JP2002510205A - Production of polyunsaturated fatty acids by expressing polyketide-like synthetic genes in plants - Google Patents

Abstract

  (57) [Summary] The present invention relates to compositions and methods for producing polyunsaturated long chain fatty acids in plants, plant parts and plant cells such as leaves, roots, fruits and seeds. Necessary for the production of polyunsaturated long-chain fatty acids such as a gene that causes eicosapentaenoic acid production in Shewanella putrefaciens and a novel gene related to docosahexaenoic acid production in Vibrio marinus Using nucleic acid sequences and constructs encoding the various PKS-like genes, transgenes containing and expressing one or more transgenes encoding one or more of the PKS-like genes involved in the production of such long chain polyunsaturated fatty acids Create genic plants, plant parts and cells. Expression of the PKS-like gene in the plant system allows large-scale production of polyunsaturated long chain fatty acids such as eicosapentaenoic acid, docosahexaenoic acid, and may alter the fatty acid profile of plants, plant parts and tissues. Manipulation of the fatty acid profile allows the production of commercial quantities of novel vegetable oils and products.

Description

DETAILED DESCRIPTION OF THE INVENTION Production of polyunsaturated fatty acids by expressing polyketide-like synthetic genes in plants                                   Introduction Field of the invention   The present invention relates to an enzyme capable of modifying long chain polyunsaturated fatty acids (PUFA) in a host cell, and Modulation of levels of enzyme components and / or production of PUFAs in host cells Constructs and methods for making. The present invention relates to Shuwanella putrefa. Shewanella putrefaciens and Vibrio marinus eusosapentenoic acid (eicosapentenoic aci) d (EPA)).background   Two major families of polyunsaturated fatty acids (PUFAs) are eicosapentaenoic acid. Which are ω3 fatty acids and ω6 fatty acids such as arachidonic acid. PUFA is the plasma membrane of cells In the plasma membrane, it is found in a phospholipid-like form. And can also be found in forms such as triglycerides. PUFA also Humans and animals such as rostacyclin, leukotrienes, prostaglandins Act as precursors for other important molecules. Important long-chain PUFAs include a variety of Docosahexenoic acid found mainly in fish oils d (DHA)) and eicosapentaenoic acid (EPA), primrose (Oenothera bienni) s), Borago officinalis and blackcurrant (Ribes nigrum) Gamma-linolenic acid (GLA) found in the seeds of many plants, such as marine oils and plants Stearidonic acid (SDA) found in seeds, and found in filamentous fungi with GLA Arachidonic acid (ARA). ARA is purified from animal tissues such as liver and adrenal glands. Can be manufactured. Some of the marine bacteria that synthesize either EPA or DHA The genus is known. DHA is present in human milk along with ARA.   PUFAs are responsible for proper development, especially in infant brain development, and tissue formation and repair Is necessary for For example, DHA is found in many human cell membranes, especially neurons (gray matter), muscle It is an important component of cells and sperm and affects the development of brain It is considered essential for the development of children. EPA and DHA have a number of nutritional and Has physical use. For example, if you have diabetes (especially non-insulin-dependent diabetes) Affected adults have deficiencies in DHA levels, which are thought to contribute to later coronary status. And imbalance. Therefore, foods containing harmonious DHA may not May be useful.   For DHA, oil and egg yolk fractions from various marine organisms, cold-water marine fish There are many commercial production sources. Purification of DHA from fish sources is technically Difficulty costs relatively high, making DHA expensive and undersupplied. Amphidinium, Schyzochytrium In any algae and marine fungi such as Thraustochytrium, DHA represents up to 48% of the fatty acid content of the cells. A small number of bacteria also produce DHA It has been reported. These are generally VIbrio marinus us) and other deep-sea bacteria. As for ARA, the genus Mortierella , Entomophthora, Phytium and Chinori Microorganisms containing the genus Porphyridium can be used for commercial production. SD Commercial origin of A includes Trichodesma and Echium Genera is included. Commercial origins of GLA include primrose, black currant and Lulitisha is included. However, commercial production of PUFAs from natural sources There are several drawbacks associated with: The natural origin of PUFAs such as animals and plants is extremely Tend to have a non-uniform oil composition. Oil from these sources may be To separate the desired PUFAs or to produce one or more desired PUFA-rich oils, Bottom purification may be required.   Also, natural sources are subject to uncontrolled fluctuations in availability. Fish Resources can be naturally mutated or depleted by overfishing. animal Oil, and especially fish oil, may have accumulated environmental pollutants. Weather and Disease can cause fluctuations in yield from both fish and plant sources . The arable land available for the production of alternative oil-producing crops is The remaining arable land is subject to competition from increased demand for food production. PUFA Producing crops (eg, rulitia) are not adapted for commercial cultivation and There is a possibility that it cannot be obtained sufficiently in one cultivation. Therefore, such crops Cultivation is economically competitive if more profitable and established crops can be grown Do not have. Large-scale fermentation of organisms such as Shewanella is high. Expensive. Natural animal tissues contain only small amounts of ARA and are difficult to process. Microorganisms such as Porphyridium and Shewanella are commercially available. It is difficult to culture on a scale.   Dietary supplements and pharmaceutical formulations containing PUFAs retain drawbacks of PUFA origin there is a possibility. Replenishers, such as fish oil capsules, have low levels of certain desired ingredients. Or do not contain it and therefore require large doses. High doses reduce contaminants Leads to high levels of intake of undesirable ingredients, including: Excessive addition can result from endogenous biosynthesis. Other necessary fats in various lipid fractions in vivo, causing suppression of the pathway Fatty acid supplements can cause competition with acids and have undesirable consequences. Care must be taken when applying fillers. For example, eating foods rich in ω3 fatty acids Eskimos have a high propensity to bleed (US Pat. No. 4,874,603). Fish oil It has a pleasant flavor and aroma, which can be economically separated from desired products such as food supplements. It may not be possible to release them. The unpleasant flavor and aroma of the replenisher Such a dosage regimen involving the drug may be undesirable and may Compliance may be hindered.   A number of enzymes have been identified that are involved in PUFA biosynthesis. Linoleic acid (LA, 18: 2 Δ9, 12) is converted to oleic acid (18: 1 Δ9) by Δ12-desaturase. Produced from GLA (18: 3 Δ6,9,12) is ligated by Δ6-desaturase Produced from luic acid (LA, 18: 2 Δ9, 12). ARA (20: 4 Δ5,8,11,14) is Δ5-de Produced from DGLA (20: 3 Δ8,11,14) catalyzed by saturase. Stingray Cosapentaenoic acid (EPA) has five double bonds (Δ5,8,11,14,1) all in cis configuration. It is a 20-carbon ω3 fatty acid containing 7). EPA and related DHA (Δ4,7,10,1 3,16,19, C22: 6) are converted to oleic acid by a series of extension and desaturation reactions. Produced from formic acid. Also extends PUFA with 18 carbon atoms to carbon chain lengths 20 and 22 To do this, elongase is required. However, animals Can convert oleic acid (18: 1 Δ9) to linoleic acid (18: 2 Δ9,12) Absent. Similarly, mammals synthesize μ-linolenic acid (ALA, 18: 3 Δ9, 12, 15) Can not do. Other eukaryotes, including fungi and plants, are at positions Δ12 and Δ15 Has enzymes to desaturate. Therefore, the major polyunsaturated fatty acids in animals are And / or linoleic acid (18: 2 Δ9,12) or μ-lino Derived from desaturation and elongation of renic acid (18: 3 Δ9,12,15).   Polyunsaturated fatty acids are considered useful for nutritional, pharmaceutical, industrial and other purposes You. The widespread supply of polyunsaturated fatty acids from natural sources and chemical synthesis is Does not meet. Linoleic acid common to most plant species (LA, 18: 2 Δ9,12) From fatty acids to more saturated, longer-chain PUFAs Required for the isolated desaturase and elongase enzymes Even for EPA and DHA, to achieve expression, Manipulation of plant host cells requires expression of five or six separate enzyme activities It is possible that for the mass production of such PUFAs, additional operating effort (e.g. For example, down-regulation, mutagenesis or Higher enzyme activity by targeting enzymes to plastid organelles Operation). Therefore, species that naturally produce these fatty acids Obtaining genetic material involved in the biosynthesis of PUFAs, and from such isolated Materials, alone or in combination, are engineered to allow the production of commercial quantities of PUFAs. There is interest in expressing in heterologous systems that can be used.Related literature   Several genera of marine bacteria that synthesize either EPA or DHA have been identified (DeLong and Yayanos, Applied and Environmental Microbiology (1986) 51: 730 -737). Researchers at the Sagami Chemical Research Institute found that marine bacteria Gene cluster from Shewanella putrefaciens EPA production in E. coli transformed with You. EPA fatty acid synthesis in E. coli requires at least five open A reading frame (ORF) is required. To date, these genes have been No extensive characterization of the function of loaded proteins has been reported (Yazawa (1996 ) Lipids 31, S-297; WO 93/23545; WO 96/21735).   Yazawa, Open Reading Framework Published in US Patent No. 5,683,898 The protein sequence of ORF3 is not a functional protein. Yazawa The protein is transformed into a Shewanella PKS-like cluster (Genbank accession no. 73935) starting from the methionine codon at nucleotides 9016 to 9014 Ends with a stop codon at nucleotides 8185 to 8183 of the Shewanella PKS-like cluster Is defined. However, this ORF is not available for all PKS-like Under control of a heterologous promoter in a raster-containing E. coli strain When expressed, the recombinant cells do not produce EPA.   Polyketides are synthesized using a set of enzymatic reactions similar to those of fatty acid synthesis. (See review below: Hopwood and Sher) man, Annu. Rev. Genet. (1990) 24: 37-66, and Katz and Donadio, Annual Revi. ew of Microbiology (1993) 47: 875-912). Poly to produce new antibiotics It has been proposed to use ketide synthase (Hutchinson and Fujii, Ann ual Review of Microbiology (1995) 49: 201-238).                                Summary of the Invention   Use of polyketide-like synthesis (PKS-like) genes in plants and plant cells Novel compositions and methods for producing unsaturated fatty acids (PUFAs) are provided. fat Known and proposed methods for producing PUFAs using acid synthesis genes and In contrast, the present invention provides a method for producing PUFAs by using genes of the PKS-like system. Constructs and methods are provided. The method comprises the steps of transforming an expression cassette with an expression cassette. Growing (proliferating) a target host cell, wherein the expression cassette is within the host cell. And the expression cassette is capable of modulating PUFA production. 5 'to the DNA sequence relative to genes (PKS-like genes) or components Transcription and translation initiation tone linked in frame Includes nodal regions. Alteration of the host cell's PUFA profile causes PUFA biosynthesis This is achieved by expression after introducing a complete PKS-like system into the host cell. The present invention For example, large-scale production of DHA and EPA, and host cells and edible plant tissues and And / or useful for modifying the fatty acid profile of plant parts.                             BRIEF DESCRIPTION OF THE FIGURES   Figure 1 shows the ORF names of the Shewanella EPA gene cluster. You. FIG. 1A shows the organization of the gene, which is essential for EPA production in E. coli. ORFs are numbered. FIG. 1B shows the names given to the subclones.   FIG. 2 shows ORF6 (FIG. 2A), ORF7 (FIG. 2B), ORF8 (FIG. 2C), ORF9 (FIG. 2D) and ORF 3 (FIG. 2E), Shewanella PKS-like domain structure, motifs and Indicates a "Blast" match. Figure 2F shows Shewanella EPA   Structure of the region of the Anabeana chromosome associated with the domain present in the ORF Show the structure.   Figure 3 shows pantethenylation of ORF3 in E. coli strain SJ16. nylation).   FIG. 4 shows Shewane containing ORFs 3, 4, 5, 7, 8 and 9. lla) is the sequence of the PKS-like cluster found in Start codon for each ORF And the final codons are as follows: ORF3 (public but inactive): 9 ORF3 (active in EPA synthesis): 9157, 8186; ORF6: 13906, 22173; ORF 7: 22203, 24515; ORF 8: 24518, 30529; ORF 9: 30730, 32358.   FIG. 5 shows Vibrio marinus containing ORFs 6, 7, 8 and 9. 2 shows the sequence of a PKS-like cluster in a DNA fragment of about 40 kb in s). Start codon for each ORF And the final codons are as follows: ORF 6: 17394, 25352; ORF 7: 25509, 281 ORF 8: 28209, 34265; ORF 9: 34454, 36118.   FIG. 6 shows the approximately 19 kb PKS-like cluster of FIG. 5 containing ORFs 6, 7, 8 and 9. The sequence of the parts is shown. The start codon and final codon for each ORF are as follows: ORF 6: 411, 8369; ORF 7: 8526, 11177; ORF 8: 11226, 17282; ORF 9: 17471, 19135.   Figure 7 shows Shewanella putrefaciens and Of PKS-like gene clusters from Vibrio marinus and Vibrio marinus Show. FIG. 7B is the operon sequence of Vibrio marinus.   FIG. 8 shows that ORFs 6, 7 and 8 are in reading frame 2 and ORF 9 is in reading frame 2. Vibrio marinus (shown in FIG. 7B) It is an enlarged view of the PKS-like gene cluster part of Vibrio marinus).   Figure 9 shows Shewanella putrefaciens and 1 shows the sequence homology of ORF6 of Vibrio marinus and Vibrio marinus. Sh The vertical axis indicates Shewanella ORF6, and the horizontal axis indicates Vibrio ORF6. Shown on the axis. Lines indicate protein regions with 60% identity. Center Repeat lines correspond to multiple ACP domains found in ORF6.   Figure 10 shows Shewanella putrefaciens and 2 shows the sequence homology of ORF7 of Vibrio marinus and Vibrio marinus. Sh The vertical axis indicates Shewanella ORF7, and the Vibrio ORF7 Is shown on the horizontal axis. Lines indicate protein regions with 60% identity.   Figure 11 shows Shewanella putrefaciens and 1 shows the sequence homology of ORF8 of Vibrio marinus and Vibrio marinus. Sh The vertical axis indicates Shewanella ORF8, and the horizontal axis indicates Vibrio ORF8. Shown on the axis. Lines indicate protein regions with 60% identity.   Figure 12 shows Shewanella putrefaciens and 2 shows the sequence homology of ORF9 of Vibrio marinus and Vibrio marinus. Sh The vertical axis indicates Shewanella ORF9, and the Vibrio ORF9 Is shown on the horizontal axis. Lines indicate protein regions with 60% identity.   FIG. 13 is a diagram of various complementation experiments and the resulting PUFA production. The video shown on the left Large containing the Vibrio and Shewanella genes The longest PUFAs produced in E. coli strains are shown on the right. The hollow frame is 1 shows an ORF derived from Shewanella. The black frame is from Vibrio This shows the ORF.   FIG. 14 shows E. coli FadE- derived from Shewanella. Of pEPAD8 (deleted ORF8) with ORF8 derived from Shewanella 5 is a chromatogram showing fatty acid production by The chromatogram is EPA (20: 5) is shown.   FIG. 15 shows E. coli FadE- from Shewanella. PEPAD8 (deleted ORF8) with ORF8 from Vibrio marinus 5 is a chromatogram showing fatty acid production by complementation. The chromatograph The EPA (20: 5) and DHA (22: 6) peaks.   FIG. 16 shows PUFA values from ORF8 complementation experiments that gave the chromatograms shown in FIG. It is a table.   FIG. 17 is a plasmid map showing the elements of pCGN7770.   FIG. 18 is a plasmid map showing the elements of pCGN8535.   FIG. 19 is a plasmid map showing the elements of pCGN8537.   FIG. 20 is a plasmid map showing the elements of pCGN8525.   FIG. 21 shows the Shewanella ORF defined by Yazawa and FIG. This is a comparison with the disclosure. Leucine (TTG) codons at nucleotides 9157-9155 The protein starting at the end and ending at the stop codon at nucleotides 8185 to 8183 is OR Heterologous production in E. coli strains containing all PKS-like clusters except F3 When expressed under the control of a motor, the recombinant cells produce EPA. did Thus, the published protein sequence may be incorrect and the protein The coding sequence for the protein may be a TTG codon at nucleotides 9157-9155 or a nucleotide. It is possible to start with the TTG codon at 9172-9170. This information is functional PKS Critical for the expression of the cluster heterologous system.   FIG. 22 is a plasmid map showing the elements of pCGN8560.   FIG. 23 is a plasmid map showing the elements of pCGN8556.   FIG. 24 shows the translated DNA sequence upstream of the published ORF3. 9016 The ATG initiation codon at position is the one of the protein described in Yazawa et al. Start codon. Other arrows may also function as start codons in bacteria Indicates the TTG or ATT codon. ORF3 from the published ATG codon at position 9016 When started, the protein is not functional in the production of EPA. ORF3 Starts at the TTG codon at position 9157, the protein promotes EPA synthesis Can.                          Description of the preferred embodiment   In the present invention, the polyunsaturated long chain fatty acid content of host cells (particularly host plant cells) is modified. Shewanella, Vibrio or other microorganisms for Novel D containing some or all of the polyketide-like synthesis (PKS-like) pathway genes derived from Provided are NA sequences, DNA constructs and methods. The present invention relates to Shuwanella Putref Polyketide-like synthesis of EPA synthesis gene in Shewanella putrefaciens Indicates that a route is configured. Features include Shewanella and Vibri Method for producing EPA and DHA in host cells, based on the Vibrio gene I will provide a. The method comprises providing a polypeptide capable of increasing the amount of one or more PUFAs in a host cell. Transforming the cells with an expression cassette containing DNA encoding the tide. Desirably, an integration that causes integration of the expression cassette into the genome of the host cell. Prepare the construct. Sen which encodes a polypeptide having PKS-like gene activity The host cell is engineered to express the antisense or antisense DNA. `` PKS's remains "Gene" refers to a polypeptide that provides any one or more of the functions of a PKS-like activity of interest. To taste. A “polypeptide” is a length or post-translational modification (eg, glycosylated or otherwise). Or phosphorylation) means any chain of amino acids. Host cell properties Depending on the enzyme, the substrate for the expressed enzyme may be produced by the host cell or It is possible to supply the same. Of particular interest are plant tissues and / or Or selective production of PUFAs in plant parts (eg leaves, roots, fruits and seeds) Control. The present invention provides for the synthesis of EPA, DHA and other related PUFAs in host cells. Can be used for   Transgenic production of PUFA has a number of advantages. For example, Shu Transgenic E. coli as in the case of Shewanella EPA accumulates in the phospholipid fraction, especially at the sn-2 position. Shewanella Or use a structured lipid that is substantially different from that produced in E. coli. It may be possible to produce it in the desired host cell. Also, in certain host cells Production of PUFAs in plants can be used for purification from natural sources such as fish and plants. Gives some advantages over. In transgenic plants, PKS-like By using malonyl Co-A and acetyl Co-A as a substrate PUFA fatty acid synthesis in the cytoplasm by a system that produces PUFA via acid de novo production Is achieved. Thus, problems associated with substrate competition, fatty acids in the host Potential questions, such as those related to the diversion of the normal product of synthesis to PUFA production Problem is avoided.   The production of fatty acids from recombinant plants is conferring a new synthetic pathway in the host. More or less undesirable pathways, thereby reducing the desired PUFA or its Increase the level of conjugated form and reduce the level of unwanted PUFAs Can alter the naturally occurring plant fatty acid profile. Also, Expression of PKS-like genes in certain tissues and / or plant parts And / or achieve a significantly increased level of desired PUFA in the part In a sense, it means that recovery from those organizations can be more economical. The advantage of meaning also confers the production of fatty acids in transgenic plants. Expression in a plant tissue and / or plant part is easily obtained by the tissue or part. Especially when harvested (eg, seeds, leaves, fruits, flowers, roots, etc.) Gives kana efficiency. For example, the desired PUFA can be expressed in seeds, Methods for isolating oils are well established. The desired PUFA source for purification (source f or purification) in addition to the PKS-like gene alone or Manipulate seed oil components by expressing them in combination with offspring (eg, elongase) To obtain a seed oil having a certain PUFA profile in a concentrated form. You. If it is not possible or desirable to feed human milk, or In the case of malnutrition or disease in both adults and infants, use the concentrated seed oil. Add to animal milk and / or synthetic or semi-synthetic milk Instead, it can be used as an infant formula.   Fatty acid production by transgenic microorganisms is higher than that of higher organisms. Many microorganisms with a very simple oil composition are known and facilitate purification of the desired components There is an advantage that. Microbial production is limited to external factors such as weather and food supply. Not subject to fluctuations caused by variables. Oil produced by microorganisms is With virtually no contamination. In addition, microorganisms are individual forms that can have specific uses It is possible to give a PUFA. For example, Spirulina is a bird It is possible to give PUFAs predominantly located in the first and third positions of glyceride, Digestion with pancreatic lipase preferentially releases fatty acids from these locations. Spill After the human or animal ingests triglycerides from lina (Spirulina), These PUFAs are released as free fatty acids by pancreatic lipase, and thus, for example, It can be directly used for infant brain development. Also, by controlling the culture conditions, Alternatively, it should be noted that individual substrates for enzymes expressed by microorganisms may be provided. Or by adding a compound that inhibits an undesirable biochemical pathway Thereby, the production of oil by microorganisms can be manipulated. In addition to these benefits Production of fatty acids from recombinant microorganisms may provide a new synthetic pathway in the host Or suppresses unwanted paths, thereby reducing the desired PUFA or its Increase the level of conjugated forms and reduce the level of unwanted PUFAs Can alter the naturally occurring microbial fatty acid profile.   The production of fatty acids in animals also offers several advantages. De in animals Saturase gene expression significantly increases the level of desired PUFAs in animal tissues. And their recovery from tissues may be more economical. For example, If the desired PUFA is expressed in the milk of the animal, a method of isolating PUFA from animal milk is Well established. In addition to obtaining the desired source of PUFA purification, By expressing the Turase gene alone or in combination with other human genes Manipulating the milk of an animal to substantially match human milk at various stages of infant development It is possible to obtain animal milk with a similar PUFA composition. Human breastfeeding When it is impossible or undesirable or malnutrition or In the case of disease, the milk of an animal that has been treated (humanized) to approximate human milk Could be used as an infant formula.   DNA encoding the desired PKS-like gene can be identified by various methods. In one method, the source of the desired PKS-like gene, for example, Shewanell a) or a genomic library from Vibrio spp. , Enzymatically or chemically synthesized with a detectable probe. ORFs with PKS-like genes originate from organisms that produce the desired PUFA (eg, under high pressure). Or a deep-sea bacterium that grows preferentially at relatively low temperatures and produces DHA or EPA). In addition, microorganisms such as Shewanella that produce EPA or DHA are It can be used as a source for S-like genes. The probe can be DNA, RNA or Can be made from non-naturally occurring nucleotides or mixtures thereof You. Hybridization methods of normal or reduced stringency The probe can be enzymatically synthesized from DNA of a known PKS-like gene. For design of nucleic acid probes and examination of annealing conditions, see, for example, Sambrook et al., M. olecular Cloning: A Laboratory Manual (2nd edition), Vol. 1-3, Cold Spring Harbor Laboratory, (1989) or Current Protocols in Molecular Biology, F. Ausubel Ed., Greene Publishing and Wiley-Interscience, New York (1987) Each of which is incorporated herein by reference). PUFA yeast Techniques for the manipulation of nucleic acids encoding elements (eg, a nucleus encoding a polypeptide) Subcloning of acid sequences into expression vectors, labeling of probes, DNA sequencing Hybridization, etc.) are generally described in Sambrook (supra).   Oligonucleotide probes are also used to screen for origin Known PKSs containing sequences conserved between known PKS-like genes Based on the sequence of the like gene or the peptide sequence obtained from the desired purified protein. And it is possible. Oligonucleotide probes based on amino acid sequences are Can be degenerate to include the degeneracy of the It can be biased to give preference to new codons. Alternatively, the desired tag The protein is completely sequenced and the DNA encoding the polypeptide Total synthesis can be performed.   Once the desired DNA has been isolated, it can be sequenced by known methods. It is recognized in the art that such methods are susceptible to error, For this reason, multiplex sequencing of the same region may be a common practice, but nevertheless, Repetitive domains, regions with extensive secondary structure or abnormal base composition (eg, high Regions with high GC base content), especially in the resulting deduced sequence. It is expected to cause a high error rate. If differences occur, resequencing should be performed. And a special method can be used. Special methods include different temperatures; Enzymes that modify the ability of the oligonucleotide to form higher order structures Proteins; modified nucleotides, such as ITP or methylated dGTP; different gels Composition, eg addition of formaldehyde; different primers or areas of interest Primers at different distances from each other; or use different templates, for example, single-stranded DNA Modification of the sequencing conditions due to the In addition, mRNA sequencing Can be used.   Typically, part or all of the coding sequence of a polypeptide having PKS-like gene activity Is of natural origin. However, in some cases, for example, it is preferred for the host In order to enhance expression by using codons, all or part of the codons must be modified. It is desirable to decorate. Preferred codons for the host are specific to the particular host species of interest. Can be determined from the highest frequency codons in the protein expressed at the highest level. Wear. Therefore, the entire coding sequence of a polypeptide having PKS-like gene activity Or a part can be synthesized. Also, any of the present in the transcribed mRNA All or part of the DNA is removed to remove destabilizing sequences or regions of secondary structure. Can be synthesized. Also, the base composition may be more favorable for the desired host cell. To modify the DNA, all or a part of the DNA can be synthesized. Distribution Methods for synthesizing sequences and coalescing sequences are well documented in the literature . In vitro mutagenesis and selection, site-directed mutagenesis or other means To obtain a mutation in a naturally occurring PKS-like gene, thereby providing the desired polymorphism. Functions in the host cell, such as longer half-life or higher production rate of saturated fatty acids Have more desirable physical and kinetic parameters for Polypeptides having PKS-like gene activity can be produced in vivo.   Of particular interest is the Shewanella p. utrefaciens) and the corresponding ORF of Vibrio marinus is there. In order to achieve EPA biosynthesis, Shuwanella putrefaciens (S hewanella putrefaciens) Expression of PKS-like gene in transgenic plants Can be In addition, Shewanella putrefaiensu (Shewanella putre faciens) is substantially identical in sequence to the PKS-like gene, or Substantially similar to the PKS-like gene of Trefaciens (Shewanella putrefaciens) Other DNAs encoding polypeptides (eg, Vibrio marinus) nus) can also be used. Substantially identical in sequence Is the PKS-like inheritance of Shewanella putrefaciens Nucleic acid sequence encoding the offspring DNA sequence or amino acid sequence for such a gene At least 60%, 80%, 90% or 95% for the columns (in this order the preference increases The amino acid sequence or the nucleic acid sequence showing the homology. Polypeptide In some cases, the length of the comparison sequence will generally be at least 16 amino acids, preferably At least 20 amino acids, most preferably 35 amino acids. In the case of nucleic acids, The length of the sequence is generally at least 50 nucleotides, preferably at least 60 nucleotides. Reotide, more preferably at least 75 nucleotides, most preferably 110 nuclei Reotide.   Homology is typically determined by sequence analysis software, such as Genetics Computer Gr. oup, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wisconsin 53705 Sequence Analysis Software Package, MEGAli gn (DNAStar, Inc., 1228 S. Park St., Madison, Wisconsin 53715) and MacVecto r (Oxford Molecular Group, 2105 S. Bascom Avenue, Suite200, Campbell, California ia 95008), BLAST (National Center for Biotechnology Information (WCBI) ww w.ncbi.nlm.gov), FASTA (Pearson and Lipman, Science (1985) 227: 1435-1446) Measure using Such software includes various substitutions, deletions and other Applying degree of homology to modification Better fits a similar sequence. Conservative substitutions typically include within the following groups: Substitutions included: glycine and alanine; valine, isoleucine and leucine Aspartic acid, glutamic acid, asparagine and glutamine; serine and Lysine and arginine; and phenylalanine and thionine. Rosin. Also, substitutions can be made on the basis of conserved hydrophobicity or hydrophilicity (Kyte and Doolittle, J. Mol. Biol. (1982) 157: 105-132) or a similar polypeptide secondary structure. (Chou and Fasman, Adv. Enzymol. (1978) 47: 45-148, 197). 8) It is possible to do. The relevant protein for the sequence being probed is , P ≧ 0.01, preferably p ≧ 10<sup>-7</sup>Or 10<sup>-8</sup>Is identified.   The present invention includes related PKS-like genes from the same or other organisms. So Related PKS-like genes, such as the same or different in Shewanella Variants of the disclosed PKS-like ORF naturally occurring in one species, and from other species Homologues of the disclosed PKS-like genes and have similar functions and activities And evolutionarily related proteins. Also, Shuwanera Putrefa Although it is not substantially the same as the Sheensella putrefaclens PKS-like gene, Also includes a PKS-like gene that functions similarly to produce PUFAs as part of the PKS-like system You. Related PKS-like genes function substantially similarly to the disclosed PKS-like genes Their ability to perform [i.e., if they are Shewanella or Used in place of the Vibrio's corresponding ORF, but nevertheless EPA or DHA Can be produced effectively]. Also disclosed Screening sequence databases for sequences homologous to PKS-like genes Or a probe based on the disclosed PKS-like gene By hybridizing to a library constructed from Product-derived mRNA and primers based on the disclosed PKS-like gene. RT-PCR can identify related PKS-like genes. Therefore, "PKS The term "like gene" refers not only to the nucleotide sequences disclosed herein, but also to these Also meant are other nucleic acids that are allelic or species variants of the nucleotide sequence. Ma These words are a single part By intentional mutagenesis using recombination techniques such as To cut out a short fragment of DNA open reading frame encoding element Or by substituting or adding a new codon. It is understood to include unnatural mutations introduced. Such minor modifications are Substantially maintain the immunoidentity of the original expression product and / or its biological activity. Break The biological properties of the altered PUFA enzyme are such that the enzyme can be expressed in a suitable cell line. And by measuring the ability of the enzyme to synthesize PUFAs Can be. Individual enzymatic modifications that are considered minor include amino acids with similar chemical properties. Substitution (eg, glutamic acid instead of aspartic acid, alternative to asparagine Glutamine).   When a PUFA PKS-like system derived from another organism is used, it is important for PKS-like gene activity. Regions of the various PKS-like gene polypeptides can be It can be determined by measuring the expression of the repeptides and their activity. The Mutant coding regions may include deletions, insertions and point mutations or a combination thereof. Can be included. A typical functional analysis starts with deletion mutagenesis Determine the N- and C-terminal boundaries of the protein required for function, and then Create internal deletions, insertions or point mutants in the Further, the area required for is determined. Also, such as cassette mutagenesis or total synthesis Other techniques can be used. Deletion mutagenesis can be performed, for example, on 5 'or 3' By using an exonuclease to sequentially remove the protected regions. Kits for such techniques are available. After deletion, start codon or end Oligonucleotides containing connection codons are deleted after 5 'or 3' deletion, respectively. The coding region is completed by ligation to the deletion coding region. Alternative The oligonucleotide encoding the start codon or stop codon. Different methods such as mutagenesis, mutant PCR, or existing limitations Insertion into the coding region by ligation to the DNA digested at the site. Internal gap Loss can be reduced by mutagenesis via site-directed mutagenesis or mutagenesis PCR. By various methods, such as by using an existing restriction site in the DNA, by using a primer. And can be similarly manufactured. Insert the linker Tanning mutagenesis, site-directed mutagenesis or mutagenesis PCR Performed by the method. Point mutation can be site-directed mutagenesis or mutagenesis. Produced by techniques such as PCR.   To identify regions of the PKS-like gene polypeptide that are important for activity, Mutagenesis can be used. Expressing the mutated construct and the resulting modification The ability of the protein to function as a PKS-like gene is assayed. Such a structure -Functional analysis shows which regions can be deleted and which regions allow insertion And what point mutations occur when the mutated protein Can be determined to allow it to function in substantially the same way as the gene . All such muteins and the nucleoti encoding them The sequence is within the scope of the present invention. EPA is a PKS-like product of Shuwanella ( Shewanella), so the EPA gene encodes a component of this system ing. In Vibrio, DHA is produced by a similar system. these Enzymes that synthesize fatty acids include C16 and C16, which are typically found in bacteria and plants. Genes that are different from the fatty acid synthesis genes that encode enzymes involved in the synthesis of Coded by a cluster of genes. Shewanella EPA gene Represents a PKS-like gene cluster, so EPA production is at least to some extent Is independent of the typical bacterial type II FAS system. Therefore, the cytoplasm of plant cells EPA production in plants is controlled by PKS-like processes in plant cells under the control of appropriate plant regulatory signals. Can be achieved by expression of tract genes.   In E. coli transformed with the Shewanella EPA gene EPA production proceeds during anaerobic growth, indicating that O<sub>Two</sub>Dependent desaturase This indicates that no reaction was involved. The ORF code required for EPA production Analysis of the protein indicates the presence of a domain structure characteristic of the PKS-like system. Figure 2A Indicates the domain, motif, and main domain detected by the "BLAST" databank search. Here is an overview of the important homology. EPA works with many of the other substrates produced by the PKS-like pathway. Are different (ie, it has five cis-sites located every three carbons along the molecule). PKS-like system for the synthesis of EPA because it contains a double bond) Is not predicted.   In addition, we use domains that exist within the Shewanella EPA ORF. BLAST searches found that some PKS-like remains found in Anabeana This indicates that it is related to the protein encoded by the gene cluster. A The structure of that region of the Anabeana chromosome is shown in FIG. 2F. Anabeana ) Is a long-chain (C26) hydroxyl found in the glycolipid layer of allogeneic cells. It is linked to the synthesis of fatty acids. Homology to Anabeana protein The EPA protein domain with is shown in FIG. 2F.   The ORF6 of Shewanella is an active site motif (DXAC<sup>*</sup>) And numerous Includes a KAS domain containing the “GFGG” motif at the end of the type II KAS protein. (See FIG. 2A). There is an extended motif, Not shown here. Next, malonyl-CoA: ACP acyltransferase (AT) domain exists. Sequence near the active site motif (GHS<sup>*</sup>XG) is that Transfers malonic acid but not methylmalonic acid (ie, it is acetate (Similar to AT). After the linker region, a PKS-like ACP There is a cluster of six repeat domains, each about 100 amino acids long, homologous to the sequence I do. Each has a pantethein binding site motif (LGXDS<sup>*</sup>(L / I)) . The presence of six such ACP domains, so far, fatty acid sintering Not found in ze (FAS) or PKS-like systems. Near the end of the protein Contains a region showing homology to β-keto-ACP reductase (KR). It contains a pyridine nucleotide binding site motif “GXGXX (G / A / P)”.   Shewanella ORF8 is a KAS domain containing an active site and a termination motif. Start from the main (Figure 2C). The best match in the data bank is Anabena (Anabeana) For HglD. Also, N-terminal of Anabeana HglC There are domains with sequence homology to one half. This region is also active Lacks site and termination motifs but shows weak homology to KAS proteins. It is characteristic of the so-called chain length factors (CLF) of type II PKS-like system Having. ORF8 is a PKS-like system that produces EPA versus DHA. It seems to command life. ORF8 is a β-hydroxyacyl-ACP dehydrase ( DH). Best for both domains Matches between the dehydrase reaction and the isomerization of the resulting double bond (trans to cis ), Which is a bifunctional enzyme that does both. coli) for FabA is there. The first DH domain contains the active site histidine (H) involved in FabA catalysis and And both adjacent cysteines (C). Second DH domain has active site H But lacks adjacent C (FIG. 2C). Blast search in the second DH domain is another E. coli (E. coli) DH FabZ, which has no isomerase activity Indicates a match.   The N-terminal half of ORF7 (FIG. 2B) has a significant match in the databank. Absent. The best match for the C-terminal half is in the C-terminal part of Anabeana HglC. Against. This domain contains an acyltransferase (AT) motif ( GXSXG). E. coli (E. coli) based on the crystal structure of malonyl-CoA: ACP AT Comparison of extended active site sequences indicates that ORF7 is required to exclude water from the active site. Lacking two residues in E. coli (E. coli) name; Q11 and R117) . These data suggest that ORF7 can function as a thioesterase. ing.   ORF9 (Fig. 2D) is linked to the ORF of unknown function in the Anabeana Hgl cluster. Homologous. It also provides NIFA, a regulatory protein in nitrogen-fixing bacteria. It shows very weak homology to them. Regulatory role for ORF9 protein excluded Not. ORF3 (FIG. 2E) was obtained from Anabeana HetI as well as E. coli (E. E. coli) and homologous to Sfp of Bacillus. Recently, HetI , A new enzyme for phosphopantetheinyl transferase, including EntD and Sfp The family was identified [Lamblot RH et al. (1996), a new enzyme superfamily-ho Hopanteteinyl transferase (A new enzyme superfamily-the phophopa ntetheinyl transferases). Chemistry & Biology, Vol 3, # 11,923-936]. Of FIG. Data shows the addition of β-alanine (ie, pantethein) to the ORF6 protein. In addition, it indicates that the presence of ORF3 is required. Therefore, ORF3 is E specific to the F6ACP domain It encodes suhopantetheinyl transferase [Haydock SF et al. (1995 ) (Methyl) malonyl-CoA in modular polyketide synthase: acyl carrier tan Branch sequence motif (D) correlated with substrate specificity of the protein transacylase domain. ivergent sequence motifs correlated with the substrate specificity of (m ethyl) malonyl-CoA: acyl carrier protein transacylase domains in modular p olyketide synthases), FEBS Lett. , 374, 246-248]. Malonic acid , A carbon source used for the elongation reaction of EPA synthesis. Also, instead of malonyl-ACP Malonyl-CoA is the AT substrate. In other words, the AT region of ORF6 uses malonyl Co-A. To use.   Once the DNA sequence encoding the PKS-like gene of the organism that causes PUFA production is obtained, They can be placed in a vector that is replicable in the host cells, or Is grown in vitro by techniques such as long PCR. Into a replication vector Can include plasmids, phages, viruses, cosmids, and the like. Hope Preferred vectors contain the desired gene for mutagenesis or the desired purpose in the host cell. Those useful for gene expression are included. PUFA synthase or homologous protein, It can be expressed in a variety of recombinantly engineered cells. Coat PUFA enzyme Numerous expression systems are available for expressing DNA to be loaded. Encodes PUFA enzyme Expression of natural or synthetic nucleic acids is typically accomplished by using a promoter (construct) in the expression vector. Functional DNA or an inducible promoter). Is achieved by The expression vector contains a segment encoding the PUFA enzyme (this Is operably linked to an additional segment that provides for its transcription) Means a linear or circular DNA molecule containing Such additional segments include , Promoter and terminator sequences. In addition, expression vectors include One or more origins of replication, one or more selection markers, enhancers, polyadenylation It is possible to include a signal or the like. Expression vectors are generally plasmids Alternatively, it can be derived from viral DNA and contain both elements. "function The term `` linkable '' refers to those segments whose intended Means that they are arranged to function in concert for the purpose of Transcription starts at the promoter and the code To the terminator via a fragment (see Sambrook et al., Supra). Want).   The technology of long PCR allows large constructs to be propagated in vitro, and Modifications to specific genes, such as mutagenesis or the addition of expression signals, And propagation of the resulting constructs without the use of replicating vectors or host cells. Can be done completely in vitro. In vitro expression, for example, in vit Insert the coding region of the desaturase polypeptide into an expression vector designed for ro This is done by placing and adding rabbit reticulocyte lysate and cofactors. If desired, a labeled amino acid can be incorporated. That's it Such an in vitro expression vector contains some or all of the expression signals required for the system used. It is possible to add parts. These methods are well known in the art The components of the system are commercially available. The reaction mixture is then converted to a PKS-like enzyme. Can be assayed directly, for example by measuring its activity, Alternatively, the synthesized enzyme can be purified and then assayed.   Expression in a host cell can be achieved transiently or stably. Transient Expression can be performed using an introduced construct containing an expression signal that is functional in the host cell. (However, this construct is not replicated and is rarely integrated into the host cell. Or in this case, the host cell is not viable). In addition, the target gene By inducing the activity of a operably linked regulatable promoter Can achieve transient expression (however, such inducible systems include: Often exhibit low basal levels of expression). Stable expression is integrated into the host genome Or can be achieved by introducing a nucleic acid construct that replicates autonomously in the host cell. it can. Located on or transfected with the expression construct Using the selected marker and then selecting for cells that express the marker. Thus, stable expression of the target gene can be selected. Built-in stable expression The integration of the construct, if it occurs from Is possible or is sufficient to target recombination with the host locus. Can be targeted by use of constructs containing regions homologous to the host genome It is. Regulation of transcription and translation when targeting the construct to an endogenous locus Territory All or part of the region can be conferred by the endogenous locus. For expression in a host cell, transcription and The transforming DNA is operably linked to the translation initiation and termination control regions.   The initiation and termination regions for transcription and translation depend on the DNA to be expressed, and the expression in the desired system. Genes known or suspected to be capable of expression, expression vectors, chemical synthesis, etc. From a variety of nonexclusive origins. The end area is the start area Can be derived from the 3 'region of the gene obtained or from a different gene. Many A number of termination regions are satisfactory in various hosts from the same or different genera and species. It is known and known to be possible. The termination area is usually a specific task. It is chosen for convenience rather than for desired characteristics. Two or more PKS-like ORFs in the same cell If it is expressed in, appropriate regulatory regions and expression methods should be used. The introduced gene can be used for integration into the host genome by using a replication vector or Thus, it can be propagated in host cells. Two or more from separate replication vectors When expressing genes, it is desirable that each vector has a different replication means. Good. Each construct introduced, whether integrated or not, has a different selection. Should have alternative means, lack homology to other constructs, and Ensures that stable expression is maintained and that rearrangement of elements between constructs is hampered . Appropriate selection of regulatory regions, selection means and propagation methods for introduced constructs should Experimentation so that the transgene is expressed at the required level and results in the synthesis of the desired product Can be determined.   Various prokaryotic expression systems can be used to express the PUFA enzyme. You. Promoter that directs transcription, ribosome binding site and transcription terminator Can be constructed. E. coli (E. coli) Regulatory regions suitable for this purpose include, for example, Yanofsky (1984) J. Bacteriol. , 158 Escherichia coli (E. coli) Tryptophan biosynthetic pathway promoter And operator regions, and Herskowitz and Hagen, (1980) Ann. Rev. Ge net. , 14: 399-445, the left promoter of phage lambda (Pλ). You. E. coli (E. E. coli) containing a selectable marker in the DNA vector to be transformed. It is also useful to have. Such markers include, for example, Characterized for resistance to picillin, tetracycline or chloramphenicol Genes. Vectors used to express foreign genes in bacterial hosts Are generally selected markers, such as genes for antibiotic resistance, and It contains a promoter that functions in the host cell. Useful for transforming bacteria PBR322 (Bolivar et al., (1977) Gene 2: 95-113), pUC plasmid (M essing, (1983) Meth. Enzymol. 101: 20-77, Vieira and Messing, (1982) Gene 19:25 9-268), pCQV2 (Queen, Id.), And derivatives thereof. The plasmid is , Viral and bacterial elements. Raw protein Methods for recovering in a physically active form are incorporated herein by reference. It is discussed in U.S. Patent Nos. 4,966,963 and 4,999,422. Other prokaryotic See Sambrook et al. For a description of an organism's expression system.   For expression in eukaryotes, host cells for use in practicing the present invention include mammalian cells. Includes milk, bird, plant, insect and fungal cells. For example, in the case of plants, The choice of a promoter may be based, in part, on either constitutive or inducible expression. And at certain stages of plant development and / or at certain tissues It will depend on whether it is desirable to produce FA. Expression of the ORF The considerations for selecting a particular tissue and / or stage of development for Or may depend on the ability of the host cell to allow expression of a particular PUFA . Specific regulatory sequences (eg, US Patent No. 5,463,174, US Patent No. 4,943,674, U.S. Pat.No. 5,106,739, U.S. Pat.No. 5,175,095, U.S. Pat. U.S. Pat. No. 5,188,958 and U.S. Pat. No. 5,589,379). Target expression at specific locations in the host plant, such as seeds, leaves, fruits, flowers, roots, etc. Can be If the host cell is yeast, a transformant that is functional in the yeast cell The transcribed and translated regions are particularly provided by the host species. The transcription initiation regulatory region may be, for example, For example, alcohol dehydrogenase, glyceraldehyde-3-phosphate dehydrogen Kinase (GPD), phosphoglucoisomerase, phosphoglycerate kinase, etc. Genes in glycolysis, or acid phosphatase, lactase, metallothionein And regulatable genes such as glucoamylase. Constitutive transcription Or inducible transcription is desirable. Individual efficiency of the promoter combined with the loading frame, a strong promoter Together with regulatory regions from different promoters that allow inducible transcription. Any one of a number of regulatory sequences, depending on the potential for Can be used in various situations. Of particular interest is the presence of galactose. It is a promoter that is activated in the presence. Galactose-inducible pro The motors (GAL1, GAL7 and GAL10) are responsible for high and regulated levels of yeast. Widely used for protein expression (Lue et al., (1987) Mol. Cell. Biol. 7: 3446; Johns ton, (1987) Microbiol. Rev. 51: 458). Transcription from the GAL promoter is GAL4 protein that binds to the promoter region and activates transcription in the presence of Activated. In the absence of galactose, the antagonist GAL80 is 4 and prevents transcriptional activation by GAL4. Galactose was added by GAL80 Prevents suppression of activation by L4. Preferably, the termination region is a yeast gene In particular, Saccharomyces, Schizosaccharo myces), from Candida or Kluyveromyces Come. In addition, two mammalian genes (γ interferon and α2 Is known to function in yeast.   Nucleotide sequence around translation initiation codon ATG affects expression in yeast cells Has been found to have The desired polypeptide is not sufficiently expressed in yeast If necessary, include an efficient yeast translation initiation sequence for optimal gene expression The nucleotide sequence of the exogenous gene can be modified as described. Saccharomyce For expression in Saccharomyces, this must be done with inefficiently expressed residues. Site-directed mutagenesis of the gene [Saccharomyces 2.) genes, preferably highly expressed genes (eg lactase genes) By in-frame fusing to an object].   As an alternative to expressing a PKS-like gene in the cytoplasm of a plant cell, Targeting chloroplasts to chloroplasts. Target proteins to chloroplasts One approach is to use a leader peptide attached to the N-terminus of the protein. Accompanied by A commonly used leader peptide is plant ribulose-bisphosphate Derived from the small subunit of carboxylase. In addition, to other chloroplast proteins It is also possible to use derived leader sequences. Targeting proteins to chloroplasts Another method for transformation is to transform the chloroplast genome. By projecting high-speed tungsten microparticles coated with Chlamydomonas reinhardtii (1 green algae) Stable transformation of chloroplasts has been described. For example, Blowers et al. Plant Cell (198 9) See 1: 123-132 and Debuchy et al. EMBO J (1989) 8: 2803-2809. Tan Transformation techniques using gustene microparticles are described in Kline et al., Nature (London) (1987) 327: 70-73]. The most common method for transforming chloroplasts is bio Including the use of biolistic technology, but other developed for this purpose It is also possible to use the technique of. The foreign gene product is transferred to the chloroplast (Shrier et al. EMBO  J. (1985) 4: 25-32) or within mitochondria (Boutry et al., Supra). Is described. Transport for transporting nuclear gene products into chloroplasts Regarding the use of peptides, see Tomai et al. Gen. Biol. Chem. (1988) 263: 15104-1510 9 and U.S. Pat. No. 4,940,835. Transporting proteins to chloroplasts Methods for directing are outlined in Kenauf TIBTECH (1987) 5: 40-47.   In order to produce PUFAs in avian species and cells, known in the art According to the method, by introducing a nucleic acid sequence encoding a PUFA enzyme into the cells, Gene transfer can be performed. When transgenic animals are desirable , A vector that carries a PUFA-encoding transgene in embryonic pluripotent stem cells To allow the cells to develop into adult animals (U.S. Pat. No., 215; Ono et al. (1996) Comparative Biochemisty and Physiology A 113 (3): 287-29 2; WO 9612793; WO 9606160). In most cases, to increase PUFA production, The transgene is modified to express high levels of a PKS-like enzyme. The tran Genes, for example, indicate expression in certain tissues and egg parts (eg, yolk). Transcriptional and / or translational regulatory regions functioning in avian cells, such as It can be modified by giving a region. The remains The gene regulatory region is a chicken anemia or avian leukemia virus or avian gene, e.g. For example, it can be obtained from various sources including the chicken ovalbumin gene.   The production of PUFAs in insect cells is based on the baculois that retains the PKS-like transgene. This can be done using a lus expression vector. Baculovirus expression vector Is available from several commercial sources, such as Clontech. Also, Desa Algae (e.g., marine algae) hives that contain and express a Turase transgene Methods for producing lid and transgenic strains are provided. For example, Trans Marine algae can be made as described in U.S. Patent No. 5,426,040. it can. As in the other expression systems described above, the desaturase transgene The timing, extent and activity of expression of the And a translational regulatory region provided in the polypeptide coding sequence. it can. Of particular interest are those that can be induced under preselected growth conditions. Motor area. For example, a sequence encoding a desaturase transgene , Into the genome of a cell into which the transgene is introduced and / or its regulatory region. Introduction of temperature sensitive and / or metabolite responsive mutations for this purpose Can be used.   Growing the transformed host cells under appropriate conditions tailored to the desired end result Let it. In order to grow host cells in culture, typically selected To obtain the largest or most economical yield of PUFAs associated with Optimize conditions. Media conditions that can be optimized include the addition of carbon sources, nitrogen sources, and substrates. , Final concentration of substrate to be added, form of substrate to be added, aerobic or anaerobic growth, Growth temperature, inducer, induction temperature, growth phase at induction, growth phase at harvest, pH, density and This includes maintaining choices. For example, microorganisms such as yeast are preferably yeast peptone. Broth (YPD) and minimal medium (amino acids, yeast nitrogen base and ammonium sulfate) (For example, lacks ingredients for selection, e.g., uracil) Grow using medium. Preferably, the substrate to be added is first dissolved in ethanol I do. If necessary, for example, to induce expression from the GAL promoter, By including or adding fructose, the expression of the polypeptide of interest is increased. Can be guided.   Expression of PKS-like gene polypeptide in host cells expressing PUFA from PKS-like system If it is desired to increase, several methods can be used. PKS-like gene Additional genes encoding the repeptide can be introduced into the host organism . Also, for example, inserting a stronger promoter into the host genome to enhance expression Anxiety or from the mRNA or the encoded protein A stabilizing sequence is deleted by removing its information from the host genome. Alternatively, by adding a stabilizing sequence to the mRNA, the natural PKS (U.S. Pat.Nos. 4,910,141 and See U.S. Patent No. 5,500,365). Therefore, the target host is the expression construct. Has at least one copy of the building and the gene is integrated into the genome Depending on whether it is amplified or present on an extrachromosomal element with high copy number It is possible to have more than one copy. When the target host is yeast Are the four main types of yeast plasmid vectors, namely yeast integrated plasmids. (YIp), yeast self-replicating plasmid (YRp), yeast centromere plasmid (YCp ) And yeast episome-like plasmid (YEp) can be used. YIp, It must lack the yeast origin of replication and must grow as an integrated element in the yeast genome. No. YRp has an autonomously replicating sequence derived from chromosome and has a moderate copy number (20 to 40). It grows as an unstable, segregating plasmid that replicates autonomously. YCp Has a low copy number (10-20), having both an origin of replication and a centromere sequence. Proliferate as a stably segregating plasmid that replicates regularly. YEp is yeast 2μm plus It has a replication origin derived from a mid-side and has a high copy number and autonomously replicates irregularly separated plus Proliferates as mid. The presence of the plasmid in yeast is a marker on the plasmid. Can be assured by maintaining choices regarding Especially interested The reason is that the yeast vector pYES2 (YEp plasmid available from Invitrogen Provides GAL1 galactose inducible promoter for siroprototrophy and expression And pYX424 (constituting the constitutive TP1 promoter and conferring leucine prototrophy) YEp plasmid) (Alber and Kawasaki (1982). J. Mol. & Appl. (Genetics 1: 419) It is.   The choice of host cells depends, in part, on the desired PUFA profile of the transgenic cells. Affected by the natural profile of the feel and host cell. One PU host cell Even when expressing PKS-like gene activity of FA, PKS-like members of another PKS-like system Expression of the gene may result in the production of a novel PUFA not produced by the host cell. is there. Expression of PKS-like gene activity is determined by ORF8 PKS-like inheritance of organisms producing different PUFAs. In certain cases, coupled with offspring expression, the host cell may have a low PKS-like residue for ORF8. The host cell has native gene activity, or has such activity. It may be desirable to mutate. For example, for the production of EPA, the D The NA sequence encodes a polypeptide having PKS-like gene activity in an EPA-producing organism On the other hand, for the production of DHA, the DNA sequence used is a DNA sequence from an organism producing DHA. Column. For use in host cells already expressing PKS-like gene activity, Expression cassettes that result in overexpression of PKS-like genes Down-regulate the activity of existing ORFs (eg, anti- In some cases, it may be necessary to use it with a construct (due to suppression). Similarly, PK Combining ORFs from different organisms producing the same or different PUFAs using an S-like system Can be used. For example, ORF8 of Vibrio is ORF3, 6, 7 And 9 are from Shewanella [they are When combined with Shewanella ORF8, it produces EPA.] Directs DHA expression in primary cells. Therefore, eicosapentaenoic acid (EPA) For production, the expression cassette used is generally the marine bacterium Shuwa. Nella putrefaciens (for Shewanella putrefaciens) (for EPA production) or For PUFA producing organisms such as Vibrio marinus (for DHA production) It contains one or more cassettes containing ORFs 3, 6, 7, 8 and 9 from which they are derived. DHA production To induce, ORF8 can be used, and to produce DHA, ORF8 from Vibrio was replaced by ORF3, 6, 7, and 7 from Shewanella. And 9 can be used. Shewanella gene cluster The organization and numbering system of the ORFs identified within the group are shown in FIG. 1A. The words in this study A map of some of the subclones affected is shown in FIG. 1B. PKS-like gene polypep It is functional in host cells for the expression of Certain transcription and translation initiation and termination regions are coded for by a PKS-like gene polypeptide. Operably linked to the DNA to be loaded.   Constructs containing the PKS-like ORF of interest can be of various standard types, depending in part on the type of host cell. It can be introduced into host cells by any of a variety of techniques. With these technologies Are transfection, infection, bolistic shock, electro Poration, microinjection, scraping, or harboring the gene of interest Any other method of introduction into the main cell is included (U.S. Pat. No. 4,795,855, U.S. Patent No. 5,068,193, U.S. Patent No. 5,188,958, U.S. Patent No. 5,463,174, U.S. Pat.No. 5,565,346 and U.S. Pat. Want to be). The transformation method used includes lithium acetate transformation (Methods in Enzym ology, (1991) 194: 186-187). Incorporate DNA sequences or constructs for convenience In the present invention, a host cell that has been manipulated by any method Or "recombinant". The target host is a host in which the expression construct is present. Will have at least one copy and the gene will be integrated into the genome. Whether it is amplified or amplified or present on an extrachromosomal element with high copy number Accordingly, it is possible to have more than one copy.   For the production of PUFAs, depending on the host cell, several Introduce the polypeptides (ORF3, 6, 7, 8 and 9) as separate expression constructs Or two or more separately introduced or co-transformed into a host cell. It can be combined in a cassette. Use standard transformation protocols . Part of the PKS-like gene required for PUFA synthesis is inserted into a single plant In the case of a plant, it is crossed with a plant containing a complementary gene to synthesize a desired PUFA. Thus, a plant containing the complete complement of the PKS-like gene can be obtained.   PKS-like mediated production of PUFAs can be performed in prokaryotic or eukaryotic host cells. The cells can be cultured or formed as part or all of a host organism, including animals. Can be achieved. In addition, in the production of PUFA, gene transfer and cell Suitable for virus and bacteriophage for targeting and selection Can be used with various cells. Host cells include dicotyledonous plants and monocotyledonous plants Any kind of plant cells, such as foods, cereals, etc., can be used. Of particular interest It has rape (Brassica), Arabidopsis (Arabidopsis), soybean And cultivated plants such as corn. Prokaryotic cells of interest include Escherichia (Esc hericia), Bacillus (Baccillus), Lactobacillus (Lactobaccillus), Cyanobacteria (cy anobacteria) and the like. Eukaryotic cells include plant cells and the details of lactating animals. Mammalian cells such as vesicles, bird cells such as chicken cells, and insects, fungi and algae Other cells suitable for genetic manipulation, including cell-like, are included. Host animals include, for example, Mouse, rat, rabbit, chicken, quail, turkey, cow, sheep, Genes for rapid growth of transgene expressing populations such as pigs, goats and yaks Animals suitable for genetic manipulation and cloning are included. In the case of animals, the gene Modification of the regulatory region allows PKS-like transgenes to be targeted to organelles, tissues and It can be adapted for expression in body fluids. Of particular interest are host animals Of PUFAs in human breast milk.   Host microorganisms include, for example, Saccharomyces cerev isiae), Saccharomyces carlsberge nsis) or other yeasts such as Candida, Kluyveromyces (Kluyv eromyces) or other fungi, such as filamentous fungi, such as Aspergillus ), Neurospora, Penicillium and the like. Desirable characteristics of the host microorganism include, for example, if it is genetically well-characterized. Can be used for high-level expression of the product using ultra-high density fermentation GRAS (genera) because the proposed end product is intended for human consumption lly recognized as safe; generally recognized as safe) That is. Of particular interest are the cell hosts in the present invention. Yeast, especially baker's yeast (S. cerevisiae). Especially interested SC334 (Mat a pep4-3 prbl-1122 ura3-52 leu2-3,112regl-501 ga l1; (Hovland P. (1989) Gene 83: 57-64), BJ1995 (Yeast Genetic Stock Centre, 1021 Donner Laboratory, Berkely, CA94720), INVSC1 (Matα hiw3Δ1 leu2 trp1- 289 ura3-52 (Invitrogen, 1600 Faraday Ave. , Carlsbad, CA 92008) and IN VSC2 (Matα his3Δ200 ura3-167; (Invitrogen)). Harbors bacterial cells It can also be used mainly. This includes E. coli (E. coli). Or PK As a host for introducing products of the S-like pathway into products such as yogurt, Hosts such as Bacillus (Lactobaccillus) species can be used.   The transformed host cells are selected for a marker contained on the introduced construct. Can be identified by selection. Alternatively, many transformation techniques involve host cells. To introduce large numbers of DNA molecules, separate the marker constructs with the desired construct. Can be introduced. Typically, the transformed host is placed on a selective medium. Selected for their ability to grow on Selection media may contain antibiotics or Or factors necessary for growth of the untransformed host (eg, trophic or growth factors) May be missing. Introduced marker genes confer antibiotic resistance Or encoding an essential growth factor or enzyme and expressed in the transformed host In some cases, it may allow for growth on selective media. Preferably, kanamycin and Of particular interest is resistance to minoglycoside G418 (U.S. Pat.No. 5,034,322) Please refer to). In the case of yeast transformants, any marker that functions in yeast (Eg, on media lacking uracil, leucine, lysine, or tryptophan) Which can proliferate) can be used.   When the expressed marker protein is directly or indirectly detectable Next, a transformed host can be selected. The marker protein is used alone Or as a fusion with another protein. The marker The protein may be detected by its enzymatic activity. Lactosidase can convert the substrate X-gal to a colored product, Lase is capable of converting luciferin to a luminescent product. The marker The protein may be one that is detected by its light-generating or modifying properties, For example, the green fluorescent protein of the luminescent jellyfish (Aequorea victoria) , Emits fluorescence when irradiated with blue light. The marker protein or molecular tag ( For example, antibodies can be used to detect it can. Cells expressing the marker protein or tag can be, for example, visually Or by techniques such as FACS or panning using antibodies. it can.   PUFAs produced using the methods and compositions of the present invention are available as free fatty acids and Conjugation of acylglycerol, phospholipid, sulfated lipid or glycolipid In a host plant tissue and / or plant part It can be extracted from host cells by various means well known in the art. So Means such as extraction with organic solvents, sonication, for example using carbon dioxide Supercritical fluid extraction and physical means such as pressing, or a combination thereof Can be included. Of particular interest are methanol and chlorophos. It is an extraction with LUM. Acidify the aqueous layer as appropriate to protonate negatively charged parts Thus, the distribution of the desired product into the organic layer can be increased. Extraction Thereafter, the organic solvent can be removed by evaporation under a stream of nitrogen. The product is When isolated in conjugated form, the product is cleaved enzymatically or chemically. To release the free fatty acids or the simpler conjugate of interest. Further processing is performed to obtain the desired end product. Desirably conjugated form Fatty acids are cleaved with potassium hydroxide.   If further purification is required, standard methods can be used. Like that Methods include extraction, treatment with urea, fractional crystallization, HPLC, fractional distillation, silica gel chromatography. Including mattography, high speed centrifugation or distillation, or a combination of these techniques Can be By known techniques such as alkylation or iodination, acid or Protection of a reactive group such as an alkenyl group can be performed in any step. Use The method involves methylation of a fatty acid to obtain a methyl ester. Similarly, The protecting group can be removed at any step. Desirably contains DHA and EPA Can be purified by treatment with urea and / or fractional distillation. Wear.   The present invention has several uses. Probes based on the DNA of the present invention Useful in methods for isolating molecules or detecting organisms that express PKS-like genes You. The DNA or oligonucleotide, when used as a probe, Must be detectable. This is usually the case for incorporation of modified residues, for example. Achieved by labeling at a more internal site or at the 5 'or 3' end. So Labels such as can be directly detectable or can be detected Can be attached to a labeled secondary molecule, or Attached to a labeled secondary molecule and a detectably labeled tertiary molecule It is possible. This method does not involve unacceptable levels of background signal. Extensions should be applied as far as practicable to obtain a signal that can be detected satisfactorily. Can be. The secondary, tertiary or cross-linking system can be any other molecule (label or other antibody Or the use of antibodies against Any molecule, such as the biotin-streptavidin / avidin system, may be involved. And it is possible. Typically, detectable labels include radioisotopes, chemical or Are molecules that produce or alter light enzymatically, enzymes that provide a detectable reaction product, Molecules with fluorescent or light-emitting properties that change upon binding, fluorescent molecules or binding Includes children. Specific examples of the labeling method are described in U.S. Pat.No. 5,011,770 . Alternatively, the binding of the target molecule is altered by the heat of solution upon binding of the probe to the target. Is measured by isothermal titration calorimetry or by the probe or standard. Target is coated on the surface and the surface generated by the binding of the target or probe, respectively. By detecting changes in their light scattering (e.g., Can be detected directly.   PUFAs produced by recombinant means are useful in a wide variety of areas. Hi Supplementing animals or animals with various forms of PUFAs, not only the level of added PUFAs, The levels of their downstream metabolites may also increase. Complex regulatory mechanisms are Combining PUFAs or adding various conjugates of PUFAs can The desired level of specific PU in an individual by inhibiting, controlling or suppressing It may be desirable to get FA. In this case, the PKS-like gene or Expression of transcription PKS-like gene transcripts is found in plant parts and / or plant tissues. The level of a particular PUFA or derivative thereof may be altered. PKS-like gene polype The region encoding the peptide may be expressed alone or with other genes and Contains a higher proportion of the desired PUFA than the tissue and / or plant parts of the decoration or Tissues and / or plants containing a PUFA composition that more closely resembles the PUFA composition of human breast milk Give part (Prieto et al., PCT Publication WO 95/24494).   PUFAs or derivatives thereof produced by the disclosed method provide intravenous nutritional support. As a dietary supplement for patients receiving or to prevent or treat malnutrition Can be used to For food supplements, purified PUFA or The derivative is formulated so that the consumer will ingest the desired amount of PUFA in normal use It can be added to a cooked cooking oil, fat or margarine. In addition, the PU FA can be added to infant formulas, nutritional supplements or other foods. It is also useful as an anti-inflammatory and cholesterol lowering agent.   Certain fatty acids, such as EPA, are used in milk to better mimic the PUFA composition of human breast milk. It can be used to modify the composition of the infant formula. Predominant in human breast milk Triglycerides have been reported to be 1,3-di-oleoyl-2-palmitoyl. , 2-palmitoyl glyceride is better than 2-oleoyl or 2-lineoyl glyceride It is reported to be well absorbed (US Pat. No. 4,876,107). Typically, human Breastfeeding has a DHA of about 0. 15% to about 0. 36%, EPA approx. 03% to about 0. 13%, ARA approx. 30 % To about 0. 88%, DGLA approx. 22% to approx. 67% and GLA approx. 27% to about 1. 04% included Have a fatty acid profile. GLA: DGLA: ARA preferred for infant formula The ratios are each from about 1: 1: 4 to about 1: 1: 1. If you are skilled in the art, The amount of oil giving the ratio can be determined without undue experimentation. Also Make the fatty acid composition of animal tissues or milk more favorable for human or animal consumption Animal feed supplementation of PUFAs or host cells containing them to It can be used as an agent.   For pharmaceutical use (human or veterinary), the compositions are generally administered orally. But by any route by which they can be successfully absorbed, e.g., parenterally (e.g., That is, subcutaneously, intramuscularly or intravenously), rectally or intravaginally, or topically (eg, , As a skin ointment or lotion). Available In some cases, gelatin capsules are a preferred form for oral administration. Also, The food supplement may be intended for the oral route of administration. Unsaturated acid of the present invention Is a salt, ester, amide or prod of the fatty acid in conjugated form or It can be administered as a rag. Pharmaceutically acceptable salts are included in the present invention, Preferred are sodium, potassium or lithium salts. Also, PCT public Open N-alkyl polyhydroxyamine salts described in WO 96/33155, such as N-methyl glu Contains cumin. Preferred esters are ethyl esters.   The PUFA of the present invention is administered alone or together with a pharmaceutically acceptable carrier or excipient. can do. As a solid salt, PUFA can be administered in tablet form. Wear. For intravenous administration, PUFA or a derivative thereof is commercially available from Intralipids and other commercial sources. It can be enclosed in an agent. If desired, the individual components of the formulation may be single or multiple. It can be provided separately, in the form of a kit for use in numbers. Individual A typical dose of fatty acids is about 0. 1 mg to 20 g or even 100 g, preferably 10 mg to 1, 2, 5, or 10 g per day (as needed), or a derivative form thereof This is the equivalent amount. From about 2 to about 30% fat by weight, calculated as triglycerides Parenteral nutritional compositions that include an acid are included in the present invention. Other vitamins, if desired, Especially contains fat soluble vitamins such as vitamins A, D, E and L-carnitine it can. If desired, a preservative such as tocopherol, typically at about 0. 1% by weight Can be added.   The following examples are illustrative only and do not limit the invention.                                  Example Example 1 ORF entity derived from Vibrio marinus   Primer [FW based on the Shewanella ORF6 (Sp ORF6) sequence  5 'primer: CUACUACUACUACC for Vibrio and SS9 respectively AAGCTAAAGCACTTAACCGTG and CUACUACUACUAACAGCGAAATGCTTATCAAG, and 3'B W primer: CAUCAUCAUCAUGCGACC for both Vibrio and SS9 AAAACCAAATGAGCTAATAC] and borophy producing Vibrio and EPA Rick Photobacter (Bartlett, UC San Diego) Polymerase chain reaction using a genomic DNA template derived from About 400 bases for Vibrio marinus by PCR For SS9, a PCR product of about 900 bases was obtained. Sp ORF6 by number measurement Showed greater than 75% homology to its corresponding fragment (see FIG. 25).   Next, a Vibrio cosmid library was prepared, and the Vibrio cosmid library was prepared. 2.) Using the ORF6 PCR product as a probe (see FIG. 26), at least OR Clones containing F6 were selected by colony hybridization.   Additional sequences of selected cosmids (eg, cosmid # 9 and cosmid # 21) Through the same sequence as the ORF 6-9, which is homologous to the ORF 6-9 of Shewanella Clusters with ORFs organized in different order (ORF6-9) (Figure 5) was obtained (FIG. 7). The Vibrio ORF from this sequence is at positions 17394-36115 Found and include ORFs 6-9.                                    table Diagram of Vibrio operon         17394-25349 length = 7956nt         25509-28157 length = 2649nt         28209-34262 length = 6054nt         34454〜36115 Length = 1662nt The name of the ORF of the Shewanella gene is based on that disclosed in FIG. Published on the Shewanella cluster ( Yazawa et al., US Patent No. 5,683,898). For example, ORF3 in FIG. It was read in the opposite direction to the other ORFs and compared with Yazawa et al., US Pat. No. 5,683,898. Yazawa et al., U.S. Patent No. 5,683,898 (see FIG. 24). ).   Sequences homologous to ORF3 can be located near ORF6 (17,000 bases upstream of ORF6) or near ORF9 (O (About 4,000 bases downstream of RF9). Phosphopantetheinyl trans Motif characteristic of ferase (Lambalot et al. (1996) Current Biology 3: 923-93 6) is the Vibrio strain screened for these motifs. Did not exist in the column. Also, Vibrio and SC2A Shuwanera (She wanella) (also provided by the University of San Diego, which can also produce EPA Genomic digest of the other bacterium) is derived from Sp ORF3 There was no match for the probe. ORF3 is in Vibrio But its DNA may not be homologous to the Sp ORF3 DNA, and And / or may be located in parts of the genome that have not been sequenced.   FIG. 6 shows the sequence of an approximately 19 kb Vibrio clone containing ORFs 6 to 9. I do. 7 and 8, Vibrio marinus and Shu Genes related to the PKS-like system of Shewanella putrefaciens Compare raster regimes. 9 to 12 show the corresponding ORFs 6, 7, 8 and The level of sequence homology between 9 is shown.                                   Example 2 ORF 8 directs DHA production   As described in Example 1, DNA homologous to Sp ORF6 can also produce EPA Found in an unrelated species, SS9 Photobacterium. Also ORFs that are homologous to Sp ORFs 6-9 produce DHA and produce Vibrio marinus. s). These ORFs inhibit EPA synthesis in E. coli. The deletion in each of the Sp ORFs 6 to 9 (Yazawa (1996) supra) is A series of experiments were designed to complement with the corresponding homologous gene from brio).   Using the Sp EPA cluster, if any of the Vibrio ORFs 6-9 are D It was confirmed whether it caused the production of HA. Obtained for each of the SP ORFs Deletion mutants are EPA and DHA null. Each deletion is then replaced with the lac promoter. And complemented with the corresponding Vibrio ORF expressed behind (FIG. 13).   Complementation of the Sp ORF6 deletion by Vibrio ORF6 restores EPA production Was. Complementing the deletion of Sp ORF7 and ORF9 gave similar results. . In contrast, complementation of the Sp ORF8 deletion caused the production of C22: 6. But Thus, Vibrio ORF8 appears to be a key element in the synthesis of DHA. Figure 14 and 15 show the complementation of Sp del ORF6 by Vibrio ORF6 (EPA (without DHA) )) And Sp del ORF with Vibrio ORF8 8 shows a chromatogram of the fatty acid profile from the complement of 8 (DHA). FIG. Shows the percentage of fatty acids for RF8 complementation, where again, ORF8 produces DHA. It has been shown to cause life.   These data indicate that polyketide-like synthetic genes with related or similar ORFs Pups are combined and expressed in a heterologous system to produce different PUFA species in the host system. ORF8 can be used to determine the final chain length Has a certain role. Vibrio ORF 6, 7, 8 And 9 restore EPA synthesis. In the case of Vibrio ORF8 , DHA (about 0.7%) is present with EPA (about 0.6%), which means that this gene Demonstrates significant role in DHA vs EPA synthesis directives for these systems are doing.                                 Example 3 DHA Requirements for the production of   Combination of Vibrio ORF8 with cluster ORF6-9 with Vibrio ORF8 To determine how to use them together and to determine the synthesis of DHA Part of the Vibrio ORF8 and other Vibrio ORF6-9 clusters Or some combinations with all were made.   Vibrio ORFs 6-9 were complemented with Sp ORF3. Figure 1 shows the result of this complementation. Shown in 6b and 16c. Significant amounts of DHA measured (greater than about 9%) and EPA Absence is an ORF other than Vibrio ORF6-9 in combination with Sp ORF3 Is not required for DHA synthesis. This is because Sp ORF3 is a bacterial PUFA Suggests a universal role in the synthesis of.   Regarding the production of DHA versus EPA, in order to specifically produce DHA, Vibrio (V ibrio) ORF8 in combination with other Vibrio ORFs in the 6-9 cluster May be necessary. Role of Vibrio ORF9 in DHA synthesis About the role of each combination such as Vibrio ORF (6,8), (7,8), (8,9) Is currently under study.                                 Example 4 Plant expression construct   To facilitate the cloning of large fragments and their subsequent manipulation Designed a cloning vector with very few restriction sites. Array AAGCCC Oligonucleotides with GGGCTT and GTACAAGCCCGGGCTTAGCT are annealed to each other The adapter was assembled by ringing. Vector pBluescript II SK + (Stratagene) after digestion with the restriction endonucleases Asp718 and SstI, An adapter was ligated to the vector. The resulting vector pCGN7769 was blunt-ended. Single SrfI (and embedded SmaI) clone for cloning DNA fragments Had a tanning site.   Contains a napin cassette from pCGN3223 (US Pat. No. 5,639,790) To a large DNA fragment containing multiple restriction sites. Make it more useful for cloning, and into a plant binary transformation vector It enabled the cloning of multiple napin fusion genes. Vector pBCSK + (Strata gene) after digestion with the restriction endonuclease BssHII, followed by the sequence CGCGATTTAAATGGCGCG Self-annealed oligonucleotide of CCCTGCAGGCGGCCGCCTGCAGGGCGCGCCATTTAAAT Was ligated to the vector to construct the vector pCGN7765. Plastic Smids pCGN3223 and pCGN7765 were digested with NotI and ligated together. The obtained vector PCGN7770 (Fig. 17) contains the pCGN7765 backbone and napin seeds from pCGN3223. And a specific expression cassette.Shewanella construct   In order to introduce appropriate cloning sites at 5 'and 3' of the ORF using PCR, The gene encoding the Shewanella protein was mutagenized. The template for the PCR reaction was cosmid pEPA (Yazawa et al., Supra) DNA. Pfu DNA PCR reactions were performed using the polymerase according to the manufacturer's protocol. S The PCR product was cloned into pCGN7769 digested with rfI. Primer CTGC AGCTCGAGACAATGTTGATTTCCTTATACTTCTGTCC and GGATCCAGATCTCTAGCTAGTCTTAGCTG ORF3 was amplified using AAGCTCGA to generate plasmid pCGN8520. Primers TCTAGACTCGAGACAATGAGCCAGACCTCTAAACCTACA and CCCGGGCTCGAGCTAAT Amplify ORF6 using TCGCCTCACTGTCGTTTGCT to generate plasmid pCGN7776 Was. Primers GAATTCCTCGAGACAATGCCGCTGCGCATCGCACTTATC and GGTACCAGATCTT Amplify ORF7 using TAGACTTCCCCTTGAAGTAAATGG to generate plasmid pCGN7771 Done. Primers GAATTCGTCGACACAATGTCATTACCAGACAATGCTTCT and TCTAGAGTC ORF8 was amplified using GACTTATACAGATTCTTCGATGCTGATAG and the plasmid pGCN7775 Generated. Primers GAATTCGTCGACACAATGAATCCTACAGCAACTAACGAA and TCTAG ORF9 was amplified using AGGATCCTTAGGCCATTCTTTGGTTTGGCTTCTC and the plasmid pCGN7 Generated 773.   By DNA sequencing of the inserts of pCGN7771, pCGN8520 and pCGN7773, the PCR The integrity of the product was confirmed. ORF6 and ORF8 had very large sizes . To avoid sequencing of all clones, the central part of the ORF was Replaced. A 6.6 kilobase PacI / BamHI fragment of pEPA containing the central portion of ORF6 And pCGN7776B4, which was ligated to pCGN7776 digested with PacI / BamHI. In ORF8 A 4.4 kb BamHI / BglII fragment of pEPA containing the central portion was digested with BamHI / BglII. The resulting product was ligated to pCGN7775 to obtain pCGN7775A. The region adjacent to the pEPA fragment And the cloning junction was confirmed by DNA sequencing.   Plasmid pCGN7771 is cut with XhoII and BglII and digested with SalI and BglII Linked to pCGN7770. The obtained napin / ORF7 gene fusion plasmid was cloned into pCGN7783 I decided to call it. Plasmid pCGN8520 is cut with XhoI and BglII and SalI and And ligated into pCGN7770 after digestion with BglII. The obtained napin / ORF3 gene fusion Rasmid has been named pCGN8528. Plasmid pCGN7773 with SalI and BamH I was cut and ligated into pCGN7770 after digestion with SalI and BglII. Napin / O obtained The RF9 gene fusion plasmid was designated as pCGN7785. Plasmid pCGN7775 A is cut with SalI and SalI And ligated to pCGN7770 after cleavage. The obtained napin / ORF8 gene fusion plasmid It was named pCGN7782. Plasmid pCGN7776B4 is cut with XhoI and deleted with SalI. The product was ligated to pCGN7770. The obtained napin / ORF6 gene fusion plasmid was 7786B4.   The binary vector pCGN5139 for plant transformation was transformed into pCGN1558 (McBride and ummerfelt (1990) Plant Molecular Biology, 14: 269-276). pCGN1558 Polylinker as a HindIII / Asp718 fragment as a unique restriction endonuclease With a polylinker containing AscI, PacI, XbaI, SwaI, BamHI and NotI Replaced. The Asp718 and HindIII restriction endonuclease sites are in pCGN5139 Is held. pCGN5139 is digested with NotI and linked to NotC digested pCGN7786B4. Tied. The resulting binary vector containing the Napin / ORF6 gene fusion was It was named pCGN8533. Plasmid pCGN8533 was digested with Sse8387I and Sse838 It was ligated to pCGN7782 digested with 7I. Napin / ORF6 gene fusion and Napin / O The resulting binary vector containing the RF8 gene fusion was cloned into pCGN8535 (FIG. 18). I decided to call it.   The plant binary transformation vector pCGN5139 was digested with Asp718 and digested with Asp718. Was linked to pCGN8528. Resulting binner containing napin / ORF3 gene fusion The lead vector was designated as pCGN8532. Plasmid pCGN8532 deleted with NotI And ligated to pCGN7783 digested with NotI. Napin / ORF3 gene fusion and The resulting binary vector containing the napin / ORF7 gene fusion was cloned into pCGN8534. I decided to call it. Plasmid pCGN8534 is digested with Sse8387I and digested with Sse8387I And linked to pCGN7785. Napin / ORF3 gene fusion, Napin / ORF7 gene fusion The resulting binary vector containing the fusion and napin / ORF9 gene fusion , PCGN8537 (FIG. 19).Vibrio construct   All Vibrio ORFs for plant expression use Vibrio (Vibrio) as the starting molecule. rio) Obtained using cosmid # 9. Vibrio cosmid # 9 is from Example 1 (Vibrio) using the Vibrio ORF6 PCR product described in It was one of the cosmids isolated from the cosmid library.   PCR primers TCTAGAGTCGACACAATGGCGGAATTAGCTGTTATTGGT and GTCGACGGATCC Using CTATTTGTTCGTGTTTGCTATATG to encode Vibrio ORF7 The gene (FIG. 6) was mutagenized and Sal upstream of the open reading frame. An I site was introduced downstream of the open reading frame at a BamHI site. PCR Primers GTCGACGGATCCACAATGAATATAGTAAGTAATCATTCGGCA and GTCGACCTCGAGTT Gene encoding Vibrio ORF9 using AATCACTCGTACGATAACTTGCC Mutants were mutated to create a BamHI upstream of the open reading frame. An XhoHI site was introduced downstream of the open reading frame. The system The restriction site was introduced using PCR and the integrity of the mutagenized plasmid was determined by the DNA sequence. Confirmed by Using the Vibrio ORF7 gene as a SalI-BamHI fragment, Cloning into the napin cassette of pCGN7770 (FIG. 17) digested with -BglI, p CGN8539 was obtained. The Vibrio ORF9 gene was converted to a SalI-BamHI fragment as Sal- Cloning into the napin cassette of pCGN7770 (FIG. 17) digested with BglI, I got GN8543.   Mutagenesis of the genes encoding Vibrio ORF6 and ORF8 A SalI site adjacent to the open reading frame was introduced. Next to ORF6 The flanking SalI site was introduced using PCR. The primer used was CCCGGGTCGAC ACAATGGCTAAAAAGAACACCACATCGA and CCCGGGTCGACTCATGACATATCGTTCAAAATGTCACT GA. The central 7.3 kb BamHI-XhoI fragment of the PCR product was transferred to Vibrio It was replaced with the corresponding fragment from cosmid # 9. Mutagenized ORF6 is transferred to pCGN7770 Cloning into the SalI site of the pin cassette resulted in plasmid pCGN8554.   Different methods were used for mutagenesis of ORF8. BamHI fragment containing ORF8 Was subcloned into plasmid pHC79 to obtain cosmid # 9 ″. The SalI site upstream of the region to the oligonucleotide TCGACATGGAAAATATTGCAGTAGTAGGTATT GCTAATTTGTTC and Introduced on adapter containing CCGGGAACAAATTAGCAATACCTACTACTGCAATATTTTCCATG . The adapter was ligated to cosmid # 9 "after digestion with SalI and XmaI. A SalI site was introduced downstream of the stop codon using PCR for mutagenesis. The end The DNA fragment containing the connection codon was prepared using primers TCAGATGAACTTTATCGATAC and TCATGA Made using cosmid # 9 "as a template with GACGTCGTCGACTTACGCTTCAACAATACT did. The PCR product was digested with the restriction endonucleases ClaI and AatII and the same enzymes And cloned into cosmid # 9 "derivative digested with to yield plasmid 8P3. The SalI fragment from 8P3 was cloned into SalI digested pCGN7770 to generate pCGN8 I got 515.   Contains Shewannella ORF3 under the control of the Napin promoter Digest pCGN8532, a binary plant transformation vector, with NotI, The NotI fragment of pCGN8539 containing the Vibrio ORF7 gene fusion was inserted into pCG N8552 was obtained. Shewannella ORF under the control of the Napin promoter 3 and the plasmid pCGN8556 containing Vibrio ORFs 7 and 9 ( Figure 23) shows that the Sse8357 fragment from pCGN8543 was cloned into pCGN8552 digested with Sse8387. It was constructed by training.   The NotI digested napin / ORF8 gene from plasmid pCGN8515 was digested with NotI. Cloning into digested plant binary transformation vector pCGN5139, GN8548 was obtained. The napin / ORF6 gene from pCGN8554 digested with Sse8387 Then, it was cloned into the Sse8387 site of pCGN8566. Napin / ORF6 gene fusion The resulting binary vector containing the body and the napin / ORF8 gene fusion, pCGN8560 (FIG. 22).                                 Example 5 Plant transformation and PUFA production EPA Production of   The Shewanella constructs pCGN8535 and pCGN8537 can be the same or different. It can be transformed into various plants. If separate plants are used, the Transgenic plants are crossed to obtain a heterozygous plant containing both constructs. A mixed seed can be obtained.   pCGN8535 and pCGN8537 were separately expressed in western rape (Brassica napus) Convert. Plants are selected on a medium containing kanamycin and the full-length The transformation by the insert is confirmed by Southern analysis. ORF3, 6, 7 Western analysis for protein expression of the enzyme encoded by, 8 or 9 Can be used to test immature seeds, where the best expressing pC GNE8535 and pCGN8537T₁Plants transformed for further experimentation and crossing Select and grow for. Alternatively, the Southern method showed an insertion, T₁Transformed with Plants were crossed with each other to obtain T_TwoGet the seeds. Of this seed Half of the seeds can be analyzed directly from the expression of EPA in the fat fraction. Grow the remaining half of the seeds with the best EPA-producing events and use traditional breeding techniques Growing more to obtain a Brassica line for the production of EPA.   Plasmids pCGN7792 and pCGN7795 were also transferred to western rape (Brassica napus ) Introduce simultaneously into host cells. Standard transformation protocols (eg, US See US Patent No. 5,463,174 and US Patent No. 5,750,871), but Agrobacteria containing both plasmids are mixed together and co-cultured. Incubate with rape (Brassica) cotyledons during the feeding process. The resulting plant Are transformed with both plasmids.DHA Production of   As described for the production of EPA, pCGN8556 and pCGN8556 Plants can be formed by introducing GN8560 into separate plants or simultaneously into the same plant. Change quality.   Alternatively, the Shewanella ORF can be replaced with the Vibrio ORF6. And 8 cooperate, for example, to transform plants with the constructs pCGN8560 and pCGN7795. Can be used to allow expression of the corresponding ORF in plant cells. it can. This combination provides the ORFs 3, 7 and 9 of Shewanella Includes with ORF6 from Vibrio and ORF8 from Vibrio Gives a PKS-like gene arrangement. As mentioned above, ORF8 It is a PKS-like gene that controls the type of final PUFA product. Therefore, the obtained shape Transgenic plants produce DHA in vegetable oils.                                 Example 6 Transgenic plant ab containing Shewanella PUFA gene Lana (Brassica) plant   52 plants co-transformed with plasmids pCGN8535 and pCGN8537 were subjected to PCR. More analysis shows that the Shewanella ORF is the transgenic plant It was confirmed whether or not it exists. 41 plants contain plasmid pCGN8537, 35 Individual plants contained pCGN8535. 11 of the plants are required for EPA synthesis All five ORFs. Some plants use the binary plasmid Contains genes from both of the genes, but lacks at least one of the ORFs It was likely. Analysis on about 20 additional plants is currently underway.   Twenty-three plants transformed with pCGN8535 alone were analyzed by PCR and To determine if a Shewanella ORF is present in the transgenic plant. Was. Thirteen of these plants contain Shewanella ORF6 and It contained both Shewanella ORF8. Six of the plants It contained only one ORF.   Nineteen plants transformed with pCGN8537 alone were analyzed by PCR and To determine if Shewanella ORF is present in the transgenic plant. Was. Eighteen of the plants are Shewanella ORF3, Shewanella (Shewanella) ORF7 and Shewanella ORF9. One plant contained Shewanella ORFs 3 and 7.Arabidopsis   More than 40 transformers co-transformed with plasmids pCGN8535 and pCGN8537 A transgenic Arabidopsis plant is grown in our growth box Growing. PCR components to confirm which of the ORFs are present in the plant Analysis is currently underway.   Plant cells are transformed using PKS-like genes from various organisms, Plant Cell Membrane or Plant Seed Oil Fat via PUFA Biosynthesis in Transformed Plant Cells Modification of the acid composition has been made possible by the present invention. Due to the nature of the PKS-like system The fatty acid end product produced in the plant cell contains a number of specific chemical structures. Can be selected or designed. For example, the fatty acids are May include: keto or hydroxy at various positions along the carbon chain. In the number and type of double bonds (cis or trans) Mutation; number and number of branches (methyl, ethyl and longer branches) from the straight carbon chain And mutations in type; and mutations in saturated carbons. Also, the final product fatty acids Each length can be controlled by the particular PKS-like gene used.   All publications and patent applications mentioned in this specification are Equivalent to the technical level of the trader. All publications and patent applications are Or where the patent application is specifically and individually indicated to be incorporated by reference. To the same extent, they are incorporated herein by reference.   The present invention has been fully described above and is intended to be within the spirit or scope of the appended claims. Many changes and modifications can be made to the present invention without departing from the invention. Will be apparent to those skilled in the art.

[Procedure for Amendment] Article 184-8, Paragraph 1 of the Patent Act [Date of Submission] December 30, 1998 (December 30, 1998) [Contents of Amendment] [Figure 1] FIG. FIG. 2 FIG. 2 FIG. 3 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 4 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 5 FIG. 6 FIG. 6 FIG. 6 FIG. 6 FIG. 6 FIG. 6 FIG. 6 FIG. 6 FIG. 6 FIG. 6 FIG. 6 FIG. 6 FIG. 6 FIG. 7 FIG. 7 FIG. 8 FIG. 9 FIG. 10 FIG. 11 FIG. FIG. 13 FIG. 14 FIG. FIG. 16 FIG. FIG. FIG. FIG. FIG. 21 FIG. FIG. 23 FIG. 24 FIG. 25 FIG. 26 FIG. 26 FIG. 26 FIG. 26

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 5/10 C12R 1:01) C12P 7/64 (C12N 1/21 // (C12N 15/09 ZNA C12R 1: 225) C12R 1:01) (C12N 1/21 (C12N 1/21 C12R 1:19) C12R 1: 225) C12N 15/00 ZNAA (C12N 1/21 5/00 B C12R 1:19) C ( 72) Inventor Rasner, Michael United States 95616 Falcon Avenue, Davis, California 721

Claims (1)

[Claims]   1. Bibs selected from the group consisting of ORF6, ORF7, ORF8 and ORF9 shown in FIG. An isolated comprising the nucleotide sequence of Rio Marinus (Vibrio marinus) Nucleic acids.   2. Includes nucleotide sequence encoding polypeptide of polyketide-like synthesis system The isolated nucleic acid of claim 1 wherein the system is expressed in a host cell. An isolated nucleic acid characterized by producing saenoic acid.   3. 3. The isolated nucleotide of claim 2, wherein said nucleotide sequence is from a marine bacterium. Nucleic acids.   4. The nucleotide sequence is as shown in FIG. 6 for Vibrio marinus. 3.) The isolated nucleic acid of claim 2, which is ORF8.   5. Bibs selected from the group consisting of ORF6, ORF7, ORF8 and ORF9 shown in FIG. At least 50 nucleotides of the nucleotide sequence of Rio Marinus (Vibrio marinus) An isolated nucleic acid comprising a nucleotide sequence substantially identical to the sequence of a tide .   6. At least one copy of the isolated nucleic acid according to claim 1 or 2. A recombinant microbial cell comprising   7. Polyketide-like synthesis system required for the cells to produce long-chain polyunsaturated fatty acids The recombinant microbial cell according to claim 6, comprising the following components:   8. The recombinant microbial cell of claim 7, wherein said cell is a eukaryotic cell.   9. 9. The eukaryotic cell according to claim 8, wherein the eukaryotic cell is a fungal cell, an algal cell or an animal cell. Of recombinant microbial cells.   Ten. The fungal cell is a yeast cell, and the algal cell is a marine algal cell. 10. The recombinant microbial cell according to 9.   11． 7. The recombinant microbial cell of claim 6, wherein said cell is a prokaryotic cell.   12． The recombinant microorganism of claim 11, wherein the cell is a bacterial cell or a cyanobacterial cell. Object cells.   13. The recombinant microbial cell is a non-recombinant microbial cell lacking the isolated nucleic acid. 7. The microbial cell of claim 6, wherein the microbial cell is rich in 22: 6 fatty acids as compared to.   14. Growing a microbial culture cell having a plurality of microbial cells , A method for producing docosahexaenoic acid in cultured microorganism cells, Alternatively, the ancestor of the microbial cell is a nucleic acid encoding a polypeptide of the polyketide synthesis system Has been transformed with a vector comprising one or more nucleic acids having a nucleotide sequence, One or more of the above-described nucleic acids is operably linked to a promoter. The one or more nucleic acids are expressed and docosahexaenoic acid is produced in the cultured cells of the microorganism. A production method characterized in that the production is carried out under the conditions in which it is produced.   15． In a plant cell, comprising growing a plant having a plurality of plant cells The method of producing a long-chain polyunsaturated fatty acid in the plant cell, One or more polypeptides of a polyketide synthesis system that produces long-chain polyunsaturated fatty acids With a vector containing one or more nucleic acids having a nucleotide sequence encoding Wherein each of the nucleic acids is a promoter that is functional in a plant cell, The polypeptide is operably linked so that the growth is controlled by the expression of the polypeptide and the A method for producing a saturated fatty acid, which is carried out under conditions in which the fatty acid is produced in the plant cell. Law.   16． The long chain polyunsaturated fatty acids produced in the plant cells are 20: 5 and 22: 6 fatty acids 16. The production method according to claim 15, wherein   17． The nucleic acid is the same as the Vibrio marinus ORF6 or ORF shown in FIG. 7, ORF8 and ORF9, and Shuwanella putrefaciens shown in FIG. Shewanella putrefaciens) group consisting of ORF3, ORF6, ORF7, ORF8 and ORF9 A nucleotide sequence encoding any one of the polypeptides selected from 16. The production method according to claim 15, wherein   18． 16. The method of claim 15, wherein the nucleic acid construct is derived from two or more polyketide synthesis systems. Production method.   19. A recombinant plant cell producing a long-chain polyunsaturated fatty acid, The fatty acid is exogenous to the plant cell, and the recombinant plant cell     One or more polypeptides of a polyketide synthesis system that produces long chain polyunsaturated fatty acids One or more nucleic acids having an encoding nucleotide sequence, each of which comprises: Operably linked to a promoter that is functional in the plant cell. Transforming a plant cell or an ancestor of the plant cell with a vector containing the nucleic acid Get the replacement plant cells,     The polypeptide is expressed and long-chain polyunsaturated fatty acids are produced in the plant cells Under a condition, produced according to a method comprising growing the recombinant plant cell. Characterized recombinant plant cells.   20. The recombinant plant according to claim 19, wherein the recombinant plant cell is a recombinant seed cell. cell.   twenty one. The recombinant plant cell according to claim 20, wherein the recombinant seed cell is a recombinant embryo cell. Vesicles.   twenty two. The long chain polyunsaturated fatty acid produced in the plant cell is eicosapentaenoic acid 16. The manufacturing method according to claim 15, wherein   twenty three. The long-chain polyunsaturated fatty acid produced in the plant cell is docosahexaenoic acid. 16. The production method according to claim 15, wherein   twenty four. The recombinant plant cells are bred (Brassica), soybean, safflower and rice. The recombinant plant cell according to claim 19, which is derived from a plant selected from the group consisting of sunflowers. Vesicles.   twenty five. A vegetable oil produced by the recombinant plant cell according to claim 19, comprising Vegetable oil comprising cosapentaenoic acid.   26. A vegetable oil produced by the recombinant plant cell according to claim 19, comprising Vegetable oil comprising sahexaenoic acid.   27. 27. The plant according to claim 25 or claim 26, wherein the vegetable oil is encapsulated. oil.   28. A food supplement comprising the vegetable oil according to claim 27.   29. Recombinant E. coli cells that produce docosahexaenoic acid.   30. Vegetable oil containing eicosapentaenoic acid.   31. Vegetable oil comprising docosahexaenoic acid.   32. 13. The recombinant microbial cell according to claim 12, wherein said bacterial cell is a lactobacillus cell.