals (preferably rabbits, mice, horses or goats) and / or from sources (preferably serum for polyclonal antibodies and spleen for monoclonal antibodies). Antibodies can be modified in primary sequence using methods known in the art, but still retain activity against TEF-3. All such modifications are contemplated by the term "antibody."

“Antisense” refers to a DNA sequence that is complementary to an mRNA sequence or its corresponding DNA sequence.

“CDNA” or “complementary DNA” refers to the reverse transcription of RNA, particularly mRNA,
And the sequence is complementary to the coding strand of the DNA.

“Chondrocyte-like cells” refers to established tissue culture cell lines that maintain the phenotypic characteristics of primary chondrocytes. Chondrocyte-like cells are produced from primary isolates of chondrocytes or are derived from tumor cell lines.

A “compound” is a small molecule, peptide, or antibody that appears to inhibit TEF-3 activity.

“Coding region” refers to a segment of mRNA or DNA whose protein sequence is encoded by a genetic codon as defined in the art.

“Compound screen” refers to methods and screens for: (1) discovering compounds that inhibit TEF-3 activity, (2) detecting compounds against TEF-3 or other related proteins. Measuring affinity and (3) designing or selecting compounds based on screens. Compound screening involves the use of high-throughput screening methods. Compound screens preferably further include the use of three-dimensional structures for drug design known in the art as "rational drug design." The use of such screening methods assists the skilled artisan in finding new structures, whether synthesized by chemists or natural, that inhibit TEF-3 activity.

“DNA” or “DNA molecule” refers to a polymerized form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in single-stranded or double-stranded helical form, and can be either a linear or cyclic molecule. Can be According to the usual rules, the DNA sequence is given in the 5 'to 3' direction, upstream in the 5 'direction, 3'
Is called downstream.

A “fusion” is two coding sequences (operatively linked together at the DNA level)
(Encoding a hybrid protein contributed by both coding sequences). "Fusion protein" thus refers to such a hybrid protein.

A “gene” is a segment of DNA involved in producing a polypeptide chain, including regions before and after the protein coding region, as well as intervening sequences (introns) between individual coding segments (exons). is there.

A “homolog” is a protein sequence exhibiting at least 90% identity to SEQ ID NO: 2 or a D sequence having at least 90% identity to SEQ ID NO: 1.
Refers to the NA sequence.

“TEF-3 activity inhibitor” or “TEF-3 inhibitor” refers to a small molecule, peptide, or antibody that inhibits TEF-3 activity. TEF-3 activity inhibitors are believed to be useful in inhibiting the expression of matrix metalloproteases in chondrocytes and other cell types, thereby inhibiting extracellular matrix remodeling and / or degradation.

[0024] "Messenger RNA (mRNA)" is an
A is a single-stranded polymeric ribonucleotide sequence generally generated from A, the nucleotide sequence of which corresponds to the sequence of amino acids encoding the protein.

“MMP-3” is human stromelysin-1 (GenBank accession number P
08254) (EC 3.4.24.17).

“Oligonucleotide” is defined as a short form of a DNA molecule consisting of at least two, and preferably less than 100, deoxyribonucleotides. Oligonucleotides can be single-stranded or double-stranded.

“Primer” refers to an oligonucleotide, derived from a natural source or produced synthetically, that can act as a starting point for DNA synthesis due to a sequence complementary to the DNA being synthesized.

“Peptide” refers to a protein of less than 100 amino acid residues as defined in the art.

A “promoter fragment” is a DNA regulatory region of a gene that can bind to RNA polymerase and other transcription factors and initiate transcription. "DN
An "A recognition element" is often found in a DNA sequence or gene promoter, which is a protein binding site, and often refers to a "motif" that binds to a transcription factor. A promoter can include one or more DNA recognition sequences or cis-acting elements. Promoters are often located numerically near the start and end nucleotide positions, assuming that the transcription start site is zero. By convention, nucleotides located 5 'upstream of 0 are given negative coordinates in descending order, and nucleotides downstream from 0 are given positive numbering in ascending order.

“Promoter / reporter gene” refers to a recombinant gene comprising a gene promoter DNA fragment linked to a cDNA encoding a protein whose activity can be measured. Preferred cDNAs are luciferase and beta-galactosidase. "TEF-3 responsive promoter / reporter gene" refers to a promoter / reporter gene, wherein a promoter DNA fragment binds to TEF-3 and increases transcription of the reporter cDNA.

“Small molecule” refers to a chemical entity produced by synthetic or natural methods having a molecular weight of 1000 Daltons or less.

“Splice variant” refers to an mRNA or protein product resulting from the alternative use of mRNA introns and exons. "Splice variants" can occur in various individuals, tissues, or species. These can be detected by various methods, such as bands of various molecular weights detected on Northern or Western blots. Thus, the 2.5 kb, 3.5 kb and 9 kb TEF-3 mRNAs are expected to have certain variants found in subpopulations of organisms or in certain tissues of organisms. Such splice variants often retain their activity and differ only in molecular weight due to having amino acids inserted into or deleted from the native sequence, as found in SEQ ID NO: 2. is there. Such splice variants may exist even between tissues of the same organism. Furthermore, without being bound by theory, such splice variants may also affect the regulation of biological cascades. For example, TEF-3 variants that are preferentially expressed in chondrocytes are responsible for regulating specific matrix metalloproteases such as MMP-3, as opposed to those found in other parts of the body (such as skeletal muscle). It is particularly effective, and indeed certain variants may downregulate MMP-3. Where such changes in activity are seen, the variant gene is preferred for antisense gene therapy. Specific variants may be useful for antisense gene therapy.

“TEF-3” refers to the protein identified by SEQ ID NO: 2, a fragment thereof, a homologue thereof, a variant thereof, or a splice variant thereof. Preferably, TEF-3 is from a human source. Without being bound by theory, TEF
-3 regulates the expression of the matrix metalloprotease gene in certain tissues.

“TEF-3 activity” refers to the ability of TEF-3 to bind to its DNA recognition sequence by itself or in combination with its interactors and / or to modulate the transcription of a TEF-3-responsive gene. Point out.

“TEF-3 DNA recognition element” refers to the DNA sequence TTTGGAATG found in the TEF-3 responsive gene promoter.

“TEF-3 interacting factor (TIF)” interacts with TEF-3,
-3 refers to a protein, a fragment thereof, a homologue thereof, a variant thereof, or a splice variant, which contributes to the activity.

“TEF-3 responsive gene” refers to a gene whose promoter contains a TEF-3 binding site, the expression of which is regulated by TEF-3.

“Transcription factors” are proteins capable of modulating mRNA synthesis during transcription due to interactions with DNA promoter sequences and transcription machinery.

Screening Method for TEF-3 Activity Inhibitor The present invention can be used to find a TEF-3 activity inhibitor. Therefore, it is useful as a screening tool for rational drug design.
Similarly, inhibitors of TEF-3 activity can be found by conventional random drug screening methods that assay the ability of the compound to bind and / or inhibit the activity of TEF-3. The use of high-throughput screening methods and the use of combinatorial compound libraries (both synthetic and natural) are also contemplated by the present invention.

[0040] TEF-3 inhibitors can also be found in cell-based inhibitor assays using a TEF-3 responsive promoter / reporter gene. Vectors constituting such promoter / reporter genes are well known in the art.

For example, the D of the MMP-3 promoter containing nucleotides +13 to -486
The NA fragment (GenBank accession number U56422) was added to the luciferase cDNA in the vector by adding the MMP-3 promoter to the luciferase cDN in the cells.
Link in the appropriate frame and orientation to direct expression of A. The MMP-3 promoter / reporter gene is transfected into SW1353 cells under conditions that promote retention of the MMP-3 promoter / reporter gene in the cell. Cells are plated in 96-well plates and incubated with compounds.
After 16 hours, the cells are lysed and the inhibitory activity of the compound is measured by observing a decrease in luciferase activity using techniques known in the art.

TEF-3 itself can be used to measure the binding of a compound to a protein. Drug screening using protein targets is used in the art, and automated high-throughput techniques can also be used. In screening, compounds can be used to determine both the quality and amount of inhibition. As a result, the screen provides information for the selection of useful actives, preferably small molecule actives, for treating the disease. For example, compounds that bind to TEF-3 can be screened directly by attaching TEF-3 to an affinity matrix using chemical crosslinking methods known in the art. A labeled compound (eg, radiolabeled, biotin-labeled, etc.) is added to the bound TEF-3 and the extent of binding is measured using standard techniques. Alternatively, compounds and known TEF-3
A binding molecule (eg, TIF, small molecule, antibody, DNA fragment, etc.)
Compound binding can be measured using a competition assay that competes for -3 binding.

Furthermore, it will be appreciated by those skilled in the art that the TEF-3 fragment can be used for screening, especially for high throughput screening, drug design, etc., and that the entire protein is not required for the purpose of using the present invention for screening. It will be obvious.
Thus, the disclosure of the protein and its use is clearly contemplated by those skilled in the art to understand useful fragments of the protein. Such fragments are also useful for determining the active site, such as DNA binding, phosphorylation, epitope formation, binding sites for proteins and other factors, and are generally useful for rational drug design and TEF-3 structure determination, respectively. It is.

Practical considerations such as protein expression, purification, yield, stability, solubility, etc., are taken into account by those skilled in the art when selecting whether to use fragments and when selecting which fragments to use. For example, soluble fragments are preferred because they are easy to reference and handle. Thus, a "soluble fragment" is one that does not readily precipitate when using, for example, an ELISA or other screening procedure, but retains its activity. These are known to other proteins,
Finding useful fragments by digestion or other means is within the skill of the art. Consequently, using routine operations in the art, those skilled in the art can also practice the present invention using fragments of TEF-3 according to the disclosure herein. In particular, soluble fragments of TEF-3 are contemplated in this sense and are suitable for large scale production and separation.

[0045] TEF-3 has been speculated to interact with other cofactors for tissue specific activity. Such cofactors are referred to herein as TEF-3 interactors (T
IF). Identification of TIF offers another method of inhibiting TEF-3 activity. Many effective methods using the TEF-3 DNA sequence or its recombinant protein can separate and identify these TIFs. For example, cellular proteins bound to a cDNA expression library or a support material with a labeled (eg, radiolabeled, biotin-labeled) TEF-3 protein can be directly screened. Another example is detecting protein-protein interactions with a yeast two-hybrid screening system. In a yeast two-hybrid approach, the TEF-3 cDNA is fused to the DNA binding (DB) domain of a known transcription factor to form a bait. C from the desired tissue
The random library of DNA binds to a prey construct that contains the activation domain (AD) of the transcription factor. When feed and prey are present and interact in the same cell, DB and AD are in close proximity, activating the reporter gene. By affinity chromatography, the TEF-3 protein itself, or an antibody raised against the TEF-3 protein, or a DNA fragment containing the TEF-3 binding site is immobilized on a solid matrix by various standard chemical or physical methods. Interacting factors can also be separated. Protein extracts from the desired cells or tissues can pass through the matrix and retain the TEF-3 interactor. A similar approach can be taken for solutions, where the solution phase T
Using EF-3, a factor bound to TEF-3 can be immunoprecipitated with a TEF-3-specific antibody.

Method for Treating Disease by Inhibiting TEF-3 Activity In one embodiment of the present invention, there is provided a method for treating an MMP-mediated disease by administering a TEF-3 activity inhibitor to a subject. "Subject" refers to a human or other mammal that has or is at risk of having an MMP-mediated disease. A TEF-3 activity inhibitor is administered to the subject in a safe and effective amount. As used herein, a "safe and effective amount" is sufficient to induce a positive change in the condition being treated, within sound medical judgment, but to avoid serious side effects. Means an amount of the inhibitor sufficiently small (at a reasonable benefit / risk ratio). A safe and effective amount of the inhibitor will be within the knowledge and experience of the attending physician, depending on the particular condition being treated, the age and physical condition of the patient being treated, the severity of the condition, the duration of the treatment, the nature of the combination And the particular pharmaceutically acceptable carrier employed.

As used herein, “MMP-mediated disease” involves unwanted or elevated MMP activity in the manifestation of a biological manifestation of a disease, in a biological cascade leading to the disease, or as a symptom of the disease. It is a disease that does. Thus, “involvement” of MMPs includes: Unwanted or elevated M as a "cause" of a disease or biological manifestation
MP activity wherein the activity is increased genetically, by infection, by autoimmunity, by trauma, by a biomechanical cause, by lifestyle (eg, obesity), or by another cause. 2. MMP as part of the observable manifestation of the disease. That is, the increased MM
Disease can be measured in terms of P activity. Unnecessary or elevated MM from a clinical point of view
2. P levels indicate disease, but MMP need not be "proof" of disease; or Unwanted or elevated MMP activity causes disease or is part of a biochemical or cellular cascade that is associated with disease. In this regard, inhibition of MMP activity disrupts the cascade and thus regulates disease.

[0048] TEF-3 activity can be inhibited by several methods. The details are shown below. Small molecules and / or peptides In a preferred embodiment of the invention, inhibition of TEF-3 activity is achieved by administering an inhibitor that prevents TEF-3 from binding to the MMP promoter gene and thereby prevents transcription. Is done. Such inhibitors include small molecules and / or peptides that bind to a DNA binding site on the MMP promoter gene,
Prevent TEF-3 from binding to the site. Other inhibitors include small molecules and / or peptides that bind to the TEF-3 protein itself and prevent TEF-3 from binding to the MMP promoter fragment.

In another embodiment of the invention, inhibition of TEF-3 activity is achieved by administering a small molecule or peptide that interferes with the binding of TEF-3 to TIF, thereby preventing transcription. Such inhibitors include small molecules and / or peptides that bind to TEF-3 or TIF.

Antibodies to TEF-3 Antibodies to TEF-3, both monoclonal and polyclonal,
-3 is useful for detecting -3 and therefore has several useful purposes. These include detection of TEF-3 up-regulation in disease, therapeutic treatment of diseases involving TEF-3, purification of TEF-3, delivery of therapeutic agents to TEF-3 and delivery of molecules to TEF-3. Includes the development of drag screens for binding.

For the purpose of purifying TEF-3, the antibodies of the invention can be used for immunoprecipitation, or are preferably conjugated to a solid support. These conjugates are TEF-3
Can be used as an affinity reagent for purification of. For example, these antibodies, when conjugated to a suitable chromatography material, are useful for separating TEF-3. Separation methods using affinity chromatography are known in the art and are within the purview of those skilled in the art.

In developing drug screens for binding molecules to TEF-3, antibodies can be used to provide information about the epitope on TEF-3 that is targeted. Antibodies can be used to identify TEF-3 sites essential for activity,
Therefore, it is useful for designing a TEF-3 inhibitor. For example, TEF-3
Antibodies that can be used to identify the above DNA binding sites are useful in a similar manner. In addition, there are domains on TEF-3 that appear to interact with other transcriptional promoters or inhibitors required to regulate gene promoter activity. The utility of designing molecules that effectively disrupt or prevent this interaction will be apparent to those skilled in the art. Such a strategy provides a highly specific agent that promotes or inhibits gene expression.

In addition, the antibodies of the present invention are useful in Western blots and other identification techniques, and are therefore useful in ELISAs, capture assays, sandwich assays, scintillation proximity assays, and the like.

For the purpose of detecting TEF-3 up-regulation in disease, the antibodies of the invention are conjugated directly to a label. Articular cartilage biopsy samples are collected during arthroscopic surgery and subjected to histological analysis commonly used in the art. The histological section is reacted with the labeled TEF-3 antibody using standard techniques. High levels of antibody binding indicate TEF-3 up-regulation.

Without being bound by theory, the expression of genes, including the genes of the present invention, has a restricted tissue distribution, the expression of which is up-regulated by potential osteoarthritis mediators. For example, expression of this gene in articular chondrocytes (
Thus, an increase in that protein) provides markers to monitor development, including the earliest asymptomatic stages, and the progression of osteoarthritis. Thus, antibodies raised for TEF-3 serve as screening tools for such increased expression, indicative of disease.

Antibodies can, for example, inject TEF-3, a TEF-3 variant, or a fragment of TEF-3 into a suitable subject (eg, a mammal), including a mouse, rabbit, goat, horse, and the like. . TEF-3, variant, or fragment is conjugated to a hapten to enhance its antigenicity. A preferred protocol involves repeated injections of the immunogen in the presence of an adjuvant according to a schedule that enhances the production of antibodies in serum. The titer of the immune serum can now be readily determined using immunoassay procedures standard in the art.

Using the resulting antisera directly or harvesting peripheral blood lymphocytes or spleen cells of the immunized animal, and immortalizing the antibody-producing cells, and then using appropriate immunoassay techniques By identifying an antibody producer, a monoclonal antibody can be obtained.

Without being bound by gene therapy theory, it is believed that TEF-3 is up-regulated in tissues during osteoarthritis. If up-regulation is responsible for the development of osteoarthritis, those skilled in the art will recognize that blocking the activity of this gene will be useful in treating osteoarthritis.
This is done by several methods, including gene (ie, antisense) therapy.

For example, use of the MMP-3 gene as a model indicates that transcription of the MMP gene in chondrocytes of articular cartilage is dependent on the transcription factor, TEF-3. Inhibition of TEF-3 activity by mutation of the promoter binding site or its expression by a TEF-3 antisense oligonucleotide causes a decrease in MMP-3 expression in chondrocytes in vitro. TEF-3 activity is determined by gene transfer technology.
It can be inhibited by overexpression of EF-3. This induces “squelching” of the transcriptional activity, thereby inhibiting or reducing the expression of the TEF-3 responsive gene. Similarly, the introduction of a variant form of TEF-3 can inhibit the activity of a TEF-3-responsive gene by inducing a dominant negative phenotype.

Thus, the present invention provides (a) cloning the TEF-3 cDNA into an expression vector in the appropriate frame and orientation for expression in cells; (b) packaging the expression vector into a suitable host virus (C) injecting the virus into the diseased area of the body; (d) incorporating the expression vector into the cells;
-3; and (e) observing reduced MMP expression due to transcriptional squelching.

Inhibition of TEF-3 activity provides an effective therapy for treating degenerative joint disease. This method makes use of currently available in vitro and explant techniques. For example, cells from degraded cartilage specimens (inside the joints of the knee, hip, etc.) are removed from the patient and manipulated in vitro using antisense technology with an adenovirus, etc., and current cartilage graft therapy is used. Return to patient in a similar manner. The patient can regenerate the degraded and lost cartilage in the affected joint.

Furthermore, overexpression of TEF-3 in vivo or in vitro, antisense TEF
Expression of -3, the variant TEF-3, is achieved using a tissue-specific promoter for expression of the recombinant gene. In the case of chondrocytes and articular cartilage, this is achieved using a collagen type II gene promoter.

Thus, the present invention provides (a) cloning the TEF-3 cDNA into an expression vector in a frame that is suitable for expression in cells, but in the reverse direction; and (b) packaging the expression vector into a suitable host virus. (C) injecting the virus into the diseased area of the body; (d) the cells take up the expression vector,
A method of treating or preventing a matrix metalloproteinase-mediated disease, comprising the steps of: expressing -3; and (e) observing a decrease in MMP expression due to antisense expression of the TEF-3 gene.

EXAMPLES The following non-limiting examples illustrate preferred embodiments of the present invention and briefly describe the use of the present invention. These examples are provided for guidance to those skilled in the art and do not limit the invention in any way. The disclosure and these examples enable one of ordinary skill in the art to make and use the claimed invention.

[0065] Standard starting materials are used in these examples. Many of these materials are known and are commercially available. For example, T4 polynucleotide kinase and λ
gt11 bacteriophage is a known material. Furthermore, Kunkel mutation and autoradiography are known techniques.

Variants can be made by various methods in expression systems and in various hosts. These methods are within the purview of those skilled in molecular biology, biochemistry, or other techniques related to biotechnology.

Example 1 Binding of a putative transcription factor to a gene promoter is conveniently identified by an electrophoretic mobility delay assay (EMRA). A double-stranded oligonucleotide homologous to the MMP-3 promoter was synthesized, using T4 polynucleotide kinase and α ³² P
End-labeled with ^[32 P] via reaction with -ATP. The radioactive oligonucleotide is incubated with nuclear extract proteins prepared from articular chondrocytes and / or other cell types. The DNA / protein complex formed as a result of the incubation is separated from unbound oligonucleotide by electrophoresis on a non-denaturing polyacrylamide gel. DNA / protein interactions can be visualized by exposure of the dried gel to x-ray film (autoradiography) or by a phosphoimager, or other imaging technique, as bands that migrate more slowly on the gel than unbound oligonucleotides. Is identified.

A DNA recognition element for a binding protein is identified using EMRA as described above. Double-stranded labeled oligonucleotides containing nucleotide mutations at the putative DNA binding site for the transcription factor are used as probes in EMRA. A positive result is a decrease in the binding site of the factor's DNA probe, as recorded by a decrease in the intensity of the binding signal on the autoradiograph. Alternatively, a competition assay can be used. The unlabeled oligonucleotide containing the putative binding sequence is included in the incubation of the labeled promoter fragment / nuclear extract mixture. Positive results are recorded as a decrease in signal on the autoradiogram.

The cDNA for the transcription factor that binds to the MMP-3 promoter fragment is a labeled promoter fragment containing the transcription factor binding site,
Bacterial recombinant cDNA expression library prepared using NA (λg
(t11 bacteriophage) can be cloned by screening. Bacteriophage containing cDNA that binds to the labeled DNA is purified by several steps in selecting positive clones, followed by replating and rescreening until all clones show a positive signal. The bacteriophage DNA carrying the transcription factor cDNA is purified and the cDNA insert is subcloned into a plasmid vector (pBlueScript) for propagation in E. coli. The nucleotide sequence of the cDNA is determined using standard techniques.

[0070] The amino acid sequence of the transcription factor is deduced from the nucleotide sequence of the cDNA clone. The amino acid sequence is used to prepare a synthetic peptide for monoclonal antibody production via standard techniques. A monoclonal antibody is used to confirm the DNA / protein binding interaction observed by EMRA. Antibodies are included in the labeled DNA / nuclear extraction incubation mixture. A positive result is recorded in the autoradiogram as a greater delay in the mobility of the labeled DNA fragment (a so-called "supershift").

The functional significance of transcription factor / DNA recognition element binding is determined by transfection of the MMP-3 promoter / luciferase reporter gene structure into chondrocytes. The promoter activity of the native MMP-3 promoter fragment is compared to a similar structure containing a mutation in the DNA recognition element for a transcription factor. A positive result is measured as a decrease in luciferase expression using the variant promoter (recorded as a decrease in luminescence).

Example 2 Inhibition of extracellular matrix remodeling is probed by inhibition of TEF-3 activity in vitro. Tissue integrity and proteoglycans are monitored using low molecular weight inhibitors of TEF-3 activity.

A sample of interleukin-1 stimulated bovine nasal cartilage is grown in a 1 μM solution of a low molecular weight inhibitor of TEF-3 activity. The experiment compares to the same culture grown without inhibitor as a control.

Assays of the cultures after 7 days show that the cultures with inhibitor show less tissue destruction and less proteoglycans present in the medium. The results are consistent with the inhibited MMP activity.

It is contemplated that similar assays using cells stimulated with retinoic acid, fibronectin, TGF-b or E. coli-LPS (lipopolysaccharide) will yield similar results.

Example 3 Cells known to transcribe the MMP gene are treated with a TEF-3 activity inhibitor. Control cells not treated with a TEF-3 activity inhibitor are compared. Protein released from cells is measured by standard methods. In particular, metalloprotease activity is monitored by literature methods. The amount of metalloprotease released is correlated (inversely proportional) to the amount of TEF-3 activity inhibitor used to treat the cell, or the amount of TEF-3 activity inhibitor used to treat the cell. Varies depending on the amount of

Example 4 TEF-3 binding is measured in mammalian chondrocyte cultures with small molecule TEF-3 inhibitors. Inhibition of TEF-3 involves a change in cell morphology associated with the interaction.
It results in inhibition of phenotypic changes. Binding is measured by a competition assay, using morphological cellular changes seen through a microscope. Inhibitors inhibit such cellular changes. There is no osteoarthritis phenotype characterized by increased matrix synthesis and enhanced matrix metalloprotease activity. The changes in gene expression and mitotic activity assayed are consistent with this result.

Example 5 Candidate inhibitors of TEF-3 gene expression are screened in vitro. Interleukin-1 stimulated normal human articular chondrocyte medium is exposed to a candidate inhibitor in vitro. MMP-3 RNA is isolated and reverse transcribed into cDNA. c
Polymerase chain reaction (DNA) using specific oligonucleotide primers
PCR) Amplify. PCR samples generated from both chondrocytes exposed to the inhibitor and uninhibited chondrocytes are electrophoresed on adjacent lanes of a polyacrylamide gel. The reduced level of the PCR product identifies the inhibitor.

Example 6 Method (DG Murry (1964) Arthritis Rheu. 7:
211-219) is monitored in mice. The experimental group was systemically administered 2 mg / kg of the TEF-3 inhibitor daily by oil bolus. The experimental group is more ambulatory and appears to recover from papain treatment. When a biopsy of the affected joint is performed, MMP-3 expression is extremely small as compared to the control group.

Similar results were obtained with iodoacetate treatment, or other chemically induced in vivo arthritis models, as well as meniscectomy, ligaments (anterior (cephalad) cruciate ligament, posterior cruciate ligament, medial ligament, lateral Surgical guidance models such as transection (including ligaments) are also expected. Any of the above can be used alone or in combination.

Example 7 Six spontaneous arthritic guinea pigs (Hartley) are treated with a TEF-3 inhibitor and monitored as in Example 6 with a control group. The experimental group moves around,
The control group is more restless. Similar results are expected in other similar animal models such as C57 black mice or aged Fisher rats.

[0082] Cartilage from these animals is removed and mRNA is prepared from the cells and reverse transcribed into cDNA. A low stringency P that provides a 20 base sense oligomer from base 311 to base 330 and a 20 base antisense oligomer from base 680 to base 699 to provide a fragment of homologous TEF-3 cDNA from guinea pigs.
Used in CR experiments.

Example 8 Generation of a 500 base pair (bp) fragment of the human MMP-3 promoter to a 150 bp fragment of the MMP-3 promoter containing +13 to -137 base pairs with BglII restriction endonuclease sites at both ends. As a template for PCR. The 5 'sense primer has the sequence GGGA
GATCTCTGCCTCCTTGTAGGTCCAACCTCGGGG and 3
'Antisense primer has the sequence AGATCTTGTATCATCCTACT
Has TTG. The PCR conditions were pre-thaw at 94 ° C for 3 minutes, followed by 25 cycles of 94 ° C for 30 seconds, 45 ° C for 30 seconds, and 72 ° C for 1 minute. Subsequently, at 72 ° C. for 8 minutes,
Then at 4 ° C. until a sample is obtained. PCR is achieved using the GeneAmp XL PCR kit (Perkin-Elmer). Using a BglII restriction site, this MMP-3 promoter fragment was converted to pGL using standard techniques.
Subcloning into a 2-Basic (Promega) luciferase expression vector. The MMP-3 promoter fragment is in the correct orientation and frame to direct luciferase expression in eukaryotic cells. This plasmid was then transferred to the human chondrosarcoma cell line SW1353 (ATCC) with the plasmid pcDNA3.1 / Zeo (In Vitrogen) containing the zeocin antibiotic resistance gene.
And co-transfection. Cells that stably incorporate the plasmid DNA are selected by culturing the cells in the presence of 600 μg / mL zeocin. Zeocin resistant SW1353 colonies are transferred to tissue culture flasks. L
The cells are tested for luciferase protein expression using the ucLite Reporter Gene Assay Kit (Packard).

Example 9 For the high-throughput screening of chemical libraries, stably transfected SW1353 cells were transferred to a 96-well tissue culture plate at 70% confluence (co
nfluence) and incubate at 37 ° C. for 24 hours. Then
The cells are cultured for an additional 16 hours in the presence of a test compound at a concentration of 10 μM. Cells are tested for reduced luciferase activity corresponding to control cells without compound using the LucLite Reporter Gene Assay Kit (Packard).

Example 10 Recombinant TEF-3 is produced in bacteria and purified. The full-length cDNA of TEF-3 with a BamHI restriction endonuclease site at the 5 'end and an EcoRI restriction endonuclease site at the 3' end is digested with these endonucleases. The plasmid expression vector pET32c (Novagen) is digested with the same restriction enzymes. Using the FastLink ligation system (Epicentre), the TEF-3 cDNA is ligated to the expression vector in the correct frame and orientation, and expressed using the gene promoter present in the plasmid. The plasmid is introduced into E. coli strain AD494 (DE3) (Novagen). Bacteria incorporating the plasmid DNA are selected by culturing the bacteria on agar plates containing the antibiotic ampicillin. Ampicillin-resistant bacteria grow on LB broth under standard laboratory conditions. TEF-3 expression is induced by adding 1 mM isopropylthiogalactoside (IPTG) to the culture broth. IPT
16 hours after G addition, the bacteria are harvested and TEF-3 is purified to homogeneity.

Example 11 Compounds are screened for TEF-3 inhibition by binding to TEF-3. Recombinant TEF-3 or chemically synthesized TEF-3 fragment is incubated in a solution containing 1 mg / ml of TEF-3 or TEF-3 fragment.
Allow to bind to 96-well polystyrene plate at room temperature for minutes. Unbound protein is removed by washing three times with phosphate buffered saline (PBS). Nonspecific binding sites are blocked by incubation with 1 mg / ml bovine serum albumin (BSA) containing PBS for 30 minutes at room temperature, followed by three washes with PBS. The radiolabeled compound at a concentration of 100 μM in PBS is added to the plate and incubated at room temperature for 30 minutes. The plate is washed three times with PBS and the amount of bound compound is determined by radioactive scintillation counting.

Example 12 Compounds are also screened for inhibition of TIF binding. Recombination TE
F-3 or a chemically synthesized fragment of TEF-3 was added to 1 mg / ml of TEF-3.
Alternatively, bind to a 96-well polystyrene plate at room temperature for 30 minutes in a solution containing the TEF-3 fragment. Unbound protein is removed by washing three times with PBS. Non-specific binding sites are blocked by incubation with 1 mg / ml BSA in PBS for 30 minutes at room temperature, followed by three washes with PBS. 100μ in PBS
g / ml with ³⁵ S-labeled recombinant TEF-3 TIF at 100 μg / ml
Test compounds are added to the plate at a concentration of ml and incubated for 30 minutes at room temperature. Wash plate 3 times with PBS. The amount of bound TIF is measured with a scintillation counter. The inhibition of TIF binding is determined by comparison to a control containing no test compound. Use medicinal chemistry to synthesize closely related analogs,
By retesting in the above assay, identified compounds that bind to TEF-3 are optimized for high affinity binding.

Example 13 Compounds are also screened for inhibition of TEF-3 antibody binding. Recombinant TEF-3 or chemically synthesized fragment of TEF-3 was added to 1 mg / ml T
Binding to 96-well polystyrene plates at room temperature for 30 minutes in a solution containing EF-3 or TEF-3 fragments. Unbound protein is removed by washing three times with PBS. Non-specific binding sites are blocked by incubation with 1 mg / ml BSA containing PBS for 30 minutes at room temperature, followed by three washes with PBS. 1 in PBS
The test compound is added to the plate at a concentration of 100 μg / ml together with the ³⁵ S-labeled TEF-3 antibody at a concentration of 00 μg / ml and incubated at room temperature for 30 minutes.
Wash plate 3 times with PBS. The amount of bound antibody is measured with a scintillation counter. The inhibition of TIF binding is determined by comparison to a control containing no test compound. Identified compounds that bind to TEF-3 are optimized for high affinity binding by retesting in the above assay using medicinal chemistry to synthesize closely related analogs.

Example 14 Compounds are also screened for inhibition of DNA binding to TEF-3. 1 mg / recombinant TEF-3 or chemically synthesized fragment of TEF-3
Binding to a 96-well polystyrene plate at room temperature for 30 minutes in a solution containing ml of TEF-3 or TEF-3 fragment. Unbound protein is removed by washing three times with phosphate buffered saline (PBS). Nonspecific binding sites are blocked by incubation with 1 mg / ml bovine serum albumin (BSA) containing PBS for 30 minutes at room temperature, followed by three washes with PBS. T at a concentration of 100 μg / ml in PBS
³⁵ S-labeled DNA containing EF-3 DNA recognition element TTTGGAATG
Add the test compound to the plate at a concentration of 100 μg / ml with the fragment,
Incubate for 30 minutes at room temperature. Wash plate 3 times with PBS. The amount of bound DNA fragment is measured with a scintillation counter. Inhibition of DNA fragment binding is determined by comparison to a control containing no test compound. Identified compounds that bind to TEF-3 are optimized for high affinity binding by retesting in the above assay using medicinal chemistry to synthesize closely related analogs.

Example 15 Price et al. (Arthritis and Rheumatism (199
9) Using bovine nasal cartilage as described in 42 (1): 137-147)
The ability of the compounds to slow the rate of interleukin-1 stimulated cartilage degradation in vitro is tested. 0, 1 ng / ml, 10 ng / ml, 100
Compounds are incubated with cartilage plugs at compound concentrations of ng / ml, 1 μg / ml, 10 μg / ml, and 100 μg / ml. Proteoglycan degradation and collagen degradation are measured as described above.

Example 16 Bendele and Hulman (Arthritis and Rheu
matism (1988) 31: 561-565).
The ability of compounds to slow the rate of cartilage degradation in vivo is tested using a model of spontaneous osteoarthritis in artley guinea pigs. The compound is 1, 10, once a day
And subcutaneous injection of the test compound in PBS at 100 mg / kg body weight for 6 months. Dosing is started to animals at 3 months of age. The cartilage degradation of the hind knee is measured as described above, as compared to control animals that received PBS injection only.

[0092] All documents mentioned herein are incorporated herein by reference.

While particular embodiments of the present invention have been described, it will be apparent to those skilled in the art that various changes and modifications can be made in the present invention without departing from the spirit and scope of the invention. It is intended that all such modifications falling within the scope of the invention be covered by the appended claims.

[Sequence list]

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C07K 16/18 C12Q 1/02 C12Q 1/02 1/68 1/68 G01N 33/15 Z G01N 33/15 33/50 Z 33/50 33/68 33/68 C12N 15/00 ZNAA (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, I T, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SL, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AE, AL, AM, AT, AU, AZ, A, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN , IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZA, ZWF terms (reference) 2G045 AA40 BB20 CB01 DA36 FB03 FB08 4B024 AA01 AA11 BA14 CA04 CA09 DA02 EA02 FA02 FA06 FA10 GA11 HA01 4B063 QA01 QQ08 QQ36 QR32 QR55 QS34 4C084 AA17 NA14 ZA962 ZC202 4H045 AA10 AA11 AA20 BA10 CA40 DA01 DA56 DA76 EA20

Claims (34)

[Claims] 1. A method for determining whether a compound is an inhibitor of TEF-3 activity, comprising: (a) containing a TEF-3 responsive gene containing a TEF-3-responsive gene promoter and a reporter cDNA; Culturing the cells; (b) incubating the cells with a sample of the compound; and (c) monitoring the cells for a response from the reporter. 2. The method according to claim 1, wherein the promoter fragment is derived from a matrix metalloprotease gene. 3. The method according to claim 2, wherein the promoter fragment is derived from the MMP-3 gene. 4. The method according to claim 3, wherein the cells are human chondrocytes or human chondrocyte-like cells. 5. The method according to claim 4, wherein the method is a high-throughput screening method. 6. The method according to claim 5, wherein the reporter cDNA encodes luciferase. 7. The method according to claim 6, wherein the human chondrocyte-like cell is SW1353. 8. The method according to claim 7, wherein the promoter fragment comprises nucleotides -1 to -150 of the MMP-3 gene. 9. The method according to claim 7, wherein the promoter fragment comprises nucleotides -1 to -499 of the MMP-3 gene. 10. A method for producing recombinant TEF-3 in a bacterium or eukaryotic cell, comprising: (a) generating a cDNA encoding TEF-3; and (b) placing the cDNA in an expression vector. (C) introducing a vector containing cDNA into a cell, (d) observing the synthesis of TEF-3 in the cell, and (e) uniformly purifying the TEF-3. Features method. 11. A method for determining whether a compound is an inhibitor of TEF-3 activity, comprising: (a) labeling the compound; and (b) binding the labeled compound to a solid support. Item 11. A method comprising: incubating with TEF-3 prepared by the method according to item 10; and (c) measuring the amount of a labeled compound that binds to TEF-3. 12. A method for determining whether a compound is an inhibitor of TEF-3 activity, comprising: (a) binding TEF-3 prepared by the method of claim 10 to a solid support. A method comprising: (b) incubating bound TEF-3 with a compound and a TEF-3 binding protein; and (c) measuring inhibition of binding of the TEF-3 binding protein. . 13. The method according to claim 12, wherein the method is a high-throughput screening method. 14. The method according to claim 13, wherein the TEF-3 binding protein is a TEF-3 interacting factor. 15. The method according to claim 13, wherein the TEF-3 binding protein is an antibody. 16. A method for determining whether a compound is an inhibitor of TEF-3 activity, comprising: (a) binding TEF-3 prepared by the method of claim 10 to a solid support. (B) incubating the bound TEF-3 with a compound and a DNA fragment containing the TEF-3 binding site; and (c) measuring the inhibition of DNA fragment binding. Method. 17. The method according to claim 16, wherein the DNA fragment is derived from an MMP promoter. 18. The method according to claim 17, wherein the DNA fragment is derived from an MMP-3 promoter. 19. The method according to claim 17, wherein the DNA fragment comprises the sequence TTTGGAATG. 20. A method for identifying a TEF-3 interacting factor, comprising: (a) collecting different tissue, cell or body fluid samples from an animal or a population thereof; and (b) an extract of the cell or nucleus. (C) exposing the extract to TEF-3 prepared by the method of claim 10; (d) immunoprecipitating with a TEF-3-specific antibody; e) identifying a TEF-3 binding agent. 21. A TEF-3 interactor identified by the method of claim 20. 22. A method for identifying a TEF-3 interacting factor, comprising: (a) collecting different tissue, cell or body fluid samples from an animal or a population thereof; and (b) an extract of the cell or nucleus. Preparing the TEF-prepared by the method of claim 10 attached to a solid support.
Exposing the extract to (3); and (d) identifying a factor. 23. A TEF-3 interactor identified by the method of claim 22. 24. A method for identifying a TEF-3 interacting factor, comprising: (a) collecting different tissue, cell or body fluid samples from an animal or a population thereof; and (b) an extract of the cell or nucleus. (C) separating the components of the extract; (d) identifying the agent by exposing the components to labeled TEF-3; and (e) labeling TEF-3. Detecting the factor by observing binding to the method. 25. A TEF-3 interactor identified by the method of claim 24. 26. A method for identifying a TEF-3 interacting factor, comprising: (a) preparing a cDNA library in an expression vector; (b) introducing the cDNA into cells; (c) Growing cells containing the cDNA; (d) searching for a sample of the cells using labeled TEF-3; and (e) observing binding to the labeled TEF-3 in the sample. Detecting the factor. 27. A TEF-3 interactor identified by the method of claim 26. 28. A method for identifying a TEF-3 interacting factor, comprising: (a) fusing a first cDNA encoding TEF-3 with a DNA binding domain of a known transcription factor; Fusing a second cDNA of the library with the DNA activation domain of the transcription factor; and (c) a promoter / reporter binding the fused first cDNA and the fused second cDNA to the transcription factor. Introducing the gene into a yeast cell containing the gene; (d) observing the response of the promoter / reporter gene; and (e) isolating cDNA from the random library to which the gene product responds. A method comprising: 29. The method according to claim 24, wherein the reporter cDNA encodes beta-galactosidase. 30. A TEF-3 interactor identified by the method of claim 29. 31. An antibody to TEF-3, or a fragment thereof. 32. A method for treating or preventing a matrix metalloproteinase-mediated disease, which comprises administering an inhibitor of TEF-3 activity to a subject. 33. The method according to claim 32, wherein the matrix metalloprotease-mediated disease is a degenerative joint disease. 34. The method of claim 33, wherein the matrix metalloprotease-mediated disease is osteoarthritis.