JP2002503963A - Human tumor necrosis factor receptor TR9 - Google Patents

Abstract

  (57) [Summary] The present invention relates to members of the tumor necrosis factor family of receptors. In particular, there is provided an isolated nucleic acid molecule encoding a human TR9 receptor. Also provided are TR9 polypeptides, and vectors, host cells and recombinant methods thereof. The present invention further provides screening methods for identifying agonists and antagonists of TR9 receptor activity.

Description

DETAILED DESCRIPTION OF THE INVENTION                       Human tumor necrosis factor receptor TR9                                Field of the invention   The present invention relates to a novel member of the tumor necrosis factor family. More specifically, TR9, a novel human tumor necrosis factor receptor that has been isolated 6, or simply referred to as DR6). TR Also provided are 9 polypeptides, their vectors, host cells and their recombinant production. You. The present invention further provides screens for identifying agonists and antagonists of TR9 activity. Also about the method.                                Background of the Invention   Numerous biological effects, such as response to certain stimuli and natural biological Processes and the like are controlled by factors such as cytokines. Cytokine Many act via the receptor by involving the receptor, triggering an intracellular response. Start out.   For example, tumor necrosis factors (TNF) α and β are cytokines, Acts through the TNF receptor to protect against infectious diseases and shock and inflammatory It regulates a number of biological processes, including the induction of disease. The TNF molecule is called "T Belonging to the “NF ligand” superfamily and their receptors or “TNF receptors It works in concert with the counter ligand, a "body" superfamily. until now , Nine members of the TNF ligand superfamily were identified, and the TNF receptor Ten members of the superfamily have been identified.   Among the ligands are TNF-α, lymphotoxin-α (LT-α, also known as TNF-α). -Β), LT-β (found in complex heterotrimeric LT-α2-β), F asL, CD40L, CD27L, CD30L, 4-IBBL, OX40L and And neurotrophic factor (NGF). The TNF receptor superfamily p55TNF receptor, p75TNF receptor, TNF receptor-related protein, anti-FAS Hara or APO-1, CD40, CD27, CD30, 4-1BB, OX40, Includes receptors for low affinity p75 and NGF (Meager, A .; Written by Bi logicals, 22: 291-295 (1994)).   Many members of the TNF ligand superfamily are activated T cells. Indeed, these are the cell types that are based on the ontogeny and function of T cells and other cells. (Meager, A. et al.). Author, supra). Considerable information on the essential functions of some of this TNF receptor family can be found in these Derived from the identification and creation of mutants that do not express the protein. For example, FAS Naturally occurring mutations in antigens and their ligands are probably programmed Lymphoid exudate disease reflecting defective cell death (Watanabe-Fu) Kunaga et al., Nature, 356: 314 (1992)). C Mutations in the D40 ligand are associated with high and low levels of immunoglobulin M found in blood. Cause an X-linked immunodeficiency characterized by immunoglobulin G of Defects in cell-dependent B cell activation (Allen et al., Science, 2 59: 990 (1993)). Directional suddenness of low-affinity neurotrophic factor receptor Mutations cause impairments characterized by defective sensory innovation of peripheral structures Kos (Lee et al., Cell, 69: 737 (1992)).   TNF and LT-α are two types of TNF receptors (55-kdTNF receptor and 75-kdTNF receptor). TNF and LT-α Numerous biological effects that occur through its receptors include hemorrhagic necrosis, Vesicular dysfunction, role in endotoxin shock, inflammation, immunomodulation, proliferation and antiviral Reactions, as well as protection from the harmful effects of ionizing radioactivity. TNF and LT-α is used for endotoxin shock, cerebral malaria, tumor, autoimmune disease, AID It has been implicated in the pathology of a wide range of diseases including S and graft host rejection (Beutl er et al., Science, 264: 667-668 (1994)). Mutations in the p55 receptor cause increased susceptibility to microbial infections.   In addition, TNFR1 (p55) and about 80 amino acids near the C-terminus of Fas The domain is called the "death domain," which is the programmed cell death Induces transduction signaling (Tartaglia et al., Cell, 74: 845 (1993)).   Apoptosis or programmed cell death is responsible for the normal growth and It is a physiological process essential for homeostasis (Steller, Science, 267: 1445-1446 (1995)). Apoptosis disruption is cancer Etiology of several human diseases, including tumors, neurodegenerative diseases and acquired immunodeficiency syndrome (Thompson, C .; B. Author, Science, Volume 267: 1 456-1462 (1995)). Recently, two types of cell surface cell death receptors Fas / APO-1 and TNFR-1 signal transduction and biological function (Cleveland et al., Cell, 81: 479-4 82 (1995); Fraser et al., Cell, 85: 781-78. 4 (1996); Nagata et al., Science, 267: 1 449-1456 (1995)). These are both TNF receptor families And TNFR-2, low affinity NGFR, CD4 0 and CD30, and others (Smith et al., Science, 2 48: 1019-23 (1990); Purton and Heldi n, Carl, "ModularTexts-in-Molecular- and Cell Biology (Standard Textbook of Molecular and Cell Biology) " Chapman and Hall, London, 1995). ri and other works). Members of the family have extracellular cysteine-rich repeats. Defined by being in the main. Fas / APO-1 and TN FR-1 also shares an appropriately named intracellular region of homology with the "death domain" However, this is far from related to the Drosophila suicide gene reaper. (Golstein et al., Cell, 81: 185-6 (1995) Year); White et al., Science, 264: 677-83 (199). 4 years)). This common death domain has not been identified for both receptors until recently Suggests interacting with related combinations of signaling transduction molecules. Fas / APO-1 Activation is Death Domain Containing Adapter Molecule FADD / MORT1 (Chinnaiyan et al., Cell, 81: 505-512). (1995); Boldin et al. Biol. Chem. , Volume 270: 7795-8 (1995); Kischkel et al., EMBO, 14: 5579-5588 (1995)), which is then a pro-apoptotic protea. Concluded with FLICE / MACH1, a member of ISE / CED-3 family Combine and possibly activate (Muzio et al., Cell, 85: 817-8). 27 (1996); Boldin et al., Cell, 85: 803-81. 5 (1996)). Central role of Fas / APO-1 may trigger cell death However, TNFR-1 can signal a range of different biological activities Many of which are due to the activation performance of NF-kB (Tartaglia et al., Immunol. Today, 13: 151-153 (1992)). Obedience Therefore, TNFR-1 is also a multivalent adapter containing a death domain like FADD. -Collect TRADD, a molecule (Hsu et al., Cell, 81: 495-495). 504 (1995); Hsu et al., Cell, 84: 299-308. (1996)). Signaling molecules including FADD, TRAF2 and RIP Through association with a large number, TRADD is able to activate apoptosis and NF-KB activation simultaneously. (Hsu et al., Cell, 84: 299-308). Page (1996); Hsu et al., Immunity, 4: 387-396. (1996)).   The effects of TNF family ligands and their receptors are diverse and may be Affects a number of normal and abnormal functions that exist in the biological processes of the system. Therefore, another novel class that affects biological activity in both normal and disease states It is clearly necessary to confirm and determine the structure of various TNF receptors and ligands. is there.                                Summary of the Invention   The present invention relates to the amino acid sequence shown in FIGS. The cDNA clone deposited as ATCC Deposit No. 209037 on the 15th A polynucleotide encoding a TR9 receptor having an amino acid sequence that encodes An isolated nucleic acid molecule is provided.   The present invention also provides a recombinant vector comprising the isolated nucleic acid molecule of the present invention. Host cells containing vectors, and methods for producing the vectors and host cells And using them to produce TR9 receptor polypeptides or peptides by recombinant techniques. It relates to the method used for manufacturing.   The present invention further provides amino acid sequences encoded by the polynucleotides described herein. An isolated TR9 polypeptide having a sequence is provided.   The invention also relates to enhancing or inhibiting the response of cells induced by the TR9 receptor. The present invention also provides a screening method for confirming a compound that can be used. This method Contacting cells expressing the TR9 receptor with a candidate compound and assaying the cellular response And comparing this cellular response to a standard cellular response. This standard Is assayed when contacted in the absence of the candidate compound. This allows An increase in the response of the vesicles above the standard indicates that the compound is an agonist, A decrease in response below standard indicates that the compound is an antagonist.   The invention further provides for the determination of TR9 protein levels, for example, as in quantitative and diagnostic assays. Also provided are diagnostic assays for detecting. So, for example, the diagnostic The assay is based on excess expression of TR9 or its soluble form compared to normal control tissue samples. Can be used to detect the presence of a tumor.   Tumor necrosis factor (TNF) family ligands have cytotoxic, antiviral, Most induce multiple cellular responses, including immunomodulatory activity and transcriptional regulation of several genes It is known to belong to pleiotropic cytokines. The TNF family The response of cells to gand is not only a normal physiological response, but also increases apoptosis. Also includes diseases associated with addition or inhibition of apoptosis. Apoptosis / program Cell death is a physiological mechanism involved in the deficiency of peripheral T lymphocytes in the immune system. Thus, the dysregulation can induce a number of different pathological processes. Cell life Diseases associated with increased survival or inhibition of apoptosis include carcinomas, autoimmune diseases, Viral infections, inflammation, graft-versus-host disease, acute graft rejection, and chronic Includes plant rejection. Diseases associated with increased apoptosis include AIDS, Degenerative disease, myelodysplastic syndrome, ischemic disorder, toxin-induced liver disease, septicemia Includes shock, cachexia and appetite disorders.   Accordingly, the present invention further provides TR9-mediated signaling in cells expressing the TR9 polypeptide. A TNF file comprising administering an effective amount of an agonist capable of enhancing null transmission. Methods for enhancing apoptosis induced by Millie's ligand are provided. Preferably, the TR9-mediated system is treated until a disease showing reduced apoptosis is treated. Enhances signal transmission.   In yet another aspect, the invention provides TR9-mediated expression of cells expressing a TR9 polypeptide. TNF comprising administering an effective amount of an antagonist capable of reducing signaling Aiming at a method of inhibiting apoptosis induced by family ligands. Preferably Until TR9-mediated signaling can be treated for diseases showing increased apoptosis Lower.                             BRIEF DESCRIPTION OF THE FIGURES   1A-D show the nucleotide sequence of TR9 (SEQ ID NO: 1) and deduced therefrom. 2 shows the amino acid sequence (SEQ ID NO: 2) obtained. Computer program PSORT In the analysis used, this protein had a putative leader sequence of about 40 amino acid residues (underlined). And a predicted molecular weight of about 72 kDa. About 41 From about 350 to about 350 (amino acid residues from about 1 to about 310 in SEQ ID NO: 2). The amino acid residue is the extracellular domain, and about 351 to about 367 is the transmembrane domain (sequence No. 2 from about 311 to about 327), about 368 to about 655 Is an intracellular domain (amino acid residues from about 328 to about 615 in SEQ ID NO: 2) And from about 429 to about 495 are death domains (from about 389 to about 455 amino acid residues).   FIG. 2 shows TR9 receptor protein and Fas (SEQ ID NO: 3), NGFR p75 (sequence No. 4) and TNFR1 (SEQ ID NO. 5) are similar in amino acid sequence Indicates the area.   FIG. 3 shows an analysis of the TR9 amino acid sequence. Alpha, beta, turn and co Ile region, hydrophilic and hydrophobic, amphiphilic region, flexible region, antigenic index And surface probabilities. In the graph of "antigen index-Jemson-Wolf", FIG. A to D from about 44 to about 121, from about 156 to about 311, from about 323 to about 348, about 376 to about 412, about 433 to about 474, about 485 From about 599 to about 599, and from about 611 to about 628. It corresponds to a highly antigenic region of white matter. These highly antigenic fragments of FIGS. Each corresponds to the next fragment of SEQ ID NO: 2. That is, from about 4 to about 81, about 11 6 to about 271, from about 283 to about 308, from about 336 to about 372, From about 393 to about 434, from about 445 to about 559, and from about 571 to about Up to 588 amino acid residues.   4A-C focus on the deduced amino acid sequence.   Figure 4A: TR9 open reading frame is 655 amino acids (SEQ ID NO: 2) transmembrane type I Indicates a protein. Using a computer program other than PSORT, it is Is presumed to start from amino acid 42 (Gln indicated by a black triangle). Guesswork Single and double underlines for the signal peptide and transmembrane domain of Attach. The six potential N-glycosylation sites are indicated by black dots. Cytoplasmic death Surround the main with a square. Leucine-zipper mochi overlaps with proline-rich sequences The subcellular region containing the sequence is underlined in bold. FIG. 4B: Extracellular cysteine of TR9 Between the abundant domain (SEQ ID NO: 19) and osteoprotegrin (SEQ ID NO: 20) Was used to align the sequences. Alignment is performed by Megaalign (DNASTAR) software I went in. Shaded parts indicate identical residues. Figure 4C: TR9 (SEQ ID NO: 21), CD95 (SEQ ID NO: 22), TNFR1 (SEQ ID NO: 23), DR3 (SEQ ID NO: 2) 4) Death domain arrangement of DR4 (SEQ ID NO: 25) and DR5 (SEQ ID NO: 26) Column comparison. Aligned and shown as in FIG. 4B. OPG: Osteoprotegeri N.   FIG. TR9 induces apoptosis in mammalian cells. Ectopic expression of TR9 Induces apoptosis in Hela cells but not MCF7 cells. Empty vector, TR9, TR9delta, or Hela cells and MCF7 cells DR4 with β-galactosidase-expressed reporter construct (BRL) Were co-transfected using the lipofectamine method according to the instructions of Introgression After 19 hours, cells were harvested from 5-bromo-4-chloro-3-indoxyl-β-galacto. Stained with pyranoside (X-Gal), Chinnaiyan et al., Cell, 81: 505-512 (1995). Data (Average (Value ± SD) is the percentage of rounded apoptotic cells expressed as total β-galactosidase positive. Shown as a function of sex cells (n = 4).   FIG. TR9 mediates nuclear factor kB activation. Co-transfection of 293 cells Performed with the constant expression construct and the NF-kB luciferase reporter construct. Remains Cell extracts were prepared after gene transfer (36 hours) and reported (Chinnaiyan Kaku, Science, 274: 990-992 (1996); and Pan et al., Science, 276: 111-113 (1997)) The luciferase activity was measured according to the following. Gene transfer efficiency is β-galactosidase Monitored by activity. Using some of the transfected cells, TR9 or The expression of TR9delta was monitored. Preparation of cell lysate and FLAG-M2 affinity The gel was immunoprecipitated and the presence of TR9 or TR9delta was probed with anti-FLAG. Was detected.                       Detailed description of preferred embodiments   The present invention is based on FIG. 1 determined by sequencing the cloned cDNA. A TR9 receptor polypeptide having the amino acid sequence shown in A to C (SEQ ID NO: 2) An isolated nucleic acid molecule comprising the encoding polynucleotide is provided. Shown in FIG. As described above, the TR9 receptor protein of the present invention comprises Fas (SEQ ID NO: 3), NGFRp75 (SEQ ID NO: 4) and shares sequence homology with TNFR1 (SEQ ID NO: 5). Array The nucleotide sequence shown in No. 1 was obtained by sequencing a cDNA clone. May 15, 1997 Zip Code 209037 Rockville, MD, PA Clone Drive at 12301 American Type Culture Collection Deposit number 209037. The deposited clones were EcoRI and PBluescript SK using the Xhol restriction endonuclease site (-) Inserted into plasmid (Stratagene, La Jolla, CA). Nucleic acid molecule   Unless otherwise specified, all nucleotide sequences are automatically derived from the DNA molecules herein. DNA sequencer (for example, a model from Applied Biosystems) (Such as Dell 373). This specification The amino acid sequence of the polypeptide encoded by the DNA molecule determined in Inferred by translation of the DNA sequence determined in this way. Therefore, it is automated As known in the art for DNA sequences determined by The nucleotide sequence determined herein may contain some errors I don't know. The nucleotide sequence determined by automation is sequenced. Typically at least about 90 compared to the actual nucleotide sequence of the DNA molecule % Identity, more typically at least about 95% to at least 99.%. There is 9% identity. The actual sequence is determined by manual D as is well known in the art. More precise determinations can be made by other techniques, including NA sequencing. In the art As is known, one to the nucleotide sequence determined relative to the actual sequence Insertions or deletions cause a frameshift in the translation of the nucleotide sequence, The putative amino acid sequence encoded by the defined nucleotide sequence is actually sequenced The amino acid sequence encoded by the inserted DNA molecule is such an insertion or deletion point. Starting from is a completely different thing.   For example, provided herein as the nucleotide sequence of FIGS. 1A-D (SEQ ID NO: 1). Using the information provided, the nucleic acid molecule of the invention encoding the TR9 polypeptide For example, for cloning cDNA using mRNA as starting material Obtained using standard cloning and search methods such as Of the present invention 1A-D (SEQ ID NO: 1) are representative of human capillary endothelium. It was found in a cDNA library derived from cells. This gene is also We have also been confirmed in cDNA libraries obtained from tissue: human placenta, stromal cells, Human amygdala, human umbilical vein endothelial cells, kidney cancer, human gallbladder, Soas adult brain, Normal human liver, hepatocellular tumor, keratinocytes, bone marrow, macrophages, human Joint sarcoma, human hippocampus, and human tonsils.   The determined nucleotide sequence of the TR9 cDNA shown in FIGS. 1) has an open reading frame coding for a protein of about 615 amino acid residues and about 40 amino acid residues. Includes with the putative leader sequence of the group and has a concluded molecular weight of about 72 kDa. The predicted amino acid sequence of the mature TR9 receptor is shown in amino acids of FIGS. 1A-D (SEQ ID NO: 2). The acid residues are shown from about 1 to about 615. TR9 protein of FIGS. 1A-D (SEQ ID NO: 2) Shows about 24% identity and 43% similarity to NGFR (FIG. 2).   Sequence homology found between TR9 and other death domain containing receptors (FIG. 4C). TR9 induces apoptosis in mammalian cells (see FIG. 6). See). TR9-induced apoptosis is a broad-spectrum irreversible caspase inhibitor Z-VAD-fmk and, for example, FLICE / MACH-1 (CASPA Cowpox virus that preferentially inhibits caspases such as Efficient Inhibition by Death Protease Inhibitors Containing the Serpin CrmA It is expected to be done.   As described above, the present invention also provides a mature form of the TR9 receptor of the present invention. Signa According to the hypothesis, proteins secreted by mammalian cells may be signal or secretory leaders. Sequence, which allows growing protein chains to be transported through the rough endoplasmic reticulum. When started, it is cleaved from the mature protein. Most mammalian cells and insect cells Cleave secreted proteins with the same specificity. However, in some cases secretion The cleavage of the resulting protein is not completely uniform, and two or more mature forms of the protein are You can get more. Furthermore, the cleavage specificity of secreted proteins ultimately results in complete proteins Determined by the primary structure of the polypeptide, i.e., the amino acid sequence of the polypeptide. It has been known for a long time. Accordingly, the present invention provides an ATCC deposit number 209037 identified by the cDNA clone contained in the host identified as The amino acid sequence has the amino acid sequence shown in FIGS. 1A to 1D (SEQ ID NO: 2). A nucleotide sequence encoding a mature TR9 receptor polypeptide is provided. ATC The cDNA clone contained in the host identified as C The mature TR9 protein having the amino acid sequence to be The complete open reading frame encoded by the human DNA sequence in the clone included is mammalian Produced by being expressed in cells (eg, the following COS cells) It means the mature form of the TR9 receptor. As noted below, ATCC Deposit No. 20 Mature T having the amino acid sequence encoded by the cDNA clone contained in 9037 R9 receptor depends on the accuracy of the cleavage site estimated based on computer analysis The putative "mature" TR9 receptor protein shown in SEQ ID NO: 2 (about 1 amino acid residue) To about 615) or not.   Whether a Protein Has a Secretory Leader and Cleavage for the Leader Sequence Methods for estimating whether or not to have points are available. For example, Mc Geoch (Virus Res. 3: 271-286 (1985)) And von Heinje (Nucleic Acid Res. , Volume 14: 4683-4690 (1986)). Known mammalian secretions The accuracy of protein breakpoint estimation ranges from 75% to 80% for each of these methods. Is within. von Heinje, supra. However, for a given protein These two methods do not always infer the same cutting point.   In the present case, the putative amino acid sequence of the complete TR9 polypeptide of the present invention Is a computer program ("PSORT") (K. Nakai and M.K. Kaneh Isa, Genomics, 14: 897-911 (1992)). This program analyzes proteins based on amino acid sequences. An expert system for estimating intracellular localization. Computer at this location As part of the conjecture by McGeoch and von Heinje, Has been introduced. The analysis by the PSORT program is shown in FIGS. A cleavage site between amino acid residues 40 and 41 in amino acid residues -1 and 1) I guessed. Then, the complete amino acid sequence was converted into von Heinje's (-1, -3) A simple form of the rule was applied and further analyzed visually. von Heinje, I mentioned earlier. Thus, the leader sequence of the TR9 receptor protein comprises the amino acid residues of FIGS. Consists of about 1 to about 40 (amino acid residues -40 to -1 of SEQ ID NO: 2) The mature TR9 protein has residues from about 41 to 655 in FIGS. (From 1 to 615 of SEQ ID NO: 2). Another computer The analysis using the program shows that the mature protein of TR9 Presumed to start with noic acid 42 (Gln). The result of this analysis is shown in FIG. This is described in Example 6.   Due to the possibility of errors in the sequencing, as one of ordinary skill would recognize And deposited due to the diversity of leader cleavage sites in various known proteins The putative TR9 receptor polypeptide encoded by the cDNA contains approximately 655 amino acids. Including the acid, but may be any of 645-665 amino acids; The leader sequence predicted for is about 40 amino acids, but about 30 to about 50 It may be any of the amino acids.   As mentioned above, the nucleic acid molecules of the invention are in the form of RNA, for example mRNA. Or obtained for example by cloning or produced synthetically It may be in the form of DNA, including cDNA and genomic DNA. This DNA is It may be a heavy chain or a single chain. Single-stranded DNA or RNA is also called the sense strand. Non-coding strand, which may be called the coding strand, or also called the antisense strand It may be a chain.   An “isolated” nucleic acid molecule is a nucleic acid molecule, DNA, that has been removed from its native environment. Or RNA. For example, a recombinant DNA molecule contained in a vector Understand that it has been separated from the purpose of Another example of an isolated DNA molecule Is in a recombinant DNA molecule or solution maintained in a heterologous host cell (partially Or (substantially) purified DNA molecules. Originally isolated RNA molecules In vivo or in vitro RNA transcripts from light DNA molecules are included. In the present invention Such isolated nucleic acid molecules further include such molecules produced synthetically. You.   The isolated nucleic acid molecules of the present invention include an open reading frame as shown in FIGS. 1A-D (SEQ ID NO: 1). DNA molecule containing (ORF); DN containing coding sequence for mature TR9 protein A molecule; and comprising a sequence substantially different from that described above, but degenerate in the genetic code Contains the sequence encoding the TR9 protein shown in FIGS. 1A-D (SEQ ID NO: 2) DNA molecules. Of course, this genetic code is well known in the art. I have. Thus, for such skilled artisans to create such degenerate variants Is everyday.   In addition, the present invention relates to the nucleotide sequences shown in FIGS. 1A-D (SEQ ID NO: 1). Provided is a nucleic acid molecule having a nucleotide sequence related to the moiety. It is the next Determined from related cDNA clones: HIBEJ86R (SEQ ID NO: 6), HL IAA79R (SEQ ID NO: 7), HHFGD57R (SEQ ID NO: 8), HSABG3 8R (SEQ ID NO: 9) and HHPDZ31R (SEQ ID NO: 10).   Further, the present invention provides nucleotides 655 to 907 of FIGS. Nucleotides 615 to 867) and / or 1A to 1D (nucleotides 540 to 1020 shown in SEQ ID NO: 1). Nucleotides 500 to 980) At least about 30 nucleotides, preferably at least about 50 nucleotides. Including polynucleotides.   In another aspect, the invention relates to ATCC Deposit No. 20903 on May 15, 1997. Amino acid encoded by the cDNA clone contained in the plasmid deposited as No. 7. Providing an isolated nucleic acid molecule encoding a TR9 receptor polypeptide having an acid sequence Offer. In another aspect, the mature TR9 receptor polypeptide or N-terminal methionine A nucleic acid molecule encoding a deleted full-length TR9 polypeptide is provided. The present invention also provides Has the nucleotide sequence shown in FIGS. 1A-D (SEQ ID NO: 1), or An isolated nucleic acid having the nucleotide sequence of a TR9 cDNA contained in a clone A nucleic acid molecule having a molecule or a sequence complementary to one of the above sequences is provided. like this Of isolated molecules, especially DNA molecules, by in situ hybridization As a probe for gene mapping and eg for Northern blot analysis Is useful for detecting the expression of the TR9 receptor in human tissues.   The present invention is further directed to fragments of the isolated nucleic acid molecules described herein. An isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNA or FIG. A to D (SEQ ID NO: 1) or nucleotides complementary thereto A fragment is at least about 15 nt in length, more preferably at least about 20 nt. nt, even more preferably at least about 30 nt, even more preferably less At least about 40, 50, 100, 150, 200, 250, 300, 400 or Means a 500 nt fragment. These fragments include, but are not limited to: But not including use as diagnostic probes and primers described herein There are many uses. Of course, large fragments of 50 to 1500 nt in length are also Useful and deposited cDNA as well as many if not all corresponding fragments Or nucleotides as shown in FIGS. 1A-D (SEQ ID NO: 1) Fragments corresponding to the sequences are also useful according to the invention. For example, at least 20n in length The fragment of t is the deposited cDNA or the nucleoside shown in FIGS. 1A to 1D (SEQ ID NO: 1). A fragment containing 20 or more contiguous bases from the peptide sequence is meant. Representative examples of the TR9 polynucleotide fragment of the present invention include, for example, the nucleoside of SEQ ID NO: 1. From the cDNA contained in the deposited or complementary DNA strand or the deposited clone A fragment containing or consisting of the nucleotide sequence of the following table of Contain: ie about nucleotides To the end. Here, "about" refers to the specified range, Includes several (5, 4, 3, 2, or 1) more or less leotides. Special In a specific embodiment, the polynucleotide fragment of the invention is a polypeptide exhibiting a functional activity. Code. Polypeptides that exhibit "functional activity" include intact or mature T Exert one or more known functional activities associated with the R9 polypeptide. Are contemplated. These functional activities are limited to these Biological activity, antigenicity [ability to bind anti-TR9 antibody (and Is the ability to compete with TR9 polypeptide for binding)], immunogenicity (TR9 polypeptide) Ability to generate antibodies that bind to peptides) and to TR9 polypeptides And the ability to bind to a receptor or ligand.   Preferred nucleic acid fragments of the invention include the extracellular domain of the TR9 receptor (SEQ ID NO: 2). From about 1 to about 310 of the amino acid residues). D; a polypeptide containing four TNFR-like cysteine-rich motifs of TR9 (FIG. 1A-D amino acid residues 67 to 211; amino acid residue 27 of SEQ ID NO: 2 171) to the TR9 receptor transmembrane domain (about 3 amino acid residues of SEQ ID NO: 2). 11 to about 327); TR9 receptor A somatic intracellular domain (constituting amino acid residues from about 328 to about 615 of SEQ ID NO: 2) And extracellular and intracellular TR9 receptor A polypeptide containing a domain but with all or part of the transmembrane region deleted The death domain of the TR9 receptor (amino acid residues from about 389 to about 4 of SEQ ID NO: 2) Up to 55 members); and a TR9 receptor protein. A nucleic acid molecule encoding an epitope having a white matter portion. As mentioned above, Together with the extracellular, transmembrane and intracellular domains of the TR9 receptor. The resulting amino acid residues were estimated by computer analysis. There As will be appreciated by those of ordinary skill, the amino acid residues that make up these domains are Depending on the criteria used to define the amino acid (eg, about 1 amino acid residue). (About 15 pieces from each other).   Preferred nucleic acid fragments of the present invention also include one of the epitope-containing portions of the TR9 receptor protein. Also encompasses nucleic acid molecules encoding one or more. In particular, such a core of the present invention Acid fragments include: a polypeptide comprising amino acid residues from about 4 to about 81 of SEQ ID NO: 2 A polypeptide comprising amino acid residues from about 116 to about 271 of SEQ ID NO: 2 A polypeptide comprising about 283 to about 308 amino acid residues of SEQ ID NO: 2; A polypeptide comprising about 336 to about 372 amino acid residues of SEQ ID NO: 2; A polypeptide comprising about 393 to about 434 amino acid residues of SEQ ID NO: 2; sequence A polypeptide comprising about 445 to about 559 amino acid residues of No. 2; and A polypeptide comprising amino acid residues from about 571 to about 588 of SEQ ID NO: 2; Also encompasses the encoding nucleic acid molecule. The present inventors have determined that the polypeptide fragment is TR9 It was determined to be the antigenic region of the receptor. Other such TR9 proteins The method for determining the portion having the epitope is described in detail below.   In another aspect, the invention is preferably carried out under stringent conditions, such as ATCC Polynucleotides of the invention, such as the cDNA clone contained in deposit no. Polynucleotides that hybridize to portions of the polynucleotide sequence of otide Provide an isolated nucleic acid molecule comprising the nucleic acid molecule. "Stringent hybrid type "Conditions" means: 50% formamide, 5 × SSC (150 mM NaCl, 15 mM-trisodium citrate), 50 mM sodium phosphate (pH 7. 6), 5 × Denhardt solution, 10% dextran sulfate, and denatured sheared salmon sperm DNA Incubate overnight at 42 ° C. in a solution containing 20 g / mL, then filter plate 0. It is intended to be washed at about 65 ° C. with 1 × SSC.   A polypeptide that hybridizes to a "portion" of a polynucleotide Is at least about 15 nucleotides (nt), more preferably at least about 20n t, more preferably at least about 30 nt, even more preferably at least About 30-70, or 80-150, or the total length of the polynucleotide as a control Polynucleotide (either DNA or RNA) that hybridizes with Is intended. These are discussed as diagnostic probes and discussed above, and are described below. It is useful as a primer to be described in detail.   In a particular embodiment, the polynucleotide of the present invention comprises the nucleotide sequence of SEQ ID NO: 2. Amino acid residues 40 to 152, 40 to 48, 40 to 51, 51 to 66, 66 to 73, 73-83, 83-104, 104-110, 110-128, 128-146 And / or a complementary strand and a hive of a polynucleotide encoding 146-152 Form the lid.   For example, a portion of a polynucleotide having a length of at least 20 nt The polynucleotide (eg, the deposited cDNA or FIGS. 1A-D (SEQ ID NO: Contiguous nucleotides from the nucleotide sequence of 1) Twenty or more are contemplated.   Of course, a polynucleotide that forms a hybrid only with the poly A sequence (for example, Like the 3'-terminal polytract of the TR9 receptor cDNA shown in SEQ ID NO: 1), Or a polynucleotide that hybridizes with a complementary extension of a T (or U) residue Tide indicates that such a polynucleotide has a poly (A) extension or its complementary strand. Any nucleic acid molecule (eg, using oligo dT as a primer in practice) To form a hybrid with any of the double-stranded cDNA clones It appears that the invention used to hybridize to a portion of the nucleic acids of the invention I do not want to include it in the clear polynucleotide.   As described above, the nucleic acid molecule of the present invention encoding the TR9 receptor polypeptide includes: Without limitation, the amino acid sequence of the mature polypeptide may be Itself; the mature polypeptide and, for example, an amino acid leader sequence or Is an additional sequence such as a secretory sequence (eg, pre or pro or prepro) Coding sequence (such as a protein sequence); having said additional coding sequence Additional non-coding sequences with or without the coding sequence of the mature polypeptide, eg For example, but not limited to, introns and transcription or Processing of mRNAs Containing Ising and Polyadenylation Signals, eg Plays a role in binding mRNA to ribosomes and stabilizing mRNA Non-coding 5 'and 3' sequences; and, for example, to provide additional functionality Additional coding sequences encoding such additional amino acids. Thus, A sequence encoding a polypeptide, for example, facilitates purification of the fusion polypeptide It may be fused to a marker sequence, such as a sequence encoding a peptide. Of the present invention In certain preferred embodiments of this aspect, the marker amino acid sequence is, for example, Many are commercially available tags, especially the pQE vector (Qiagen). A hexahistidine peptide such as a tag to be provided. For example, Gentz et al. Author, Proc. Natl. Acad. Sci. USA, Vol. 86: 821-824 Hexahistidine is a convenient fusion protein as described on page 1989. It provides a simple purification method. The "HA" tag is for influenza hemagglutinin protein Another useful peptide for purification corresponding to the epitope derived from Wilson et al., Cell, 37: 767-778 (1984). It is described in. As described below, different types of such fusion proteins Include the TR9 receptor fused to Fc at the N- or C-terminus.   The invention further relates to variants of the nucleic acid molecules of the invention, which comprise the TR9 receptor. Encodes a subform, analog, or derivative. Mutants include, for example, natural alleles Like mutants, they may also exist in nature. An "allelic variant" is One of several different types of genes occupying a particular location on a chromosome is contemplated. "Genes", Volume II, Lewin, B .; Hen, John Wile y & Sons, New York (1985). Non-naturally occurring variants are It may be produced using mutagenesis techniques known in the art.   Such variants may be produced by nucleotide substitutions, deletions or additions. Wherein the nucleotides can be one or more. The variants may have altered coding regions, non-coding regions, or both. Ko Changes in the nucleotide region may result in conservative or non-conservative amino acid substitutions, deletions or additions. May wake up. Particularly preferred among these are silent substitutions, additions and Deletions, which alter the properties and activities of the TR9 receptor or part thereof. I can't. Particularly preferred in this regard are conservative substitutions.   In a further aspect of the present invention, (a) the amino acid sequence shown in FIGS. Nucleotide sequences encoding polypeptides having a sequence; (b) FIGS. A nucleotide sequence encoding a polypeptide having the amino acid sequence of No. 2) And lacking the N-terminal methionine; (c) a putative mature TR9 poly Nucleotide sequence encoding the peptide (all nucleotides with the leader sequence removed) Amino acid at about position 1 to about 615 of SEQ ID NO: 2 (D) cDNA clone contained in ATCC Deposit No. 209037 Encoding a TR9 polypeptide having an amino acid sequence encoded by (E) a cDNA clone contained in ATCC Deposit No. 209037; Nucleotide encoding mature TR9 polypeptide having encoding amino acid sequence (F) a nucleotide sequence encoding the extracellular domain of the TR9 receptor; (G) Nucleotide encoding four cysteine-rich TNFR-like motifs of TR9 Pide sequence (amino acid residues 67 to 211 of FIGS. 1A-D; amino acid of SEQ ID NO: 2) (H) acid residues 27 to 171); (h) encoding the transmembrane domain of the TR9 receptor (I) Nucleic acid encoding the intracellular domain of the TR9 receptor Otide sequence; (j) the TR9 receptor in which all or part of the transmembrane domain has been deleted. Nucleotide sequences encoding extracellular and intracellular domains; (k) TR9 receptor A nucleotide sequence encoding the body death domain; (l) the leucine zipper of TR9. A nucleotide sequence encoding par; (m) a nucleotide sequence (a), (b), (C), (d), (e), (f), (g), (h), (i), (j), (k) Or a nucleotide sequence complementary to any of (1); Identity, preferably at least 95%, 96%, 97%, 98% or 99% An isolated nucleic acid comprising a polynucleotide having a nucleotide sequence of identity Including molecules.   For example, at least a control nucleotide encoding a TR9 receptor polypeptide may have A polynucleotide having a nucleotide sequence with 95% "identity" is defined as A control nucleoside wherein the nucleotide sequence of the polynucleotide encodes a TR9 receptor May contain 5 point mutations per 100 nucleotides of nucleotide sequence It is intended to be identical to the control sequence except for the following. In other words, the control nucleus Obtaining a polynucleotide having a nucleotide sequence 95% identical to an otide sequence. To delete or replace up to 5% of the nucleotides in the control sequence Up to 5% of all nucleotides in the control sequence that may be substituted or Indicates that the nucleotide may be inserted into the control sequence. Mutations in these control sequences The difference may occur at the 5 'or 3' end of the control nucleotide sequence, and Can occur anywhere between the terminal sites, such as Interspersed within the control sequence individually or as one or more contiguous groups It may be. This control (of interest) sequence is the complete T shown in FIGS. 1A-D (SEQ ID NO: 1). It may be the R9 nucleotide sequence or any of the fragments described herein. As a practical matter, certain nucleic acid molecules are identified in, for example, FIGS. 1A-D (SEQ ID NO: 1). The nucleotide sequence shown or the nucleotide sequence of the deposited cDNA clone At least 90%, 95%, 96%, 97%, 98% or 99% identity For example, whether or not the Bestfit program (Wisconsin / Seque nce Analysis Package, 8th edition for Unix, Geneti cs ・ Computer ・ Group 、 University ・ Rearc h. Park, 575 Science Drive, Madison, WI 53711) It can be determined routinely using known computer programs. B Estfit by Smith and Waterman, Advantages in A Applied Mathematics, 2: 482-489 (1981) ) Finds the optimal segment of homology between two sequences using the local identity algorithm I do. Use Bestfit or another program to align sequences to make specific alignments. Determine if a sequence has, for example, 95% identity to a control sequence of the invention. Parameters, of course, the percentage of identity is based on the total length of the control nucleotides. And the homology gap is up to 5% of the total number of nucleotides in the control sequence. Are acceptable.   In certain embodiments, the control (of interest) sequence (the sequence of the invention) and the global sequence alignment are both The identity between the sequences of interest referred to by Brutlag et al. (Comp. Ap p. Biosci. 6: 237-245 (1990)) Determined using the FASTDB computer program based on identity Suitable parameters used for FASTDB alignment of DNA sequences to calculate percentages The meters are: matrix = single, k-set = 4, mismatch penalty = 1, combined pen Nalty = 30, randomized group length = 0, cutoff score = 1, gap pena Ruty = 5, gap size penalty = 0. 05, window size = 500 Or, the shorter of the length of the nucleotide sequence of interest. In this aspect Thus, if the sequence of interest is not an internal deletion but a 5 'or 3' deletion, Calculate percentage identity by making individual corrections to results if shorter than the sequence in question When the FASTDB program cuts 5 'or 3' of the target sequence Consider not including it. Truncated at the 5 'or 3' end compared to the sequence in question % Identity does not match / align with the target sequence Of the sequence in question as a percentage of the total bases of the sequence in question which is 5 'or 3' Correct by calculating the number of bases. Whether the nucleotide matches / aligns Whether this is determined by the result of FASTDB sequence alignment. This percentage is given below. Percent identity calculated by the FASTDB program using the parameters listed above To finally obtain a percentage identity value. This modified score is It is used for various purposes. Problems indicated by FASTDB alignment The 5 'or 3' bases outside the target sequence that do not match / align with the sequence of Calculate percent identity for correction purposes. For example, if the target sequence of 90 bases is 1 The percent identity is determined by alignment with the sequence of interest at 00 bases. Deletion is Alignment by FASTDB occurs at the 5 'end of the row, so a 10 base match at the 5' end / Does not show alignment. Non-corresponding bases account for 10% of the sequence (with no 5 'and 3' Number of matching bases / total number of bases in the sequence in question). So 10% FASTDB program Subtract from the percent identity calculated in. If the remaining 90 bases do not match exactly The final percentage will be 90%. In another example, the target sequence of 90 bases is replaced with 100 salts Compare with the underlying sequence in question. At this time, the deletion is an intermediate deletion and No 5 'or 3' bases in the sequence are mismatched / aligned with those in question. This In this case, the percent identity calculated by FASTDB is not individually corrected. Again And only the 5 'and 3' bases of the target sequence that do not match / align with the sequence in question. Modify each. No other individual modifications are made for the purposes of this embodiment.   The present application relates to encoding a polypeptide having TR9 receptor activity. 1A-D (SEQ ID NO: 1) or the sequence of the deposited cDNA Have at least 90%, 95%, 96%, 97%, 98% or 99% identity Directed to a nucleic acid molecule having a sequence. Therefore, a specific nucleic acid molecule has TR9 activity. If one does not encode one polypeptide, those skilled in the art will still refer to the nucleic acid molecule as an example. For example, as a probe for hybridization or polymerase chain reaction (PCR) You will know how to use it as a primer. Has TR9 receptor activity Use of the nucleic acid molecules of the invention that do not encode a polypeptide includes, among others, (1) cDN Isolation of TR9 receptor gene or allelic variant in A library; (2) intermediate TR by in situ hybridization (e.g., "FISH") to phase chromosome dispersion Providing accurate chromosomal localization of the 9 receptor gene (Verma et al., Human. Chromosomes: A. Manual of Basic Techni ques (human chromosome: manual for basic technology) ", Pergamon Pre ss, New York (1988)); and (3) TR9 within certain organizations Northern blot analysis to detect receptor mRNA expression.   However, the nucleic acid sequence shown in FIGS. 1A-D (SEQ ID NO: 1) or the deposited cDN At least 90%, 95%, 96%, 97%, 98% with the sequence of A or a fragment thereof Or a nucleic acid molecule having a sequence with 99% identity, Those encoding polypeptides having body activity are preferred. "TR9 receptor activity The "polypeptide having" has the TR9 receptor of the present invention (full length protein or preferably Polypeptides that show similar, but not necessarily identical, activity to the mature protein). To taste. This activity is measured in specific immunoassays and / or biological assays I do. For example, TR9 receptor activity is substantially as previously reported (Chinnaiyan et al., Cell, 81: 505-512 (1995); Boldin et al., J. . Biol. Chem. 270: 7795-8 (1995); Kisch Kel et al., EMBO, 14: 5579-5588 (1995); Ch. Innaiyan et al. Biol. Chem. , Volume 271: 4961-4 965 (1996)) and a cell death assay performed as described in Example 5. Can be used to measure. In MCF7 cells, a plasmid encoding full-length TR9 or PLatern encoding a receptor containing a candidate death domain and green fluorescent protein Les Co-transfect with the porter construct. The nucleus of cells transfected with TR9 is DA Evaluation by PI staining shows a form of apoptosis. TNFR-1 And Fas / APO-1 (Muzio et al., Cell, 85: 817-82). 7 (1996); Boldin et al., Cell, 85: 803-815. (1996); Biol. Chem. , Volume 270: 3255-60 (1995)), TR9-induced apoptosis was detected by ICE. Blocked by CrmA and z-VAD-fmk, which are inhibitors of lipase-like protease Will be done. In addition, TR9-induced apoptosis is associated with FADD or Is the dominant negative version of FLICE (FADD-DN; FLICE-DN / MACHalC360S).   Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art 1A-D (SEQ ID NO: 1) or the sequence of the deposited cDNA At least 90%, 95%, 96%, 97%, 98%, or 99% identity Many of the nucleic acid molecules having a sequence or fragments thereof have "TR9 receptor activity" It immediately recognizes that it encodes a peptide. Actually these nuclei This is because degenerate variants of the otide sequence all encode the same polypeptide. Will be apparent to the skilled artisan in many instances without the aforementioned assay. Further degenerate changes Polypeptides with significant number of TR9 receptor activities for non-heterologous nucleic acid molecules Will be recognized in the art. This is the function of the protein Amino acid substitutions that have little or no apparent effect on (Eg, replacing an aliphatic amino acid with a second aliphatic amino acid) Because he is completely aware.   Guidelines on how to make silent amino acid substitutions, for example, in terms of phenotype Is J. U. Bowie et al., "Deciphering the Messa." ge in Protein Sequences: Tolerance to ・ Amino ・ Acid ・ Substitutions ”, Science, 2 47: 1306-1310 (1990). These authors Point out that proteins are surprisingly tolerant of amino acid substitutions. Polynucleotide assays   The invention also relates to complementary polynucleotides, for example, as diagnostics. It also relates to the use of the TR9 polynucleotide for detection. Related to dysfunction Detection of a mutated form of TR9 reduces expression or expression of TR9 or a soluble form thereof. Diseases such as tumors or autoimmune diseases resulting from excessive or altered expression or Provides diagnostic means by which a diagnosis of susceptibility can be added or determined It is.   Individuals with mutations in the TR9 gene detect DNA levels by various techniques it can. Diagnostic nucleic acids include, for example, blood, urine, saliva, tissue biopsy and autopsy material. Obtained from cells of the patient. Genomic DNA can be used directly for this detection Good and may be enzymatically amplified using PCR before analysis (Saiki et al. Author, Nature, 324: 163-166 (1986)). RNA or Can use cDNA in the same manner. As an example, complementary to the nucleic acid encoding TR9 The expression and mutation of TR9 can be confirmed and analyzed using appropriate PCR primers. For example, comparing amplification product size changes to normal genotypes will Can be detected. Point mutations can result in amplified DNA being radiolabeled TR9 RNA or radioactive By forming a hybrid with a functionally labeled TR9 antisense DNA sequence You can check. Perfectly matched sequences were determined by RNase A digestion or by differences in melting points. Can be distinguished from mismatched double strands.   Differences between control genes and genes with mutations can lead to direct DNA sequencing Therefore, it may be clarified. In addition, the cloned DNA segment is It may be used as a probe for detecting the NA segment. The sensitivity of such a method is PCR Or can be significantly enhanced using the appropriate use of other amplification methods. For example, sequencing Single stranded template molecule produced by double stranded PCR product or modified PCR Use with Sequencing is a routine procedure using radiolabeled nucleotides Thus, or by automatic sequencing procedures using fluorescent tags.   Genetic testing based on DNA sequence differences can be performed in gels with or without denaturing agents. The detection may be performed by detecting a change in electrophoretic mobility of a DNA fragment to be performed. Small sequence deletions and insertions can be visualized by high resolution electrophoresis. Various arrangements The DNA fragments in a row have the mobility of various DNA fragments at various positions in the gel. Denatured formamide gradients that delay according to specific or partial melting temperatures (For example, Myers et al., Science, Vol. 230). : 1242 (1985)).   Sequence changes at specific positions may be due to, for example, RNase and S1 protection or chemical cleavage. The cutting method (eg, Cotton et al., Proc. Natl. Acad. Sci. USA, 85: 4397-4401 (1985)). It may be elucidated by a protection assay.   Therefore, detection of a specific DNA sequence is performed, for example, by hybridization, RNase protection, or the like. Protection, chemical cleavage, direct DNA sequencing, or the use of restriction enzymes (eg, restriction Fragment length polymorphism ("RFLP"), Southern blotting of genomic DNA, etc. This can be achieved by such a method.   In addition to conventional gel electrophoresis and DNA sequencing, mutations are Can also be detected. Vectors and host cells   The present invention also relates to a vector comprising the isolated DNA molecule of the present invention, Producing a genetically engineered host cell or polypeptide of the invention Cells that have been otherwise processed, and TR9 receptor poly The present invention relates to a method for producing a peptide or a fragment thereof.   Polynucleotide ligates to vector containing selectable marker for propagation in host May be. Generally, a plasmid vector is used, for example, in a calcium phosphate precipitate. It is added to such a precipitate or introduced into a complex of charged lipids. This vector If a virus, package it in vitro using an appropriate packed cell line, then The host cell can be transduced.   In one embodiment, the DNA of the present invention is linked to a suitable heterologous regulatory element (eg, a promoter). Promoter or enhancer), to name a few. Promoter, E. coli lac, trp, and tac promoters, SV40 early And late promoters, such as the retroviral LTR promoter And operatively placed. Other suitable promoters are known to skilled professionals. ing.   In embodiments where the vector comprises an expression construct, the construct further comprises a transcription initiation site, A termination site, and a ribosome binding site for translation in the transcribed region. Depending on the structure The coding site of the mature transcript to be expressed is preferably added first with a translation initiation codon, And a termination codon (UAA, appropriately positioned at the end of the polypeptide to be translated) UGA or UAG).   As mentioned above, the expression vector preferably contains at least one selectable marker. Good. Such markers include dihydrofolate reductase in eukaryotic cell culture. Or tetracycline for neomycin resistance and culture in E. coli or other bacteria. Or an ampicillin resistance gene. Representative examples of suitable hosts are not limited to these. But not for example E. coli, Streptomyces and Salmonella typhi cells. Bacterial cells; mold cells such as yeast cells; Drosophila S2 and Spodopte Insect cells such as La Sf9 cells; CHO, COS and Bowes melanoma cells. Animal cells, such as vesicles; and plant cells. Suitable culture media for the host cell Culture media and culture conditions are known in the art.   Some vectors suitable for use in bacteria are purchased from Quiagen. PQE70, pQE60, pQE9; can be purchased from Stratagene PBS vector, Phasescript vector, Bluescript vector And pNH8A, pNH16a, pNH18A, pNH46A; ptrc99a, pKK223-3, pKK2 available from Armasia 33-3, pDR540, and pRIT5. Of suitable eukaryotic vectors Some are pWLNEO, pSV2CAT, which can be purchased from Stratagene. pOG44, pXT1, pSG; and p available from Pharmacia SVK3, pBPVNpMSG and pSVL. Other suitable vectors Tar will be readily apparent to skilled professionals.   Selection of appropriate vectors and promoters for expression in certain host cells Well-known operations, including vector construction, introduction of the vector into a host and The techniques necessary for expression in that host are within the level of routine skill in the art. The present invention also relates to host cells comprising the vector constructs described herein, wherein In addition, using heterogeneous control regions (eg, promoters) using techniques known in the art. Operable with one or more of the Host cells containing the nucleotide sequence of the invention. Host cells Higher eukaryotic cells, such as mammalian cells (eg, cells derived from humans) or other cells For example, it can be a lower eukaryotic cell, such as a yeast cell, and the host cell can be For example, it can be a prokaryotic cell, such as a bacterial cell. The host strain was inserted Modifying the gene product in a specific or desired manner that modulates the expression of the gene sequence, What to process may be selected. Expression from certain promoters Can be enhanced in the presence of certain transducing agents; The expression of the peptide may be controlled. Furthermore, the different host cells are translated and translated. For post-translational processing and protein modification (eg, phosphorylation, cleavage, etc.) Has characteristics and specific mechanisms. Suitable cell lines are expressed heterologous proteins Can be selected to establish the desired modifications and processing.   The introduction of the construct into the host cell is performed by the calcium phosphate gene transfer method, DEAE-dex. Tran-mediated gene transfer, cationic lipid-mediated gene transfer, electroporation, traits It can be done by induction, infection or other means. Such a method is, for example, D avis, et al., "Basic Methods In Molecular. Biology (a basic technique in molecular biology) "(1986) It is described in a number of standard laboratory manuals.   This polypeptide may be, for example, a fusion protein (a heterologous protein sequence (of a different protein)). Consisting of polypeptides linked via peptide bonds to And may contain other heterologous functional regions as well as secretion signals. It may be. Such a fusion protein can be used to convert the polynucleotide of the present invention to a desired amino acid. The desired nucleic acid sequence encoding the acid sequence can be compared with other nucleic acid sequences by methods known in the art. Linked together into a unique reading frame, and the fusion protein product is known in the art. It can also be produced by expressing by a method. Apart from this, like this A novel fusion protein can be obtained by protein synthesis technology using, for example, a peptide synthesizer. Can also be manufactured. So, for example, the region of additional amino acids, especially charged amino acids, It can be added to the N-terminus of the polypeptide and added to the host cell, during purification or during subsequent operations and May improve stability and stability during storage and storage. In addition, it facilitates purification A peptide moiety may be added to the polypeptide for this purpose. Such an area is It may be removed prior to final production of the polypeptide. Eg secretion or excretion To improve stability and improve purification and to facilitate purification. The addition of peptides to peptides is a routine and routine technique in the art. Suitable fusion proteins are derived from immunoglobulins useful for solubilizing proteins. Including heterogeneous regions. For example, EPA0466453 (Canadian application is 2045) No. 869) shows that another human protein or a part thereof is a constant region of an immunoglobulin molecule. Disclosed are fusion proteins that include these various parts. Often a fusion protein The quality Fc portion may be used in therapy and diagnosis, for example, with improved pharmacodynamic properties. (EPA 0232262). On the other hand, for certain uses Once the fusion protein has been expressed, detected and purified in the advantageous manner described above, the Fc It may be desirable to be able to remove parts. Fc part used in therapy and diagnosis Has been shown to inhibit, e.g., antigens for immunizing the fusion protein This is the case when it is intended to be used as. For example, in drug development Is used, for example, for the purpose of efficient search to identify hIL5 antagonists. A human protein, such as the IL5 receptor, was fused to the Fc region. By Bennett et al. J. of Molec. Recognition, 8: 52-58 (19 1995) and Johanson et al. Biol. Chem. , 270 volumes : 9449-9471 (1995).   The TR9 receptor is derived from, but not limited to, sulfate from recombinant cell culture. Ammonium or ethanol precipitation, acidic extraction, anion or cation exchange Chromatography, phosphocellulose chromatography, hydrophobic chromatography Raffy, affinity chromatography, hydroxylapatite chroma Recovered by standard methods including chromatography and lectin chromatography And can be purified. Most preferably, high performance liquid chromatography ("H PLC ") for purification.   The polypeptides of the present invention include purified natural products, products of chemical synthesis operations, and Including prokaryotes or cells such as bacteria, yeast, higher plants, insects and mammalian cells Includes products produced by recombinant techniques from eukaryotic hosts. Adopt for recombinant production operation Depending on the host, the polypeptide of the invention may be glycosylated, or It may be a non-glycosylated form. In addition to this, the polypeptides of the invention May have a modified methionine residue, or as a result of a host-mediated process. In some cases, there may be no N-terminal methionine.   TR9 receptor polynucleotides and polypeptides may vary according to the invention. Used for applications, especially those that use the chemical and biological properties of TR9 Sometimes. These include tumor treatment, resistance to parasites, bacteria and viruses Retinopathy to induce sex, T cell, endothelial cell and certain hepatocyte proliferation To treat graft-versus-host disease, modulate antiviral response, and activate Use to prevent certain autoimmune diseases following TR9 stimulation by drugs is there. Another application relates to the treatment and treatment of diseases of cells, tissues and organisms. Book These aspects of the invention are described further below. TR9 receptor polypeptides and fragments   The present invention further relates to the amino acid sequence encoded by the deposited cDNA or FIGS. An isolated TR9 receptor polypeptide having the amino acid sequence of (SEQ ID NO: 2) Providing a peptide or polypeptide comprising a peptide or a portion of said polypeptide I do.   The polypeptides of the invention may be membrane-bound and in circulating soluble form. You may. Soluble peptides include polypeptides lacking the transmembrane domain. The amino acid sequence is defined as   The polypeptide of the present invention has a transmembrane region and an intracellular region and an extracellular region May be present as a membrane-bound receptor or lack the transmembrane domain It may exist as a soluble form. Examples of TR9 receptor types are shown in FIGS. A TR9 receptor represented by (SEQ ID NO: 2), which comprises a transmembrane domain in addition to a leader sequence. And some contain intracellular and extracellular domains. So, TR9 This type of receptor appears to be localized to the plasma membrane of cells expressing this protein. You.   Certain amino acid sequences of the TR9 receptor significantly affect the structure or function of this protein It will be recognized in the art that it can be varied without effecting. like that If sequence differences are intended, proteins may have determinants that determine activity Should be recalled. Thus, the present invention further demonstrates substantial TR9 receptor activity. Or comprises a region of the TR9 receptor protein, such as the protein portions described below. Includes variants of the TR9 receptor. This mutant has deletions, insertions, inversions, and repetitions. And type substitution. As mentioned above, which amino acid changes are phenotypically Guidance on whether or not rent is available from Bowie et al., "Deciphering. the-Message-in-Protein-Sequences: Tol erance-to-Amino-Acid-Substitutions ", Science, 247: 1306-1310 (1990). I have.   Therefore, the polymorphisms of FIGS. 1A-D (SEQ ID NO: 2) or the deposited cDNA The fragment, derivative or analog of the peptide is (i) one or more amino acid residues Is a conservative or non-conservative amino acid residue (preferably a conservative amino acid residue, Preferably at least one and less than ten amino acid residues) The amino acid residue to be substituted is not encoded in the genetic code. (Ii) one or more of the amino acid residues (Iii) the mature polypeptide is, for example, a peptide Other compounds, such as compounds that increase half-life (eg, polyethylene glycol) (Iv) for example, an IgG Fc fusion region peptide or Is the leader or secretory sequence or the purified or proprotein sequence of the mature polypeptide Additional amino acids are fused to the mature polypeptide, such as the sequence adopted for May be; Such fragments, derivatives and analogs are described herein. The teachings are considered to be within the skill of the art.   Of particular interest are charged amino acids due to other charged amino acids and neutral or Substitution with a negatively charged amino acid. The latter involves proteins with a reduced positive charge. To improve the properties of the TR9 receptor. Prevention of aggregation is highly suitable. protein Aggregation is not only a loss of activity, but also a problem during the manufacture of pharmaceutical preparations due to its immunogenicity May cause (Pinkard et al., Clin. Exp. Immun ol. 2: 331-340 (1967); Robbins et al., Di. abetes, 36: 838-845 (1987); Cleland et al. Author, Crit. Rev .. TherapeuticIDrrug. Carrier Systems, 10: 307-377 (1993)).   Amino acid substitutions also alter binding selectivity for cell surface receptors. Osta de et al., Nature, 361: 266-268 (1993). TNF-α is only one of the two known types of TNF receptor It states that it will selectively bind. Thus, the TR9 receptor of the present invention Up to one amino acid substitution, deletion or addition due to natural mutation or human manipulation Or more.   As mentioned above, this change has a significant effect on, for example, the folding or activity of the protein. And smaller conservative amino acid substitutions that do not give (see Table 1).                         Table 1 Conservative amino acid substitution   In particular aspects, the amino acid sequences of FIGS. 1A-D and or as described herein. Any polypeptide fragment (eg, extracellular domain or intracellular domain) The number of substitutions, additions or deletions of the amino acid sequence of 75, 70, 60, 50, 40, 35, 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 Or 30-20, 20-15, 20-10, 15-10, 10-1, 5-10, 1-5, 1-3 or 1-2.   Amino acids essential for the function of the TR9 protein of the present invention include, for example, site-specific mutations. Mutagenesis or alanine scanning mutagenesis (Cunningham and W ells, Science, 244: 1081-1085 (1989)) Can be confirmed by methods known in the art. In the latter operation, A single alanine mutation is introduced at every residue in the molecule. Mutants obtained Molecules are tested for biological activity, for example, receptor binding or in vitro proliferative activity. And test. Critical sites for ligand-receptor binding include, for example, crystallization, Structural analysis such as nuclear magnetic resonance or photo-affinity labeling Can be determined (Smith et al., J. Mol. Biol., 224: 899- 904 (1992) and De Vos et al., Science, 255 : 306-312 (1992)).     The polypeptide of the present invention is preferably provided in an isolated form. "I'm separated "Polypeptide" means a polypeptide that has been removed from its native environment. Made Polypeptides made and / or contained in recombinant host cells are objects of the invention. Let's assume that they are separated. Is "isolated polypeptide" a recombinant host cell? Or partially or substantially purified polypeptide. For example, recombinant The TR9 receptor produced by Smith and Johnson, Gene, 67 : Substantially one-step method described on pages 31 to 40 (1988).   The polypeptide of the present invention includes a leader containing a leader encoded by the deposited cDNA. Peptide; mature polypeptide encoded by the deposited cDNA minus leader ( I.e., the mature protein); including amino acids from about -40 to about 615 of SEQ ID NO: 2. A polypeptide comprising amino acids from about -39 to about 615 of SEQ ID NO: 2 Peptide: a polypeptide comprising from about 1 to about 615 amino acids of SEQ ID NO: 2 Polypeptide containing the extracellular domain; TNFR-like cysteine-rich of TR9 A polypeptide containing four motifs (amino acid residues 67 to 211 in FIGS. 1A to 1D). Amino acid residues 27 to 171 of SEQ ID NO: 2); Polypeptide containing intracellular domain; including extracellular and intracellular domains A polypeptide in which all or part of the transmembrane domain has been deleted; Lpeptides (amino acid residues 429 to 495 of FIGS. 1A-D; Amino acid residues 389-455); and / or containing a TR9 leucine zipper. Lpeptides (amino acid residues 497 to 518 of FIGS. 1A-D; Amino acid residues 457-478); and at least 80% identical to the polypeptide. One polypeptide; preferably a polypeptide that is at least 90% or 95% identical More preferably at least 96%, 97%, 98%, or 99% identical And at least three amino acids which are part of these polypeptides. Those having 0 amino acids; more preferably those having at least 50 amino acids.   For example, at least 95 relative to a reference amino acid sequence of a TR9 receptor polypeptide. % A polypeptide having an "identical" amino acid sequence is one in which the sequence of the polypeptide is Up to 5 amino acid changes per 100 amino acids of the control amino acids of the TR9 receptor Means that this polypeptide is identical to the control sequence except that it may contain I do. In other words, an amino acid sequence that is at least 95% identical to a control amino acid sequence Up to 5% of the amino acid residues in the control sequence are deleted to obtain a polypeptide with Or may be substituted with other amino acids, or all amino acid residues in the reference sequence Up to 5% of the total number of amino acids may be inserted in the control sequence. Of the control sequence This change may occur at the amino or carboxy terminal position of the control amino acid sequence. Or anywhere between these two ends, the residues of the control sequence May be interspersed individually, or as one or more contiguous groups within a control sequence. There may be more.   In practice, certain polypeptides are shown, for example, in FIGS. 1A-D (SEQ ID NO: 2). The amino acid sequence, the amino acid sequence encoded by the deposited cDNA clone, or At least 90%, 95%, 96%, 97%, 98% or 99% identical to the fragment For example, check the Bestfit program (Wisconsin / Seque ance / Analysis / Package, 8th edition for Unix, Geneti cs / Computer / Group, University Research Park, 575 Known drives such as Science Drive, Madison, WI, 53711) Can be routinely determined using computer programs. Certain sequences according to the invention Bestfit to determine if it is, for example, 95% identical to the control sequence of Or when using other sequence alignment programs, the percent identity As calculated over the entire length of the control amino acid sequence, Set the parameters to allow up to 5% of the total number of amino acid residues. specific In an embodiment, the identity between the control (problem) sequence (the sequence of the invention) and the sequence of interest Is also called a general sequence alignment, using the FASTDB computer program It is determined. This program is based on Brutlag et al. (Comp. App. Bio.) sci. 6: 237-245 (1990)). I have. Preferred parameters used for FASTDB amino acid alignment are: matrix = PAM0, k-set = 2, mismatch penalty = 1, join penalty = 20, random Digitized group length = 0, cutoff score = 1, window size = sequence length, gap Nalty = 5, gap size penalty = 0.05, window size = 50 0 or the shorter of the desired amino acid sequence length. According to this aspect, if Because the sequence of interest is not an internal deletion but an N-terminal or C-terminal deletion, FASTDB program calculates overall identity percentage if result is shorter than sequence Do not include cuts at the N- and C-termini of the target sequence Make manual corrections taking into account the facts. N-terminal and C-terminal truncated purposes N-terminal of the sequence of interest for percent identity compared to the sequence in question Of the sequence in question does not match / align with the corresponding residue of interest at the C-terminus and C-terminus It is corrected by calculating the number of residues as a percentage of the total number of bases. Ah The determination of which residues match / align depends on the results of the FASTDB amino acid alignment. I decide. The FASTDB program uses this percentage to describe the parameters. Subtract from the percentage match calculated in to arrive at the final identity value. This final identity The percentages are used for the purpose of this embodiment. Do not match / align with the sequence in question Only the residues at the N-terminus and C-terminus of the target sequence have manual identity percentage values. It is considered for the purpose of preparing in. The farthest N-terminus of the sequence of interest and Residues of interest outside the C-terminal residue are occupied. For example, amino acid residues of the target sequence Ninety are aligned with 100 residues of the sequence in question to determine percent identity. Deletion is eye Occurs at the N-terminus of the sequence of interest, so alignment by FASTDB No match / alignment is taken into account for the 10 residues. This unpaired residue is 10% of the sequence (Number of residues that do not match at the N- and C-termini / total number of residues in the sequence in question) Therefore, this is subtracted from the percentage identity value calculated by the FASTDB program. remaining If the 90 residues completely match, the final percent identity is 90%. Another In the example, 90 residues of the sequence of interest are compared to 100 residues of the sequence in question. In this case, the deletion is an internal deletion and residues that do not match / align with the sequence in question are At the N- and C-termini of the sequence In this case, it was calculated by FASTDB There is no manual modification of the percentage identity. Of the problem indicated by FASTDB alignment In the target sequence that does not match / align with the sequence, the residue positions outside the N- and C-termini are Correct again manually. No other manual corrections are made for the purposes of this embodiment.   The polypeptides of the present invention include, but are not limited to, those skilled in the art. On a SDS-PAGE gel or molecular sieve used in a manner familiar to There are uses that include making it a molecular weight marker on a gel filtration column.   Numerous proteins containing the mature extracellular domain of membrane-associated or secreted proteins In the art, a single amino acid or It is known that more can be deleted from the N-terminus or C-terminus. However In addition, one or more amino acids are deleted from the N-terminus or C-terminus of a protein and the protein is deleted. Modification or loss of one or more biological functions of white matter can result in other TR Nine functional activity may be maintained. For example, often shortened proteins Induce antibodies that recognize TR9 (preferably antibodies that specifically bind to TR9) And / or the ability to bind the antibody is independent of the size or location of the deletion Will be maintained. Certain deletions of the N-terminal and / or C-terminal residues of the complete protein Whether or not a polypeptide retains such immunological activity is described herein. Or readily determined by routine methods known in the art.   In one aspect, the invention is further described in FIGS. 1A-D (SEQ ID NO: 2) or deposited. Amino acid sequence of the TR9 polypeptide encoded by the cDNA of the clone Provided is a polypeptide having one or more residues deleted from the terminus. Especially aspects In one, the N-terminal deletion of the TR9 polypeptide has the general formula m to 615 Where m is from -39 to 614 and the amino acid identified in SEQ ID NO: 2 N, corresponding to the position of the N-acid, and preferably identified by the N-terminal deletion described herein. Corresponds to one of the terminal amino acid residues. In a specific aspect, the TR9 polypeptide of the invention The N-terminal deletion of the peptide contains the following amino acid residues or Consisting of: (“to” in the amino acid residues listed below is “ ". ) Polynucleotides encoding these polypeptides are also included in the present invention.   In another embodiment, the N-terminal deletion of the TR9 polypeptide is of the general formula m to 310: Where m is from -40 to 309, and Corresponds to the amino acid sequence. In a specific embodiment, the N-terminal deletion of TR9 of the present invention comprises the following: It contains amino acid residues or consists of the following amino acid residues: ie (below In the amino acid residues listed above, “to” is translated as “kara”. ) Polynucleotides encoding these polypeptides are also included in the present invention.   Another aspect of the invention is a C-terminus of a TR9 polypeptide represented by the general formula: 1 to n. Directs deletion. Here, n is a number from 2 to 614 and is found in SEQ ID NO: 2. Corresponding to the position of the amino acid residue to be deleted, preferably at the C-terminal deletion specified herein. It corresponds to one of the identified C-terminal amino acid residues. In a specific aspect, the present invention The C-terminal deletion of a TR9 polypeptide comprises the following amino acid residues or Consists of amino acid residues: ie (in the amino acid residues listed below, " "to" is translated as "kara". ) Polynucleotides encoding these polypeptides are also included in the present invention.   Another aspect of the invention comprises or comprises amino acids of general formulas m to n. Directs the polypeptide fragment to be formed. Where m and n are each of these symbols Corresponds to any one of the specified amino acid residues. These polypeptides Polynucleotides encoding are also included in the present invention.   The polypeptide fragment of the present invention has the amino acid sequence of SEQ ID NO: 2, The amino acid sequence encoded by the cDNA included in the loan or the deposited clone Form a hybrid with the contained nucleotide sequence (eg, stringency 1A-D (under SEQ ID NO: 1). An acid or a polypeptide contained in the sequence encoded by the nucleic acid of the complementary strand thereof. Including. Protein fragments may be "free" or may be reduced to larger polypeptides. Included, the fragments of which may be part or form regions, most preferably A single continuous area may be formed. Representative examples of polypeptide fragments of the present invention Include, for example, the following amino acid residues, or Includes what is formed: ie Or from 601 to the end of the coding region of SEQ ID NO: 2. Furthermore, polypep The tide fragment is at least about 20, 30, 40, 50, 60, 70, 80, 90, 1, Can be 00, 110, 120, 130, 140 or 150 amino acids in length. Wear. Here, "about" is a specific range, several amino acids at one or both ends (5, 4, 3, 2, or 1) indicates larger or smaller.   Particularly preferred fragments of the invention are characterized by the structural or functional properties of TR9. Be charged. Such fragments include the TR9 alpha helix and alpha Helix forming area ("alpha area"), beta sheet and beta sheet form Formation region ("beta region"), turn and turn-forming region ("turn region"), Coil and coil forming region ("coil region"), hydrophilic region, hydrophobic region, Fa amphipathic region, beta amphiphilic region, surface forming region, and high antigen index region Domain (ie use the default parameters of the Jameson-Wolf program) A poly-amino acid residue that is equal to or greater than the antigen index of 1.5. Region of the peptide). Certain preferred areas are shown in FIG. Disclosed, but not limited to, the amino acids set forth in FIGS. Such regions include regions of the type identified by analysis, such preferred regions include: Gar nier-Robson putative alpha, beta, turn and carp regions Chou-Fasman inferred alpha region, beta region, turn region and And coil regions; putative hydrophilic and hydrophobic regions of Kyte-Doolittle Eisenberg alpha amphipathic domain, beta amphipathic domain; Emin i surface formation region; and default parameters of these computer programs Includes high antigen index region of Jameson-Wolf estimated using data . Polynucleotides encoding these polypeptides are also included in the present invention.   In a specific embodiment, the polypeptide fragment of the invention comprises the following amino acid residues, Or consisting of the following amino acid residues:   In another aspect, the fragment or polypeptide of the invention (ie, as described herein) Is not greater than: amino acid residue length   In another aspect, the invention relates to an epitope-bearing portion of a polypeptide according to the invention. Or a peptide or polypeptide comprising: Epitope of polypeptide part Is an immunogenic epitope or the antigenicity of a polypeptide described herein Is an epitope. An "immunogenic epitope" is defined as the total protein is immunogenic. A protein is defined as a part that performs an antibody reaction. On the other hand, proteins to which antibodies can bind Regions of the molecule are defined as "antigenic epitopes." Generally a protein immunogen The number of sexual epitopes is less than the number of antigenic epitopes. For example, Geysen K., Proc. Natl. Acad. Sci. USA, 81: 3998-4 002 (1983).   A peptide or polypeptide having an antigenic epitope (ie, a protein molecule) (Including the region to which the antibody binds) is selected. Relatively short synthetic peptides usually produce antisera that react with partially mimicked proteins. It is well known in the art that For example, J. G. FIG. Sutcl ife et al., "Antibodies, That, React, With, Predetermined, Sites, on Proteins (planned Antibodies reacting with sites on proteins) ", Science, 219: 660-66. See page 6 (1983). Peptides that can make protein-reactive serum Often represented by the primary sequence of proteins, they can be combined by simple chemical rules. And the immunodominant region of the intact protein (ie, It is not limited to (Tope), nor to the amino or carboxy termini.   The peptides and polypeptides of the invention having an antigenic epitope are therefore To make antibodies, including monoclonal antibodies, that specifically bind to a light polypeptide Useful for For example, Wilson et al., Cell, 37: 767-778. See page 777 of page (1984). Peptides having the antigenic epitope of the present invention Preferably at least 7, more preferably at least 7, 9, most preferably at least about 15 to about 30 polypeptides of the invention Amino acids in the amino acid sequence of   Antigenic polypep that can be used to generate antibodies specific for the TR9 receptor Non-limiting examples of a tide or peptide include: SEQ ID NO: From about 4 to about 81 of SEQ ID NO: 2, from about 116 to about 271 of SEQ ID NO: 2, SEQ ID NO: 2 From about 283 to about 308 of SEQ ID NO: 2, from about 336 to about 372 of SEQ ID NO: 2, No. 2 from about 393 to about 434, and SEQ ID NO: 2 from about 445 to about 559. And a polypeptide comprising amino acid residues from about 571 to about 588 of SEQ ID NO: 2. As described above, the present inventors have determined that the polypeptide fragment has the antigenicity of the TR9 receptor protein. Decided to be an area.   The peptide or polypeptide of the present invention having an epitope can be prepared by a conventional method. May be produced. R. A. Houghten, General Meth. od for the the Rapid Rapid Solid Phase Syntheses is-of-Large-Numbers-of-Peptides: Spec ifity ・ of ・ antigen-antibody ・ interact ion ・ the ・ the ・ Level ・ of ・ Individual ・ Amino Acids (General method for rapid solid-phase synthesis of a large number of peptides: Specificity of Antigen-Antibody Interaction in Proc. Natl. Acad. Sci. USA, 82: 5131-5135 (1985). This "Simulta neous / Multiple / Peptide / Synthesis (SMP S: Simultaneous Multiple Peptide Synthesis)) "method was further provided to Houghten. It is also described in detail in U.S. Pat. No. 4,631,211 (1986).   As will be appreciated by those skilled in the art, the TR9 receptor of the present invention described above. Polypeptides and fragments thereof having an epitope are immunoglobulins (IgGs). It can bind to portions of the constant domains to provide a chimeric polypeptide. these Fusion protein facilitates purification and exhibits an increased half-life in vivo. This is, for example, First two domains of the CD4 polypeptide and the heavy chain of a mammalian immunoglobulin And chimeric proteins composed of various domains in the constant region of the light chain. (EPA 394827; Traunecker et al., Nat. ure, 331: 84-86 (1988)). Disulfide in IgG part The fusion protein having the binding dimer structure is further different from the TR9 protein or the protein fragment alone. Can efficiently bind to and neutralize other molecules (Funtoulak is, et al. Biochem. 270: 3958-3964 (199 5 years)). Polypeptide assays   The present invention also relates to TR9 receptor proteins or their Normal and abnormal levels such as quantitative and diagnostic assays to detect soluble form levels The present invention relates to a diagnostic assay including determination of a bell. So, for example, compared to a normal control tissue sample Diagnostic assay for detecting overexpression of TR9 or a soluble form thereof according to the invention The method may be used, for example, to detect the presence of a tumor. Sample obtained from the host Level of the protein therein, such as the TR9 protein of the invention or a soluble form thereof Assay techniques that can be used to determine for, are well known to those skilled in the art. You. Such assays include radioimmunoassays, competitive binding assays, and Western blots. Includes lot analysis and ELISA assay.   Assaying the level of TR9 protein in a biological sample is a method known in the art. Can be performed by using any of the above. "Biological sample" refers to the TR9 receptor From individuals, cell lines, tissue cultures or other sources that contain the protein or mRNA It is meant to include any of the biological material obtained. TR9 protein in a biological sample Preferred for assaying white matter levels are antibody-based techniques. For example, an organization Expression of TR9 protein in E. coli can be studied by classical immunohistological methods. (Jalk Anen et al. Cell Biol. 101: 976-985 (1 985); Jalkanen et al. Cell Biol. 105 volumes: 3 087-3096 (1987)). To detect TR9 receptor gene expression Other methods based on antibodies that are useful for, for example, enzyme-linked immunosorbent assays (RLI SA) and immunoassays such as radioimmunoassay (RIA).   Suitable labels are known in the literature; for example, glucose oxidase Enzyme labeling; and iodine (¹²⁵I,¹²¹I), carbon (¹⁴C), sulfur (³⁵S), Mie hydrogen(^ThreeH), indium (¹¹²In) and technetium (⁹⁹mTc) Radioisotopes; and fluorescents such as fluorescein and rhodamine Photolabels; and biotin. Therapeutic agent   Ligands of the tumor necrosis factor (TNF) family have many pleiotropic cytokines. Is known to be a member of the family of cytotoxic, antiviral, Induces numerous cellular responses, including epidemiological regulatory activity and transcriptional regulation of several genes. (D. V. Goeddel et al., "Tumor / Necrosis / Factors" ： Gene ・ Structure ・ and ・ Biological ・ Activ items (tumor necrosis factor: gene structure and biological activity) ", Symp. Q ant. Biol. 51: 597-609 (1986), Cold. Spring Harbor; B. Beutler and A.J. By Cerami, An nu. Rev .. Biochem. 57: 505-518 (1988); L. J. Old, Sci. Am. 258: 59-75 (1988); W. Fiers, FEBS Lett. 285: 199-224 (19 1991)). TNF family ligands include TNF families including TR9 of the present invention. Induces a number of cellular responses by binding to Rea receptors. TR9 polypep Fetal cells that express Tide and are believed to have a strong cellular response to TR9 ligand For liver, PBL lung, kidney, large intestine, small intestine, keratinocytes, endothelial cells and monocytes Includes activated tissue. What is "cell response to TNF family ligands" Genotype, phenotype for cell, cell line, tissue, tissue culture or patient And / or morphological changes. As described above, such a cellular response requires T Apoptosis as well as normal physiological response to NF family ligands Also includes diseases associated with enhancement or inhibition of apoptosis. Apoptosis--Prog Ramped cell death--the physiological mechanism involved in the removal of peripheral T lymphocytes of the immune system And its dysregulation leads to a number of pathological processes (J. C. Ameise n, AIDS, 8: 1197-1213 (1994); H. Kra mmer et al., Curr. Opin. Immunol. , Volume 6: 279-28 9 (1994)).   Diseases associated with increased cell survival or apoptosis inhibition Carcinomas (eg follicular lymphoma, cancers with p53 mutations and eg breast cancer, Hormone-dependent tumors such as prostate cancer, Kaposi's sarcoma and ovarian cancer), autoimmunity Diseases (eg, systemic lupus erythematosus and immune-related nephritis, rheumatoid arthritis) Viral infections (eg, herpes virus, polio virus and adenoids); Inflammation; graft-versus-host disease; including acute and chronic graft rejection I will. Diseases associated with enhanced apoptosis include AIDS; For example, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, pigmented retinopathy, Cerebellar degeneration); myelodysplastic syndrome (eg, aplastic anemia); ischemia Sexual disorders (eg, due to myocardial infarction, stroke and reperfusion injury), toxin induction Liver disease (for example, due to alcohol), septic shock, cachexia, And loss of appetite.   Thus, in one aspect, the present invention provides TR9 polypeptide expressing cells with TR9 polypeptide. Ligands, analogs thereof, or agents capable of increasing TR9-mediated signaling Induced by a TNF family ligand comprising administering an effective amount of a drug. To enhance apoptosis. Preferably TR9-mediated signaling For diseases with reduced apoptosis or decreased cytokines and adhesion molecule expression Increase before placing. Although not limited to this, TR9 includes TR9 Antibodies to soluble forms and TR9 polypeptides (preferably monoclonal Body).   In yet another aspect, the invention relates to a cell expressing a TR9 polypeptide. TN comprising administering an effective amount of an antagonist capable of reducing signaling Directing a method to inhibit apoptosis induced by F family ligands You. Preferably, TR9 mediated signaling induces apoptosis, NFkB expression and / or Alternatively, the disease is reduced until a disease showing an increased expression of JNK is treated. This is an antagonist Without limitation, soluble forms of TR9 polypeptides and TR9 polypeptides Antibodies to the peptides (preferably monoclonal antibodies).   "Agonists" are natural sources capable of enhancing or enhancing apoptosis and A compound derived from synthesis is meant. "Antagonists" can inhibit apoptosis Natural and synthetic compounds. The “agonist” or “antagonist” of the present invention It is known in the art whether `` antagonists '' can enhance or inhibit apoptosis. TNF family ligands / receptors, including those described in more detail below It can be determined using a cell response assay.   One such screening procedure is to express the receptor of the present invention. Use the transfected melanophore. Such a screening technique was introduced in 1992 It is described in PCT WO 92/01810 published on February 6. For example Compounds that inhibit (or enhance) the activation of the receptor polypeptide of the present invention Melanophore cells encoding this receptor and TNF family members This contact by contacting both Gand and a candidate antagonist (or agonist) Such an assay may be employed. Inhibition of the signal generated by this ligand or Enhancement is when the compound is a signal transduction pathway ligand / receptor antagonist or agonist Is shown.   Other screening techniques include, for example, Science, 246: 181-29. Extracellular pH at which receptor activation occurs as described on page 6 (1989) Receptor expressing cells (eg, transfected CH) in a system for measuring changes O cells). For example, a compound may express a receptor polypeptide of the present invention. Contacting the cells with a second messenger reaction such as signal induction or pH change Activation is measured to determine whether the candidate compound activates or inhibits the receptor.   Other screening techniques include the use of African tools to temporarily express the receptor. Introducing the RNA encoding the receptor into the oocytes of the Megafrog. next Contact this receptor oocyte with receptor ligand and compound to be screened And then screen for compounds that appear to inhibit receptor activation In some cases, inhibition or activation of the calcium signal is detected.   In other screening techniques well known in the art, the receptor is phosphorylated. The construct linked to Pase C or D is expressed in the cell. An exemplary cell is Endothelial cells, smooth muscle cells, fetal kidney cells and the like. This screening is Activation or reception of a receptor from a phospholipase signal as described above. It does so by detecting inhibition of body activity.   Other methods determine inhibition of labeled ligand binding to cells with receptors on the surface By inhibiting the activation of the receptor polypeptide of the present invention Including screening. For such a method, eukaryotic cells are coated with receptors. The DNA to be transfected is transfected and the cell expresses the receptor on the surface, and the cell is labeled. The compound is contacted in the presence of a known ligand. The ligand can be It can be labeled by firing ability. For example, by measuring the radioactivity of the receptor The labeled ligand bound to the body is measured. The compound binds to the receptor If a decrease in bound labeled ligand is measured, binding of labeled ligand to the receptor is Is inhibited.   Soluble forms of the polypeptides of the present invention may be utilized in the ligand binding assays described above. After this form of the TR9 receptor has been secreted, it is contacted with a ligand in the extracellular medium. Next, it is quantified whether the secreted protein binds to the TR9 receptor ligand. Assays for screening for agonists and antagonists of the invention are also available from Tarta Glia et al. Biol. Chem. 267: 4304-4307 (1992).   Thus, in yet another aspect, a candidate agonist or antagonist is a TNF family member. Script to determine whether the cell response to gand can be enhanced or inhibited Provide a learning method. For this method, cells expressing the TR9 polypeptide are candidates. Contacting the compound and a TNF family ligand and assaying the cellular response; It involves comparing the cellular response to a standard cellular response. This standard provides for ligand-free contact. I went there. Increased cellular response over the standard indicates that the candidate compound C / receptor signaling pathway. Cells reduced from normal Response indicates candidate compound is an antagonist of ligand / receptor signaling pathway You. "Assay for cell response" refers to candidate compounds and / or TNF family ligands. Qualitatively or quantitatively (eg, T cell proliferation or Determining or assessing the increase or current status of lysylated thymidine labeling) means. A cell expressing a TR9 polypeptide according to the present invention may be endogenously or It can be contacted with an exogenously administered TNF family ligand.   Agonists according to the present invention include, for example, TNF family ligand peptide fragments, Transforming growth factors, neurotransmitters (eg, glutamate, dopamine, N-methyl-D-aspartate), tumor suppressor (p53), cytolytic T cells Naturally occurring and synthetic compounds such as vesicles and antimetabolites are included. Suitable Agonists include, for example, cisplatin, doxorubicin, bleomycin, cytosine Arabinoside, nitrogen mustard, methotrexate and vincristine Contains chemotherapeutic agents such as stin. In addition, ethanol and -amyloid pep Contains tide. (Science, 267: 1457-1458 (1995) )). Another suitable agonist is for a TR9 polypeptide of the present invention or a fragment thereof. Polyclonal and monoclonal antibodies. Such a T Agonist antibodies raised against the NF family of receptors are Tartaglia et al. Author, Proc. Natl. Acad. Sci. USA, 88: 9292-92 96 (1991) and Tartaglia et al. Biol. Che m. 267: 4304-4307 (1992). PC See also T application WO 94/09137.   Antagonists according to the present invention include, for example, C40 ligand, neutral amino acids, zinc, Trogen, androgen, viral genes (eg, adenovirus E1B, Clovirus p35 and IAP, Cowpox virus crmA, Epsta In-Barr virus BHRF-1, LMP-1, African swine fever virus LM W5-HL, and herpesvirus yl34. 5), calpain inhibitors, cis Tein protease inhibitors, and tumor promoting agents (eg, PMA, phenobarbi Natural sources such as tar and -hexachlorocyclohexane) and Synthetic compounds are included.   In a particular embodiment, the antagonist of the present invention comprises a sequence contained in FIGS. To the nucleotides contained in the nucleic acid corresponding to the strand and / or the deposited clone. The corresponding nucleic acid. In one embodiment, the antisense sequence is in vivo by the organism. Although produced, in other embodiments, the antisense sequence is administered separately (e.g., O'C onnor, J.M. Neurochem. 56: 560 (1991); “Oligodeoxynucleides, as Antisense, Inhibitors of Gene, Expression (of gene expression) Oligodeoxynucleotides as antisense inhibitors) ”, CRC Pre ss, Boca Raton, Florida (1988)). Antisense DNA Or regulate gene expression by RNA or by triple helix formation Antisense technology can be used to Antisense technology is, for example, Okano Author, J. et al. Neurochem. 56: 560 (1991); odeoxynucleotides ・ as ・ Antisense ・ Inhib itors of Gene, Expression (antisense of gene expression) Oligodeoxynucleotides as inhibitors), CRC-Press, Inc. Kalaton, FL (1988). About triple helix formation Are described, for example, by Lee et al., Nucleic. Acids. Research, Volume 6 3037 (1979); Cooney et al., Science, 241: 456 (1988); and Dervan et al., Science, 251. Volume: 1300 (1991). This method is a polynucleotide Based on binding to DNA or RNA that is complementary to   For example, the 5 'sequence of a polynucleotide encoding the mature polypeptide of the present invention. Antisense RNA polymerase of about 10 to 40 base pairs in length Design nucleotides. Involved in gene transcription in DNA polynucleotides It is designed to be complementary to the region and to prevent transcription and production of the receptor. This anti The sense RNA polynucleotide forms a hybrid with mRNA in vivo, Blocks translation of the mRNA molecule into the receptor polypeptide. As described herein Polynucleotides also allow the antisense RNA or DNA to It can be delivered to cells to be expressed in vivo for inhibition.   In one embodiment, the antisense nucleic acid of the invention is transcribed from an exogenous sequence. Produced in cells. For example, the vector or a part thereof may be transcribed to Produce a sense nucleic acid (RNA). Such a vector is a TR9 antisense It would include sequences encoding nucleic acids. Where such vectors are transcribed As long as it produces the desired antisense RNA, it remains on the chromosome even if it remains in the episome. It may be incorporated. Such vectors are standard recombinant DNs in the art. A technology can be used. Vectors are vertebrate cells known in the art Plasmid, virus or other plasmid used for replication and expression in It may be something. Expression of a sequence encoding TR9 or a fragment thereof is a vertebrate Any known in the art to act in cells, preferably human cells It may be due to any promoter. Such promoters are inducible It may be either sex or structural. Such promoters include Without limitation, the SV40 early promoter region (Bernoi) St. and Chambon, Nature, 29: 304-310 (1981) Year), the promoter contained in the 3 'long terminal repeat of Rous sarcoma virus (Y Amamoto et al., Cell, 22: 787-797 (1980), Herpes thymidine promoter (Wagner et al., Proc. Natl. A cad. Sci. USA, 78: 1441-1445 (1981), Meta. Regulatory sequence of the rothionine gene (Brinster et al., Nature, 29 6: 39-42 (1982)) and others.   The antisense nucleic acid of the present invention is complementary to at least the RNA transcript of the TR9 gene. Including sequences. However, absolute complementarity is preferred but not essential. Honcho The sequence "complementary to at least a portion of the RNA" described in the specification is the A sequence that has sufficient complementarity to form a lid and form a stable duplex means. For double-stranded TR9 antisense nucleic acids, try one strand of double-stranded DNA. Or assay for triplex formation. The ability to form a hybrid It will depend on the complementarity and length of the antisense nucleic acid. Generally hybrid The longer the nucleic acid that forms the base, the longer the mismatch of the base that may be contained in the TR9 RNA. But still forms a stable double strand (or triplex in some cases) Is done. One skilled in the art is familiar with the standard for determining the melting point of a hybridized complex. The tolerance of the mismatch can be ascertained using a statistical procedure.   Potential antagonists according to the present invention include catalytic RNAs or ribosomes (eg, PCT International Publication WO 90/11364 published October 4, 990; Sarver See Science, 247: 1222-1225 (1990). See). The ribozyme that cleaves mRNA at a specific recognition sequence is TR9 mRNA The use of a hammerhead ribozyme is preferred. Han Merhead ribozyme is a flanking region that forms complementary base pairs with the target mRNA Cleaves mRNA at sites governed by regions. The only requirement is that the target mRNA It has a two-base sequence: 5'-UG-3 '. Hammerhead ribo team Construction and production are well known in the art and have been described by Haseloff and Ger. Lach, Nature, 334: 585-591 (1988). Have been. The nucleotide sequence of TR9 (FIGS. 1A-D) contains a potential hammerhead. There are many deribozyme cleavage sites. Preferably, the ribozyme is processed into TR9 A cleavage recognition site is located near the 5 'end of the mRNA. This increases efficiency and is This is to reduce the accumulation of functional mRNA transcripts in cells. Antisense The DNA construct encoding this ribozyme is introduced into the The cells are introduced in the same manner as described above. Ribozyme is catalytic unlike antisense molecules However, a low intracellular concentration is required for efficiency.   Other antagonists of the invention include soluble forms of TR9 (eg, TR9 as described in FIGS. 1A-D). 9 ligand sequence obtained from the extracellular region of the full-length receptor Including fragments). Soluble forms of such receptors are of natural or synthetic origin. May compete with cell surface TR9 for binding to TNF family ligands. Combination antagonizes TR9-mediated signaling. So the ligand binding Soluble forms of this receptor, including the mains, are induced by TNF family ligands It is a novel cytokine that can inhibit apoptosis. These are two quantities It is preferably expressed as an isomer or trimer. The reason is, for example, In c-TNF receptor family fusions, more antagonists than monomeric forms of soluble receptors This is because it has been proven to be excellent. Other cytokines are not Known in the art to physiologically induce apoptosis induced by Fas ligand Including FasB (a soluble form of the mouse Fas receptor) that acts to restrict (Hu ghes and Crispe, J.M. Exp. Med. , 182: 1395-14 01 (1995)).   The experiments described in Examples 5 and 6 show that the TR9 receptor is different from other homologous proteins. It is also a death domain containing molecule that can trigger apoptosis, Important for system regulation. In addition to this, the experiments described below are TR9 induced CrmA and z-VAD apoptosis is an inhibitor of ICE-like protease Suggests being blocked by fmk. It is important to note that TR9-induced Pototosis has long been a death signal by Fas / APO-1 and TNFR-1. Or FLICE dominant that has been shown to inhibit transduction of Negative version (FADD-DN or FLICE-DN / MACHa Expected to be blocked by 1C360S). ICE-like protease FDN-DN and FLICE-DN / MACHalC360 S could also be used as an antagonist for TR9 activity.   The antagonist of the present invention may also be a TNF family ligand or a TR9 polypeptide of the present invention. Antibodies specific for the peptide are also included. As used herein, the term “antibody” (Ab) Is a "monoclonal antibody" (mAb) is an intact molecule that can bind to an antigen And fragments thereof (eg, Fab and F (ab ') 2 fragments). To taste. Fab and F (ab ') 2 fragments contain the Fc portion present in intact antibodies. Non-specific tissue binding of intact antibodies as they are deleted and are rapidly cleared from the circulatory system May be weak (Wahl et al., J. Amer. Nucl. Med. , 24: 31 6-325 (1983)).   The antibodies of the present invention may be prepared by any of a variety of standard methods using the TR9 immunogens of the present invention. Can be manufactured even if used. As mentioned above, such TR9 immunogens include FIGS. (SEQ ID NO: 2). And, for example, a ligand binding domain, an extracellular domain, Transmembrane domain, intracellular domain, death domain, incomplete death domain, or TR9 polypeptide fragments that include any of these linkages are included.   Agonists or antagonists that are polyclonal and monoclonal antibodies of the invention Is described by Tartaglia and Goeddel, J. Mol. Biol. Chem. , 2 67 (7): 4304-4307 (1992); Tartaglia et al. Author, Cell, 73: 213-216 (1993); and PCT Application W It can be prepared by the method described in O94 / 09137. They are Specific for the polypeptide of the present invention having the amino acid sequence of SEQ ID NO: 2 (ie, un iqly). As used herein, the term "anti- "Body" (Ab) or "monoclonal antibody" (mAb) is an intact And fragments thereof (e.g., Fab and F (ab ') 2 fragments). Means Fab and F (ab ') 2 fragments contain the Fc present in the intact antibody. Non-specific tissue binding of intact antibodies due to lack of May be weak (Wahl et al., J. Amer. Nucl. Med. , 24: 3 16-325 (1983)).   In a preferred method, the antibodies of the invention are mAbs. Such mAbs are hybrid (Kohler and Millstein, Nat. ure, 256: 495-497 (1975) and U.S. Pat. No. 10, Harlow et al., "Antibodies: A. Laborato ry Manual (Antibodies: Laboratory Handbook) ", Cold. Spring Har Bor Laboratory Press, Cold Spring Harbor, NY, 1988; "Monoclonal Antibodies and. Hybridomas: A. New. Dimension ・ in ・ Biolog ical Analysis (monoclonal antibodies and hybridomas: biological New dimension of analytical method) ", Plenum Press, New York, NY, 19 1980; Campbell, Monoclonal. Antibody T technology (monoclonal antibody technology) "," Laboratory. Techniques in Biochemistry. and. Molec ullar Biology (experimental techniques in biochemistry and molecular biology) " Volume 13 (Burdon et al.), Elsevier, Amsterdam (198 4 years)).   Proteins and other compounds that bind to the TR9 domain are also agonists of the invention. And antagonist candidates. Such binding compounds can be used in yeast two-hybrid systems. (Fields and Song, Nature, 340: 245-2). 46 (1989) "capture." A modified version of this yeast two-hybrid system Reported by Roger Brent and his collaborators (Gyuris) Cell 75: 791-803 (1993); Zervos et al., Cell, 72: 223-232 (1993)). Preferably yeast two high The brid system can be used in accordance with the invention to bind the ligand binding domain of TR9 to extracellular, intracellular, Capture compounds that bind to transmembrane and death domains. Such compounds are It is a good agonist and antagonist candidate of the invention.   Using said two-hybrid system, the intracellular domain of TR9 receptor or one thereof The part may be used to identify cellular proteins that interact with this receptor in vivo. Such assays may also provide potential agonistic or antagonistic activity for TR9 receptor function. May be used to identify ligands that exhibit This screening assay Previously identify proteins that interact with the cytoplasmic domain of mouse TNF-RII Have been used to identify two receptor-related proteins. Rothe Ka, Cell, 78: 681 (1994). Cytoplasmic domain of TR9 receptor Proteins and amino acid sequences that bind to ins are good alternative agonists and antagonists of the invention. It is an antidrug.   Other screening techniques include cells expressing the polypeptides of the invention (eg, The extracellular pH change due to receptor activation of (eg, transfected CHO cells) Science, 246: 181-296 (1989). Includes use in systems that measure as such. In other instances, potential agonists or An antagonist is contacted with a cell that expresses a polypeptide of the invention, for example, to signal Measuring a second messenger response, such as transmission, to determine its potential agonist or antagonist One may determine whether the antidrug is effective.   “TNF family ligands” are naturally occurring, recombinant and synthetic ligands. Binding to members of the TNF receptor family via ligand / receptor signaling Means that can guide the road. The TNF ligand family is not limited to these TRAIL, TNF-α, lymphotoxin-α (LT-α, T NF-β), LT-β (present in the heterotrimeric complex LT-α2-β FasL, CD40, CD27, CD30, 4-1BB, OX40, And neurotrophic factor (NGF).   Representative therapeutic applications of the present invention are described in detail below. Immunity defined as AIDS Insufficient conditions are followed by a decrease in the number and function of CD4 + T lymphocytes. Recent reports The loss of CD4 + T lymphocyte cells was 3. Between 5 × 107 and 2 × 109 (Wei et al., Nature, 373: 117-122) P. (1995)). Contribution of CD4 + T lymphocyte deficiency in the development of HIV infection Is believed to be HIV-induced apoptosis. In fact, HIV induces Cell death due to apoptosis is not only in vitro, but importantly in infected individuals (Ameisen, J. et al.). C. Authors, AIDS, 8: 1197- 1213 (1994); by Finkel and Banda, Curr. Opin . Immunol. 6: 605-615 (1995); Muro-Ca. Cho et al. Immunol. 154: 5555-5566 (19 1995)). In addition, apoptosis and CD4 + T have been observed in various animal models of AIDS. There is a close relationship with lymphocyte deficiency (Brunner et al., Nature, 3 73: 441-444 (1995); Gougeon et al., AIDS. Res. Hum. Retroviruses, 9: 553-563 (199 3 years)), apoptosis is an animal model in which viral replication does not cause AIDS Not observed. I mentioned earlier. Another data is uninfected but starts from an HIV-infected patient. Alternatively, activated T lymphocytes are triggered upon encountering FasL, a TNF family ligand. This indicates that potosis occurs. Monocyte cell lines that die after HIV infection Infection of U937 cells with HIV causes new expression of FasL, Has been shown to mediate HIV-induced apoptosis (Bad Lee et al. Virol. 70: 199-206 (1996)) . Furthermore, TNF-family ligands can be detected in uninfected macrophages, but their expression is H Selective refinement of uninfected CD4 + T lymphocytes after IV infection Causes spore death. I mentioned earlier. Thus, the present invention reduces the selective death of CD4 + T lymphocytes. Treating an HIV + individual comprising administering an antagonist of the invention to reduce A method is provided. The administration method and dose will be described in detail below.   In allograft rejection, the immune system of the recipient animal is largely an environmental antigen It was not sensitized in advance because it was sensitized only by A group obtained from a similar member Weaves may not be presented in a similar course as, for example, viruses and bacteria. Absent. In the case of allograft rejection, immunosuppressive therapy brings the immune system to the effector stage Designed to prevent reaching. However, xenograft immunoprofiling The file is more similar to disease recurrence than to allograft rejection. In case of disease recurrence The immune system is already activated, as evidenced by the destruction of native islet cells. Therefore, the immune system is already at the effector stage upon disease recurrence. Departure Bright agonists can suppress the immune response to allo- and xenografts. Lymphocytes activated and differentiated into effector cells express TR9 polypeptide Where they become sensitive to compounds that enhance apoptosis. Therefore, the present invention Provide further methods for creating immunocompetent tissues.   TR9 antagonists of the present invention further include, for example, inflammatory gastritis, rheumatoid arthritis, Associated with inflammatory diseases and stress responses such as osteoarthritis, psoriasis and sepsis Can be used to treat disease.   Additionally, TR9 expression in lymphocytes, soluble TR9 agonists, or antagonists Antibodies (eg, mAbs) could be used to treat this type of cancer. More soluble Various chronic and acute forms, such as leukemia, using TR9 or neutralizing mAbs, Inflammatory diseases such as osteoarthritis, osteoarthritis, psoriasis, sepsis and inflammatory gastritis I could take action. Administration method   The agonists or antagonists described herein may be administered in vitro, in vitro, or in vivo. It can be administered to cells that express the receptor of the present invention. "Effective amount" of agonist or antagonist Is the response of cells to those containing TNF family ligands and polypeptides Means an amount of the compound sufficient to enhance or inhibit Especially "effective amount" of agonist Alternatively, administration of an antagonist is useful for enhancing or preventing TR9-mediated apoptosis. Effective amount. Of course, if enhancement of apoptosis is desired, the agonist of the present invention Is administered with the TNF family ligand. Ordinary skilled workers have agonists or antagonists. The effective amount can be determined experimentally and may be in pure form or as a pharmaceutically acceptable salt, ester Or, it will be appreciated that administration may be in the form of a prodrug. Agonist Alternatively, the antagonist is one or more pharmaceutically acceptable additives (ie, carriers). It may be administered as a composition in combination with the above.   When administered to human patients, the total daily dose of the compounds and compositions of the present invention will be directed to the attending physician. Therefore, it is understood that it is determined within the scope of sound medical judgment. Becomes Specific therapeutically effective dose levels for any particular patient are It depends on factors well known in the art.   A general proposal is for a TR9 polypeptide to be administered parenterally per administration. The total pharmaceutically effective dose is from about 1 μg / kg of patient weight / day to about 10 μg / kg of patient weight. / Day, but as noted above, this range is subject to therapeutic judgment. More preferably, this dose is at least 0.5. 01 mg / kg / day, most preferred Is about 0,0 for this hormone in humans. Between 01 and 1 mg / kg / day. For continuous administration, the TR9 polypeptide is typically from about 1 μg / kg / hr to about 50 μg / kg / hr. Inject 1 to 4 times a day at a rate of μg / kg / hr or use To give a continuous subcutaneous infusion. Solutions in intravenous bags may also be used.   Administration supplies a predetermined concentration of an agonist or antagonist into the blood as determined by the RIA technique. May be adjusted in a patient-specific manner. Therefore, administration to patients is a regular process. The lowest blood level in the row is 50 to 1000 ng / mL, preferably 150 to 500 ng / mL. It may be determined and adjusted with the RIA technique to achieve on the order of ng / mL. TR9 agonist (TR9 receptor polynucleotide, polypeptide or Antibodies (including antibodies) or antagonists (eg, TR9 polynucleotides, polypep of the invention) And antibodies thereto) and a pharmaceutically acceptable carrier or additive. A pharmaceutical composition is provided. This includes oral, rectal, parenteral, Intracerebral, vaginal, intraperitoneal, topical (powder, ointment or transdermal As a patch), as a buccal, or with a spray for oral or nasal administration May be administered. In one aspect, a “pharmaceutically acceptable carrier” is a non-toxic solid , Semi-solid or liquid fillers, diluents, encapsulating materials or other types of formulation materials Means fee. In certain embodiments, "pharmaceutically acceptable" refers to a federal or state Approved by the competent authority of the government or the U.S.E. That are listed in the standards for use in animals, especially humans. this Non-limiting examples of suitable pharmaceutical carriers in embodiments are described in W. Martin, "R emington's Pharmaceutical Sciences Minton's Pharmaceutical Sciences), for example, water and petroleum, animal oils, Includes sterile liquids such as natural oils or oils containing synthetics, including peanut oil, soy Includes such things as oil, mineral oil, sesame oil, and others. The pharmaceutical composition is administered intravenously In some cases, water is a preferred carrier. Salt solutions and dextran especially for injectable solutions Water and glycerin solutions can be employed as liquid carriers.   As used herein, the term “parenteral” refers to dosage forms that include: intravascular, intramuscular Intramuscular, intraperitoneal, intrasternal, subcutaneous, and intraarticular injections and infusions.   Pharmaceutical compositions of the invention for parenteral injection may be sterile, pharmaceutically acceptable aqueous solutions. Or non-aqueous solutions, dispersions or emulsions and sterile injectable solutions or solutions immediately before use. Can be a sterile powder that can be regenerated into a dispersion.   TR9 polypeptides containing transmembrane domains in addition to soluble TR9 polypeptides It is also solubilized with a surfactant such as CHAPS or NP40 and a buffer. If you can use it. Chromosome test   The nucleic acid molecules of the invention are also useful for chromosome identification. Sequence is human A hybrid is formed at a specific position of a color body as a specific target. Book The creation of a DNA map on a chromosome according to the invention involves the identification of the sequence and the genes involved in the disease. This is the first stage of association.   Certain preferred embodiments in this aspect use the cDNAs disclosed herein to This is for cloning the genomic DNA of the TR9 receptor gene. This is various Using well-known technologies and publicly available libraries Can be achieved. Then, using genomic DNA, techniques well known for this purpose are used. An in situ chromosome map is created by surgery.   In addition to this, in some cases, it is also possible to use PCR primers (preferably 15 〜25 bp) to map the sequence to the chromosome. gene Using computer analysis of three untranslated regions to span one or more exons Quickly select primers that do not complicate the amplification process. Then these PCR screening of somatic cell hybrids containing human chromosomes using primers I do.   Fluorescent in situ hybridization of cDNA clones to metaphase chromosome dispersion Using ("FISH"), the exact chromosomal location is obtained in one step. this The technique can be used to probe from cDNAs of about 50 or 60 bp in length. For a review of this technology, see Verma et al., "Human Chromosomes: A ・ Manual ・ Of ・ Basic ・ Techniques (human chromosome: group Handbook of Fundamental Technologies) ", Pergamon Press, NY (1988)) See   Once a sequence has been assigned a chromosome location accurately, the physical location of that sequence on the chromosome Link to genetic map data. Such data is described, for example, in V.A. McKusic k, "Mendelian Inheritance In Man (human Mendelian Genetics) ”from Johns Hopkins University Welch Medical Library Available on site, there is a description. Disease and gene assigned to the same chromosomal region The relationship is then confirmed by linkage analysis (co-inheritance of physically close genes).   Next, determine the differences in cDNA or genomic sequence between affected and unaffected individuals There is a need to. A mutation is observed in any or all affected individuals, If not observed in any normal individual, the mutation may be the etiology of the disease There is.   Although the present invention has been described generally, it is intended to be illustrative but not limiting. The invention will be more readily understood by reference to the following non-limiting examples.                                  Example Example 1: Expression and purification of TR9 receptor in E. coli   In this example, the E. coli expression vector pQE60 is used for bacterial expression (Qiagen, 913 11 Chatsworth Eaton Avenue, California 9259). pQE60 Syrin antibiotic resistance (`` Amp^r)), The origin of bacterial replication ("ori"), Conductive promoter, ribosome binding site (“RBS”), sold by QIAGEN Nickel-nitrilo-triacetic acid (`` Ni-NTA '') affinity resin 6 codons encoding a histidine residue that allows for a purity purification, and Includes an appropriate single restriction enzyme cleavage site. These sequences encode certain polypeptides. The DNA fragment to be added to the polypeptide at the carboxyl terminus of the polypeptide. As produced with six covalently linked His residues (i.e., a "6 x His tag") It is arranged so that it can be inserted in any style. However, in this example, six His The polypeptide coding sequence is inserted such that translation of the The peptide is produced without a 6 × His tag.   Encodes a desired portion of the TR9 receptor protein lacking a hydrophobic leader sequence DNA sequence obtained from the deposited cDNA clone The amino-terminal sequence of the part and the 3 'end of the cDNA coding sequence in the deposited construct Amplified using PCR oligonucleotide primers that anneal to the sequence at It is. Added including restriction sites to facilitate cloning into pQE60 vector Are added to the 5 'and 3' sequences, respectively.   To clone the mature protein, the 5 'primer isCCATGGCTC Has the sequence AGCCAGAACAGAAG3 '(SEQ ID NO: 11), which is an NcoI restriction site (underlined ) Followed by the amino-terminal coding sequence of the mature TR9 receptor sequence of FIGS. 1A-D. The row is followed by 17 nucleotides complementary. The ordinary skilled person is, of course, shorter than the mature form. This 5 'primer is used to amplify the desired It will be appreciated that the position in the starting protein coding sequence can be changed. 3 ' Limer is 5'CGCAAGCTTHas a sequence of TTAGGGCAAATGCTCATTG3 '(SEQ ID NO: 12), It contains a HindIII restriction site (underlined) followed by the TR9 receptor of FIGS. 1A-D. 19 nucleotides complementary to the 3 'end of non-coding sequences in DNA sequences Is followed.   The amplified TR9 receptor DNA sequence and vector pQE60 were digested with NcoI and HindIII Thereafter, the digested DNAs are ligated together. TR9 receptor for restriction digested pQE60 vector -Insertion of the DNA causes the TR9 receptor protein coding region to Initiation AUG and in-frame downstream of the IPTG-inducible promoter, including the stop codon To be placed. The accompanying stop codon is the six histidines downstream of the insertion site. Prevent Ncodon translation.   The ligation mixture is transferred to competent E. coli cells, for example, as described by Sambrook et al. oning: a Laboratory Manual (2nd edition) '' (Cold Spring Harbor Laboratory Press, Marks as described in Cold Spring Harbor, New York (1989)) Introduce in a standard way. The implementation of the example described here involves the launch of a lac repressor. Kanamycin resistance (`` Kanmycin^r)) To give multiple copies of plasmid pREP4. Use the Escherichia coli M15 / rep4 containing strain. Express TR9 receptor protein This strain, which is only one of many suitable strains, is commercially available from QIAGEN I have. Transformants grow on LB plates in the presence of ampicillin and kanamycin Identified by their ability to Plasmid DNA from resistant colonies The identity of the isolated and cloned DNA is confirmed by restriction analysis, PCR and NA sequencing. Admit.   Clones containing the desired constructs were cloned with ampicillin (100 μg / ml). Overnight ("O / N") in liquid culture in LB medium supplemented with both namycin (25 μg / ml) Grow up. The O / N culture is used to inoculate a large culture at a dilution of about 1:25 to 1: 250. Cells are grown until the optical density at 600 nm ("OD600") is between 0.4 and 0.6. Next In addition, by inactivating the lacI repressor, the lac repressor-sensitive promoter Isopropyl-β-D-tothiogalactopyrano to induce transcription from Sid ("IPTG") is added to a final concentration of 1 mM. Then add 3-4 more cells Incubate for days. The cells are then collected by centrifugation.   The cells are then stirred in 6M guanidine-HCl (pH 8) at 4 ° C. for 3-4 hours. Cell debris Remove by centrifugation and add TR9 receptor containing supernatant to 200 mM NaCl Dialysis is performed against 50 mM sodium acetate buffer (pH 6). Alternatively, protein quality Converts it to 500 mM NaCl containing protease inhibitors, 20% glycerol, 25 mM Successful regeneration can also be achieved by dialysis against M Tris / HCl (pH 7.4). Playback Later, the protein is ion-exchanged, hydrophobic interactions and size exclusion chromatography Can be purified. Alternatively, obtain a pure TR9 receptor protein For this purpose, affinity chromatography methods such as antibody columns may be used. No. Store the purified protein at 4 ° C or freeze at -80 ° C. Example 2: Cloning of TR9 receptor protein in baculovirus expression system And expression   In this specific example, "A Manual of Methods for Baculovirus Vecto" by Summers et al. rs and Insect Cell Culture Procedures '' (Texas Agricultural Experiment Station Publication No. 1555 (1 987)) to produce the mature TR9 receptor protein using standard methods as described in Using the plasmid shuttle vector pA2 to Cloned encoding all proteins including secretory signal (leader) sequence The DNA is inserted into the baculovirus. This expression vector is Contains the strong polyhedrin promoter of Refornica nuclear polyhedrosis virus (AcMNPV) And followed by convenient restriction sites such as BamHI and Asp718. Efficiency Simian virus 40 ("SV40") polyadenylation site is used for polyadenylation Is done. This plasmid is derived from E. coli for easy selection of recombinant virus Β-galactosidase gene under the control of a weak Drosophila promoter In the same direction, followed by the polyadenylation signal of the polyhedrin gene in the process of. Both sides of the inserted gene are cell-mediated with wild-type viral DNA A viable window expressing the cloned polynucleotide by homologous recombination. The viral sequences are flanked to generate a virus.   The construct was properly placed, as will be readily understood by those skilled in the art. Signals such as transcription, translation and secretion (signal peptide and inflation PAc373, pVL941, pA Many other baculovirus vectors can be used, such as cIM1. Like that Such vectors are described, for example, in Luckow et al., Virology 170: 31-39 (1989).   The cDNA sequence encoding the full-length TR9 protein in the deposited clone is shown in FIGS. 5 'and 5' of the gene, including the indicated AUG initiation codon and the naturally associated leader sequence. And using PCR oligonucleotide primers corresponding to the 3 'sequence. Five' Primer is 5'CGCCCCGGGThe sequence GCCATCATGGGGACCTCTCCGAGC3 '(SEQ ID NO: 13) This is the SmaI restriction enzyme site (underlined), Kozak, M., J. Mol. Biol. 198: 947-95. Efficient sig for translation initiation in eukaryotic cells as described in O. (1987). Null, followed by AUG opening of all TR9 receptor protein sequences shown in FIGS. Contains several bases starting from the start codon.   3 'primer (for soluble cloning) is 5' CGCGGTACCTTAGGGCAAATGCTCATTG3 ' (SEQ ID NO: 14), which contains the Asp718 restriction site (underlined) and Followed by nucleotides complementary to the 3 ′ non-coding sequence of FIGS. 1A-D.   The amplified fragment was obtained from a commercial kit ("Geneclean" BIO101, CA La Jolla)) from a 1% agarose gel. Next, the fragment was SmaI and As Digest with p7l8 and purify again on 1% agarose gel. This fragment is called "F1" here. Call.   The plasmid is digested with the restriction enzymes SmaI and Asp718. Optionally, known in the art Dephosphorylation may be performed using bovine intestinal phosphatase in a conventional manner. Then the Use a commercially available kit (`` GenecleanJ '' BIO101, La Jolla, Calif.) From a 1% agarose gel. This vector DNA is called "V1" here. .   Fragment F1 and the dephosphorylated plasmid V1 are ligated together with T4 DNA ligase. Big Enterobacteriaceae HB101 or other suitable E. coli hosts, such as XL-1 Blue (Stratagene Cloning Systems, Inc. (La Jolla, Calif.) Apply to plate. Plasmid containing the human TR9 receptor gene using PCR Identify bacteria containing (used in this PCR to amplify the gene One and the second primer contain a TR9 receptor gene fragment. Only bacterial colonies that are selected from within the vector to show DNA amplification). K The sequence of the cloned fragment is confirmed by DNA sequencing. Copy this plasmid Here, it is called pBacTR9.   Felcner et al., Proc. Natl. Acad. Sci. USA 84: 7413-7417 (1987). 5 μg of plasmid pBacTR9 is replaced with 1.0 μg of commercially available linear Baculovirus DNA (BaculoGold<sup>TM</sup>Baculovirus DNA '' Pharmingen (Cali Simultaneously transfected with San Diego, California)). 1 μg BaculoGold<sup>TM</sup> Viral DNA and 5 μg of plasmid pBacTR9 were combined with 50 μl of serum-free Grace's medium (LifeT echnologies (Rockville, MD)) Mix in sterile wells. Then, add 10 μl of Lipofectin and 90 μl of Grace's medium. Add, mix and incubate at room temperature for 15 minutes. Next, the transfection Transfer the mixture to a 35 mm tissue culture plate with 1 ml of Grace's medium without serum. It is added dropwise to the seeded Sf9 insect cells (ATCC CRL 1711). Rock the plate back and forth Mix the solution added to. Then incubate the plate at 27 ° C for 5 hours . After 5 hours, the transfection solution is removed from the plate and 10% fetal bovine blood Add 1 ml of Grace's insect medium with clarified. Return the plate to the incubator, Culture is continued at 27 ° C. for 4 days.   Four days later, the supernatant is collected and collected as described in Summers and Smith (supra). Perform the assay. Ease of gal-expressing clones producing blue-stained plaques Blue Gal (Life Technologies, Inc. Agarose gel containing Rockville, Rand)) is used. (This type of plastic A detailed description of the `` Work Assay '' is available from Life Technologies (Rockville, MD). User's guide on insect cell culture and baculovirology distributed by On pages 9-10). After appropriate culture, remove blue stained plaques Pick up with the tip of a clopipetter (eg Eppendorf). Next, the recombinant virus Was resuspended in a microcentrifuge tube containing 200 μl Grace's medium and the recombinant Using the baculovirus suspension, Sf9 cells inoculated into 35 mm culture dishes Infect. After 4 days, collect the supernatants of the culture dishes and store them at 4 ° C. So Is called V-TR9.   To confirm V-TR9 gene expression, Grace's medium supplemented with 10% heat-inactivated FBS Grow Sf9 cells in the ground. The cells were transformed into recombinant baculovirus V-TR9 by approximately 2 Infect at multiplicity of infection ("MOI"). After 6 hours the medium is removed and methionine and cis SF900 II medium lacking tein (Life Technologies, Rockville, MD) Available). After 42 hours if radiolabeled protein is desired And 5μCi³⁵5 μCi with S-methionine³⁵S-cysteine (available from Amersham) ). Cells are cultured for an additional 16 hours before harvesting by centrifugation. Up SDS-PAGE followed by autoradiography Analyze by fee (if radiolabeled). Amino terminal sequence of mature protein To determine the breakpoint and length of the secretory signal peptide. Microsequencing of the amino-terminal amino acid sequence of quality may be used. Example 3: Cloning and expression of TR9 in mammalian cells   Typical mammalian expression vectors contain a promoter sequence that mediates the initiation of mRNA transcription. Sequence, protein coding sequence, required for transcription termination and transcript polyadenylation Signal. Other sequences include enhancers, Kozak sequences, RNA There are intervening sequences flanking the donor and acceptor sites for splicing. Remarkably effective Efficient transcription is due to the early and late promoters of SV40, retroviruses (e.g., R SV, HTLVI, HIVI) long terminal repeat (LTR), cytomegalovirus (CMV) Can be achieved with a motor. However, cell sequences (e.g., human actin promoter) Can also be used. Expression vectors suitable for use in practicing the present invention include: For example, pSVL, pMSG (Pharmacia (Uppsala, Sweden)), pRSVcat (ATCC37152 ), PSV2dhfr (ATCC37146), pBC12MI (ATCC67109) and the like. Use Mammalian host cells include human HeLa, 293, H9 and Jurkat cells, NIH3T3 and C127 cells, Cos1, Cos7 and CV1, quail QC1-3 cells, mouse L There are cells, Chinese hamster ovary (CHO) cells.   Alternatively, the gene is integrated into a chromosome and contains a stable cell line containing the gene. Can also be expressed. dhfr, gpt, neomycin or hygromycin Co-transfection with a selectable marker such as Can be identified and isolated.   Transfected cells to express large amounts of the encoded protein The amplified gene can also be amplified. Dihydrofolate reductase (DHFR) marker Develops cell lines that carry hundreds or even thousands of copies of the gene of interest. To help. Another useful selectable marker is the enzyme glutamine synthase (GS) (Murphy et al., Biochem J. 227: 277-279 (1991); Bebbington et al., Bio / Technology 10: 169-175 (1992)). Use these markers to grow mammalian cells in selective media. Grow and select cells with the highest resistance. In those cell lines, the amplified The gene is integrated into the chromosome. Chinese hamster ovary (CHO) cells and NSO Cells are often used for protein production.   The expression vectors pC1 and pC4 contain the Rous sarcoma virus strong promoter (LTR) (Cu llen et al., Molec.Cell.Bjol. 5: 438-337 (1985)) and a fragment of the CMV enhancer (Boshart Cell 41: 521-530 (1985)). For example, BamHI, XbaI, Asp718 etc. Multiple cloning sites with restriction sites allow for cloning of the gene of interest. Make it easier. These vectors also contain the 3 'of the rat preproinsulin gene. Contains introns, polyadenylation and termination signals. Example 3 (a): Cloning and expression in COS cells   The cDNA encoding TR9 is transferred to the expression vector pcDNAI / Amp or pcDNAIII (these are (available from trogen) to allow expression plasmid pTR9- Create HA.   Expression vector pcDNAI / Amp is (1) Escherichia coli effective for growth in E. coli and other prokaryotic cells Origin of replication, (2) Ampicillin resistance inheritance to select plasmid-containing prokaryotic cells (3) SV40 origin of replication for growth in eukaryotic cells, (4) CMV promoter, polylinker -, SV40 intron, (b) hemagglutinin fragment (i.e. HA) tag), followed by the cDNA in the polylinker. SV40 intron conveniently placed under the control of CMV promoter expression using restriction sites Stop cod positioned so that it can be operably linked to a polyadenylation signal And a polyadenylation signal. HA label is Wilson et al., Cell 37: 767-7. Epitope from influenza hemagglutinin protein described in 78 (1984) Equivalent to Fusion of HA tag to target protein recognizes HA epitope Enables easy detection and recovery of recombinant proteins using antibodies. pcDNAIII further contains a selectable neomycin marker.   The DNA fragment encoding TR9 is inserted into the polylinker region of the vector using the recombinant protein. It is cloned such that quality expression is dictated by the CMV promoter. That The plasmid construction method is as follows. Vectors for TR9 expression in E. coli In much the same way as described above for construction, the deposited clone TR9 cDNA was Amplify using primers containing convenient restriction sites. Suitable primer Include the following used in this embodiment:   SmaI site (underlined), Kozak sequence, AUG start codon and complete TR9 receptor The 5 'primer containing the codon of the 5' coding region has the following sequence:   XbaI site (underlined), stop codon, 3 'containing nucleotides of 3' coding sequence The primer has the following sequence (at its 3 'end):   The PCR-amplified DNA fragment and the vector pcDNAI / Amp are digested with SmaI and XbaI and then ligated. You. The ligation mixture was used for the E. coli SURE strain (Stratagene Cloning Systems, Inc. (Available from La Jolla North Tree Pines Road, 11099) The transformed culture is inoculated on an ampicillin medium plate, which is then cultured. Grow ampicillin-resistant colonies. Isolate plasmid DNA from resistant colonies And check for the presence of the TR9 coding fragment by restriction analysis or other means.   To express recombinant TR9, for example, see Sambrook et al., “Molecular Cloning: a L aboratory Manual '' (Cold Spring Harbor Laboratory Press) Old Spring Harbor) (1989)). In a manner, COS cells are transfected with an expression vector as described above. Cells Culture under conditions suitable for the expression of TR9 by the vector.   Expression of the TR9-HA fusion protein is described in, for example, Harlow et al., "Antjbodjes: A Laborator y Manual (2nd edition) '' (Cold Spring Harbor Laboratory Press (Spring Harbor) (1988)). Detected by immunoprecipitation. For this reason, two days after transfection,³⁵S -Label cells by culturing for 8 hours in medium containing cysteine. That Collect cells and media, wash cells, and as described by Wilson et al., Cited above. , Surfactant-containing RIPA buffer: 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM Squirrel dissolves at pH 7.5. M-specific monoclonal antibody from cell lysate and culture medium Precipitate the protein using. Next, remove the precipitated protein Analyze by SDS-PAGE and autoradiography. Expression products of the expected size , Found in cell lysates, which is not seen in negative controls. Example 3 (b): Cloning and expression in CHO cells   The vector pC4 is used for the expression of the TR9 protein. Plasmid pC4 is plasmid p It is a derivative of SV2-dhfr (ATCC accession number 37146). This plasmid is the SV40 early pro Contains mouse DHFR gene under motor control. Transcription of these plasmids Chinese hamster ovary cells lacking transfected dihydrofolate activity Other cells were grown in selective media (α-MEM, Life Tetrax) supplemented with the chemotherapeutic agent methotrexate. Select by growing cells at Chnologies (Rockville, MD) it can. Amplification of DHFR gene in cells resistant to methotrexate (MTX) Are well documented (eg, Alt et al., J. Biol. Chem. 253: 1357-1370 (1978); Hamlin et al., Biochem et Biophys. Acta, 1097: 107-143 (1990); Page et al., Biotechnolog. y 9: 64-68 (1991)). Cells grown with increasing MTX concentrations were treated with DHF By overproducing the target enzyme DHFR as a result of amplification of the pupil gene, Develop tolerance to When a second gene is linked to the DHFR gene, Are co-amplified and overexpressed. More than 1000 copies of amplified material using this method It is known in the art that cell lines that carry genes can be developed. Then met When you stop using trexate, it becomes integrated into one or more chromosomes in the host cell. A cell line containing the amplified gene is obtained.   Plasmid pC4 contains the Rous sarcoma virus to express the gene of interest. Strong promoter of the terminal repeat (LTR) (Cullen et al., Molec. Cell. Biol. 5: 438-447 (1985)) and human cytomegalovirus (GMV) immediate-early gene enhancers. Contains the fragment to be isolated (Boshart et al., Cell 41: 521-530 (1985)). promoter Downstream of BamHI, XbaI and Asp7l8 restriction enzymes that allow gene integration There is a cut site. Behind these cloning sites, this plasmid Contains the 3 'intron of the preproinsulin gene and a polyadenylation site. Other high efficiency promoters, such as the human β-actin promoter, SV40 early or Is the terminus from the late promoter or other retrovirus (eg, HIV or HTLVI) Repetitive sequences and the like can also be used for expression. In a regulated way in mammalian cells To express TR9, Clontech's Tet-Off and Tet-On gene expression systems and Systems similar to these can be used (Gossen et al., Proc. Natl. Acad. Sci. USA 89: 5547-555. 1 (1992)). Other signals (e.g., human growth hormone) And those derived from the globin gene) can be used as well. Integrated into the chromosome Gpt, G418 or hygromycin And by co-transfection with a selectable marker such as Ma First use two or more selectable markers (e.g. G4l8 and methotrexate) It is advantageous.   After digestion of plasmid pC4 with restriction enzymes SmaI and Asp718, Dephosphorylation using bovine intestinal phosphatase by the method. Then the vector Isolate from a 1% agarose gel.   The DNA sequence encoding the complete TR9 protein, including the leader sequence, is Amplification using PCR oligonucleotide primers corresponding to the 5 'and 3' sequences of the offspring I do.   5 'primer is 5' CGCCCCGGGGCCATCATGGGGACCTCTCCGAGC3 '(SEQ ID NO: 13) Sequence, restriction sites, described in Kozak, M., J. Mol. Biol. 196: 947-950 (1987). Efficient signal for translation initiation in eukaryotic cells, followed by Figures 1A-D It has some of the nucleotides in the coding sequence of the TR9 receptor protein shown in SEQ ID NO: 1. One.   3 'primer (for soluble cloning) is 5' CGCGGTACCTTAGGGCAAATGCTCATTG3 '( SEQ ID NO: 14), which contains the Asp718 restriction site (underlined) and Is complementary to the untranslated region of the TR9 receptor gene shown in FIG. 1A-D (SEQ ID NO: 1). Followed by a nucleotide.   After digesting the amplified fragment with the endonuclease SmaI, Purify on a gel. Next, the isolated fragment and the dephosphorylated vector were Connect with ose. Next, E. coli HB101 cells or XL-1 Blue cells are transformed. For example, bacteria containing the fragment inserted into plasmid pC4 using restriction enzyme analysis, etc. Is identified.   Transfection of Chinese hamster ovary cells lacking active DHFRia gene Used for the option. 5 μg of the expression plasmid pC4 was ligated with Lipofectin (Filgner et al., Supra. ) With 0.5 μg of plasmid pSV2-neo. plus Mido pSVneo confers resistance to antibiotics, including dominant selectable marker G418 It contains the neo gene derived from Tn5 that encodes the enzyme to be expressed. 1 mg / ml G4l8 was added Inoculate the cells into α-MEM. Two days later, cells are trypsinized and 10, 25 or 50 Hybridomas in α-MEM supplemented with ng / ml methotrexate and 1 mg / ml G418 Inoculate a cloning plate (Greiner, Germany). After about 10-14 days, After trypsinizing the lawn, various concentrations of methotrexate (50 nM, 100 nM, (200nM, 400nM, 800nM) to inoculate 6-well Petri dishes or 10ml flasks I do. Next, clones growing at the highest concentration of methotrexate were 6 new wells containing 2% methotrexate (1 μM, 2 μM, 5 μM, 10 μM, 20 μM) Transfer to plate. A clone that grows with the same procedure at a concentration of 100 to 200 μM is obtained. Repeat until Expression of the gene product of interest can be determined using, for example, SDS-PAGE and Western blot. Or by reverse phase HPLC analysis or the like. Example 4: Tissue distribution of TR9 mRNA expression   For example, using the method described in Sambrook et al. Blot analysis is performed to determine TR9 gene expression in the cells. rediprime^TM Use DNA labeling system (Amersham Life Science) according to manufacturer's instructions By doing so, a cDNA template containing the entire nucleotide sequence of the TR9 protein (SEQ ID NO: 1) Robe³²Label with P. After signing, CHROMA SPIN-100^TMColumn (Clontech Labora tories) according to the manufacturer's protocol number PT1200-1. Were purified. Next, using purified labeled probes, various human tissues Is checked for TR9 mRNA.   Multiple tissueo containing various human tissues (H) or human immune system tissues (IM) Southern (MTN) blots were obtained from Clontech and ExpressHyb^TMHybridization Solution (Clontech) according to the manufacturer's protocol number PT1190-1 And probe with a labeled probe. Following hybridization and washing, Mount the kit and expose to film overnight at -70 ° C, and remove the film by standard methods. Develop with. Example 5: TR9-induced apoptosis   Overexpression of Fas / APO-1 and TNFR-1 in mammalian cells mimics receptor activation (M.Muzio et al., Cell 85: 817-827 (1996); M.P.Boldin et al., Cell 85: 803-815 (1996) )). Therefore, this system is used to study the functional role of TR9. MCF7 milk Transient expression of TR9 in cancer cells and 293 human embryonic kidney cells induces apoptosis Find out about. Experiment plan   Cell death assays are performed essentially as described previously (A.M.Chinnaiyan Cell 81: 505-512 (1995): M.P.Boldin et al., J. Biol. Chem. 270: 7795-8 (1995); F.C. Kischkel et al., EMBO 14: 5579-5588 (1995); A.M.Chinnaiyan et al., J. BIol. Chem. 271: 496. 1-4965 (1996)). Briefly, only the vector, the CrmA expression construct (M.Te wari et al., J. Biol. Chem. 270: 3255-60 (1995)) or FADD-DN expression construct (A.M. Chinnaiyan et al., J. Biol. Chem. 271: 4961-4965 (1996)). Cloned MCF-7 human breast cancer cell line using lipofectamine (GIBCO-BRL) In the presence of a 10-fold excess of pcDNA3 expression construct encoding the indicated protein Next, it is transiently transfected with pCMV-TR9-galactosidase. 293 cells are Ca Transfect similarly with the PO4 method. Five hours after transfection, ICE Family inhibitor z-VAD-fmk (Enzyme Systems Products (Dub, CA) Phosphorus)) is added to the cells at a concentration of 10M. 32 hours after transfection, As described (A.M. Chinnaiyan et al., Cell 81: 505-12 (1995); M.P.Bold in et al., J. Biol. Chem. 270: 7795-8 (1995); F.C.Kischkel et al., EMBO 14: 5579-5588 (199 5)), fix cells and stain with X-Ga1. result   Affected cells undergo morphological changes that are common in apoptotic cells Will show, round, condense, and will detach from the culture dish. With TNFR-1 and Fas / APO-1 Similarly, (M.Muzio et al., Cell 85: 817-827 (1996); M.P.Boldin et al., Cell 85: 803-815 (199) 6); M. Tewari et al., J. Biol. Chem. 270: 3255-60 (1995)), TR9-induced apoptosis , Is blocked by the ICE-like protease inhibitors CrmA and z-VAD-fmk. Example 6: Characterization of TR9   Members of the TNF receptor family are critical for inflammatory and cellular immune responses A key regulator, ranging from cell proliferation, differentiation and apoptosis to cell survival Mediates various biological functions (Nagata, S., Cell 88: 355-365 (1997); Armitage, R .J., Curr. Opin. Immunol. 6: 407-413 (1994); Goldstein, P., Curr. Biol. 7: R750-R75. 3 (1997); Baichwal et al., Curr. Biol. 7: R94-R96 (1997); Smith et al., Cell 76: 959-962 (1 994); Anderson et al., Nature 390: 175-179 (1997); Cleveland et al., Cell 81: 479-482 (1 995)). This family of receptors consists of several components that make up the ligand binding domain. Characterized by an extracellular high cysteine motif (Armitage, R.J., Curr.Opin.Immuno.6: 407-413 (1994); Smith et al., Cell 76: 959-962 (1994)). To that cognate ligand When combined, these receptors are associated with apoptosis, immune response and stress. Includes activation of the NFκB and JNK pathways that regulate expression of genes involved in the response Involved in several signaling pathways (Smith et al., Cell 76: 959-962 (1994)).   Six members of the TNF receptor family are called cell death receptors Emerged as a unique subgroup. They contain a cytoplasmic death domain , The activity of these receptors results in the involvement of components of the cell death pathway (Nagata, S., Ce ll 88: 355-365 (1997); Goldstein, P., Curr. Biol. 7: R750-R753 (1997)). Cell death Signal transmission originally originated from the adapter molecule FADD / MORT1 and the cell death protease cas. Death effector domain and death domain identified as being present in Pase-8 Mediated by a series of homophilic protein-protein interactions involved (Chinnaiyan et al., Semmin. Immunol. 9: 66-678 (1997)). For example, cell death Putter CD95 / Fas linked by cognate ligand or agonist antibody And the adapter molecule FADD and the cell death protease caspase-8 Interaction involving the death and effector domains Recruitment to coalescence (Chinnaiyan et al., Semmin. Immunol. 9: 66-67 (1997); Muzio et al., Cel. l 85: 817-827 (1996); Boldinra, Cell 85: 803-815 (1996)). When approaching, Kaspa Ease-8 self-activates, activating downstream caspases, cleaving cell death substrates and And initiates cell death (Muzio et al., J. Biol. Chem. 273: 2952-2956 (1997); Barin aga, M., Science 280: 32-34 (1998); Salvesen et al., Cell 91: 443-446 (1997); Martin et al., Cell 82: 349-352 (1995)). CD- directly involved in the FADD-caspase-8 pathway 95 (Muzio et al., Cell 85: 817-827 (1996); Boldin et al., Cell 85: 803-815 (1 996); Chinnaiyan et al., Cell 81: 505-512 (1995); Boldin et al., J. Biol. Chem. 270: 7795- 7789 (1995)), TNFR1 and DR3 are both FADD-caspase-8 pathway, death domain- NFκB activation pathway and adapter molecule TRAF2 involving Ser / Thr kinase RIP containing A primary pathway called TRADD, in which the JNK activation pathway mediated by Utilizes the adapter molecule (Hsu et al., Cell 81: 495-504 (1995); Hsu et al., Immunity 4:38 7-396 (1996); Chinnaiyan et al., Science 274: 990-992 (1996); Kitson et al., Nature 384. : 372-375 (1996); Yeh et al., Immunity 7: 715-725 (1997); Lee et al., Immunity 7: 703-713. (1997); Kelliher et al., Immunity 8: 297-303 (1998). Finally, binds to caspase-2 And contains a death domain that has been shown to be part of the TNFRI receptor complex There is an auxiliary cell death pathway that involves the adapter RAIDD, but this extra pathway The exact physiological relevance is still unknown (Duan et al., Nature 385: 86-89 (1997); Ahm ad et al., Cancer Res. 57: 615-619 (1997)).   Here, we present a new member of the TNF receptor family with a cytoplasmic death domain. We report the identification and initial characterization of a new member, TR9. TR9 is a mammalian cell Apoptosis was induced and NFκB and JNK pathway could be involved. Materials and methods Expression construct-TR9 (amino acid residues 42-655 described in FIGS. 1A-D; Amino acid residues 2-615 described above and TR9 delta (amino acid residues 42-460 described in FIGS. 1A-D; Amino acid residue 2-420 described in SEQ ID NO: 2 was added to pCMV1FLAG (IBI-Kdak) at the TR9 terminal FLAG tag encoded by the preprotrypsin leader sequence and its vector Cloned as an in-frame fusion to DNA oligo primer for TR9 : 5'-GAAGATCTGCCAGAACAGAAGGCCTCGAAT-3 '(SEQ ID NO: 16) and 5'-CCATCTTCCTGACCTG DNA oligo primers for CTGTAGTCTAGAGCC-3 '(SEQ ID NO: 17) and TR9delta: 5 '-GGAAGATCTGCCAGAACAGAAGGCCTCGAAT-3 '(SEQ ID NO: 16) and 5'-GCCGACCACGAGCGGGCC TAGTCTAGACDNA is synthesized by polymerase chain reaction using GCC-3 '(SEQ ID NO: 18). Obtained. Code DR4, FADD, CD95, DR3, TRADD, ICH1-pro, RAIDD and RIP The construct has already been described (Chinnaiyan et al., Cell 81: 505-512 (1995); Hsu et al., Cell 81: 495-504 (1995); Hsu et al., Immunity 4: 387-396 ( 1996); Chinnaiyan et al., Science 274: 990-992 (1996); Kelliher et al., Immunity 8: 297. -303 (1998); Pan et al., Science 276: 111-113 (1997)). Apoptosis assay-Cell death assay was performed as described previously (Ch innaiyan et al., Cell 81: 505-512 (1995); Pan et al., Science 276: 111-113 (1997)). Hi Lipofectamine method (Life Technologies) And transfected according to the manufacturer's instructions. The co-immunoprecipitation assay-in vivo interaction assay was described separately (Chin naiyan et al., Cell 81: 505-512 (1995); Pan et al., Scjence 276: 111-113 (1997)). 293 The cells are FLAG-TR9, FLAG-TR9 Delta, FLAG-CD95, FLAG-DR3, FLAG-TNFRI and ICH-1 The pro-FLAG expression construct is used for simultaneous Transfected. Cell lysate after transfection (at 38-48 hours) Is prepared and FLAG-labeled expressed protein is transferred to FLAG M2 affinity gel (IBI-Kodak ) Immunoprecipitation and FADD, myc-labeled TRADD and RIP (myc-TRADD and myc-RIP) Or the presence of RAIDD, polyclonal antibodies against FADD, Rabbit peroxidase (HRP) conjugated antibody (BMB) or polyclod against RAIDD Detection was performed by immunoblotting with a null antibody. NF-κB luciferase assay--NFκB luciferase assay described separately (Chinnaiyan et al., Cell 81: 505-512 (1995); Pan et al., Science 276: 111-). 113 (1997)). JNK activation assay-293 cells were cultured in MEM containing 10% FBS. 6 well cells Seeded on a plate and produced at the confluence of 60-70% by the lipofectamine method. Transfect with TR9 expression plasmid or vector only, according to manufacturer's instructions did. 40 hours after transfection, 20 mM HEPES, pH 7.4, 2 mM EDTA, 250 mM  NaCl, 0.1% NP-40, 2 μg / ml leupeptin, 2 μg / ml aprotinin, 1 mM PMSF, 0. In lysis buffer containing 5 μg / ml benzamide, 1 mM DTT and 1 mM orthovanadate To prepare a cell extract. The C-jun kinase assay was modified as described Performed by the good method (Haridas et al., Immunol. 160: 3152-3162 (1998)). Briefly, The cell extract (70 μg) was subjected to immunoprecipitation with 0.03 μg of anti-JNK antibody at 4 ° C. for 30 minutes. Was. Incubate with Protein A / G-Sepharose beads for 30 minutes at 4 ° C Collected the immune complexes. Dissolve the beads in lysis buffer (400 μl x 4) and Wash thoroughly with ze buffer (40oμl x 2; 20mM HEPES, pH 7.4, 1mM DTT, 25mM NaCl) 20 mM HEPES, pH 7.4, 10 mM MgCl_Two, 1 mM DTT and 10 μCi [γ³²20 including P] ATP The kinase reaction was allowed to proceed for 15 minutes at 30 ° C. with 2 μg of GST-Jun (1-79) in μl. SDS The reaction was stopped by adding 15 μl of sample buffer, and the SDS-polyacrylamide gel was charged. Separated by electrophoresis. Visualize GST-Jun (1-79) by staining with Coomassie blue, Phosphorimager analysis (Molecular Dynamics, Inc. Sunny-Vale, Lunia) and ImageQuant software (Molecular Dynamics) After quantification, the dried gel was visualized. In specific assays for JNK activity, phosphate Using calcium precipitation, 3 × 10⁶293 cells, vector or CD40, TR9 Alternatively, TR9delta expression construct (6.4 μg) and 2.4 μg of JNK-myc expression plasmid And transfect at the same time. After transfection (about 36 hours), NP40 buffer (20 mM Tris-Cl, pH 8.0) containing protease inhibitor cocktail (BMB) , 137 mM NaCl, 10% glycerol, 2 mM EDTA, 5 mM Na_TwoVO_Four, 0.5mM PMSF and 1% Cell extracts were prepared by lysis with (NP40). Immunoprecipitation of JNK-myc is monochrome Of the immunoconjugate was performed using 20 μl of the pro-anti-myc antibody (10 μg, Babco). Precipitated with tein G-Sepharose (50% slurry, Sigma), anti-myc-HRP Was detected by blotting. FLAG-labeled CD40, TR9 and TR9 delta are anti-FLAG M2 Immunoprecipitated on affinity gel and detected by blotting with anti-FLAG antibody . For the kinase assay, 30 μl of kinase buffer (30 mM HEPES, pH 7.4, 7 mM Mn Cl_Two, 5mM MgCl_TwoAnd 1 mM DTT), 2 μg of GST JUN (1-79) as substrate, 50 mM A TP and 5 μCi [γ³²[P] ATP was used. Results and discussion   TR9 is a putative signal sequence (amino acid residues 1-41 shown in FIGS. 1A-D and 4A; No. 2 amino acid residues -40 to 1), the mature form of which is described in FIGS. Expected to start at amino acid residue 42 (Gln) (Nielson et al., Protein. Eng. 10: l-6 (1997)). Extracellular portion (amino acid residues 42-350 described in FIGS. 1A-D and 4A; Amino acid residues 2-310) contain the four TNFR-like cysteine-rich motifs of TR9 (FIG. 1A- Amino acid residues 67-211 of SEQ ID NO: 27-171); Gerin (OPG) and TNFR2 are most associated with 36% and 42% amino acid identity, respectively. (Fig. 4B; data not shown). Transmembrane domain (amino acids described in Figures 1A-D 351-370; residues 331-330 of SEQ ID NO: 2) are followed by a 285 amino acid long narrow section of this molecule. The cytoplasm is followed by the death domains of all known cell death receptors (Fig. 4C), but contains the death domain of TNFR1 (27.2%) Most relevant and least similar to the death domain of DR5 (19.7%). Oddly, other Cell death receptors have a death domain at their COOH terminus, whereas TR9 death The domain is located adjacent to the transmembrane domain, followed by a 150 amino acid tail. in the process of. Interestingly, after the death domain, the SH3 domain binding Putative leucine zipper overlaps high proline region reminiscent of profession -Sequence was followed (Figure 4A) (Pawson et al., Science 278: 2075-2080 (1997)). TR9 mRNA expression in human tissues and cancer cell lines--4 kb TR9 transcript was used according to manufacturer's instructions. Therefore, most of the Northern blots (Clontech) probed with TR9 cDNA Found in human adult tissues, immune tissues and cancer cell lines (data not shown). This roll Pictures were abundant in the heart, brain, placenta, pancreas, lymph nodes, thymus, and prostate. Lungs, skeleton Lower in muscle, kidney, testis, uterus, small intestine, colon, spleen, bone marrow, fetal liver Level detected. However, adult liver and peripheral blood leukocytes almost express TR9 mRNA I didn't. Smaller transcripts of 3.1 kb and 2.4 kb are also found in testis and fetal liver. Each was observed.   Among human cancer cell lines, high levels of 4 kb transcripts were found in cervical cancer HeLa S3, colorectal Several non-lymphoma tumor cells including adenocarcinoma SW480, lung cancer A549 and melanoma G361 cells Was detected. Importantly, hematopoietic strains (eg large, K562, HL-60) Showed low expression or no expression was observed (data not shown). TR9 induces apoptosis in mammalian cells-ectopic apoptosis receptor Since it can now induce cell death in a ligand-independent manner (Chinnaiyan et al., Cell 81: 505-5 12 (1995); Boldinra, J. Biol. Chem. 270: 7795-7789 (1995); Chinnaiyan et al., Scien. ce274: 990-992 (1996); Kitson et al., Nature 384: 372-375 (1996); Pan et al., Science 2. 76: 111-113 (1997)), we induced apoptosis when TR9 was overexpressed. I checked whether I could lead. HeLa S3 cervical cancer cells with TR9 expression construct When transfected, 43% of transfected cells undergo apoptosis A unique morphological change occurred (Fig. 5). As expected, putative death domain deletion (TR9 Delta) counteracted its lethal activity. Importantly, TR9 is a human breast cancer MCF7 cells failed to induce cell death, but these cells were extremely susceptible to DR4 killing. Due to the sensitivity (Figure 5 and data not shown), TR9 is involved in other cell death pathways. It was suggested that this may be different from that involving the cell death receptor. Or , The apoptotic activity of TR9 is regulated by other signaling pathways that it activates May be knotted (see below), or to demonstrate full lethality May require ligand binding. Interaction of TR9 with adapter molecules in vivo-cell death receptors To transmit the signal, the adapter molecule FADD (for CD95) or TRADD and FAD Use D (for TNFR1 and DR3) (Chinnaiyan et al., Cell 81: 505-512 (1995); Bold In et al., J. Biol. Chem. 270: 7795-7789 (1995); Chinnaiyan et al., Science 274: 990-992 (1 Kitson et al., Nature 384: 372-375 (1996)). We have confirmed that TR9 is human embryonic kidney 293 cells It was determined whether the cells could bind any of these adapter molecules. CD95 and The association between FADD was easily detected under similar conditions, but TR9 interacted with FADD. No (non-public data). Interestingly, the interaction between DR3 and TRADD Although weaker than the interaction, TR9 was found to associate with TRADD (not shown) data). This observation is consistent with the observation that TR9 has a weak lethal potential. I have. Alternatively, TR9 may use TRADD-related molecules as adapters. The chair or observed association is bridged by another adapter protein It may be done. Recruitment to TNFR1 and DR3 signaling complexes Interaction between two other known adapter molecules RAIDD or RIP and TR9 Could not be detected (data not shown). TR9 activates nuclear factor-κB--TNFRI and DR3 both cause activation of NF-κB Be involved in signal transduction pathways (Smith et al., Cell 76: 959-962 (1994); Chinnaiyan et al. Kitson et al., Nature 384: 372-375 (1996); Baker et al., O., Science 274: 990-992 (1996); ncogene 12: 1-9 (1996)). The ability of TR9 to activate NF-κB Tested in a dose-dependent assay, which induced NF-κB activation in a dose-dependent manner. Was found (FIG. 6). This receptor is presumably overexpressed in the NF-κB It would have made it possible to adopt an active configuration that could transmit signals to Interesting Notably, a cytoplasmic deletion of TR9 that counteracts its apoptotic activity activates its NF-κB Noh also cancels out (data not shown), and these two signaling paths are common This suggests that it is likely to be mediated by a receptor proximal adapter molecule. Ectopic expression of TR9 induces JNK activation--JNK activation may include some TNFR1 and CD40 Is known to be induced by some TNF receptors (Smith et al., Cell 76: 9 59-962 (1994); Yeh et al., Immunity 7: 715-725 (1997); Lee et al., Immunity 7: 703-713 (1 997); Baker et al., Oncogene 12: 1-9 (1996)). We next found that overexpression of TR9 Whether it resulted in sexing was determined using an in vitro kinase assay. TR 9 was found to induce JNK activation in a dose-dependent manner (data not shown). Cell death Alternatively, cytoplasmic deletions that attenuate NF-κB activation, unexpectedly, Has little effect (data not shown). This is the activation of JNK activation It is mediated by a cytoplasmic moiety distinct from that responsible for cis and NF-κB induction. Will be in line with the reminders. Two potential TRAF binding motifs, PRQDP (see FIG. 1A-D). Amino acid residues 381-385; amino acid residues 341-345 of SEQ ID NO: 2) and PTQNR (FIGS. 1A-D Amino acid residues 400-404 described in SEQ ID NO: 2; amino acid residues 360-364 shown in SEQ ID NO: 2) It is notable that it is adjacent to the common domain (Gedrich et al., J. Biol. Chem. 2 71: 12852-12858 (1996); Boucher et al., Biochem. And Biophy. Res. Communi. 233: 592-6. 00 (1997)).   In conclusion, we have shared a novel death domain-containing TNF receptor, named TR9. Specified. TR9 is initiated by CD95, TNFR1 or TRAIL / Apo2L receptor It is involved in a different cell death pathway. TR9 is also shared by TNFRI2 Two signaling pathways, NF-κB and JUK, are also activated. Thus, the TNF receptor Like other members of the family, TR9 plays a role in inflammatory responses and immune regulation It is.   The invention may be practiced in other ways than those specifically described in the above description and examples. It should be clear.   In view of the foregoing, there are many variations to the present invention, which Is included in the claims.   All publications cited herein (patents, patent applications, journal articles, laboratory books, books, (Including other documents) are hereby incorporated by reference.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12N 5/10 C12N 15/00 ZNAA C12P 21/02 5/00 A (81) Designated countries EP (AT, BE) , CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, CM, GA , GN, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE ES, FI, GB, GE, GH, GM, GW, HU, ID, IL, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD , MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, U Z, VN, YU, ZW (72) Inventor Juan, Pin Apartment No. 335, West Side Drive, Gay Saarsburg, 20878 Maryland, United States of America, Apartment 302 (72) Inventor Genz, Rainer El. Kubile, Mount Prospect Drive 13608

Claims (1)

[Claims]   1． A sequence selected from the group consisting of the following nucleotide sequences has at least 9 An isolated nucleic acid comprising a polynucleotide having a 5% identical nucleotide sequence molecule:   (a) encoding a polypeptide comprising amino acids from about -40 to about 615 of SEQ ID NO: 2; Nucleotide sequence to be loaded,   (b) encoding a polypeptide comprising amino acids from about -39 to about 615 of SEQ ID NO: 2; Nucleotide sequence to be loaded,   (c) encoding a polypeptide comprising amino acids from about 1 to about 615 of SEQ ID NO: 2; Nucleotide sequence to be loaded,   (d) amino acid encoded by the cDNA clone contained in ATCC Accession No. 209037 A nucleotide sequence encoding a polypeptide having an acid sequence,   (e) amino acid encoded by the cDNA clone contained in ATCC Accession No. 209037 A nucleotide sequence encoding a mature TR9 polypeptide having an acid sequence,   (f) a nucleotide sequence encoding the TR9 extracellular domain,   (g) a nucleotide sequence encoding a TR9 transmembrane domain,   (h) a nucleotide sequence encoding a TR9 intracellular domain,   (i) TR9 receptor extracellular or extracellular And a nucleotide sequence encoding an intracellular domain,   (j) a nucleotide sequence encoding a TR9 death domain, and   (k) Nucleotide shown in (a), (b), (c), (d), (e), (f), (g), (h), (i) or (j) Nucleotide sequence complementary to any of the nucleotide sequences.   2． The polynucleotide of claim 1 wherein the polynucleotide has the nucleotide sequence set forth in SEQ ID NO: 1. Nucleic acid molecule.   3． TR9 receptor whose polynucleotide has the amino acid sequence shown in SEQ ID NO: 2. 2. The nucleic acid molecule of claim 1 having the nucleotide sequence shown in SEQ ID NO: 1 that encodes   Four. A mature TR9 receptor whose polynucleotide has the amino acid sequence set forth in SEQ ID NO: 2 2. The nucleic acid molecule of claim 1 having the nucleotide sequence shown in SEQ ID NO: 1 that encodes a promoter.   Five. The nucleotide sequence of a cDNA clone whose polynucleotide is contained in ATCC Accession No. 209037. 2. The nucleic acid molecule of claim 1 having a reotide sequence.   6． The polynucleotide depends on the cDNA clone contained in ATCC Accession No. 209037. Nucleotide sequence encoding a TR9 receptor having an amino acid sequence encoded by 2. The nucleic acid molecule of claim 1 having a sequence.   7． The polynucleotide depends on the cDNA clone contained in ATCC Accession No. 209037. Encoding a mature TR9 receptor with an encoded amino acid sequence 2. The nucleic acid molecule of claim 1 having a nucleotide sequence.   8． Claim 1 (a), (b), (c), (d), (e), (f), (g), (h), (i), (j) or (k) A polynucleotide with the same nucleotide sequence as Polynucleotides that hybridize under lingent hybridization conditions Tide (where the hybridizing polynucleotide is a stringent Nucleotide consisting of only A residues or only T residues under suitable hybridization conditions Which does not hybridize to polynucleotides having peptide sequences) Nucleic acid molecule.   9． Claim 1 shows (a), (b), (c), (d), (e), (f), (g), (h), (i) or (j). The amino acid sequence of the epitope-bearing portion of the TR9 receptor An isolated nucleic acid molecule comprising a polynucleotide to be loaded.   Ten. Epitope of TR9 receptor selected from the group consisting of the following polypeptides 10. The isolated nucleic acid molecule of claim 9, which encodes a toep retaining moiety: amino acid of SEQ ID NO: 2. A polypeptide comprising from about 4 to about 81 acid residues, about amino acid residues of SEQ ID NO: 2 A polypeptide comprising 116 to about 271; about 283 amino acid residues of SEQ ID NO: 2; A polypeptide comprising from about amino acid residue 336 to about 3 of SEQ ID NO: 2. A polypeptide comprising up to about 72 amino acid residues from about 393 to about 434 of SEQ ID NO: 2. A polypeptide comprising amino acid residues from about 445 to about 559 of SEQ ID NO: 2 A polypeptide comprising, and from about amino acid residue 571 to about 588 of SEQ ID NO: 2 A polypeptide comprising   11． 2. The isolated nucleic acid molecule of claim 1, which encodes a TR9 receptor extracellular domain. .   12． 2. The isolated nucleic acid molecule of claim 1, which encodes a TR9 receptor transmembrane domain. .   13. 2. The isolated nucleic acid molecule of claim 1, which encodes a TR9 receptor intracellular domain. .   14. At least a sequence selected from the group consisting of the following nucleotide sequences: An isolated nucleic acid molecule comprising a polynucleotide having a 95% identical sequence:   (a) the nucleotide sequence of clone HIBEJ86R (SEQ ID NO: 6),   (b) the nucleotide sequence of clone HL1AA79R (SEQ ID NO: 7),   (c) the nucleotide sequence of clone HHFGD57R (SEQ ID NO: 8),   (d) the nucleotide sequence of clone HSABG38R (SEQ ID NO: 9),   (e) the nucleotide sequence of clone HHPDZ31R (SEQ ID NO: 10),   (f) Of the sequence shown in SEQ ID NO: 1, from nucleotide 500 to nucleotide 980 A portion comprising at least 50 contiguous nucleotides of (A), (b), (c), (d), (e) or complementary to any of the nucleotide sequences shown in (f) Nucleotide sequence.   15． A recombinant vector comprising inserting the isolated nucleic acid molecule of claim 1 into a vector. Manufacturing method.   16． A recombinant vector produced by the method of claim 15.   17． A recombinant host cell comprising introducing the recombinant vector of claim 16 into a host cell. Method for producing cells.   18． A recombinant host cell produced by the method of claim 17.   19. The recombinant host cell of claim 18 under conditions such that the TR9 polypeptide is expressed. Producing a recombinant TR9 polypeptide, including culturing and recovering the polypeptide. Production method.   20. At least 95% of the sequence selected from the group consisting of the following amino acid sequences: An isolated TR9 polypeptide having the same amino acid sequence:   (a) from about amino acid -40 to about 615 of SEQ ID NO: 2,   (b) from about amino acid -39 to about 615 of SEQ ID NO: 2,   (c) from about 1 to about 615 amino acids of SEQ ID NO: 2,   (d) amino acid encoded by the cDNA clone contained in ATCC Accession No. 209037 An amino acid sequence of a TR9 polypeptide having an acid sequence,   (e) amino acid encoded by the cDNA clone contained in ATCC Accession No. 209037 An amino acid sequence of a mature TR9 polypeptide having an acid sequence,   (f) the amino acid sequence of the TR9 receptor extracellular domain,   (g) the amino acid sequence of the TR9 receptor transmembrane domain,   (h) the amino acid sequence of the TR9 receptor intracellular domain,   (i) TR9 receptor extracellular or extracellular And the amino acid sequence of the intracellular domain,   (j) the amino acid sequence of the TR9 receptor death domain, and   (k) polypeptide of (a), (b), (c), (d), (e), (f), (g), (h), (i) or (j) The amino acid sequence of any one of the epitope-bearing portions.   twenty one. TR9 receptor protein selected from the group consisting of the following polypeptides An isolated polypeptide comprising a polypeptide epitope-bearing portion: SEQ ID NO: 2 A polypeptide comprising from about 4 to about 81 amino acid residues, amino acid of SEQ ID NO: 2 A polypeptide comprising residues from about 116 to about 271; amino acid residues of SEQ ID NO: 2 A polypeptide comprising from about 283 to about 308, about 336 amino acid residues of SEQ ID NO: 2. A polypeptide comprising from about amino acid residue 393 of SEQ ID NO: 2 to about 372. A polypeptide comprising up to about 434, about 445 to about 559 amino acid residues of SEQ ID NO: 2. And amino acid residues from about 571 to about 58 of SEQ ID NO: 2. A polypeptide comprising up to 8.   twenty two. An isolated antibody that specifically binds to the TR9 receptor polypeptide of claim 20. body.   twenty three. Comprising a polynucleotide encoding a TR9 receptor polypeptide An isolated nucleic acid molecule, wherein said polypeptide comprises at least one conservative amino acid. Having a sequence selected from the group consisting of: thing:   (a) encoding a polypeptide comprising amino acids from about -40 to about 615 of SEQ ID NO: 2; Nucleotide sequence to be loaded,   (b) encoding a polypeptide comprising amino acids from about -39 to about 615 of SEQ ID NO: 2; Nucleotide sequence to be loaded,   (c) encoding a polypeptide comprising amino acids from about 1 to about 615 of SEQ ID NO: 2; Do A nucleotide sequence,   (d) amino acid encoded by the cDNA clone contained in ATCC Accession No. 209037 A nucleotide sequence encoding a polypeptide having an acid sequence,   (e) amino acid encoded by the cDNA clone contained in ATCC Accession No. 209037 A nucleotide sequence encoding a mature TR9 polypeptide having an acid sequence,   (f) a nucleotide sequence encoding the TR9 extracellular domain,   (g) a nucleotide sequence encoding a TR9 transmembrane domain,   (h) a nucleotide sequence encoding a TR9 intracellular domain,   (i) TR9 receptor extracellular or extracellular And a nucleotide sequence encoding an intracellular domain,   (j) a nucleotide sequence encoding a TR9 death domain, and   (k) nucleotides of (a), (b), (c), (d), (e), (f), (g), (h), (i) or (j) A nucleotide sequence that is complementary to any of the sequences.   twenty four. The following amino acid sequence, except that it contains at least one conservative amino acid substitution: An isolated TR9 receptor polypeptide having a sequence selected from the group consisting of:   (a) from about amino acid -40 to about 615 of SEQ ID NO: 2,   (b) from about amino acid -39 to about 615 of SEQ ID NO: 2,   (c) from about 1 to about 615 amino acids of SEQ ID NO: 2,   (d) amino acid encoded by the cDNA clone contained in ATCC Accession No. 209037 An amino acid sequence of a TR9 polypeptide having an acid sequence,   (e) the amino acid encoded by the cDNA clone contained in ATCC Accession No. 209037 An amino acid sequence of a mature TR9 polypeptide having an acid sequence,   (f) the amino acid sequence of the TR9 receptor extracellular domain,   (g) the amino acid sequence of the TR9 receptor transmembrane domain,   (h) the amino acid sequence of the TR9 receptor intracellular domain,   (i) TR9 receptor extracellular or extracellular And the amino acid sequence of the intracellular domain,   (j) the amino acid sequence of the TR9 receptor death domain, and   (k) polypeptide of (a), (b), (c), (d), (e), (f), (g), (h), (i) or (j) The amino acid sequence of any one of the epitope-bearing portions.