JP2002365292A - Reactive solid-phase carrier and dna fragment detecting implement - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a fixing method capable of stably bonding nucleic acid fragments such as previously prepared DNA fragments and oligonucleotides to a surface of a solid-phase carrier by speedy reaction, a method for manufacturing a carrier for fixing the nucleic acid fragments through the use of the fixing method, and an implement for detecting DNA fragment samples, etc., represented by a DNA chip. SOLUTION: The reactive solid-phase carrier is formed by fixing a group of acryloyl groups or reactive precursor groups thereof to the surface of the solid-phase carrier each via connecting groups by covalent bonding through the use of diacryloyl compounds. The implement for detecting and fixing the DNA fragment samples is constituted by bonding and fixing the nucleic acid fragments (probe molecules) to the reactive solid-phase carrier by covalent bonding.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a detection tool useful for analyzing the structure of a biopolymer, and more particularly to a detection tool useful for efficient analysis of gene expression, mutation, polymorphism, etc., of many biological origins. The present invention relates to a detection tool in which a polymer substance or its analog is aligned and fixed on the surface of a solid support. The invention particularly relates to DN
A high-density array-type detection tool (DNA detection chip), in which a large number of nucleic acid fragments are aligned and fixed at high density on the surface of a solid support, and useful for analysis of the base sequence of the A fragment sample, The present invention relates to a reactive solid support that can be advantageously used for production.

[0002]

2. Description of the Related Art Technology for efficiently analyzing gene functions of various organisms has been rapidly developed, and their DNs have been rapidly developed.
For analysis of the nucleotide sequence of A or DNA fragment, DN
A detection tool called an A chip in which a large number of DNA fragments or nucleotide derivatives such as synthetic oligonucleotides are immobilized on the surface of a solid substrate is used. Such a detection molecule such as a DNA or a fragment thereof or a synthetic oligonucleotide, such as a nucleotide derivative immobilized on the surface of a solid substrate, is also called a probe molecule. A typical DNA chip is a microarray in which a large number of probe molecules are aligned and fixed on a solid support such as a slide glass. The DNA chip-related technology relating to the production and use of this DNA chip is considered to be applicable to the detection of biomolecules other than DNA, and therefore, is useful for drug discovery research, disease diagnosis and development of prevention methods, and the like. It is expected to provide a means.

[0003] The DNA chip-related technology has been embodied since the invention of a method for determining the base sequence of DNA by hybridization with an oligonucleotide. Although this method could overcome the limitations of base sequencing using gel electrophoresis, it was not practical at first.

[0004] Subsequently, a DNA chip having the above-described structure and a technique for producing the same have been developed, and it has become possible to efficiently examine gene expression, mutation, polymorphism and the like in a short time. That is, a DNA fragment sample (also referred to as a target DNA fragment) exhibiting complementarity to a nucleic acid fragment (including a synthetic oligonucleotide) on the prepared DNA chip is generally prepared by a D
Detection is performed using hybridization between a nucleic acid fragment on the NA chip and a labeled DNA fragment sample.

[0005] In order to put the DNA chip preparation technique into practical use, a technique for aligning a large number of nucleic acid fragments at high density and stably on the surface of a solid support is required.

As a method for preparing a DNA chip, a method of directly synthesizing an oligonucleotide on the surface of a solid support (referred to as “on-chip method”) and a method of binding and fixing a nucleic acid fragment prepared and prepared in advance to the surface of the solid support And is known.
The on-chip method combines the use of protecting groups that are selectively removed by light irradiation with the photolithography and solid-phase synthesis techniques used in semiconductor manufacturing to produce oligonucleotides in a predetermined small matrix area. Method of selectively synthesizing (called "masking technology")
Is typical.

[0007] As a method for binding and fixing a nucleic acid fragment prepared in advance on the surface of a solid support, the following methods are known depending on the type of the nucleic acid fragment and the type of the solid support. (1) When the nucleic acid fragment to be fixed is a cDNA (complementary DNA synthesized using mRNA as a template) or a PCR product (a DNA fragment obtained by amplifying cDNA by PCR), the cDNA or PCR product is transferred to a DNA chip. A spotter device provided in the production apparatus spots the surface of the solid support that has been surface-treated with a polycationic compound (polylysine, polyethyleneimine, etc.) and uses the charge of the DNA fragment to electrostatically charge the solid support. It is common to combine.
As a method for treating the surface of the solid support, a method using a silane coupling agent having an amino group, an aldehyde group, an epoxy group or the like is also used. In the surface treatment using the silane coupling agent, amino groups, aldehyde groups, and the like are fixed to the surface of the solid support by covalent bonds.
Compared to the case of surface treatment with polycationic compound,
It is stably immobilized on the surface of the solid support.

As a modification of the above-mentioned method utilizing the charge of a DNA fragment, a PCR product modified with an amino group is subjected to SSC
(Standard salt-citrate buffer), a method of spotting the suspension on a surface of a silylated slide glass, incubating the suspension, followed by a treatment with sodium borohydride and a heating treatment in order. However, this fixing method has a problem that it is not always possible to obtain sufficient fixing stability of a DNA fragment. In DNA chip technology,
The detection limit is important. Therefore, the binding and fixation of the nucleic acid fragment in a sufficient amount (that is, at a high density) and stably on the surface of the solid-phase carrier can improve the detection limit of hybridization between the nucleic acid fragment probe and the labeled sample DNA fragment. Affects directly.

(2) Nucleic acid fragments to be fixed (probe molecules)
Is a synthetic oligonucleotide, first synthesize an oligonucleotide into which a reactive group is introduced, and spot the oligonucleotide on a solid support surface which has been surface-treated in advance to form a reactive group. A method is also known in which an oligonucleotide is covalently immobilized on the surface of a solid support. For example, a method in which an amino group-introduced oligonucleotide is reacted with a slide glass having an amino group introduced into the surface thereof in the presence of PDC (p-phenylenediisothiocyanate), and an aldehyde group-introduced oligonucleotide is reacted with the slide glass. Methods are known. These two methods have an advantage that the oligonucleotide is stably fixed to the surface of the solid support as compared with the above-mentioned method (1) in which the charge of the DNA fragment is used to fix the DNA fragment by electrostatic bonding. . However, in the method in which PDC is present, the reaction between the PDC and the amino group-introduced oligonucleotide is slow, and in the method using the aldehyde group-introduced oligonucleotide, the stability of the reaction product, the Schiff base, is low (accordingly, hydrolysis). Tends to occur).

In recent years, a technique has been proposed in which an oligonucleotide analog called PNA (peptide nucleic acid) is used as a probe molecule of a DNA chip instead of a conventional nucleic acid fragment. As a method for immobilizing PNA to a solid phase substrate by covalent bonding, a method using a combination of avidin and biotin is also known (Japanese Patent Application Laid-Open No. 11-1999).
332595). This publication also describes a technique of utilizing a surface plasmon resonance (SPR) biosensor as a solid substrate. Using a DNA chip on which a probe molecule is immobilized on a surface plasmon resonance biosensor, a DNA fragment immobilized on the surface via hybridization can be detected using the surface plasmon resonance phenomenon.

It is also known to use a charge-coupled device (CCD) as a substrate for a DNA chip (Nuclei
c Acids Research, 1994, Vol.22, No.11, 2124-212
Five).

Japanese Patent Application Laid-Open No. Hei 4-228076 (corresponding to US Pat. No. 5,387,505) discloses that a target DNA having a biotin molecule attached thereto is bound to a substrate having an avidin molecule immobilized on the surface to separate the target DNA. The technology to do this is described.

Japanese Patent Publication No. 7-43380 (corresponding to US Pat. No. 5,094,962) discloses a detection tool for use in a ligand-receptor assay, which comprises microporous polymer particles having a reactive group on the surface. An analytical device having a receptor molecule bound to a surface is described.

[0014]

DISCLOSURE OF THE INVENTION The present invention is particularly advantageous for use in rapidly and stably binding and fixing previously prepared nucleic acid fragments such as oligonucleotides, polynucleotides and peptide nucleic acids to the surface of a solid support. To provide a tool for detecting DNA, RNA, or a fragment thereof having a specific base sequence portion, in which a nucleic acid fragment is bound and fixed to the reactive solid phase carrier. , The subject.

[0015]

SUMMARY OF THE INVENTION The present invention relates to a reactive solid phase comprising a group of acryloyl groups or reactive precursor groups thereof fixedly and covalently bonded to the surface of a solid support via a linking group. On the carrier. It is desirable that the conjugate of the acryloyl group or its reactive precursor group with the linking group is represented by the following formula (1).

[0016]

## STR4 ## -L-CO-X --- (1)

[In the above formula, X is -CR ¹ = C
Represents R ² R ³ or ^{-CHR 1 -CR 2 R 3 Y;} R 1, R
² and R ³ each independently represent a hydrogen atom or a carbon atom number of 1
An atom or group selected from the group consisting of an alkyl group having 6 to 6 carbon atoms, an aryl group having 6 to 20 carbon atoms, and an aralkyl group having 7 to 26 carbon atoms having an alkyl chain having 1 to 6 carbon atoms. the expressed; Y is a halogen _{^{atom, -OSO 2 R 11, -OCOR 12}} , -OSO 3 represents M, and the atom or group selected from the group consisting of quaternary pyridinium group; R ¹¹ is the number of carbon atoms 1 Represents an alkyl group having 1 to 6 carbon atoms, an aryl group having 6 to 20 carbon atoms, and an aralkyl group having 7 to 26 carbon atoms having an alkyl chain having 1 to 6 carbon atoms. R ¹² represents a group selected from the group consisting of an alkyl group having 1 to 6 carbon atoms and a halogenated alkyl group having 1 to 6 carbon atoms; M represents a hydrogen atom,
Represents an atom or group selected from the group consisting of an alkali metal atom and an ammonium group; and L represents a linking group].

In the above formula (1), X represents -CH =
Desirably, it is a vinyl group represented by CH ₂ .

L is preferably a linking group containing a divalent or higher valent atom other than a carbon atom. L is -NH
A linking group having a linking site such as-, -S-, or -O- is desirable. An example of L is-
(L ¹ ) _n -NH- (CR ¹ R ² ) _2- or-(L ¹ ) _n-
S- (CR ¹ R ² ) _2- wherein R ¹ and R ² have the same meanings as described above, L ¹ represents a linking group, and n is 0 or 1. be able to. In particular, it is preferable that L is a connecting group represented by-(L ¹ ) _n -NHCH ₂ CH _2- [where L ¹ represents a connecting group and n is 0 or 1]. Desirably, L ¹ is a linking group containing a group represented by —OSi—.

The reactive solid support of the present invention is prepared by adding the following formula (2) to a solid support having a reactive group introduced on its surface.

[0021]

Embedded image X ¹ -CO-L ² -CO-X ^2- (2)

[In the above formula, X ¹ and X ² are independently of each other -CR ¹ = CR ² R ³ or -CHR ¹ -CR
^{2 represents} R ³ Y (reactive precursor group); R ¹ , R ² and R ³
Are each independently a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, an aryl group having 6 to 20 carbon atoms, and a total of 7 carbon atoms having an alkyl chain having 1 to 6 carbon atoms. Y represents a halogen atom,-represents an atom or a group selected from the group consisting of
R ¹¹ represents an atom or group selected from the group consisting of OSO ₂ R ¹¹ , —OCOR ¹² , —OSO ₃ M, and a quaternary pyridinium group; R ¹¹ represents an alkyl group having 1 to 6 carbon atoms;
R ¹² represents a group selected from the group consisting of an aryl group having 6 to 20 carbon atoms and an aralkyl group having 7 to 26 carbon atoms having an alkyl chain having 1 to 6 carbon atoms; M represents a group selected from the group consisting of an alkyl group having 1 to 6 atoms and a halogenated alkyl group having 1 to 6 carbon atoms; M is selected from the group consisting of a hydrogen atom, an alkali metal atom and an ammonium group And L ² represents a linking group], and can be easily produced by contacting a diacryloyl compound represented by the formula:

The reactive group introduced on the surface of the solid support is preferably an amino group, a mercapto group or a hydroxyl group.

According to the present invention, a group of acryloyl groups or their reactive precursor groups are each covalently immobilized on the surface of a reactive solid-phase carrier to form a covalent bond with the reactive group. There is also a method for producing a solid phase carrier in which a nucleic acid fragment is fixed to the surface of a carrier via a linking group having a carbonyl group, which comprises contacting a nucleic acid fragment having a reactive group.

Representative examples of the nucleic acid fragment immobilized on the solid support include oligonucleotides, polynucleotides, and peptide nucleic acids. These nucleic acid fragments include a vinylcarbonyl group such as an amino group, an imino group, a hydrazino group, a carbamoyl group, a hydrazinocarbonyl group, or a carboxyimide group or a reaction thereof at or near one end of the molecule. Those having a reactive group that forms a covalent bond that reacts with the reactive precursor group are used.

The solid support to which the nucleic acid fragment is immobilized is
In the presence of an aqueous medium, a DNA fragment (DNA or its fragment, RN
A or a fragment thereof) to cause hybridization, whereby the complementary DNA fragment can be immobilized. The complementary DNA fragment to be immobilized, so that the immobilization can be detected from the outside,
Preferably, a detectable label (eg, a fluorescent label) is attached.

[0027]

BEST MODE FOR CARRYING OUT THE INVENTION The reactive solid support of the present invention has a structure in which a group of acryloyl groups or reactive precursor groups thereof are covalently bonded and fixed to the surface of a solid support via respective linking groups. have. The reactive solid support of the present invention prepares a solid support in which a reactive group is previously introduced on the surface, and reacts with the solid support and the reactive group provided on the support surface to form a covalent bond. Having a reactive group at one end or near the end and a compound having an acryloyl group or a reactive precursor group of an acryloyl group at the other end or near the end. Can be.

The solid support is preferably a substrate having a particularly smooth surface with low hydrophobicity or low hydrophilicity. In addition, a substrate having a surface with unevenness and low flatness can be used. Examples of the material of the solid support include glass, cement, ceramics such as ceramics or new ceramics, polyethylene terephthalate, cellulose acetate,
Bisphenol A polycarbonate, polystyrene,
Polymers such as polymethyl methacrylate, silicon, activated carbon, porous glass, porous ceramics, porous silicon, porous activated carbon, woven / knitted fabric, non-woven fabric, filter paper, short fiber,
Examples include various porous substances such as a membrane filter. The pore size of the porous material is 2 to 1
2,000 nm, preferably from 2 to 500 nm.
It is particularly preferred that it is in the range of nm. The material of the solid support is particularly preferably glass or silicon. This is due to the ease of surface treatment and the ease of analysis by electrochemical methods. The thickness of the solid support is 1
It is preferably in the range of 00 to 2000 μm.

As the solid phase carrier used for producing the reactive solid phase carrier of the present invention, various solid phase carriers conventionally used for producing a DNA chip or proposed for producing a DNA chip can be used. It can be preferably used. Examples of such solid supports include glass substrates,
Examples include a resin substrate, a glass substrate or a resin substrate surface-treated with a silane coupling agent, or a glass substrate or a resin substrate having a coating layer on the surface. As the solid support, in particular, a silicate glass substrate, a silicate glass substrate surface-treated with a silane coupling agent,
Alternatively, it is preferably a silicate glass substrate covered with an organic coating layer. Further, an electrode substrate used as a substrate of a DNA chip used in an electrochemical analysis method may be used. In addition, the surface plasmon resonance (SP
R) Various functional substrates such as a biosensor substrate and a charge-coupled device (CCD) may be used. Further, in addition to these substrates, a particulate solid support or the like can also be used.

On the surface of the solid support, a polycationic compound (for example, poly-L-) is used for covalently bonding and fixing a polyfunctional reactive compound such as a diacryloyl compound.
Coating treatment with a polymer having an amino group in the side chain such as lysine, polyethyleneimine, polyalkylamine and the like, and more preferably poly-L-lysine (in this case, introduction onto the surface of the solid support) The reactive group performed is an amino group).
Alternatively, the surface of the solid support can be contact-treated with a surface treating agent having a reactive group such as a silane coupling agent that reacts with the surface of the solid support and another reactive group such as an amino group.

When the surface of the solid support is coated with a polycation compound, an amino group or a mercapto group is introduced into the surface of the solid support by electrostatic bonding between the polymer compound and the surface of the solid support. In the case of the surface treatment using a silane coupling agent, the amino group or the mercapto group is stably present on the surface of the solid support because the surface is fixed by covalent bonding to the surface of the solid support. Besides an amino group and a mercapto group, an aldehyde group, an epoxy group, a carboxyl group, or a hydroxyl group can be preferably introduced.

As the silane coupling agent having an amino group, γ-aminopropyltriethoxysilane, N-
It is preferable to use β (aminoethyl) -γ-aminopropyltrimethoxysilane or N-β (aminoethyl) -γ-aminopropylmethyldimethoxysilane, and it is particularly preferable to use γ-aminopropyltriethoxysilane.

The treatment using a polycation compound may be combined with the treatment using a silane coupling agent. According to this method, electrostatic interaction between the solid phase carrier having low hydrophobicity or low hydrophilicity and the nucleic acid fragment can be promoted. A layer made of a charged hydrophilic polymer or the like or a layer made of a cross-linking agent may be further provided on the surface of the solid support treated with the polycation compound. By providing such a layer, the unevenness of the solid support that has been treated with the polycationic compound can be reduced. Depending on the type of the solid phase carrier, a hydrophilic polymer or the like can be contained in the carrier, and a solid phase carrier that has been subjected to such treatment can be preferably used.

On the surface of a solid support for a normal DNA chip, a large number of regions are set in advance or are assumed, and a polyfunctional reaction such as a diacryloyl compound is performed for each region as described above. A reactive group capable of reacting with the reactive compound is introduced in advance. The surface of each region of the solid phase carrier to be used is provided with a reactive group such as the above amino group, mercapto group, or hydroxyl group, but the solid phase carrier having no such reactive group is used. As described above, the surface treatment with a silane coupling agent, or the method of applying a polymer having a reactive group such as an amino group in the side chain on the surface of the solid support using a method of coating the reactive group. Introduction is performed.

When a solid support having a reactive group contacts a polyfunctional reactive compound such as a diacryloyl compound, the reactive group reacts with the polyfunctional reactive compound to form a covalent bond. The reactive group portion of the solid support is extended to form a reactive chain having an acryloyl group or its reactive precursor group at or near the tip thereof, thereby forming the reactive solid support of the present invention. I do.

In the reactive solid phase carrier of the present invention, the conjugate of the acryloyl group or its reactive precursor group and the linking group introduced on the surface of the solid phase carrier is represented by the following formula (1). Desirably.

[0037]

-L-CO-X-(1)

In the above formula (1), X is -CR ¹
ＣＲCR ² R ³ or —CHR ¹ —CR ² R ³ Y (reactive precursor group). R ¹ , R ² and R ³ each independently represent a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, an aryl group having 6 to 20 carbon atoms, or an alkyl group having 1 to 6 carbon atoms. Represents an aralkyl group having 7 to 26 carbon atoms having a chain. Examples of the alkyl group having 1 to 6 carbon atoms include a methyl group, an ethyl group, an n-propyl group, an n-butyl group, and an n-hexyl group, and a methyl group is particularly preferable. . Examples of the aryl group include a phenyl group and a naphthyl group. Preferably, R ¹ , R ² and R ³ are all hydrogen atoms.

Y is -OH, -OR ⁰ , -SH, NH ₃ ,
NH ₂ R ⁰ (where R ⁰ is a group such as an alkyl group, excluding a hydrogen atom); or a group which is eliminated as “HY” by a base; Examples include a halogen atom, -OSO ₂ R
¹¹ , -OCOR ¹² , -OSO ₃ M, or a quaternary pyridinium group (R ¹¹ is an alkyl group having 1 to 6 carbon atoms, an aryl group having 6 to 20 carbon atoms, or a carbon atom having 6 to 20 carbon atoms. R 7 represents an aralkyl group having 7 to 26 carbon atoms having 1 to 6 alkyl chains;
¹² represents an alkyl group having 1 to 6 carbon atoms or a halogenated alkyl group having 1 to 6 carbon atoms;
Represents a hydrogen atom, an alkali metal atom or an ammonium group).

L represents a solid support or a divalent or higher linking group linking the -CO-X group with the linking group bonded to the solid support. However, L may be a single bond. Examples of the divalent linking group include an alkylene group having 1 to 6 carbon atoms and 3 to 16 carbon atoms.
An aliphatic ring group having 6 to 20 carbon atoms, an arylene group having 6 to 20 carbon atoms, a heterocyclic group having 2 to 20 carbon atoms containing 1 to 3 heteroatoms selected from the group consisting of N, S and P,
-O -, - S -, - SO -, - SO 2 -, - SO 3 -, -
NR ¹¹ -, - CO- and is preferably a combination of these is a group formed by combining one or a plurality of groups selected from the group. R ¹¹ is a hydrogen atom, an alkyl group having 1 to 15 carbon atoms, an aryl group having 6 to 20 carbon atoms, or an alkyl group having 1 to 6 carbon atoms and having 7 to 21 carbon atoms. It is preferably an aralkyl group, more preferably a hydrogen atom or an alkyl group having 1 to 6 carbon atoms, and particularly preferably a hydrogen atom, a methyl group or an ethyl group.

[0041] L is ^{-NR 11 -, - SONR 11 -} , - CO
NR ¹¹ —, —NR ¹¹ COO—, and —NR ¹¹ CONR
¹¹ - If it is two or more combinations comprising group a more groups selected the group consisting of may be bonded to their R ¹¹ together to form a ring.

The alkyl group of R ^11, aralkyl group having an aryl group, and R ¹¹ of R ¹¹ may have a substituent. Examples of such a substituent include a hydroxyl group, an alkoxy group having 1 to 6 carbon atoms, an alkenyl group having 1 to 6 carbon atoms, a carbamoyl group having 2 to 7 carbon atoms, and a carbamoyl group having 1 to 6 carbon atoms. Alkyl group, aralkyl group having 2 to 7 carbon atoms, aryl group having 6 to 20 carbon atoms, sulfamoyl group (or its Na salt, K salt, etc.), sulfo group (or its Na salt, K salt, etc.) ), A carboxylic acid group (or a Na salt or a K salt thereof), a halogen atom, an alkenylene group having 1 to 6 carbon atoms, an arylene group having 6 to 20 carbon atoms, a sulfonyl group, and a combination thereof. Examples include atoms or groups selected from the group.

Preferred specific examples of the "-X" group are shown below. Examples of groups that can be used as "-L-CO-X" are also shown later.

[0044]

Embedded image

[0045]

Embedded image

"-X" represents (X1),
(X2), (X3), (X4), (X7), (X8),
(X13) or (X14),
More preferably, it is (X1) or (X2). Particularly preferred is a vinyl group represented by (X1).

Preferred specific examples of L are shown below. However,
a is an integer of 1 to 6, preferably 1 or 2, and particularly preferably 1. b is an integer of 0 to 6, and is preferably 2 or 3.

[0048]

Embedded image

As L, in addition to the above-described divalent linking group, the hydrogen atom of the alkylene group of the above formula is represented by -SO ₂ CH =
A group substituted by a CH ₂ group is also preferred.

The polyfunctional reactive compound used for obtaining the solid support to which the acryloyl group or the reactive precursor group represented by the above formula (1) is immobilized by covalent bond includes the following formula (2) The diacryloyl compound represented by the formula (1) can be advantageously used.

[0051]

Embedded image X ¹ -CO-L ² -CO-X ^2- (2)

[In the above formula, X ¹ and X ² are independently of each other -CR ¹ = CR ² R ³ or -CHR ¹ -CR
^{2 represents} R ³ Y (reactive precursor group); R ¹ , R ² and R ³
Are each independently a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, an aryl group having 6 to 20 carbon atoms, and a total of 7 carbon atoms having an alkyl chain having 1 to 6 carbon atoms. Y represents a halogen atom,-represents an atom or a group selected from the group consisting of
R ¹¹ represents an atom or group selected from the group consisting of OSO ₂ R ¹¹ , —OCOR ¹² , —OSO ₃ M, and a quaternary pyridinium group; R ¹¹ represents an alkyl group having 1 to 6 carbon atoms;
R ¹² represents a group selected from the group consisting of an aryl group having 6 to 20 carbon atoms and an aralkyl group having 7 to 26 carbon atoms having an alkyl chain having 1 to 6 carbon atoms; M represents a group selected from the group consisting of an alkyl group having 1 to 6 atoms and a halogenated alkyl group having 1 to 6 carbon atoms; M is selected from the group consisting of a hydrogen atom, an alkali metal atom and an ammonium group And L ² represents a linking group].

That is, the reactive solid support of the present invention can be easily produced by bringing the diacryloyl compound represented by the above formula (2) into contact with the solid support, for example, in an aqueous atmosphere. be able to.

Representative examples of the diacryloyl compound and the triacryloyl compound preferably used in the present invention are shown below. Incidentally, these polyfunctional acryloyl compounds,
Two or more kinds may be used as a mixture.

[0055]

Embedded image

Among these polyfunctional acryloyl compounds, 1,2-bis (acryloylamino) methane and 1,2-bis (acryloylamino) ethane represented by the following formulas are preferable.

[0057]

Embedded image

The method for synthesizing the diacryloyl compound or triacryloyl compound used in the present invention is described below.
For example, G. Lutzel: Angew. Che
m. 77, pages 308-313 (1965) and the methods described in the cited references.

Using the reactive solid support obtained as described above, DNA, RNA, DNA fragment or R
A detection tool (generally D-type) for detecting and fixing a polynucleotide or oligonucleotide of natural origin such as NA fragment
In order to manufacture a so-called NA chip),
A method in which the reactive solid phase carrier is contacted with a nucleic acid fragment having a reactive group such as an amino group that forms a covalent bond by reacting with an acryloyl group or a reactive precursor group on the surface of the carrier is used. Is done. That is, a detection tool (so-called DNA chip) provided with a probe molecule composed of a desired nucleic acid fragment can be prepared in this manner.

The acryloyl group or its reactive precursor group bonded to the surface of the solid phase substrate through a covalent bond according to the present invention has high resistance to hydrolysis, so that it can be easily and stably stored. In addition, it is possible to form a stable covalent bond by preliminarily providing an amino group, or by introducing a reactive group such as an amino group or reacting quickly with a reactive group of a nucleic acid fragment. it can.

Representative examples of nucleic acid fragments used as probe molecules include oligonucleotides, polynucleotides,
And a peptide nucleic acid can be mentioned. These nucleic acid fragments are of natural origin (DNA, DNA fragments, RN
A or an RNA fragment) or a synthetic compound. The nucleic acid fragment includes a compound called LNA having a cross-linking group in its sugar unit (described in J. Am. Chem. Soc. 1998, 120, 13252-13253).
And various related compounds.

When a DNA fragment is used as a probe molecule, it can be divided into two types depending on the purpose. In order to examine gene expression, it is preferable to use a polynucleotide such as cDNA, a part of cDNA, or EST. The function of these polynucleotides may be unknown, but in general, PCR is performed using a cDNA library, a genomic library, or a whole genome as a template based on sequences registered in a database.
It is prepared by amplification according to the method (hereinafter referred to as “PCR product”). Those not amplified by the PCR method can also be preferably used. In addition, in order to examine gene mutations and polymorphisms, it is preferable to synthesize various oligonucleotides corresponding to the mutations and polymorphisms based on a known sequence as a standard, and use them. Furthermore, when the purpose is to analyze a base sequence, it is preferable to synthesize 4 ⁿ (n is the length of bases) kinds of oligonucleotides and use them. The base sequence of the DNA fragment is preferably determined in advance by a general base sequence determination method. The DNA fragment is preferably a 2- to 50-mer, and particularly preferably a 10- to 25-mer.

At one end of a nucleic acid fragment such as an oligonucleotide or a DNA fragment, a reactive group which forms a covalent bond by reacting with the acryloyl group or a reactive precursor group thereof is introduced. Such a reactive group is preferably an amino group, an imino group, a hydrazino group, a carbamoyl group, a hydrazinocarbonyl group, or a carboximide group, and particularly preferably an amino group. These reactive groups are usually bound to an oligonucleotide or a DNA fragment via a crosslinker. As the crosslinker, for example, an alkylene group or an N-alkylamino-alkylene group is used,
It is preferably a hexylene group or an N-methylamino-hexylene group, particularly preferably a hexylene group. In addition, since the peptide nucleic acid (PNA) has an amino group, it is usually unnecessary to separately introduce a reactive group.

The contact between the nucleic acid fragment having a reactive group and the reactive solid support is usually carried out by spotting an aqueous solution of the nucleic acid fragment on the surface of the reactive solid support. Specifically, after dissolving or dispersing a nucleic acid fragment having a reactive group in an aqueous medium to form an aqueous liquid, the aqueous liquid is dispensed into a 96-well or 384-well plastic plate, and the dispensed aqueous liquid is dispensed. Is preferably dropped on the surface of the solid support using a spotter or the like.

In order to prevent drying of the nucleic acid fragments after spotting, a substance having a high boiling point may be added to the aqueous liquid in which the nucleic acid fragments are dissolved or dispersed. The substance having a high boiling point is a substance which can be dissolved in an aqueous liquid in which a nucleic acid fragment after spotting is dissolved or dispersed, and is used for hybridization with a sample such as a DNA fragment sample (target DNA fragment) to be detected. It is preferable that the material is not hindered and the viscosity is not so large. Such materials can include glycerin, ethylene glycol, dimethyl sulfoxide and low molecular weight hydrophilic polymers. Examples of the hydrophilic polymer include polyacrylamide, polyethylene glycol, and sodium polyacrylate. The molecular weight of these polymers is
It is preferably in the range of 10 ^{3 to} 10 ⁶ . As the substance having a high boiling point, glycerin or ethylene glycol is more preferably used, and glycerin is particularly preferably used. The concentration of the substance having a high boiling point is preferably in the range of 0.1 to 2% by volume, particularly preferably in the range of 0.5 to 1% by volume, in the aqueous liquid of the nucleic acid fragment.

For the same purpose, it is also preferable to place the solid phase carrier after spotting the nucleic acid fragments in an environment having a humidity of 90% or more and a temperature range of 25 to 50 ° C.

After spotting the nucleic acid fragment having a reactive group, post-treatment with ultraviolet light, sodium borohydride or a Schiff reagent may be performed. These post-treatments may be performed in combination of a plurality of types, and particularly preferably performed in combination of the heat treatment and the ultraviolet treatment. These post-treatments are particularly effective when the surface of the solid support is treated only with the polycationic compound. After spotting, it is also preferable to carry out incubation. After incubation,
It is preferable to wash and remove unreacted nucleic acid fragments.

The fixed amount (number) of nucleic acid fragments is preferably in the range of 10 ^{2 to} 10 ⁵ types / cm ² with respect to the surface of the solid support. The amount of the nucleic acid fragment is in the range of 1 to 10 ^-15 mol, and the weight is preferably several ng or less. By spotting, the aqueous liquid of the nucleic acid fragment is fixed in the form of dots on the surface of the solid support. The shape of the dot is almost circular. The absence of variation in shape is important for quantitative analysis of gene expression and analysis of single nucleotide mutation. The distance between each dot is preferably in the range of 0 to 1.5 mm, particularly preferably in the range of 100 to 300 μm. The size of one dot is preferably in the range of 50 to 300 μm in diameter. The amount of nucleic acid fragments spotted on the solid support surface is 100
It is preferably in the range of pL to 1 μL,
It is particularly preferred to be in the range of 00 nL.

FIG. 1 schematically shows a method for producing an oligonucleotide-immobilized solid phase carrier, which is a typical embodiment of the present invention, and a configuration of a typical oligonucleotide-immobilized solid phase carrier. When a diacryloyl compound represented by the above formula (2) is used as a method for producing a solid-phase carrier on which the oligonucleotide of the present invention is immobilized, four types of production methods can be used depending on X ¹ and X ² . .

FIG. 1 shows an immobilized oligonucleotide when X ¹ and X ² of the diacryloyl compound of the formula (2) are both —CHR ¹ —CR ² R ³ Y (reactive precursor group). (A) for producing the solid support (C1), wherein X ¹ is —CHR ¹ —CR ² R ³ Y, and X ² is —CR ¹ ＣＲCR ²
When the oligonucleotide is R ³ , the oligonucleotide-immobilized solid support (C
The manufacturing method (b) of 2) is shown. However, the X ^1, assuming solid and phase reactive group introduced to the surface of the support 1 (R) the first reaction to group, in the manufacturing method of the X ¹ and -CR ¹ = CR ² R ³ There may be. Hereinafter, “X ¹ ” will be referred to as solid-phase carrier 1
The description will be made assuming that the group reacts first with the reactive group (R) introduced on the surface of.

The manufacturing methods (a) and (b) will be described. Step (1): A diacryloyl compound represented by the formula (1) is brought into contact with a solid support 1 [solid support (A)] having a reactive group (R) introduced on the surface of the support, and -Y of X1 is contacted. By substituting a reactive group (R) on the moiety,-(CR ¹
R ² ) _n -CO-L-CO-X ² groups are introduced on the surface of the solid support.

Step (2): introduced in step (1)
Oligonucleotide 2 having a reactive group (Z) at one end at X ² of (CR ¹ R ² ) _n -CO-L-CO-X ² group
It is added to the reactive group (Z) by contacting, or to replace the reactive group (Z) by contacting the oligonucleotide 2 -Y of the X ^2.

The carrier for immobilizing a probe molecule of the present invention comprises X ¹
Is a group that first reacts with the reactive group (R) introduced on the surface of the solid support 1, and X ¹ is represented by -CR ¹ = CR ²
It is one that is produced by the following method to R ³ may be.

[0074] Step (1): to a solid support one surface active groups solid support (R) has been introduced (A), contacting the Jiakuriroiru compound represented by the formula (I), the X ¹ −CR ¹ =
By adding a reactive group (R) to CR ² R ³ , a —R ³ R ² C—R ¹ HC—CO—L—CO—X ² group is introduced onto the surface of the solid support.

[0075] Step (2): Step (1) -R ³ introduced in ^{R 2 C-R 1 HC-} CO-L-CO-X 2 group of X ²
To, either by adding a reactive group (Z) by contacting an oligonucleotide having a reactive group (Z) at one end, or -Y portion of said X _2, contacting said oligonucleotide Replaces this reactive group (Z).

The oligonucleotide having a reactive group (Z) at one end is a compound indicated by 2 in FIG. The crosslinker (Q) is not essential, but is generally present between the reactive group (Z) and the phosphate group for the purpose of preparing the reactive oligonucleotide 2. -Phosphate group-NNNN ... N
N represents an oligonucleotide. R ₄ is a group determined by a reaction between the reactive group (R) and X ^1, and Z ¹ is a group determined by a reaction between X ² and the reactive group (Z).

When the oligonucleotide fragment 2 having a reactive group (Z) is spotted on the surface of the solid support (B) in FIG. 1, X ² or —Y of X ² and the reactive oligonucleotide fragment 2 Occurs, but unreacted X ² to which the oligonucleotide 2 is not bound also exists on the surface of the solid support (B). Such X ² are likely to cause non-specific reaction in the hybridization with a labeled DNA fragment sample is performed after, since there is a fear that by measuring the non-specific binding, pre said It is preferable that X ₂ (that is, for example, the halogen atom of X ² ) is masked. The mask treatment is performed on a solid phase carrier (C1).
It is preferable to carry out the process by bringing an anionic compound having an amino group or a mercapto group into contact with the surface of (or (C2)). The oligonucleotide 2 is
Since it has a negative charge, it is possible to prevent the oligonucleotide 2 from reacting with unreacted X ² by generating a negative charge on the surface of the solid support (C). Such anionic compounds include those which react with a halogen atom of X ² and have a negative charge (COO ⁻ , SO ₃ ⁻ , OSO ₃ ⁻ ,
Any substance having PO ₃ ⁻ or PO ₂ ⁻ ) can be used, but is preferably an amino acid, and particularly preferably glycine or cysteine. Taurine can also be preferably used.

The solid-phase carrier on which the nucleic acid fragment is immobilized according to the present invention is used for monitoring gene expression, determining the base sequence, analyzing mutations, analyzing polymorphism, and the like. The principle of detection is hybridization with a labeled sample nucleic acid fragment described below.

As a labeling method, an RI method and a non-RI method (fluorescence method, biotin method, chemiluminescence method, etc.) are known, but in the present invention, it is preferable to use a fluorescence method. As the fluorescent substance used for the fluorescent labeling, any substance can be used as long as it can bind to the base portion of the nucleic acid. Cyanine dyes (for example, Cy3 and Cy5 of the commercially available Cy Dye ^™ series), rhodamine 6G A reagent, N-acetoxy-N ² -acetylaminofluorene (AAF) or AAIF (iodine derivative of AAF) can be used.

As the target DNA fragment, usually, a DNA fragment sample such as a DNA fragment sample or an RNA fragment sample whose sequence or function is unknown is used.

The DNA fragment sample is preferably isolated from eukaryotic cell or tissue samples for the purpose of examining gene expression. If the sample is a genome, it is preferably isolated from any tissue sample except red blood cells. Preferably, any tissue other than red blood cells is peripheral blood lymphocytes, skin, hair, semen and the like. If the sample is mRNA, m
Preferably, it is extracted from a tissue sample in which the RNA is expressed. mRNA is labeled dNTP by reverse transcription reaction.
("DNTP" means a deoxyribonucleotide whose base is adenine (A), cytosine (C), guanine (G), or thymine (T)). As dNTP, it is preferable to use dCTP for chemical stability. MRN required for one hybridization
The amount of A varies depending on the amount of liquid to be spotted and the labeling method, but is several μg or less. Note that DN on the nucleic acid fragment-immobilized solid phase carrier was
When the A fragment is an oligo DNA, it is desirable that the DNA fragment sample be reduced in molecular weight. In prokaryotic cells, it is difficult to selectively extract mRNA, so it is preferable to label total RNA.

For the purpose of examining gene mutation or polymorphism, a DNA fragment sample is labeled with a labeled primer or labeled dNTP.
Is preferably obtained by performing PCR of the target region in a reaction system containing

In the hybridization, an aqueous solution prepared by dissolving or dispersing a labeled DNA fragment sample, which has been dispensed into a 96- or 384-well plastic plate, is placed on a nucleic acid fragment-immobilized solid phase carrier of the present invention. It is preferred to carry out by wearing. The amount of spotting is 1 to 1
It is preferably in the range of 00 nL. Hybridization is preferably carried out in a temperature range from room temperature to 70 ° C. and for a time in the range from 6 to 20 hours. After the completion of the hybridization, it is preferable to wash with a mixed solution of a surfactant and a buffer to remove unreacted DNA fragment samples. It is preferable to use sodium dodecyl sulfate (SDS) as the surfactant. As a buffer, a citrate buffer, a phosphate buffer, a borate buffer, a Tris buffer, a Good buffer, and the like can be used, but a citrate buffer is particularly preferable.

A feature of the hybridization using the nucleic acid fragment-immobilized solid phase carrier is that the amount of the target labeled DNA fragment sample can be extremely reduced. Therefore, it is necessary to set optimal hybridization conditions depending on the chain length of the nucleic acid fragment immobilized on the solid phase carrier and the type of the labeled DNA fragment sample. For gene expression analysis, it is preferable to perform hybridization for a long time so that low-expressed genes can be sufficiently detected. For detection of a single nucleotide mutation, it is preferable to perform hybridization for a short time. Another feature is that two types of DNA fragment samples labeled with different fluorescent substances are prepared and simultaneously used for hybridization, whereby the expression level can be compared and quantified on the same DNA fragment-immobilized solid phase carrier.

[0085]

EXAMPLES Example 1 Preparation of Oligonucleotide-Immobilized Slide and Measurement of Immobilized Amount of Oligonucleotide The method for immobilizing an oligonucleotide of the present invention is represented by the reaction path of an oligonucleotide, and the reaction path is illustrated. It is shown in FIG. In the figure, 1 represents a slide glass.

(1) Preparation of solid support (B) into which acryloyl group was introduced A glass slide (25%) was added to an ethanol solution of 2% by weight aminopropylethoxysilane (manufactured by Shin-Etsu Chemical Co., Ltd.).
mm × 75 mm) for 10 minutes, taken out, washed with ethanol, and dried at 110 ° C. for 10 minutes to prepare a silane compound-coated slide (A). Next, this silane compound-coated slide (A) was added in an amount of 5% by weight.
After being immersed in a phosphate buffer solution (pH 8.5) solution of 1,2-bis (acryloylamino) ethane for 1 hour, taken out, washed with acetonitrile, dried for 1 hour under reduced pressure, and solidified with an acryloyl group introduced on the surface. A phase carrier (B) was obtained.

(2) Spotting of Oligonucleotide and Measurement of Fluorescence Intensity The 3 ′ end and the 5 ′ end were modified with an amino group and a fluorescent labeling reagent (FluoroLink Cy5-dCTP, manufactured by Amersham Pharmacia Biotech), respectively. Oligonucleotide (3'-CTAGTCTGGTGA
AGTGTCTGATC-5 ') aqueous solution dispersed in the 0.1M carbonate buffer ^{(pH9.3) (1 × 10 -6} M, 1μ
L) was spotted on the slide (B) obtained in the above (1).
Immediately, the solid support after spotting is heated at 25 ° C. and 90% humidity for 1 hour.
After standing for a period of time, this solid support was
(Sodium dodecyl sulfate) and 2 × SSC (2 × SS
C: A solution obtained by diluting a stock solution of SSC two-fold, a mixed solution of SSC: standard salt and citrate buffer) twice, 0.2 ×
It was sequentially washed once with an aqueous SSC solution. Next, the washed slide was immersed in a 0.1 M glycine aqueous solution (pH 10) for 1 hour and 30 minutes, washed with distilled water, dried at room temperature, and solid phase carrier (C) on which DNA fragments were immobilized. ) Got. When the fluorescence intensity on the surface of the solid support (C) was measured with a fluorescence scanning device, it was confirmed that the fluorescence intensity was clearly increased from the background fluorescence intensity. Therefore, it can be seen that the oligonucleotide was efficiently fixed to the slide glass by the immobilization method of the present invention.

Example 2 Detection of Complementary Target Oligonucleotide Sample (1) Preparation of Oligonucleotide-Immobilized Solid-Phase Support 40-mer oligonucleotide whose 3 ′ end is modified with an amino group (3′-TCCTCCATGTCCGGGG
AGGATCTGACACTTCAAGGTCTAG-
An aqueous liquid (1 × 10 ⁻⁶ M, 1 μL) obtained by dispersing 5 ′) in a 0.1 M carbonate buffer (pH 9.3) was added to the solid support (B) obtained in (1) of Example. I spotted. Immediately after the solid support after spotting was left at 25 ° C. and 90% humidity for 1 hour, the solid support was combined with 0.1% by weight of SDS (sodium dodecyl sulfate) and 2 × SSC (2 × SSC: SSC). Solution twice diluted with SSC: standard salt-citrate buffer) twice and 1 times with 0.2 × SSC aqueous solution.
Washing was performed one by one. Next, the washed slide was immersed in a 0.1 M glycine aqueous solution (pH 10) for 1 hour and 30 minutes, washed with distilled water, dried at room temperature, and solid-phase carrier (C) having oligonucleotides fixed thereon. ') Got.

(2) Detection of Complementary Target Oligonucleotide Sample A 22-mer target oligonucleotide sample (CTAGTCTGGTGA) with Cy5 (fluorescent label) bound to the 5 ′ end
AGTTCCAGATC-5 ′) dispersed in a hybridization solution (a mixed solution of 4 × SSC and 10% by weight of SDS, 20 μL) was spotted on the solid support (C ′) obtained in the above (1). After protecting the surface with a microscope cover glass,
Incubated at 0 ° C. for 20 hours. Next, this was mixed with 0.1% by weight of SDS and 2 × SSC, and mixed with 0.1% by weight.
After sequentially washing with a mixed solution of 1% by weight SDS and 0.2 × SSC and a 0.2 × SSC aqueous solution, 600 rpm
For 20 seconds and dried at room temperature. When the fluorescence intensity on the surface of the slide glass was measured with a fluorescence scanning device, it was confirmed that the fluorescence intensity clearly increased from the background fluorescence intensity. Therefore, by using the oligonucleotide-immobilized solid phase carrier produced by the immobilization method of the present invention, a target oligo such as a target DNA fragment sample having complementarity with the oligonucleotide immobilized on the oligonucleotide-immobilized solid phase carrier is obtained. It turns out that a nucleotide sample can be detected efficiently.

Example 3 Detection of Complementary Target Oligonucleotide Sample (1) Preparation of Oligonucleotide-Immobilized Solid Phase Carrier The procedure of Example 1 was repeated except that an oligonucleotide whose 3 ′ end was not modified with a fluorescent labeling reagent was used. Similarly, a solid phase carrier (C1 ′) to which the oligonucleotide was immobilized was obtained. (2) Detection of Complementary Target Oligonucleotide Sample A 22-mer oligonucleotide sample (CTAGTCCTGTGAAGTTCCAG) with Cy5 bound to the 5 ′ end
ATC-5 ') with a hybridization solution (4 ×
A mixed solution of SSC and 10% by weight of SDS) (20 μl)
L) was dispersed on the solid support (C1 ′) obtained in (1) above, and the surface was protected with a microscope cover glass.
Incubated for hours. Next, this was mixed with a mixed solution of 0.1% by weight of SDS and 2 × SSC,
A mixed solution of DS and 0.2 × SSC, and 0.2 × S
After sequentially washing with an SC aqueous solution, the mixture was centrifuged at 600 rpm for 20 seconds and dried at room temperature. When the fluorescence intensity on the surface of the slide glass was measured with a fluorescence scanning device, it was confirmed that the fluorescence intensity was clearly increased from the background fluorescence intensity. Therefore, by using the oligonucleotide-immobilized solid phase carrier produced by the immobilization method of the present invention,
It can be seen that a target oligonucleotide sample such as a target DNA fragment sample having complementarity with the oligonucleotide immobilized on the solid support can be efficiently detected.

Example 4 Preparation of Oligonucleotide-Immobilized Solid-Phase Support and Measurement of Amount of Oligonucleotide Fixed (1) Preparation of Gold Electrode with Acryloyl Group Immobilized on Surface A gold electrode whose surface was washed with acetone (surface area) : 2.25m
² μL of an aqueous solution (1 mM) of 11-amino-1-undecathiol was dropped on the surface of m ² ), and allowed to stand at room temperature for 10 hours while keeping the aqueous solution from drying. Washed sequentially. Next, 2 μL of a phosphate buffer (pH 8.5) containing 3% 1,2-bis (acryloylamino) ethane was applied to the surface of the gold electrode.
After dripping and leaving at room temperature for 2 hours, the electrode surface was sequentially washed with distilled water and ethanol. Thereafter, by drying under reduced pressure for 1 hour, a gold electrode having an acryloyl group bonded to the surface via a linking group was obtained.

(2) Immobilization of Oligonucleotide (Production of Electrochemical Analysis Element) Thymine 2 having an aminohexyl group introduced at the 5 ′ end was applied to the gold electrode having an acryloyl group on the surface obtained in (1) above.
An aqueous solution of a 0-mer oligonucleotide (T ₂₀ ) (100
(Picomolar / 1 μL) was added dropwise, left at room temperature for 1 hour, and then the excess oligonucleotide (T ₂₀ ) was washed away, followed by drying to produce an electrochemical analysis element.

(3) Preparation of Ferrocene-Labeled Oligonucleotide An aminohexyl group-linked oligonucleotide was bound to the 5 'end of adenine 20-mer (A ₂₀ ) to obtain an aminohexyl group-linked oligonucleotide. Using the aminohexyl group-linked oligonucleotide obtained above, Analytic by Takenaka et al.
al Biochemistry, 218, according to the method described in 436-443 (1994), 5 'terminally prepare oligonucleotides adenine 20 mer labeled with ferrocene (F1-A _20).

(4) Detection of Complementary Target Oligonucleotide Sample On the surface of the electrochemical analysis element prepared in (2) above,
Adenine 20 whose 5 'end is labeled with ferrocene
10m comprising mer oligonucleotide (F1-A ₂₀₎
2 μL of M Tris buffer (pH 7.5) solution was added dropwise,
Incubate for 30 minutes at 25 ° C. After the incubation is completed, the surface of the analysis element was washed with pure water to remove compounds F1-A ₂₀ unreacted. Using a 0.1 M potassium chloride-0.1 M acetate buffer (pH 5.60) solution as a measurement solution (38 ° C.) and performing differential pulse voltammetry (DVP) in an applied voltage range of 100 to 700 mV, 460 mV in the applied voltage, the response current derived from the compound F1-a ₂₀ were obtained. By the above operation and results, the oligonucleotide can be stably bound and immobilized on the surface of the gold electrode, and using this electrode, it is possible to detect a complementary target nucleotide sample labeled with an electrochemical labeling substance. Was confirmed.

[0095]

According to the immobilization method of the present invention, a probe of a nucleotide derivative such as an oligonucleotide, a polynucleotide, or a peptide nucleic acid or a nucleotide analog thereof can be stably and rapidly immobilized on the surface of a solid support. be able to. Therefore, the solid phase carrier on which the nucleic acid fragment prepared by the immobilization method of the present invention is immobilized becomes a very stable solid phase carrier in which the detachment of the probe due to hydrolysis hardly occurs. In particular, when an amino group or the like is introduced to the surface of the solid support using a silane coupling agent, both the bond of the amino group and the like to the surface of the solid support and the bond of the probe are covalent bonds. In addition, the probe can be firmly immobilized on the solid support. By stably fixing the probe, it is possible to obtain a detection tool having a high detection limit that can be effectively used for gene analysis and the like.

As one example, a probe molecule immobilized on an oligonucleotide-immobilized solid phase carrier is obtained by performing hybridization with a sample nucleic acid fragment using the oligonucleotide-immobilized solid phase carrier produced by the present invention. Can be detected with high sensitivity. In addition, after spotting a probe sample such as an oligonucleotide on the surface of the reactive solid support, and then treating the solid support surface with an anionic compound such as glycine, non-specific adsorption of the sample nucleic acid fragments can be prevented. This has a great effect on highly sensitive detection of a DNA fragment sample having complementarity.

[Brief description of the drawings]

FIG. 1 is a schematic diagram showing a typical oligonucleotide-immobilized solid phase carrier of the present invention and a typical oligonucleotide immobilizing method of the present invention.

FIG. 2 is a schematic diagram illustrating a fixing method according to the first embodiment.

 ──────────────────────────────────────────────────続 き Continued on the front page F term (reference) 4B024 AA11 AA19 CA01 HA12 4B029 AA07 AA23 BB15 BB20 CC03 FA15

Claims (21)

[Claims] 1. A reactive solid phase carrier comprising a group of acryloyl groups or reactive precursor groups thereof immobilized on the surface of a solid phase carrier by covalent bonds via respective linking groups. 2. The reactive solid-phase carrier according to claim 1, wherein the conjugate of the acryloyl group or its reactive precursor group and the linking group is represented by the following formula: ## STR1 ## CO—X wherein X represents —CR ¹ ＣＲCR ² R ³ or —CHR ¹ —CR ² R ³ Y; R ¹ , R ² and R ³ are
Independently of each other, a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, an aryl group having 6 to 20 carbon atoms, and a total carbon atom having an alkyl chain having 1 to 6 carbon atoms has 7 to 26 carbon atoms. Represents an atom or group selected from the group consisting of aralkyl groups of the formula: Y is a halogen atom, -OS
R ₂ represents an atom or group selected from the group consisting of O ₂ R ¹¹ , —OCOR ¹² , —OSO ₃ M, and a quaternary pyridinium group; R ¹¹ represents an alkyl group having 1 to 6 carbon atoms and a carbon atom having 1 to 6 carbon atoms. 6 to 20 aryl groups and 1 carbon atom
7 to 2 carbon atoms having from 6 to 6 alkyl chains
6 represents a group selected from the group consisting of 6 aralkyl groups;
R ¹² represents a group selected from the group consisting of an alkyl group having 1 to 6 carbon atoms and a halogenated alkyl group having 1 to 6 carbon atoms; M represents a hydrogen atom, an alkali metal atom and an ammonium group. And L represents a linking group]. 3. The reactive solid phase carrier according to claim 2, wherein X is a vinyl group represented by —CH ＝ CH ₂ . 4. The reactive solid support according to claim 2, wherein L is a linking group containing a divalent or higher valent atom other than a carbon atom. 5. L is -NH-, -S-, and -O-
The reactive solid support according to claim 2, which is a linking group having a linking site selected from the group consisting of: 6. L is-(L ¹ ) _n -NH- (CR ¹ R ² )
_2- or-(L ¹ ) _n -S- (CR ¹ R ² ) _2- [where R ¹
And R ² have the same meanings as described above, L ¹ represents a linking group, and n is 0 or 1.]. Carrier. 7. L is-(L ¹ ) _n -NHCH ₂ CH _2-
The reactive solid support according to claim 2, wherein L ¹ represents a linking group, and n is 0 or 1. 8. The reactive solid phase carrier according to claim 6, wherein L ¹ is a linking group containing a group represented by —OSi—, and n is 1. 9. A sheet wherein the solid phase carrier is selected from the group consisting of a glass substrate, a resin substrate, a glass substrate or a resin substrate surface-treated with a silane coupling agent, and a glass substrate or a resin substrate having a coating layer on the surface. The reactive solid support according to claim 1, which is a substrate in the form of a solid. 10. A silicate glass substrate, a silicate glass substrate surface-treated with a silane coupling agent,
The reactive solid support according to claim 9, which is a sheet-like substrate selected from the group consisting of silicate glass substrates coated with an organic coating layer. 11. A solid support having a surface into which a reactive group is introduced has the following formula: X ¹ -CO-L ² -CO-X ² [wherein X ¹ and X ² are Independently of each other,
CR ¹ = CR ² R ³ or —CHR ¹ —CR ² R ³ Y; R ¹ , R ² and R ³ each independently represent a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, Y represents an atom or a group selected from the group consisting of an aryl group having 6 to 20 atoms and an aralkyl group having 7 to 26 carbon atoms having an alkyl chain having 1 to 6 carbon atoms; Y
It is a halogen _{^{atom, -OSO 2 R 11, -OCOR 12}} , -
R ¹¹ represents an atom or group selected from the group consisting of OSO ₃ M and a quaternary pyridinium group; R ¹¹ is an alkyl group having 1 to 6 carbon atoms, an aryl group having 6 to 20 carbon atoms, and a carbon atom R ¹² represents a group selected from the group consisting of aralkyl groups having 7 to 26 carbon atoms having an alkyl chain having 1 to 6; R ¹² represents an alkyl group having 1 to 6 carbon atoms and a carbon atom having 1 to 6 carbon atoms. M represents a group selected from the group consisting of 1 to 6 halogenated alkyl groups;
Represents an atom or a group selected from the group consisting of a hydrogen atom, an alkali metal atom and an ammonium group; and L ² represents a linking group]. 3. The method for producing a reactive solid phase carrier according to 2. 12. The method according to claim 11, wherein the reactive group introduced on the surface of the solid support is an amino group, a mercapto group or a hydroxyl group. 13. A reactive group capable of reacting with a reactive group to form a covalent bond on a surface of a reactive solid support in which a group of acryloyl groups or reactive precursor groups thereof are fixed by covalent bonds. A method for producing a solid support in which a nucleic acid fragment is bound and fixed to the surface of a support via a linking group having a carbonyl group. 14. The method according to claim 13, wherein the nucleic acid fragment is selected from the group consisting of an oligonucleotide, a polynucleotide, and a peptide nucleic acid. 15. A reactive solid support to which an acryloyl group represented by the following formula or a conjugate of a reactive precursor group thereof and a linking group is bonded and fixed, as the reactive solid support. the process according to claim 13 or 14: embedded image in -L-CO-X [the above formula, X represents a -CR ¹ = CR ² R ³ or -CHR ¹ -CR ² R ³ Y R ¹ , R ² and R ³ are
Independently of each other, a hydrogen atom, an alkyl group having 1 to 6 carbon atoms, an aryl group having 6 to 20 carbon atoms, and a total carbon atom having an alkyl chain having 1 to 6 carbon atoms has 7 to 26 carbon atoms. Represents an atom or group selected from the group consisting of aralkyl groups of the formula: Y is a halogen atom, -OS
R ₂ represents an atom or group selected from the group consisting of O ₂ R ¹¹ , —OCOR ¹² , —OSO ₃ M, and a quaternary pyridinium group; R ¹¹ represents an alkyl group having 1 to 6 carbon atoms and a carbon atom having 1 to 6 carbon atoms. 6 to 20 aryl groups and 1 carbon atom
7 to 2 carbon atoms having from 6 to 6 alkyl chains
6 represents a group selected from the group consisting of 6 aralkyl groups;
R ¹² represents a group selected from the group consisting of an alkyl group having 1 to 6 carbon atoms and a halogenated alkyl group having 1 to 6 carbon atoms; M represents a hydrogen atom, an alkali metal atom and an ammonium group. And L represents a linking group or a single bond]. 16. X is -CR ¹ = CR ² R ³ [R ¹ , R ²
And R ³ represent the same meaning as described above]. 17. A solid support, on which a nucleic acid fragment obtained by the production method according to any one of claims 13 to 16 is bound and immobilized on the surface of the support. 18. A complementation method comprising bringing a DNA fragment exhibiting complementarity with the immobilized nucleic acid fragment into contact with the solid-phase carrier on which the nucleic acid fragment according to claim 17 is immobilized in the presence of an aqueous medium. Method for binding and fixing a functional DNA fragment. 19. The method according to claim 18, wherein a detectable label is bound to the complementary DNA fragment. 20. A complementation method, wherein a DNA fragment exhibiting complementarity to the immobilized nucleic acid fragment is complementarily bound to the solid-phase carrier on which the nucleic acid fragment according to claim 17 is immobilized. A solid support to which a DNA fragment is bound and fixed. 21. The solid support according to claim 20, wherein a detectable label is bound to the DNA fragment exhibiting complementarity.