JP2002503709A - Regulation of therapeutic genes by stress promoters in gene therapy: compositions and methods - Google Patents

Abstract

  (57) [Summary] The present invention relates to methods and compositions for treating disease by gene therapy. The invention particularly relates to the regulation of the expression of therapeutic genes by heat shock or stress promoters, the use of gene mixtures for specific therapies, and the use of optimal induction methods and systems.

Description

DETAILED DESCRIPTION OF THE INVENTION

FIELD OF THE INVENTION The present invention relates to methods and compositions for treating diseases by gene therapy. In particular, the present invention relates to the regulation of therapeutic genes by promoters of heat shock or stress, the use of gene mixtures for specific therapies, and the use of optimal induction methods and systems.

BACKGROUND Gene therapy Field of the invention, various diseases, for example genetic diseases, are progressing rapidly in the medical treatment of cancer and infectious diseases. The fundamental difference from pharmacotherapy is the use of DNA encoding the protein in place of the protein used itself, such as interferon, interleukin, growth hormone, blood clotting factor, insulin, vaccine, and the like.

To date, two basic gene therapy approaches have been attempted, one is an ex vivo approach, which removes cells from a patient, makes the genetic modification by DNA transfer, and returns it to the patient. And in vivo, in which the therapeutic DNA construct is introduced into a patient as naked DNA or by viral or non-viral vectors.

[0004] More human genes have been identified and isolated that are precisely linked to certain human diseases. It relies on ongoing human genome research. Thus, potentially more useful therapeutic genes can be used for gene therapy. Classes of genes of interest include tumor suppressor genes such as p53 (Takahashi et al., Cancer Res. 52, 2340-
2343, 1992, Wild-type but not mutant p53 suppresses the growth of human
lung cancer cells bearing multiple genetic lesions) and the retinoblastoma gene RB; a gene that directs apoptosis, ie, cell death, such as Fas (Itoh et al.
, Cell 66, 233-243, 1991, The polypeptide encoded by the cDNA for human
cell surface antigen Fas can mediate apoptosis), GAX (PCT / US95 / 01882, fi
led 22.02.95) and FADD (Chinnalyan et al., Cell 81, 501-512, 1995, FAD
D, a novel death domain-containing protein, interacts with the death dom
ain of Fas and initiates apoptosis); cell cycle inhibitors such as GATA-6 (Su
zuki et al., Genomics 38, 283-290, 1996, The human GATA-6 gene: Chromoso
mal location, and regulation of expression by tissue-specific and mitoge
n-responsive signals); anti-angiogenic genes such as endostatin and angiostatin (Folkman J., Nature Med. 1, 27-31, 1995, Angiogenesis in can
cer, vascular, rheumatoid and other diseases), antisense gene sequence (W
ang & Becker, Nature Med. 3, 887-893, 1997, Anti-sense targeting of basi
c fibroblast growth factor and fibroblast growth factor receptor), and a gene encoding a viral subunit vaccine (Donnelly et al., Nature M.
ed. 1, 583-587, 1995, Pre-clinical efficacy of a prototype DNA vaccine:
There is Enhanced protection against antigenic drift in influenza virus).

[0005] Successful gene therapy requires requirements other than the identification and availability of therapeutic genes. Two key requirements are effective targeting of the expressed construct in the body, ie, in the case of solid tumors, to the cancer cells themselves, and
Efficient and effective regulation of gene expression, that is, regulation of the expression level and expression amount of a therapeutic target protein.

[0006] Targeting is a fundamental constraint on the effective application of gene therapy, especially when certain gene products exhibit unwanted side effects. This is especially true in the case of drug-mediated cell killing, for example, when the herpes thymidine kinase gene (TK) is introduced into the cells and treated with ganciclovir, which induces cell death of the TK-containing cells.

Current methods of targeting therapeutic gene constructs include the use of modified viruses with infection specificity for cells, the use of various anionic and cationic lipids, and some targeting mechanisms, such as particle size, There are uses for other non-viral carriers with lipid-soluble or associated adhesive targeting molecules. To date, all these methods have encountered the problem of limited specificity and efficiency.

Another method relies on the use of a tissue-specific promoter, wherein the gene under its expression control is expected to be selectively expressed in the tissue from which the tissue-specific promoter originated. You. Certain limitations will obviously accompany this method. For example, many tissue-specific promoters are not completely specific for one type of cell or tissue, lack a strong tissue-specific promoter, and lack the ability to control gene expression once it has been reached. is there.

[0009] Among the evolving gene switch technologies, there is a clear need for general easily controlled gene switches that can be used for a number of purposes and applications.

The present invention relates, in one aspect, to inducible and regulatable expression of genes that have therapeutic effects in gene therapy of disease. The present inventors and others have shown the utility of stress promoter-based inducible gene expression to constitutive gene expression in various fields, including in vitro (US Pat. No. 5,646,010) and in vivo (Dre
ano et al., Biotechnology, 1988, 1340-1343, Antibody formation against h
Production of therapeutic proteins in eat-induced gene products expressed in animals and toxicity evaluation in vitro (Fischbach et al., Cell Biology and Toxico
logy 9, 177-188, 1993, Induction of the human growth hormone gene placed
under human hsp-70 promoter control in mouse cells: A quantitative indi
cator of metal toxicity). Furthermore, the present inventors have incorporated the human growth hormone (hGH) gene under the control of the human hsp-70 promoter as a marker gene into mouse cells together with the oncogene ras, and injected it into nude mice. It has been shown previously that the expression of the gene can be induced when the whole body is hyperthermic (Dreano et al., Biotechnology, 1988, 1340-13).
43, Antibody formation against heat-induced gene products expressed in a
nimals).

SUMMARY OF THE INVENTION In the present invention, the ability to combine multiple genes in a particular therapy and to locally or locally apply a heat source to selected sites for gene expression and protein synthesis. It is shown that various inductions can be achieved. This newly developed method allows gene expression at the target to be applied to gene therapy in practice, and without the need for sophisticated targeting of therapeutic gene constructs.
Thus, the present invention can greatly reduce the harmful side effects that occur when using genes encoding toxic or other proteins in gene therapy by non-inducible and site-independent protein synthesis.

The present invention provides for the regulated expression of one or more therapeutic genes in the body,
It relates to utilizing a stress-inducible promoter, such as, but not limited to, the human hsp-70 promoter. Gene expression according to the present invention can be achieved by the application of a tunable heat source to the external body or by the insertion of an element capable of locally heating a part of the body. Thus, the invention makes it possible to avoid the problem of targeting, in particular of the expression of toxic genes, and to allow for the temporal and efficient regulation of the supplied expression construct.

[0013] Stress promoters are generally highly regulatable promoters,
Among them, the heat shock promoter is probably the best known promoter. That is, the non-induced expression thereby is low or absent. On the other hand, the level of inducible expression thereby is very high. Although some stress promoters can be activated by multiple stress factors, such as heat, metal ions, irradiation, and toxic compounds, the preferred method of inducing the expression of a therapeutic gene in the present invention is by mild local heating. Things.

For example, in the field of cancer treatment, there has been great hope and great effort for hyperthermia to treat solid tumors. This method is based on the apparently higher sensitivity of cancer cells to heat than normal cells. This method is 10
After years of vigorous testing, the results have been somewhat disappointing. More recent observations have suggested that higher temperatures than normally used, 45 ° C. or higher, are required to produce different effects on tumor cells as compared to normal cells.

[0015] Despite the limited success of hyperthermia methods, these developments have greatly advanced equipment and techniques that allow for the controlled heating of specific parts of the body. Instrument systems using microwave, NMR and other radiation sources have been used to heat specific parts of the body. One example of such development is the microwave heat treatment device ("Pr
ostatron "(R), EDAP Technomed Inc., Lyon, France)
(BPH) treatment. Such devices can be used in the present invention to regulate the expression of genes for treating prostate cancer, thereby opening up a whole new field of therapy. This is an example of a potential application of the present invention and other preferred embodiments of the present invention are described in detail with specific examples.

The present invention provides for the use of a therapeutic gene placed under the control of a stress promoter,
It also includes more traditional cancer treatments, for example, combination therapy combined with chemotherapy using cisplatin and radiation therapy.

[0017] DETAILED DESCRIPTION OF THE INVENTION The present invention, as a point of one relates to a method of treating a patient diagnosed as having a condition that may be treated by gene therapy. The method includes providing a sufficient amount of a stress promoter-therapeutic gene construct to effectively treat the condition. As used herein, "patient" refers to any mammal that can suffer from a condition that can be treated by gene therapy. Preferably, said patient is a human.

The present invention utilizes a combination of a therapeutic gene, an inducible expression system, and a specific inducing method. In order to understand the application of the present invention, it is important to observe constitutive and induced expression, and their use in gene therapy.

Expression systems in gene therapy Constitutive gene expression systems in gene therapy Early tests in the field of gene therapy exclusively used constitutive and strong promoters. Examples of such promoters include, without limitation, promoters for the following genes: hypoxanthine phosphoribosyltransferase (HPTR)
, Adenosine deaminase, pyruvate kinase, β-actin, and other constitutive promoters. Constitutive viral promoters that function in eukaryotic cells include monkey virus, papillomavirus, adenovirus, human immunodeficiency virus (HIV), Rous monkey comba virus, cytomegalovirus (CMV), and Moloney leukemia virus LTR. (Long-range repeats), and those from other retroviruses. In gene therapy, the CMV promoter, a strong constitutive promoter, is widely used.

Inducible gene expression system in gene therapy Recently, a large number of inducible promoters have been studied, and the importance of inducible expression has been recognized. Inducible promoters include, but are not limited to, promoters for the following genes: metallothionein, heat shock, stress response, ubiquitin, ecdysone response element, and the doxycycline regulatory element of the Escherichia coli tetracycline resistance operon in eukaryotic cells.

Tissue-specific expression systems in gene therapy Increasing promoters in the art include: the promoter of the thyroxine-binding globulin protein gene for the liver, the promoter of the leukocyte integrin CD11 for leukocytes, A vascular smooth muscle-specific promoter / enhancer, an NSE promoter and PDGF-B promoter specific to spinal nerves, and a rhodopsin promoter predominantly expressed in photoreceptor cells.

Cell Cycle-Dependent Gene Expression in Gene Therapy The promoter of the E2F-1 gene regulates the expression of a universal growth regulatory protein that exhibits peak activity during the S phase. The E2F-1 promoter has been reported to be capable of inducing the expression of transgenes that act specifically in dividing cells, such as tumor cells (Parr et al., Nature Medicine 3, 1145-1149, 1997). ,
Tumor-selective transgene expression in vivo mediated by an E2F-responsi
ve adenoviral vector).

Gene Expression by Stress Promoter in Gene Therapy Gene expression driven by a stress promoter used in the gene therapy of the present invention may be optionally combined with a promoter / enhancer which provides tissue-specific and / or cell cycle-specific expression. Can be combined.

A particularly preferred stress promoter in the present invention is the promoter of the human hsp-70 heat shock gene. Other preferred promoters are other heat, shock, ubiquitin and stress promoters from humans and other eukaryotic cells. In the present invention, a prokaryotic stress-inducible promoter can also be used. Standard methods are used to identify and isolate the sequence of the stress-inducible promoter, and utilize functional tests and reporter genes. Many such inducible promoters have been identified from a variety of sources and can be used in place of the present invention.

In addition to isolating a naturally occurring stress promoter, the same species or sequence variant of the promoter can be obtained by nucleotide synthesis methods, as well as random or site-directed mutagenesis, well known to those skilled in the art. (For example, Synthesis an
d Application of DNA and RNA, SA Narang, ed., 1987, Academic Press, Sa
n Diego, CA and Molecular Cloning, A Laboratory Manual, J. Sambrook et a
l., ed., Cold Spring Harbor Laboratory Press, Plainview, NY (1989))
. In the present invention, all synthetic and sequence-mutated stress promoters that are stress-inducible can be used.

When each is covalently linked such that the therapeutic gene is transcribed and translated under the control of the stress promoter, the therapeutic gene and the stress promoter become “
Operatively connected ". If it is desired that the induced therapeutic gene be translated into a functional protein, the induction of the stress promoter located 5 ′ of the expressed gene sequence transcribes the therapeutic gene sequence and furthermore, the sequence between the two DNA sequences If the ligation does not result in mutation by frameshift, does not interfere with the ability to direct transcription of the therapeutic gene sequence in the promoter region, and does not interfere with the ability to be translated into protein in the corresponding RNA transcript, It can be said that two DNA sequences were operably linked. Additional sequences, such as 3 'stop sequences, can be used if necessary to ensure efficient translation of the gene of interest.

[0027] The techniques of the present invention can be applied to a number of disease states. It is preferably applied when the diseased tissue is confined to one or more parts of the body. It is possible to optimally select therapeutic genes, combine them, place each under the control of the expression of a stress promoter, and direct their expression by external stress on the tissue, preferably by mild heat. Is the basis of the present invention.

[0028] Among the many diseases for which this technique can be applied, solid tumors are an important disease type selected for treatment according to the present invention. In essence, there is no limit to the choice of genes to use, the particular choice being dependent on the specificity of each disease state.

Cancer Gene Therapy In gene therapy for cancer, a number of genes are being tested clinically. Genes for cancer treatment available in the field of medical research can be divided into essentially three types: genes that induce cancer cell death; genes that revert the cancer phenotype to non-cancer types; Genes that reduce the risk of spread and metastasis. In the present invention, 3
All types of genes can be used, and in the most preferred embodiment, a combination of two or more types of genes is used. In one preferred embodiment, treatment with a particular combination of genes can be combined with standard anti-cancer treatments using chemotherapy, radiation therapy or both.

The genes that can be used in the present invention include, but are not limited to, one or more of the following genes: apoptosis-inducing gene : 1.1 Genes of proteins with cell death domains, such as GAX, GATA-6, TNFR1
, TRADD, FADD, FAS. Another approach relies on the use of tissue specific promoters with Th and RIP. 1.2 TRAF family genes such as TRAF1, TRAF2, TRAF3 and TRAF4 / CART1
. 1.3 ICE / CED-3 family genes such as ICE, Ich-1 / Nedd-2, Cpp32 / Yama /
apopain, TX / Ich-2 / ICE rel 11, Mch-2, ICE rel 111 and Ced-3. Cell cycle inhibitor gene : For example, GATA-6, cdc2 kinase and PCNA. "Suicide" genes : eg herpes thymidine kinase and ganciclovir or penciclovir, mouse α-1,3-galactosyltransferase and human serum. Tumor suppressor gene : for example, p53, NB, p16INK4 / CDNK2. Anti-angiogenic genes : eg angiostatin, endostatin. Antisense oligonucleotides : Any antisense gene sequence that inhibits gene expression can be used.
Its target sequences include oncogenes, growth factor genes, and angiogenesis inducer genes.

Strategic Use of Gene Combinations in the Treatment of Specific Cancers The present invention includes, in one preferred embodiment, the treatment of solid tumors, such as brain tumors, lung cancer, and prostate cancer. The method used is to select particular genes from the group and combine their expression at the target site. The goals of treating solid tumors are to limit their continued growth and spread,
And since it is ultimately to remove the tumor mass, it would be optimal to induce the gene continuously.

A general combination of genes for treating a solid tumor may include one or more genes from one or more of the six groups described above. In the treatment of prostate cancer,
Highly effective genes, such as Fas ligand and tk and ganciclovir, could be used and could be combined with one or more genes from a group of genes that inhibit angiogenesis. On the other hand, treatment of cerebral glioma may require relying on anti-angiogenic and cell cycle inhibitor genes to avoid damage to normal surrounding tissues in the brain. In the present invention, it is beneficial to classify genes for gene therapy in a certain way, but the inventors have determined that optimal activity in the clinic is based on individual indications and indications of a particular patient. You will find the exact mix of genes shown. One of skill in the art would be able to select a particular gene combination for a particular application based on an analysis of preclinical results.

Other Diseases Due to Non-Cancer Indication Cell Proliferation Many vascular disorders result from the proliferation of vascular smooth muscle cells (VSMC) in response to injury.
Atherosclerotic foci formation involves the infiltration of macrophages and T cells into the vascular wall, which induces VSMC migration from the media to the intima, where they dedifferentiate, proliferate, Then, the extracellular matrix component is synthesized. These lesions can induce thrombi leading to the occurrence of ischemia in luminal and distal tissues. VMSC hyperplasia has also contributed to the occurrence of restenosis in 30-50% of patients who have undergone percutaneous balloon angioplasty. Therefore, many groups are exploring molecular genetic approaches to target VSMC proliferation to minimize the occurrence of restenosis after percutaneous revascularization.

A number of genes have been used exclusively with constitutive promoters. Examples include the thymidine kinase gene (with ganciclovir treatment), Rb, p21 and p27, GAX and hirudin (Prospects for Intravascular Gene Therapy, Smith R. and Wa
lsh K., Journal of Clinical Apheresis 12, 140-145, 1997). A recent report by Walsh et al. (Sata et al., 1998, Proc. Natl. Acad. Sci. USA 95, 1213-12.
In 17) the Fas ligand gene was used in the study. The high toxicity levels of such genes will likely require inducible gene expression for clinical applications.

Treatment of Diabetes by Gene Therapy The present invention allows precise physical and temporal regulation of gene expression, making it a good candidate for the treatment of diseases requiring regulated and dose-related production of proteins in vivo. Applied to In a preferred embodiment, the present invention is applied when disease regulation cannot be achieved due to cell proliferation.

One important disease with these precise features and requirements is diabetes. 1
One important type of diabetes is insulin-dependent diabetes. This type of diabetes
It usually begins at the age of 10 to 20 years. The etiology is unknown, but it is likely that in immunologically infectious individuals, beta-pancreatic islet cells become infected with the virus, resulting in infinitely persistent autoimmune damage. In the disease, a partial remission follows the acute phase, followed by a practical destruction of the islet cells, which requires insulin for life.

By expressing the human insulin gene according to the present invention, the disease could be treated with a gene. Insulin must be supplied to patients suffering from insulin-dependent diabetes at specific times and in specific amounts. The invention can be used, for example, in an ex vivo method, in which cells are engineered to produce a regulated amount of insulin, as required.

Furthermore, in many other diseases, a certain amount of gene expression is required to treat the required metabolic factors. Numerous diseases of the brain and nervous system are best treated by the present invention, which makes temporal and localized expression of specific proteins.

Other diseases, such as gout in which there is a temporal deficiency of a specific enzyme involved in uric acid metabolism, are also easily treated by the present invention. A metabolic disease that requires constant and lifelong production of one or more proteins,
For example, hemophilia is not beneficially treated by the present invention.

Preferred Embodiments of the Invention The present invention demonstrates that one or more human genes can act on a disease state in a patient, especially solid tumors, and that each is beneficial for therapy. In the present invention, such gene expression induction can be performed at a specific site in the body by controlled stress, preferably mild heat. The present invention can also be practiced systemically in the body using certain drugs as inducers of disease treatment.

The present invention can be used in an advantageous manner for the expression of genes for vaccination. In this case, the temporal regulation of expression is desirable, while the localization of expression is relatively less important. The exception that requires both regulation in DNA vaccination would be when using transplanted cells designed to produce the selected protein antigen for a particular vaccination treatment.

Unfortunately, the disease does not necessarily occur in a patient as an individual and single event. Particularly in the elderly, the incidence of various diseases, particularly cancer and cardiovascular diseases, tends to increase. In some cases, effective treatments for cancer, such as the use of anti-angiogenic compounds or genes, were counterproductive, for example, in patients with limb ischemia.

Isner et al. (Clinical evidence of angiogenesis after arterial gene tr
ansfer of phVEGF165 in patient with ischaemic limb, 1996, J. Isner et al
., The Lancet 348, 370-374) describes a plasmid DNA encoding phVEGF165,
When fed into the artery of a patient with an ischemic right leg, collateral vessels increased at the position of the knee, tibia and tarsal joint 4 weeks later, and continued to increase at the time of observation 12 weeks later That was shown.

In the above clinical test, a method in which 2 mg of plasmid DNA was administered once was used.
Providing said substantial amount of DNA into the bloodstream for the desired treatment; and
This administration will also affect other parts of the body, since a constitutive promoter, the cytomegalovirus promoter / enhancer, was used to express VEGF165. Obviously, the cancer indications in such patients are at risk of being exacerbated by the required treatment.

According to the present invention, two or more genes can be expressed at a single site, for example, in a solid tumor or a restenotic artery, and at two or more sites as in the examples above. Thus, in one preferred embodiment of the present invention, each disease comprises an anti-angiogenic gene, such as angiostatin, for treating solid tumors and an angiogenesis-inducing gene, such as phVEGF165, for treating ischemia. Both symptoms can be beneficially treated while avoiding negative effects on the symptoms.

Vectors for stress promoter-therapeutic gene constructs and administration systems Any gene or combination of genes, including but not limited to those listed above, can be supplied by various methods. They can be equally well introduced into patients for ex vivo gene therapy as well as in vivo gene therapy. Therapeutic genes placed under the control of the expression of a stress promoter can be supplied to cells or tissues, alone or in combination with a vector. In the broadest sense, the term "vector" refers to any element that facilitates the supply of the gene expression system to target cells, and facilitates the uptake of the gene expression system into target cells that are less degradable than without the vector. Carrier.

Vectors can be divided essentially into two groups: biological vectors and chemical / physical vectors. Biological vectors include, without limitation, plasmids, cosmids, viruses, and carriers derived from bacteria or viruses into which the nucleic acid sequences of the invention can be inserted or integrated. Preferred biological vectors are viral vectors, including, but not limited to, the following viruses: adenovirus, adeno-associated virus, herpes virus, vaccinia virus, polyoma and papilloma virus, semliki forest virus, retrovirus, eg, Rous Sarcoma virus, Harvey mouse leukemia virus, Moloney mouse leukemia virus, human immunodeficiency virus. Although not listed here, other viruses known to those skilled in the art can also be used.

Preferred viral vectors are those that infect eukaryotic cells without cytopathic effects,
It is modified so that non-essential or potentially harmful genes are replaced by other genes such as therapeutic genes placed under the regulation of stress promoter expression. Adenovirus-based and retrovirus-based vectors, and recently reported adenovirus / retrovirus chimera vectors
(Feng., Nature Biotechnology 15, September 1997, Stable in vivo gene tra
nsduction via a novel adenoviral / retroviral Chimeric Vector) is a preferred viral vector.

Preferred non-viral vectors include colloidal dispersion systems, such as lipid-based systems, such as oil-in-water emulsions, micelles and liposomes. Liposomes,
By binding to a specific ligand, eg, a monoclonal antibody, a sugar, a glycolipid, or a protein, it can be specifically delivered to a particular tissue. The vector may also be ligated to a peptide that targets the nucleus, thereby allowing the stress promoter-therapeutic gene construct to be specifically delivered to the host cell nucleus.

In one aspect, the preferred carrier is a biocompatible microsphere or implant that can be introduced into the body. Exemplary biodegradable implants that can be used in the present invention are described in PCT / US / 03307. It describes a biocompatible, biodegradable polymer substrate for containing a foreign gene under the control of expression of a suitable promoter. The polymer matrix is used to sustain foreign gene release in a patient. Other forms of polymer substrate, such as films, coatings and gels, can also be used.

In another preferred embodiment, a preferred carrier is a cell from a mammal containing a stress promoter-therapeutic gene construct selected for application to a particular disease. As a therapeutic implant device, for example, living cells carrying the expression construct of the present invention are encapsulated in a non-crosslinkable chitosan core substrate described in WO93US9023. It can be prepared by extruding the viable cultured cells and the polymeric solution and sealing such a tubular semipermeable extrudate. See U.S. Patent Application No. 5283187. Such implants can be used as in vivo bioreactors to produce useful proteins in the body using the techniques of the present invention.

For therapeutic applications of the invention, an effective amount of a therapeutic molecule is administered. Generally, a therapeutically effective amount refers to that amount required to delay the onset of, suppress the progress of, or halt the progress of a particular condition being treated. In general, the amount will vary with the age, sex and weight of the patient, as well as the nature and progress of the disease being treated.

Gene therapy with a stress promoter-therapeutic gene construct can be performed alone or in combination with conventional drugs and other treatments. For example, in the treatment of cancer, chemotherapeutic agents, such as cisplatin, vinblastine, taxol, bepeside, kaliolicin, bleomycin, and / or radiation therapy
It can be combined with the treatment according to the invention.

[0054] Others have developed vectors and systems for supplying genes and proteins for gene therapy. An example of such a development is provided to clarify the differences from the present invention.

1. Vectors and vector systems containing genes encoding tumor suppressor proteins, and production cells transformed therewith, PCT / US94 / 14278. There, inducible promoters are used and a series of inducible promoters, including heat shock promoters, are cited. The goals and embodiments of the art are different from those of the present invention. The purpose is to modulate tumor suppressor protein levels in the producing cells, thereby allowing the cells to grow and produce recombinant virus particles. The particles are then used for gene therapy. Inducibility has been exploited to regulate the level of tumor suppressor protein produced. Furthermore, all examples describe the cell line producing the viral vector and the vector itself.

[0056] 2. PCT / US94 / 07091, a toxin cassette for gene therapy that has pore forming properties and encodes a superantigen. There, the gene applied for gene therapy is a gene encoding a toxin, preferably a gene encoding a cytolytic enterotoxin. Such toxins destroy cell membranes by producing pore-forming complexes. An example is Staphylococcus aureus enterotoxin A (SAEA). Heat shock inducible and ionizing radiation inducible promoters have been proposed as elements that regulate SAEA expression. The examples and claims are limited to genes encoding potent toxins that are not of human origin.

To express a gene in an animal tumor, an inducible promoter, such as human
The use of the hsp-70 promoter has been reported (Dreano et al., Biotechn.
ology, November 1988, 1340-1343). Drosophila in mouse cells
Regulation of c-myc gene expression by the hsp-70 promoter (Wurm et al., Proc. Natl. Ac
ad. Sci. USA 83, 5414-5418, 1986) is an excellent example of very tight expression regulation by the hsp-70 promoter. When the cells are induced by heat shock, very large amounts of c-myc are synthesized and cell death is induced.

Experimental Protocol Example 1: Construction of Expression Plasmid Hhsp-70-Vector The plasmid used as the basis was a commercially available 4518 bp pBK-CMV phagemid (Stratagene, GmbH, Postfach, Germany). This plasmid is capable of replication and propagation in prokaryotic cells, as well as expression in eukaryotic cells. In eukaryotic cells, its expression is regulated by the CMV immediate early promoter. This constitutive CMV promoter is replaced by a human hsp-70 inducible promoter.

PBK-CMV was digested with Hind111 and ApaL1. A large fragment of 3329 bp was isolated. pBK-CM
V was digested with ApaL1 and Nsi1, and the resulting 363 bp fragment was isolated. The other fragments are 196270 and 2030 bp in size, respectively. Plasmid p17 (Voellmy et al., PNA
S. USA 82, 4949-4953, 1985, Isolation and functional analysis of a human
70,000 dalton heat-shock protein gene segment) was digested with Pst1 and Hind111, and a 700 bp fragment was isolated. Pst1 and Nsi1 are isoacceptors.

The three isolated fragments of 3329, 363 and 700 bp are mixed and ligated. Escherichia coli was transformed with the ligation reaction solution, and a kanamycin-resistant strain was selected. The resulting plasmid, Hhsp-70, was isolated and characterized.

Example 2 Construction of Expression Plasmid Hhsp-70-GATA-6 Hhsp-70 was digested with Xba1 and Apa1, and a large fragment of 3311 bp was isolated. The small fragment is 18
00 bp. Separately, Hhsp-70 was digested with Hind111 and Apa1, and a small 1800 bp fragment was isolated. Its large fragment is 3329 bp. Plasmid pCGN (S
uzuki et al., Genomics 38: 3, 283-290, 1996, The human GATA-6 gene: struc
ture, chromosomal location, and regulation of expression by tissue-speci
fic and mitogen-responsive signals) were digested with Hind111 and Xba1, and a 1995 bp fragment containing GATA-6 was isolated. Hhsp-70-GATA-6 was prepared by ligating these three fragments and transforming E. coli based on kanamycin resistance.

Example 3 Construction of Expression Plasmid Hhsp-70-p53 The GATA-6 sequence present in the plasmid Hhsp-70-GATA-6 was replaced with the p53 sequence present in the plasmid containing the wild-type p53 cDNA. By doing so, the plasmid Hhsp
-70-p53 was constructed. This was performed as follows. Plasmid Hhsp-70-GATA-6 into Hi
After digestion with nd111 and Xba1, a large fragment of about 5200 bp was isolated. The small fragment is 1995 bp. Separately, the wild-type p53 sequence present in SN3-p53 was amplified by PCR using oligonucleotides with the following sequences. 5 'TTAATTAATT AAGCTT ATGGAGGAGCCGCAGTCAG 3' including Hind111 site (underlined) and 5 'TACTGATATAAA TCTAGA CTAGTCTGAGTCAGGCCCTTCTG 3' including Xba1 site (underlined)

These oligonucleotides were chosen to add a single Hind111 site and an Xba1 site, respectively, at the 5 ′ and 3 ′ ends of the p53 gene. Amplify the PCR product with Hind111
Plasmid Hhsp-70-p53 was created by digesting with Xba1 and isolating the resulting approximately 1180 bp fragment and ligating it to the 5200 bp described above.

Example 4: Construction of a replication defective adenovirus expressing the GATA-6 gene under the control of the hsp promoter An adenovirus expression vector was constructed by the method developed by M. Perricaudet and his group (Smith RC, Branellec). D., Guo K., Periman H., Dedie
u J.-F., Pastore C., Mahfoudi A., Denefie P., Isner JM and Walsh K., 1
997, p21 CIPI-mediated inhibition of cell proliferation by over-expressi
on of the gax homeodomain gene, Genes Dev. 11: 1674-1689). Plasmid pB
K-HSP-GATA-6 was digested with BamH1 and Xba1, and the resulting small fragment of about 2000 bp containing the HSP and GATA-6 sequences was treated with Klenow enzyme to blunt its ends.

In parallel, the pCO1 vector containing the adenovirus 5 sequence required for homologous recombination (described in the above-cited reference) was linearized by EcoRV digestion and removed by calf intestinal alkaline phosphatase (CIP) treatment. Phosphorylated. Next, HSP-GATA
-6 was ligated to the fragment containing. After transforming competent E. coli, HSP-GA
A pCO1 derivative with the TA-6 gene inserted in either direction was obtained. This plasmid
After linearization with Xmn1, a large Cla1 fragment of adeno 5 d1234 viral DNA (Stratford-P
erricaudet LD, Makeh I., Perricaudet M. and Briand P. 1992, Widespread
long-term gene transfer to mouse skeletal muscles and heart, J. Clin. I
nvest. 90, 626-630) into 293 cells. In this way, 293
Through recombination in cells, infectious virions expressing GATA-6 under HSP regulation were produced.

The plasmid was derived from a serotype 5 human adenovirus lacking the early genes E1a, E1b and E3. The resulting adenovirus grows only in 293 cells that express the Ad5 E1 gene product required for replication. The recombinant replication-defective adenovirus is purified from the isolated plaque and the viral DNA is prepared. Recombinant adenoviruses containing the appropriate expression cassette are identified by restriction fragment analysis and grown in 293 cells. The virus preparation is purified by two CsCl gradient centrifugations. Virus titers are determined by plaque testing on 293 cells (Graham F.
L. and van der Eb AJ, 1973, A new technique for assay of infectivity o
f human adenovirus 5 DNA, Virology 52, 456-463).

[0067] Example 5: full length native human Fas ligand and, adenoviral vector expressing defective derivative amino acids 430-460 spanning the protein region that allows Shedi ring (shedding) of the extracellular domain Constructed full-length human Fas ligand cDNA (Takahashi, T., Tanaka, M., Inazawa, J., Ab
e, T., Suda, T. and Nagata, S., Human Fas ligand: gene structure, chromosom
al location and species specificity, Int. Immunol. 6, 1567-1574, 1994) was obtained from the vector pEX-hFL1 from Shigekazu Nagata (GenBank No. U11821). PCR amplification using the following primers yielded an open reading frame fragment of the Fas ligand flanked by XhoI (5 ′) and XbaI (3 ′) restriction sites: Kpn5 (5 ′ GGGGGGGGTACCCTCGAG ATG CAGCAGCCCTTCAATTACCCA 3 ′) and Xba3 ( 5 'GGCGGCTCTAGA TTA GAGCTTATATAAGCCGAAAAACG 3')

The translation start and stop codons are underlined. The PCR reaction solution was subjected to size fractionation by agarose gel electrophoresis, and the desired product (presumed to be 876 bp) was isolated by QiaexII (Qiagen). The fragment was digested with KpnI and XbaI, size fractionated and purified. The fragment was obtained from the pGL3-Basic vector (Promega) 1710, which had the bacterial origin and the ampicillin resistance gene, but lacked the luciferase reporter gene.
It was ligated to a bp KpnI / XbaI fragment. XL1Blue competent due to the ligation reaction
Bacteria were transformed and recombinants were selected for ampicillin resistance. Each isolate was selected by restriction enzyme analysis for the presence of the 861 bp XhoI / XbaI fragment of the Fas ligand. The resulting recombinant plasmid containing the Fas ligand cDNA was digested with XhoI, and the linearized plasmid was size fractionated and purified. The purified plasmid was transformed into pD3SX (StressGen Bi) containing the Hsp70B promoter and RNA leader sequence.
otechnologies Corp.) and ligated to an approximately 400 bp XhoI / SalI fragment. Bacteria were transformed with this recombinant plasmid and selected for ampicillin resistance. From the plasmids obtained from the isolated bacterial colonies, plasmids having the Hsp70B promoter in an appropriate direction were selected by restriction enzyme analysis using XhoI and XbaI. HSP70B
In order to analyze promoter-induced and functional Fas ligand expression, approximately 13
Recombinants containing the 00 bp fragment were selected (pGL3-Hsp70B Fas ligand).

By deleting the cleavage site located between amino acids 129 and 130, a shedding resistant Fas ligand derivative was created (Tanaka, M., Itai, T., A
dachi, M., Nagata, S., Down regulation of Fas ligand by shedding, Nature M
ed. 4, 31-36, 1998). The deletion corresponds to the amino-terminal coding region of the Fas ligand (1-1
21) and a carboxy-terminal coding region (133-281) in open reading frame. To this end, the amino terminal region was separately amplified from pEX-hFL1 using the Kpn5 primer and the following primer FL5R, and the carboxy terminal region using the following primers FL3F and Xba3 primer: FL5R ( 5 ' GGGTGGACTGGGGTG CATCTGGCTGGTAGACTCTC 3') FL3F (5 'GAGAGTCTACCAGCCAGATG CACCCCAGTCCACCC 3')

The PCR reaction solution was subjected to size fractionation, and a PCR product having an appropriate size was purified. 5 'fragment (3
96 bp) and 3 'fragment (477 bp) are mixed at a ratio of 1: 1 and a full-length template is prepared by elongation of a hybrid cross-linked via the complementary sequence (underlined) contained in the FL5R and FL3F primers. did. This template was amplified with Kpn5 and Xba3 primers. The PCR reaction solution was size-fractionated by agarose gel electrophoresis,
The 3 bp product was identified, isolated and purified. Next, the PCR product was digested with KpnI and XbaI.
And the digest was fractionated, purified, and placed under control of the HSP70B promoter in the PGL3 Basic vector, as in the full-length native Fas ligand. To analyze the expression of a form of the Fas ligand that is resistant to induction by the HSP70B promoter and shedding into the medium, the recombinant containing the approximately 1200 bp fragment was selected (pGL3-Hsp70BncFas ligand).

Adenovirus vectors were constructed by standard methods (Becker, TC, Noel
, RJ, Coats, WS, Gomez-Foix, AM, Alam, T., Gerard, RD, Newgard, CB (
1994) Use of Recombinant Adenovirus for Metabolic Engineering of Mammali
an Cells in "Methods in Cell Biology" vol.43, Chapter 8, 161-189 (Academ
ic Press)). From the pACCMV.pLpA plasmid, the CMV promoter and the SV40 polyadenylation signal sequence were excised by NotI digestion and size-fractionated by agarose gel electrophoresis. A fragment (about 7.6 kb) containing the Ad5 sequence was identified, isolated, and purified. The NotI fragment of pACCMV.pLpA was converted to a pair of oligonucleotides NKX1 (5'-
KpnI and XbaI sites were created by ligation to GGCCGGTACCTCTAGA-3 ′) and NKX2 (5′-GGCCTCTAGAGGTACC-3 ′). Candidate plasmids were digested with KpnI or XbaI and screened on agarose gel electrophoresis for the presence of a single fragment, and KpnI and XbaI
A recombinant plasmid containing the site (pACCMV.pLpA-KX) was identified. pGL3-Hsp70B Fa
The s ligand construct was digested with KpnI and XbaI. The digest was size-fractionated by agarose gel electrophoresis, and the Hsp70B promoter fragment (1300 bp) was identified, isolated and purified. This fragment was ligated with a 7.6 kb Kp from pACCMV.pLpA-KX containing the Ad5 sequences necessary for recombination with plasmid pJM17 containing the modified Ad5 genome.
Ligation to the nI / XbaI fragment. The digest was digested with KpnI and XbaI, analyzed by agarose gel electrophoresis, and the presence of the 1300 bp fragment identified the recombinant construct. pACCMV.pLpA
The Fas ligand construct was cotransfected with pJM17 into 293 cells by CaCl2 precipitation.
When lysis of the culture reached a maximum, the monolayer culture was detached and lysed by freeze-thawing to obtain the virus. The lysate was amplified and serially diluted,
Monolayers of 293 cells cultured with a soft agarose overlay were infected. Gel sections containing single plaques were removed from plates infected at a dilution high enough to form independent plaques. A virus stock was prepared from the gel portion to identify positive recombinants expressing Fas ligand. Positive clones were evaluated from the ability of the Hsp70B promoter to express Fas ligand under temperature control. Using a similar method, pG expressing the non-cleavable Fas ligand
An adenovirus construct derived from L3-Hsp70B ncFas ligand was obtained.

Example 6 In Vitro Inspection with GATA-6 Expression Plasmid Mouse embryonic fibroblasts (MEF's) were induced to rest by removing serum for 3 days in 0.5% FBS DMEM. 60mm with gelatin-coated cover glass
MEF's were cultured in the plate at a concentration of 50000 cells / ml. After induction to a quiescent state, the cells were transfected with Hhsp-70-GATA-6 (Example 2) by the LipofectAmine method (Gibco BRL) using 5 μg of the construct in OPTI-MEM medium for 4 hours. did. After incubation for 4 hours, the cells were washed twice with PBS at 37 ° C., followed by culturing in 10% FBS DMEM for 12 hours. As controls, β-galactosidase expression plasmid and GATA-6 expression plasmid with GATA-6 gene under the control of strong constitutive CMV promoter were transfected.

In the expression experiments, all the transformed cultured cells were subjected to a heat shock at 42 ° C. for 90 minutes and then incubated at 37 ° C. for 16 hours. At that time, 10 μM
BrdU was added, and the culture was continued for another 12 hours. GATA-6 expression and BrdU incorporation were detected by double immunofluorescence. From typical microscopic observations, only GATA-6 positive cells, namely with and without heat shock, with CMV-GATA-6 plasmid and exclusively with heat-shocked Hhsp-70-GATA-6 plasmid Did not incorporate BrdU. This means that expression of cell cycle inhibitory factor genes, such as GATA-6,
Figure 4 shows that -70 expression can be precisely regulated in vitro.

[0074] Example 7: viruses preparation used in Lee Nbibo inspection vivo test in gene therapy with adenovirus restenosis model in rats, and purified by CsCl gradient centrifugation, and
Dialyzed against buffer containing 10 mM Tris-Cl pH 7.4, 10% glycerol and stored at -80 ° C. Viral titers were determined by plaque testing on 293 cells and expressed in plaque forming units (pfu) / ml.

The balloon injury model is described in Clowes et al. (Clowes, AW, MA Reidy, and MM
. Clowes, 1983, Kinetics of cellular proliferation after arterial injury
I: smooth muscle cell growth in the absence of endothelium, Lab.Invest
49: 327-333). 400-500 g of male Sprague-Dawley rats were anesthetized by intraperitoneal injection of pentobarbital sodium (45 mg / kg). The left common carotid artery was exposed through a midline incision, and the left common carotid artery, internal carotid artery, and external carotid artery were temporarily ligated. A 2F embolectomy catheter was introduced into the external carotid artery and advanced to the distal ligation site of the common carotid artery. To inflate and damage the endothelium, the balloon was inflated with saline and pulled three times toward the arteriotomy site. Next, the catheter was pulled out. A cannula is inserted just proximal to the bifurcation of the carotid artery and into a temporarily isolated site in the artery, through which adenovirus (1 x 10 ⁹ pfu / 10 μl
l diluted to 100 μl). The adenovirus solution was incubated for 20 minutes before the virus infusion and cannula were withdrawn. The proximal external carotid was then ligated, and blood flow was restored to the common carotid by loosening the other ligatures.

Test gene expression was induced by locally heating the treated carotid artery region using a plastic aquarium tailored to the carotid artery. Heated at 44 ° C. for 30 minutes. The heating was performed during adenovirus treatment and every three days thereafter.

Rats were killed 14 days after treatment by intraperitoneal injection of pentobarbital (100 mg / kg). The balloon injury site of the left common carotid artery was perfused with saline from the proximal end of the scapulohyoid muscle to the carotid bifurcation, and the surrounding tissue was excised. The tissues were fixed in 100% methanol and embedded in paraffin. Several 4 μm sections were cut from each tissue specimen. For each specimen, one section was stained with hematoxylin and eosin, another section was stained with Richardson's mixed elastic trichrome stain, and analyzed by conventional light microscopy.

A histological image of a transverse section of an artery piece stained with hematoxylin and eosin, or elastic trichrome, was projected onto a digitizing board, and the intima, media and luminal areas were imaged by a computer image processing program. Measured by quantitative morphological analysis.

The effect of Fas ligand under the regulation of constitutive CMV promoter expression on rat carotid neointima formation two weeks after balloon injury has been published (Sata et a
l., 1998). The results showed that increasing doses from 1 × 10 ⁶ to 3 × 10 ⁸ pfu per animal produced significant Fas ligand effects. A more than 300-fold difference in virus concentration indicates a relatively similar effect on neointima / intimal membranes.
% To 73% reduction. This indicates that a threshold effect was observed with the Fas ligand. Thus, experiments with the hsp-70 promoter showed comparable effects, though they were inducible, non-constitutive, and somewhat weaker than the very strong CMV promoter. In this way, an intrinsic advantage of the stress-inducible promoter over the CMV promoter is localized expression in the rat carotid artery.

FIG. 1 shows that Fa under the control of the CMV promoter and under the control of the HSP promoter.
Show comparable effects of adenovirus constructs expressing s ligand. The results are from arteries 2 weeks after balloon injury and adenovirus treatment (adenovirus 1 × 10 ⁸ pfu / animal). This shows approximately 60% inhibition for both promoters as compared to the saline and β-galactosidase samples.

Example 8: Gene Therapy of Rat Brain Tumor Glioma Model with Adenovirus Using a rat model of glioma, the effect of treatment with adenovirus gene transfer was examined. Pregnant CDF Fischer rats are treated with 50 mg / kg
Undifferentiated glioma cell line F98 derived from glioma induced by exposure to N-methyl-N-nitrosourea. Kobayashi et al. (Kobayashi, N
., Allen, N., Clendenon, NR, LW Ko., 1980, An improved rat brain-tum
or model, J. Neurosurg, 53: 808-815)
Clendenon et al. (Clendenon, NR, RF Barth, WA Gordon, JH Goodman
, F. Alam, AE Staubus, CP Boesel, AJ Yates, ML Moeschberger, RG
. Fairchild, and JA Kalef-Ezra. 1990. Boron neutron capture therapy of.
a rat glioma. Neurosurgery 26: 47-55) and adapted for F98 transplantation, and
Perez-Cruet et al. (Perez-Cruet MJ, TW Trask, SH Chen, JC Goodma
n, SL Woo. RG Grossman, HD Shine. 1994. Adenovirus-mediated gene t
Herapy of experimental gliomas. J. Neurosci. Res. 39: 506-511).

To apply the present invention to this in vivo model, a suitable transplantation probe was constructed and used as follows. This probe resembles in some respects the Ommaya Reservoir system used to treat various brain tumors (Ommaya AK 1984, Impla
ntable devices for chronic access and drug delivery to the central nervo
us system, Cancer Drug Deliv, 1 (2), 169-179, and Cornwell CM 1990.The
Ommaya Reservoir: implications for pediatric oncology.:Pediatr. Nurs. 16
(3) 249-251).

The probe is formed by molding a rigid polymer (eg, Teflon) into the general shape of a coach bolt, drilling through a hole from the wide end, and inserting a minimized thermal resistor and wiring. Created. The internal volume area communicates with the CSF via a number of radiating holes in the trunk. -Some early probes are equipped with temperature sensors that are insulated from the inner heating volume and are flush with the outer surface, thereby studying heat diffusion in the rat brain at various depths. Becomes possible. -The other larger end of the implant is dented and closed with a naturally healing membrane. The wiring is led out through a radial sealing hole. The adenovirus is passed through this membrane by a standard hypodermic needle. • Place the thread on top of the trunk, just below the reservoir, thereby ensuring that the implant is tied to the rat skull.

Insertion method The probe was inserted into the rat brain via the hole used to inject the tumor tissue. Using the operating arm of the stereotaxic device, slowly insert and screw into the deepest part of the brain. Injection of adenovirus vector suspension • Slowly remove an equal volume of CSF from the reservoir before injecting the adenovirus vector suspension. The adenovirus solution is then injected, and the heater is turned on to promote heat convection of the solution from the reservoir trunk.

Determination of Thermal Diffusion Parameters A simple rat brain thermal model for the first dead rat brain and then some live rat brains using a reservoir trunk equipped with a temperature sensor It was created. It was then used to construct a resistor current-potential curve to stimulate the construct in tumor tissue. Induction • Apply heat by applying a DC potential to the resistor while measuring the current. The temperature of the resistor is deduced from the pre-calibrated temperature potential-current characteristics and avoid destruction of the resistor. Adjust the temperature characteristics of the resistor so that the temperature in the CSF around the outer periphery of the reservoir does not exceed 44 ° C.

The method of heat induction shown here is not limiting. For example, microwaves, lasers, magnetic induction, etc., may all be used in certain applications of the invention or in multiple applications. For example, in certain cases where a stent is implanted for the treatment of restenosis, the use of metal stents can specifically induce heat on the stent. This allows for accurate and single expression of genes such as Fas ligand, GATA-6, GAX, etc. at potential cell growth sites in balloon-treated arteries.

In this method, adult female Fischer rats were treated with ketamine (42.8 mg / ml), xylazine
(8.6 mg / ml) and acepromazine (1.4 mg / ml) were injected and fixed in a stereotaxic apparatus. The scalp was incised at the midline and a hole was drilled with a 0.9 mm drill 1.8 mm to the right and 2.5 mm anterior to Bregma. A plastic screw embedded in the skull was used as a guide. An injection containing 5 × 10 ⁴ live tumor cells in 10 μl of Dulbecco's minimal essential medium containing 1% agarose was loaded into a syringe with a 26 gauge needle, which was attached to the operating arm of the stereotaxic apparatus. . The right caudate nucleus, 4.5 mm deep from the dura, was injected over several minutes. After injection, the needle was left in place for a few minutes before slowly withdrawn. The screw holes were filled with bone wax and the scalp was closed with sterile clips.

Four to eight days after tumor injection, 1.2 × 10 ⁹ adenovirus in sterile 6 μl 10 mM Tris-HCl pH 7.4, 10% glycerol was placed at the same coordinates as used for tumor cell implantation. The solution containing the virus particles was injected. Starting at a depth of 5.5 mm from the dura surface, 1 μl was injected six times in 0.5 mm increments while lifting the needle. The injection was slow over several minutes and the needle was slowly withdrawn.

At the end of the experiment, the animals were euthanized by injection of sodium pentobarbital mg / kg, during which time phosphate buffered saline (PBS) followed by 4% paraformaldehyde / PBS
Was fixed by cardiac perfusion. Brains were fixed for an additional 24 hours before removal, frozen sections were prepared by continuous incubation in fixative containing 5%, 10% and 20% sucrose and embedding in OCT. Cryostat sections (6 microns) were stained with hematoxylin and eosin for light microscopic analysis. Four days after treatment with adenovirus, the treatment response was measured as survival in days. The results obtained are as follows.

Example 9: F98 brain glioma model multiple gene-treated animals Survived for 20-30 days HSP-Fas ligand treated 27 days 50% Survived 36 days 100% dead HSP-Fas and HSP-GATA-6 30 days 50% death HSP-Fas and HSP-GATA-6 100% death after 40 days

The results show the use of individual genes under the control of the above indications, with the use of potent and potentially harmful genes, such as Fas ligand, having a prolonged survival effect in animal models. The combination of genes under the conditions of the present invention increases the protective effect.

The purpose of the application of multiple genes under strict expression regulation over time and in a targeted manner is simply to promote cell killing in tissues involved in cell proliferative diseases such as cancer and restenosis. Not to gain. The clinical effect sought is both efficiency and lack of secondary effects due to potential gene expression in tissues other than the target tissue.

For any particular indication, eg, a disease such as cancer, multiple combinations of therapeutic genes, and their dosages, will be tried by those skilled in the art. The work reported illustrates the general principles of the present invention.

[Brief description of the drawings]

FIG. 1 Description of FIG. 1. Adult Fischer rats were treated as described in Example 7. Standard viral dose in the rat model, a single gene vector or a combination as described in Example 8, the total 1 x 10 ⁹ pfu. FIG. 1 shows the effect on neointimal formation in a balloon injury model of the rat carotid artery. From left to right in figure: "Empty" adenovirus vector; Fas ligand adenovirus vector using human HSP-70 promoter; Fas ligand adenovirus vector using CMV constitutive promoter; CMV promoter under expression control An adenovirus vector containing β-galactosidase. These analytical methods are described in Example 7.

──────────────────────────────────────────────────続 き Continuation of front page (81) Designated country EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE ), OA (BF, BJ, CF, CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GD, GE, GH, GM, HR, HU, ID, IL, IN, IS, JP, KE , KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD, MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, US, UZ, VN, YU, ZW

Claims (18)

[Claims] 1. A method of treating a patient diagnosed as having a disease that can be treated by gene therapy, said method comprising the steps of:-DNA encoding a eukaryotic heat-inducible gene. Cleaving and removing the structural gene sequence encoding the heat shock protein to obtain a promoter sequence for the gene; an appropriate transfer plasmid, first the promoter sequence and then the selected heterologous protein mixture. Preparing a plasmid for recombination transfer by combining with the encoding DNA sequence, in which case the selected heterologous DNA sequence is operably linked to the heat shock promoter, and thus Creating an expression construct by placing it under transcriptional and translational regulation; preventing said expression construct from preventing disease states or Administering to said patient in an amount effective to reduce; treating said selected heterologous gene by stress treating a body site to be treated sufficiently to induce expression by said heat shock promoter. To induce the expression of 2. The method of claim 1, further comprising inducing the heat shock promoter with a source of electromagnetic, ionization, infrared, ultraviolet, microwave, heat, laser, ultrasonic, and nuclear magnetic resonance emission. 3. The method of claim 1, further comprising inducing a heat shock promoter with a stress inducer, such as a metal salt, other organic or inorganic compound, drug, hormone, and chemotherapeutic agent. 4. The method according to claim 1, wherein an antisense gene sequence is used in place of the DNA sequence encoding the selected heterologous protein. 5. The therapeutic gene expression construct comprises a combination of genes encoding at least two proteins selected from a protein that induces apoptosis, a protein that suppresses tumor, and a protein that inhibits angiogenesis. 4. The method of any of the preceding claims, comprising: 6. The method of claim 1, wherein said therapeutic gene expression construct is selected for the treatment of a genetic disease other than cancer. 7. The method of claim 1, wherein said treatment with gene therapy comprises the application of a standard cancer treatment selected from the group consisting of chemotherapy, radiation therapy and immunotherapy. Method. 8. The method of claim 1, wherein said therapeutic gene expression construct is introduced into a patient as naked DNA. 9. The method according to any of claims 1 to 7, wherein said therapeutic gene expression construct is introduced into a patient in a form contained in a vector or in combination with a vector. 10. The method of claim 9, wherein a chemical / physical vector is used. 11. The method according to claim 1, wherein the therapeutic gene expression construct is introduced into a patient in a form contained in a sustained release preparation or in combination with a sustained release preparation.
Any method of 0. 12. The therapeutic gene expression construct is introduced into a patient in a form contained in a viral vector or in combination with a viral vector.
The method of claim 9. 13. The method of any one of claims 1 to 12, wherein said therapeutic gene expression construct is introduced into a patient for specific treatment of cancer. 14. A gene sequence encoding an anti-angiogenesis-inducing protein, such as angiostatin or endostatin, placed under the control of the expression of a heat-inducible promoter that allows the gene to be expressed in vivo; A composition comprising a vector in combination with a genetic construct. 15. A composition comprising a gene sequence encoding a tumor suppressor protein, for example, p53, p16INK4 / CDNK2. 16. An apoptosis-inducing protein such as GAX, TNFR1, TRADD,
FADD, TRAF1, TRAF2, TRAF3 and TRAF4 / CART1, ICE, Ich-1 / Nedd-2, Cpp32 / Yama
/ apopain, TX / Ich-2 / ICE rel 11, Mch-2, ICE rel 111 and Ced-3, Bcl-xS, Bax
A composition comprising a gene sequence encoding, Bad, Bak and Bik. 17. A composition comprising a gene sequence encoding an antisense sequence. 18. An apoptosis-inducing protein, a tumor suppressor protein,
A composition comprising a gene sequence encoding a protein selected from the group consisting of a cell cycle inhibitor protein, an angiogenesis inducing protein, and an antisense sequence.