JP2002360268A - Marker for family line diagnosis - Google Patents

Abstract

PROBLEM TO BE SOLVED: To separate and identify a new gene relating to polyglutamine diseases and clarify the polypeptide coded by the gene and to provide an examination technique and a preventing and/or treating agent for polyglutamine diseases using the gene or polypeptide. SOLUTION: The invention relates to a new gene containing a polynucleotide composed of a base sequence described in the sequence No.1, No.3, No.5, No.7 or No.9 of a sequence table (refer to the specification) having a CAG repeat encoding a polyglutamine, a polypeptide coded by the gene, a means for the diagnosis of family line taking advantage of the polymorphism of each gene derived from the difference of the number of the CAG repeats, a probe composed of a partial sequence of the gene and usable for the family line diagnosis and a preventing and/or treating agent for polyglutamine diseases based on the inhibition of the expression of the gene and the function of a polypeptide coded by the gene.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a novel gene and a polypeptide encoded by the gene,
More specifically, the present invention relates to a polyglutamine disease-related gene, a polypeptide encoded by the gene, and means for using the same.

[0002]

2. Description of the Related Art Molecular genetic analysis to date reveals that eight inherited neurodegenerative diseases represented by Huntington's disease are caused by abnormal elongation of CAG repeats in the causative gene. (Trend Genet 14: 396-402,
1998). In the genes responsible for these diseases, CAG
Repeats are present in the translation region and are all translated into polyglutamine. Except for spinocerebellar ataxia type 6, the number of CAG repeats does not exceed about 40 repeats in healthy individuals, but a higher number of repeats (up to about 130 repeats at most) causes a hereditary neurodegenerative disease. . In addition, CA
The longer the G repeat, the earlier the onset and the severity of the disease,
It has been found that the length of CAG repeats increases with each generation.

[0003] As a factor defining the onset of polyglutamine disease having an abnormal CAG repeat number, direct involvement of polyglutamine itself translated from the CAG repeat is considered. It has been reported that apoptotic cell death is observed in cultured cells expressing polyglutamine, and that neurodegeneration and cerebellar atrophy are observed in model animals expressing polyglutamine (Nat. G).
enet. 13, 196-202, 1996). Also,
A processing model has been proposed in which polyglutamine is excised from an individual disease-causing gene product in a brain region-specific manner, and the specific region is considered to be disease-specific injured.

[0004] Recently, a protein called TAF130 (TATA-binding protein-assembly) in which an elongated polyglutamine chain is present in the nucleus of a nerve cell.
It has been reported that the protein binds to an oxidized factor (TATA-binding protein-related factor) and strongly inhibits its function (Nat. Genet. 26, 29-36).
2000). Since TAF130 is one of the gene expression activators involved in cAMP response element binding protein-dependent transcriptional activation, it is indispensable for nerve growth factor and nerve cell plasticity that are important for survival and function expression of nerve cells. is there. Therefore, if the function of TAF130 is inhibited,
Serious damage to nerve cells. In addition, in the above report, in addition to polyglutamine, TA in addition to polyglutamine was found in aggregates found in nerve cells of the autopsy brain of patients with polyglutamine disease.
It was shown that the presence of F130 and the inhibition of gene transcription / expression and cell death caused by polyglutamine expression were restored or alleviated by the introduction of TAF130. Conventionally, it has been thought that the onset mechanism of polyglutamine disease is related to the induction of apoptosis of nerve cells by the formation of aggregates, but polyglutamine accumulated in the nucleus binds to TAF130 to regulate gene transcription and expression. It is suggested that inhibition and nuclear dysfunction may be involved.

[0005] Early detection and / or prophylaxis of polyglutamine disease can be achieved by using, as a marker, a gene in which the number of CAG repeats in a gene is abnormal compared to that of a healthy person. However, genes are diverse in individuals, and for the diagnosis of polyglutamine disease, it is essential to find various types of polyglutamine disease-related genes. In addition, few effective preventive and / or therapeutic agents for polyglutamine disease have been put on the market, and their development is expected.

[0006]

SUMMARY OF THE INVENTION An object of the present invention is to isolate and identify a novel polyglutamine disease-related gene, to clarify the polypeptide encoded by the gene, and to use the same to utilize the polyglutamine disease. An object of the present invention is to provide a preventive and / or therapeutic agent for a disease associated with a related gene, and a measurement means for diagnosis.

[0007]

Means for Solving the Problems The present inventors focused on cDNAs having a large number of CAG repeats, and found that cDNAs having a large number of CAG repeats obtained from a human brain cDNA library exhibited polymorphism. The present invention has been completed by finding that the polypeptide encoded by the obtained cDNA can be used for screening for a preventive and / or therapeutic agent for polyglutamine disease.

That is, the present invention provides: (1) a polynucleotide selected from the group consisting of the following: a nucleotide sequence represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9 in the sequence listing Or a complementary strand thereof, and at least 70% of the polypeptide encoded by the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9 in the Sequence Listing. Polynucleotide having the above amino acid sequence homology and encoding a polypeptide having a polyglutamine sequence or a complementary strand thereof, a polynucleotide hybridizing with the above-described polynucleotide or a complementary strand thereof under stringent conditions 1 to several nucleotides in the nucleotide sequence of the polynucleotide or its complementary strand A polynucleotide having a mutation such as deletion, substitution, addition, and / or insertion of an amino acid, and a polynucleotide containing any one of the above-mentioned polynucleotides or a complementary strand thereof. (2) A polynucleotide having at least about 10 consecutive nucleotide sequences in the nucleotide sequence constituting the polynucleotide; (3) a polynucleotide comprising a partial nucleotide sequence of the polynucleotide of (1), wherein 1
A polynucleotide consisting of the nucleotide sequence of any one of 1 to 20; (4) a polypeptide selected from the following group; (A) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5,
A polypeptide encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 or SEQ ID NO: 9, wherein SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10 in the sequence listing (B) a polypeptide having at least 70% or more amino acid sequence homology with the polypeptide of (A), and having a polyglutamine sequence;
(C) a polypeptide having a mutation such as deletion, substitution, addition, and / or insertion of one or several amino acids in the polypeptide of (A) and having a polyglutamine sequence; and (D) a polypeptide having a polyglutamine sequence. A polypeptide containing the polypeptide of A), (B) or (C); (5) a recombinant vector containing the polynucleotide of any of (1) to (3) or a complementary strand thereof; ) The recombinant vector of the above (5), wherein the recombinant vector is an expression recombinant vector; (7) a transformant transformed by the recombinant vector of the above (5) or (6); )) A method for producing the polypeptide of the above (4), which comprises a step of culturing a transformant transformed with the recombinant vector; (9) an antibody that immunologically recognizes the polypeptide of the above (4). , (10) (1) compound to interact with a polynucleotide that inhibits the expression of, and / or (4)
Interacts with a polypeptide of the type
A method for identifying a compound that inhibits binding to 130,
At least one of the polynucleotide of (1), the polypeptide of (4), the vector of (5) or (6), the transformant of (7), and the antibody of (9) (11) A method for identifying a compound that interacts with the polynucleotide of (1) and inhibits its expression, wherein the interaction between the compound and the polynucleotide is enabled. Under the conditions described above, the interaction of the compound is evaluated by contacting the polynucleotide with a compound to be screened, and then the presence or absence or change of a signal caused by the interaction between the compound and the polynucleotide Determining whether the compound interacts with the polynucleotide to inhibit its expression by detecting 4) A method for identifying a compound that interacts with the polypeptide of 4) and inhibits the binding of the polypeptide to TAF130, wherein the method comprises the steps of: By contacting the peptide with the compound to be screened to evaluate the interaction of the compound, and then detecting the presence or absence or change of the signal generated by the interaction of the compound with the polypeptide, the compound Determining whether or not interacts with the polypeptide to inhibit binding to TAF130; (13) a compound identified by any of the above (10) to (12); A) a compound that interacts with the polynucleotide of (1) to inhibit its expression, or a polypeptide that interacts with the polypeptide of (4) and (15) a polynucleotide according to any one of (1) to (3), a polypeptide according to (4), a vector according to (5) or (6), (7) a pharmaceutical composition comprising the transformant of (9), the antibody of (9), or at least one of the compounds of (13) or (14); A compound that interacts with the polynucleotide of 1) to inhibit its expression, and / or (4)
Interacts with a polypeptide of the type
(17) a pharmaceutical composition according to (15) and / or (16), which is a preventive and / or therapeutic agent for polyglutamine disease, which comprises a compound that inhibits binding to 130. (18) means for quantitatively or qualitatively measuring the polynucleotide of (1) or the polypeptide of (4); (19) the method of (1), wherein the means of (18) is used. ) Means for diagnosing a disease associated with the polynucleotide or the polypeptide of the above (4);
9) a diagnostic means; (21) a diagnostic means for polyglutamine disease characterized by analyzing the length of the base sequence encoding polyglutamine in the polynucleotide of (1); (22) a polyglutamine disease of the above (21). A means for diagnosing glutamine disease, wherein the polynucleotide of (2) and / or (3) is used; (23) a method of diagnosing polyglutamine in the polynucleotide of (1); A family diagnostic means characterized by analyzing the encoded base sequence length as a polymorphic marker; (24) SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, and SEQ ID NO: (25) The family diagnostic means of (23), wherein the polynucleotide comprising the nucleotide sequence of (18) is used as a probe. In families diagnosis means (24), the combination of polynucleotide comprising the nucleotide sequence set forth in SEQ ID NO: 13 and SEQ ID NO: 14 of the Sequence Listing, of the sequence listing SEQ ID NO: 1
5 and the combination of the polynucleotides consisting of the nucleotide sequences of SEQ ID NO: 16 and the combination of the polynucleotides consisting of the nucleotide sequences of SEQ ID NO: 17 and SEQ ID NO: 18 in the sequence listing are used alone or in combination. (26) a combination of polynucleotides comprising the nucleotide sequences of SEQ ID NO: 11 and SEQ ID NO: 12 in the sequence listing, and / or a combination of polynucleotides of SEQ ID NO: 19 and SEQ ID NO: 20 in the sequence listing (24) or (25), wherein the combination of polynucleotides comprising a nucleotide sequence is used as a negative control. (27) Use for any of the means (18) to (26). A reagent kit comprising: the polynucleotide according to any one of (1) to (3); Peptide or an antibody at least one or more comprising at reagent kit of the (9), consists of.

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION The cDNAs according to the present invention are five genes selected from cDNAs obtained from a human brain cDNA library by a conventional method, focusing on those having a long CAG repeat. These genes are those containing the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9 as their open reading frame (ORF), respectively. In the description, HH00456,
HG00622, HH01321, FH16716, F
J14474. HH0 is included in the nucleotide sequence unit considered to encode polyglutamine of each gene.
0456 is 65 repeats, HG00622 is 30 repeats, HH01321 is 14 repeats, FH16716
Has 21 repeats and FJ14474 has a CAG repeat of 27 repeats. When the tissue distribution of the transcripts of these genes was examined by a conventional method, HH0
0456, especially in the whole brain, ovaries, and spinal cord,
High transcripts of G00622 are particularly high in the whole brain, HH01321 is particularly high in the whole brain and ovary, FH16716 is high in the whole brain, ovary and cerebellum, and FJ14474 is high in the whole brain, cerebellum and spinal cord. The presence was recognized.

HG00622, HH01321 and FH16716 are the CAGs present in each gene.
Genes differing in the number of CAG repeats are determined by analysis of CAG repeats by polymerase chain reaction (PCR) amplification using a polynucleotide designed and synthesized based on the 5'-side and 3'-side nucleotide sequences adjacent to the repeats as primers The polymorphism was found to be present. In a healthy person, the DNA fragment which is a PCR product derived from HG00622 has a size of 153 bp, 156 bp, and 168 bp.
153 bp homo, 156 bp homo, 153 bp and 156 bp, 153 bp and 168 bp
Could be classified as having The DNA fragment, which is a PCR product derived from HH01321, has a size of 124b.
p, 130 bp, and 133 bp were detected, and 124
bp and 130 bp, 130 bp homo, 124 bp and 1
It could be classified into those having a homology of 33 bp, 130 and 133 bp, 133 bp. The DNA fragment which is a PCR product derived from FH16716 has a size of 104 bp and 113 bp.
bp, 116 bp, 119 bp, 122 bp, 125 b
p are detected, 104 bp, 113 bp, and 113 bp
bp homo, 113 bp and 116 bp, 113 bp and 1
19 bp, 113 bp and 122 bp, 113 bp and 12
It could be classified as homozygous of 5 bp and 122 bp. In the case of polyglutamine disease, CAG repeat elongation is observed as compared with healthy individuals, and it is considered that those having a size larger than the above PCR product can be diagnosed as having a predisposition to develop polyglutamine disease. Furthermore, the above gene can be used as one of family markers by analyzing its polymorphism. Although HH00456 and FJ14474 do not have a gene polymorphism, they can be used as a negative control in screening for diagnosing polyglutamine disease. The specific method for obtaining and analyzing the gene according to the present invention will be described in detail in Examples. Furthermore, diagnosis of polyglutamine disease can be performed using an increase in the number of CAG repeats in a unit considered to encode polyglutamine or an increase in the number of units as an index. Here, the “unit encoding polyglutamine” means a unit of a base sequence composed of a base sequence containing one or more extended CAG repeats.

[0011] The polynucleotide according to the present invention is represented by SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7,
Or a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 or a complementary strand thereof; a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9 in the sequence listing A polynucleotide encoding a polypeptide having at least 70% amino acid homology with the polypeptide encoded by the above and having a polyglutamine sequence, or a complementary strand thereof; A polynucleotide that hybridizes under the conditions; deletion of one to several nucleotides in the base sequence of the polynucleotide or its complementary strand;
A polynucleotide having a mutation such as substitution, addition, and / or insertion; a polynucleotide containing any one of the above-mentioned polynucleotides or a complementary strand thereof, or a complementary strand thereof. Note that “a DNA molecule that hybridizes to a DNA molecule under stringent conditions” is, for example, M
olecular Cloning: A Labora
toy Manual (Cold Spring Harbor Laboratory, 1989) and the like. Here, “hybridize under stringent conditions” refers to, for example, 6 × SSC, 0.
42 ° C. in a solution of 5% SDS and 50% formamide
Means that a positive hybridizing signal is still observed under the condition of washing at 68 ° C. in a solution of 0.1 × SSC, 0.5% SDS after heating.

[0012] All of the above-mentioned polynucleotides provide useful genetic information as a gene for a family diagnosis or a polyglutamine disease-related gene, and can be used as a marker for a family diagnosis or a polyglutamine disease diagnosis. The polynucleotide is useful in producing a polypeptide encoded by the polynucleotide, or can be used as a reagent or standard for nucleic acids.

[0013] A polynucleotide consisting of 10 or more, preferably 15 or more, more preferably 20 or more nucleotides corresponding to a region designated in the nucleotide sequence constituting the polynucleotide and a complementary strand thereof are also included. Included within the scope of the invention. These can be used as probes or primers for detecting the gene according to the present invention, antisense oligonucleotides for regulating gene expression, and the like. In that sense, the polynucleotide according to the present invention includes not only the translated region but also the one corresponding to the untranslated region. When used for the purpose of specifically inhibiting the expression of each of the above genes, the antisense oligonucleotide is preferably composed of a nucleotide sequence of a region unique to each of the above genes.
The probe or primer may be, for example, a polynucleotide designed and synthesized from the 5'-side or 3'-side nucleotide sequence at least adjacent to the CAG repeat site in the nucleotide sequence of the polynucleotide. Using the polynucleotide as a primer for PCR, PCR
By obtaining the polynucleotide of the CAG repeat portion as a PCR product by the gene amplification method and analyzing the size of the CAG repeat, diagnosis of polyglutamine disease and family diagnosis can be performed. Particularly preferably as a probe, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 or SEQ ID NO: 12 in the sequence listing designed from HH00456, or the nucleotide of SEQ ID NO: 13 or SEQ ID NO: 14 in the sequence listing designed from HG00622 A polynucleotide comprising the nucleotide sequence of SEQ ID NO: 15 or SEQ ID NO: 16 in the sequence listing designed from HH01321, FH16716
A polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 17 or SEQ ID NO: 18 in the sequence listing designed from, or SEQ ID NO: 19 in the sequence listing designed from FJ14474
Alternatively, it is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 20.

The polynucleotide according to the present invention is useful as a means for diagnosing a family or a disease associated with the polynucleotide, for example, a means for diagnosing a polyglutamine disease. Here, means means a method or medium for achieving an object. The medium in the present invention means, for example, a diagnostic kit or a composition containing a polynucleotide.

[0015] The diagnostic means determines the abundance of the corresponding nucleic acid and / or measures the mutation of the nucleic acid by utilizing, for example, the interaction or reactivity with the polynucleotide, and determines the change in the abundance or the mutation. It can be implemented by detecting the presence or absence. That is, the gene according to the present invention is qualitatively or quantitatively measured as a diagnostic marker. As a method for quantitatively or qualitatively measuring the nucleic acid in a sample, a method well known to those skilled in the art can be used. Such measurements include:
For example, amplification, PCR, RT-PCR, RNase protection,
Examples include Northern blotting and other hybridization methods.

The sample to be measured includes cells derived from an individual,
Examples include blood, urine, saliva, cerebrospinal fluid, tissue biopsy or autopsy material. The nucleic acid to be measured can be obtained from each of the above samples by a nucleic acid preparation method known per se. Nucleic acids may be used directly for detection of genomic DNA or may be amplified enzymatically by using PCR or other amplification methods prior to analysis. RNA or cDN
A may be used similarly. In comparison with the normal genotype, deletions and insertions can be detected by changes in the size of the amplification product. The point mutation can be identified by hybridizing the amplified DNA to the DNA encoding the labeled polypeptide.

Specifically, for example, the polynucleotide according to the present invention designed and synthesized from the 5 ′ or 3 ′ base sequence adjacent to the CAG repeat site of the gene according to the present invention is used as a primer for PCR. A family diagnosis is performed by obtaining a polynucleotide of the CAG repeat portion as a PCR product by PCR gene amplification and performing electrophoresis, and analyzing the size of the CAG repeat with analysis software. Those having a PCR product size larger than that of healthy individuals are considered to be diagnosable as having a predisposition to develop polyglutamine disease. The method for detecting and analyzing the CAG repeat portion using the polynucleotide according to the present invention is not particularly limited to the above, and a known method can be used.

The means for diagnosing polyglutamine disease according to the present invention is preferably a combination of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13 or SEQ ID NO: 14 designed from HG00622.
By combining the polynucleotides consisting of the nucleotide sequences of SEQ ID NO: 15 and SEQ ID NO: 16 of the sequence listing designed from H01321, and from the nucleotide sequences of SEQ ID NO: 17 and SEQ ID NO: 18 of the sequence listing designed from FH16716 Are used in combination. These combinations may be used alone,
A plurality of them can be used in combination. Also, HH
A combination of polynucleotides consisting of the nucleotide sequences of SEQ ID NO: 11 and SEQ ID NO: 12 in the sequence listing designed from 00456, and / or the nucleotide sequence of SEQ ID NO: 19 and SEQ ID NO: 20 in the sequence listing designed from FJ14474 Preferably, a polynucleotide combination consisting of is used as a negative control.

The present invention also provides a diagnostic reagent or a diagnostic reagent kit containing the polynucleotide according to the present invention for use in family diagnosis or the like. The diagnostic reagent or diagnostic reagent kit contains at least the polynucleotide of the present invention, and further contains a buffer solution, a nucleic acid, and the like necessary for measurement for detecting a polymorphism of the gene of the present invention. You may go out.

[0020] The polypeptide according to the present invention is a polypeptide encoded by the above polynucleotide. Preferably, the above HH00456, HG00622, HH0
1321, FH16716, or FJ14474, SEQ ID NO: 2, SEQ ID NO: 4,
A polypeptide comprising the amino acid sequence of any one of SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10. Further, polypeptides having at least 70% or more amino acid sequence homology with these polypeptides and having a polyglutamine sequence are also included in the scope of the present invention. As used herein, any peptide containing two or more amino acids linked to each other by a peptide bond or a modified peptide bond is referred to as a long-chain peptide. For example, a protein is also included in the polypeptide in this specification. Amino acids having mutations such as deletion, substitution, addition, and / or insertion of one or several amino acids by using at least the length of polyglutamine as an index based on the polypeptide according to the present invention. Also provided is a polypeptide consisting of a sequence. Means for introducing mutations such as deletion, substitution, addition, and / or insertion are known per se, and for example, Ulmer's technique (Science 219: 666, 1983) can be used. From the viewpoint of not changing the basic properties (physical properties, activity, immunological activity, etc.) of the polypeptide upon introduction of such a mutation, for example, homologous amino acids (polar amino acids, nonpolar amino acids, hydrophobic amino acids) , Hydrophilic amino acids, positively charged amino acids, negatively charged amino acids, aromatic amino acids, etc.) are easily assumed. In addition, these polypeptides
The modification can be made to such an extent that the function is not remarkably changed, for example, by modifying the constituent amino group or carboxyl group. Further, a polypeptide containing the above polypeptide is also included in the scope of the present invention.

Recently, it has been reported that an extended polyglutamine chain binds to TAF130, a protein involved in gene expression in nerve cells, and inhibits transcriptional activation involving TAF130 (Nat. Genet. 26, 29).
-36,2000). The polypeptide encoded by the gene containing the CAG repeat contains polyglutamine, and is considered to bind to TAF130 and suppress gene expression. In polyglutamine disease, an aggregate formed from an extended polyglutamine chain and TAF130 has been found. Induction of cell apoptosis by the toxicity of this aggregate or inhibition of gene expression by binding of the polyglutamine chain to TAF130, It has been pointed out that it may cause polyglutamine disease. Therefore, a substance that inhibits the function of the polypeptide according to the present invention or a substance that inhibits the above-mentioned binding can be used as an agent for preventing and / or treating polyglutamine disease. The polypeptide according to the present invention is useful for screening for a substance that inhibits the function of the polypeptide.

The polypeptide according to the present invention can be obtained by known synthesis, extraction and isolation, or genetic engineering techniques. For example, each of the above polynucleotides is introduced into an appropriate expression vector DNA, and then the vector DN
A is obtained by transducing A into a corresponding host, and culturing the transformed transformant. The transformant into which the expression vector DNA incorporating the polynucleotide has been introduced is cultured under conditions known per se, which are optimal for the culture conditions of each host. The culturing is performed by the action of the polypeptide of the present invention expressed by the transformant, for example, TAF.
It may be performed using the binding ability to 130 or the amount of the polypeptide produced in or outside the host as an index,
Subculture or batch culture may be performed using the amount of the transformant in the medium as an index. Alternatively, for example, mRNA can be synthesized from each of the above polynucleotides by a method known per se, and the mRNA can be used to obtain a known cell-free protein synthesis method. The recovery of a polypeptide from a culture solution or a synthesis reaction solution containing the above-mentioned polypeptide is performed by combining a molecular sieve, ion column chromatography, affinity chromatography or the like with the function of the polypeptide, for example, the binding ability to TAF130 as an index. Alternatively, it can be purified and recovered by means of fractionation of ammonium sulfate, alcohol or the like based on the difference in solubility. More preferably, a method of preparing an antibody against the amino acid sequence based on the information on the amino acid sequence and specifically adsorbing and collecting the antibody with the obtained polyclonal antibody or monoclonal antibody is used.

A recombinant vector containing the above-mentioned polynucleotide can be obtained by introducing the above-mentioned polynucleotide into vector DNA appropriately selected depending on the kind of host and purpose of use. The vector DNA is obtained by extracting naturally occurring DNA, and also includes DNAs other than those required for growth.
The NA part may be partially missing. For example,
Chromosomal, episomal and viral derived vectors, such as bacterial plasmid derived, bacteriophage derived, transposon derived, yeast episomal derived, insertion element derived, yeast chromosomal element derived such as baculovirus, papovavirus, SV40, vaccinia virus, adenovirus, fowlpox A virus, a vector derived from a virus such as a pseudorabies virus and a retrovirus,
And vectors obtained by combining them, for example, vectors derived from genetic elements of plasmids and bacteriophages, such as cosmids and phagemids. Further, an expression vector, a cloning vector, or the like can be used depending on the purpose.

A recombinant vector comprises a gene sequence of interest and a gene sequence carrying information relating to replication and control, such as a promoter, a ribosome binding site, a terminator, a signal sequence, an enhancer, etc., and these are known per se. It is produced in combination by a method. As a method for introducing the polynucleotide according to the present invention into the vector DNA, a method known per se can be applied.
For example, a method is used in which a DNA is cleaved at a specific site by selecting and treating an appropriate restriction enzyme, then mixed with a DNA to be used as a vector similarly treated, and religated with ligase. Alternatively, a desired recombinant vector can also be obtained by ligating an appropriate linker to the target polynucleotide and inserting this into a multicloning site of a vector suitable for the purpose.

A transformant can be obtained by transforming a host known per se, for example, Escherichia coli, yeast, Bacillus subtilis, insect cells, animal cells, or the like, by a method known per se, using the vector DNA into which the above-described polynucleotide has been incorporated. Can be
In the case of performing transformation, a more preferable system includes an integration method into a chromosome if gene stability is taken into consideration. However, an autonomous replication system using an extranuclear gene can be used simply. Introduction of vector DNA into host cells can be performed, for example, by using Molecular Cloni.
ng: A Laboratory Manual (Sa
mbrook et al., Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, New York, 1989). Specifically, calcium phosphate transfection, DEAE-dextran mediated transfection, microinjection, cationic lipid mediated transfection, electroporation, transduction, scrape loading (sc
rape loading, ballistic introduction (b
allic induction) and infection.

An antibody against the above polypeptide is prepared using the polypeptide as an antigen. The antigen may be the polypeptide itself or a fragment thereof and is composed of at least 5, more preferably at least 8 to 10 amino acids. In order to prepare an antibody specific to the polypeptide, it is preferable to use a region consisting of an amino acid sequence unique to the polypeptide. This amino acid sequence does not necessarily need to be homologous to the amino acid sequence of the polypeptide, and preferably has an exposed site on the three-dimensional structure of the polypeptide, and the amino acid sequence of the exposed site is discontinuous in the primary structure. Alternatively, any amino acid sequence that is continuous for the exposed site may be used. The antibody is not particularly limited as long as it immunologically binds or recognizes the polypeptide.
The presence or absence of this binding or recognition is determined by a known antigen-antibody binding reaction.

In order to produce an antibody, a known antibody production method can be used. For example, it can be obtained by administering an antigen alone or in the presence or absence of an adjuvant to an animal, alone or in combination with a carrier, to induce immunity such as a humoral response and / or a cellular response. The carrier is not particularly limited as long as it does not cause harmful effects on the host, and examples thereof include cellulose, polymerized amino acids, and albumin. As the animal to be immunized, a mouse, a rat, a rabbit, a goat, a horse and the like are suitably used.

The polyclonal antibody is obtained from the serum of the animal to which the above-mentioned immunization has been applied by an antibody recovery method known per se. Preferred means include immunoaffinity chromatography. In order to produce a monoclonal antibody, antibody-producing cells (for example, lymphocytes derived from spleen or lymph node) are collected from an animal to which the above-mentioned immunization method has been applied, and a permanently proliferating cell known per se (for example, P
3 / X63-Ag8 strain). For example, a hybridoma is prepared by fusing an antibody-producing cell and a permanently proliferating cell by a method known per se, and after cloning the hybridoma, selecting a hybridoma that produces an antibody that specifically recognizes the polypeptide, The antibody is recovered from the culture solution of the hybridoma. The thus obtained polyclonal antibody or monoclonal antibody capable of recognizing and binding to the polypeptide can be used as an antibody for purification of the polypeptide, a reagent, a label marker, or the like.

The polynucleotide and its complementary strand,
The polypeptides, cells transformed on the basis of the information on their base sequences and amino acid sequences, or antibodies immunologically recognizing them can be used alone or in combination of two or more to provide the functions of the polypeptides, for example, TAF.
The present invention provides an effective means for screening a substance that inhibits or promotes binding to 130 or a substance that inhibits or promotes expression of a polynucleotide. The screening method is
It can be constructed using a drug screening system known per se. To identify a compound that interacts with the polynucleotide to inhibit its expression, the polynucleotide is contacted with the compound to be screened under conditions that allow the compound to interact with the polynucleotide. To evaluate the interaction between the compound and the polynucleotide, and then detect the presence or absence or change in the signal caused by the interaction between the compound and the polynucleotide, thereby allowing the compound to interact with the polynucleotide. Methods can be used to determine whether they interact and inhibit their expression. In addition, the polypeptide interacts with the above-mentioned polypeptide to form a TAF130.
In order to identify a compound that inhibits binding to, under conditions that allow the interaction between the compound and the polypeptide,
The polypeptide is contacted with the compound to be screened to evaluate the interaction between the compound and the polypeptide, and then the presence, absence or change of a signal caused by the interaction between the compound and the polypeptide is detected. By doing so, a method can be used to determine whether the compound interacts with the polypeptide and inhibits binding to TAF130. Specifically, for example, using the two-hybrid system known per se, the polynucleotide, TAF130 and TAF are used.
A group of factors related to gene expression involving F130 and a signal for detecting the gene expression are co-transfected into a host, for example, yeast and expressed in an experimental system (Na
t. Genet. 26, 29-36, 2000), and by adding a test substance to this experimental system and detecting a change in the signal, the above-mentioned polynucleotide is converted into TAF1
A substance that prevents inhibition of the gene expression by binding to 30 can be selected. This experimental system describes one of the screening methods, and the screening method according to the present invention is not limited to this.

The present invention is also directed to compounds obtained by the above screening method. The compound interacts with the polypeptide to cause the polypeptide to interact with TAF130.
Or a compound that interacts with the polynucleotide to inhibit its expression. The compound thus selected can be prepared as a pharmaceutical composition by selecting in consideration of the balance between biological utility and toxicity.

Also, the polypeptide according to the present invention, the polynucleotide according to the present invention and its complementary chain, a recombinant vector prepared based on the amino acid sequence and base sequence information thereof, and a cell transformed with the recombinant vector Or an antibody that immunologically recognizes the polypeptide,
A function of the polypeptide, eg, binding to TAF130,
Or a compound that interacts with the polynucleotide to inhibit its expression, alone or in combination, to provide a pharmaceutical composition containing at least one of the above. Among the pharmaceutical compositions, for example, a compound that inhibits the binding of the polypeptide to TAF130 and / or a compound that inhibits the expression of the polynucleotide is a T
Since the formation of aggregates between AF130 and the polypeptide and / or the inhibition of TAF130-related gene expression by the polypeptide can be prevented, it is useful as a preventive and / or therapeutic agent for polyglutamine disease. When formulating a pharmaceutical composition, any known formulation means suitable for each subject such as a protein, polynucleotide, antibody, or compound may be introduced. The dose can be appropriately selected depending on the administration route, symptoms, nature of the prescription, nature of the symptom of the subject, etc., but generally 0.01 mg to 100 mg / day / adult human, preferably 0.1 mg as an active substance. 1 mg to 10 mg / day / adult human. Variations in these dosages can be made using routine experimentation for optimization well known in the art.

The polypeptide of the present invention can be used as a diagnostic marker for diagnosing a disease related to the expression or function of the polypeptide, for example, a polyglutamine disease, by measuring qualitatively or quantitatively as a diagnostic marker. .
For example, by determining the biodistribution of the polypeptide in an individual and / or determining the abundance of the polypeptide in a sample derived from the individual, and comparing with the normal polypeptide,
Diagnosis can be made. As a method for quantitatively or qualitatively measuring the polypeptide in a sample, a method well known to those skilled in the art can be used. Such assays include radioimmunoassays, competitive binding assays, western blot analysis and ELISA assays. As the sample to be measured, those similar to the sample used for the above-described nucleic acid measurement can be used.

The present invention also provides a diagnostic reagent or a diagnostic reagent kit for use in diseases associated with the expression or function of the polypeptide, such as polyglutamine disease. The diagnostic reagent or the diagnostic reagent kit contains at least the polynucleotide of the present invention or the antibody of the present invention, and may further contain a buffer solution and the like necessary for measurement.

[0034]

EXAMPLES Hereinafter, the present invention will be described specifically with reference to Examples and Experimental Examples, but the present invention is not limited to the following Examples and Experimental Examples.

[0035]

Example 1 (Construction of cDNA library) Double strand c
The DNA fragment was ligated with reverse transcriptase (SuperScript).
II, Invitrogen, USA).
(dT) ₁₅ primer (5'-
pGACTAGTTCTAGATCGCGAGGCGGC
_{CGCCC (T) 15 -3 ')} , and human whole brain poly ^(A) + using RNA (Clontech, USA), was prepared according to the manufacturer's instructions. The obtained cDNA was ligated with a Sal I adapter, and Not I was ligated.
After digestion with 1% agarose gel (low-melt)
agarose gel) and 3k
The cDNA fragment below b was removed. Next, the cDNA fragment of 3 kb or more was ligated to pBluescript II SK + vector digested with Sal I and Not I, and introduced into E. coli by electroporation (ElectroMax DH10B cells,
Invitrogen, USA). 8 × 10 ⁶ ampicillin-resistant colonies obtained by culturing E. coli on an agar medium
Plasmids were extracted from the individuals by the alkali / dodecyl sulfide sodium salt method. The plasmid was further fractionated into 10 fractions by agarose gel electrophoresis to increase the size of the inserted cDNA to 3 kb or more. The plasmid in each fraction was reintroduced into E. coli, and the E. coli was incubated at 37 ° C for 3 hours.
After shaking culture in an LB medium containing 100 μg / ml of ampicillin for a period of time, the resulting colonies (10 ^{6 for} each fraction)
From above), the plasmid was recovered again. By repeating the above-mentioned size selection step twice or more, cDNA having a size of about 8 kb was obtained.

(DNA sequencing) Plasmid D
For NA, dye-primer cycle sequencing (Dye-primer cycle sequencing)
Encoding reaction) to ABI PRIS
^MTM Cycle Sequencing Kit (Perkin
-Elmer Cetus, USA) and a robotic reaction system
m) (CATALYST Turbo, Perkin-
Elmer Cetus, USA). The reaction product was analyzed with an ABI 373A or 377 DNA sequencer using the ABI sequence analysis system INHERIT.
Was analyzed using. The dye-labeled M13 forward primer and reverse primer were used for unidirectional sequencing (single-pass seq) from the ends.
uenging) and also used for full-length sequencing of the inserted cDNA by the shotgun strategy. For estimation of the full-length sequence, the inserted cDNA was excised from the vector and purified by agarose gel electrophoresis. The recovered inserted cDNA was self-ligated and dephosphorylated with bovine intestinal alkaline phosphatase.
Fragmented by sonication. 700bp-10 obtained
The 00 bp fragment was blunt-ended, subjected to agarose gel electrophoresis, and then dephosphorylated SmaI-dig.
Ligation was performed with the Sted M13mp18 vector. Sixteen randomly separated shotgun clones were analyzed for each 1 kb cDNA. The remaining gap is
Dye-bound terminators or dye-bound primer sequencing were used, using the appropriate primers of the PCR product designed to fill the gap. The full length sequence of the cDNA clone was constructed from data for both strands. Analysis of the obtained sequence, such as homology search, was performed using a GCG software package.

(Novel gene having CAG repeat) In the nucleotide sequence of the obtained cDNA clone, those having a large number of CAG repeats were selected, and HH00456 and HG006 were selected.
22, HH01321, FH16716, and FJ1
4474 was obtained. HH004 is contained in the nucleotide sequence unit considered to encode polyglutamine of each gene.
56 is CAG of 65 repeats, HG00622 is 30 repeats, HH01321 is 14 repeats, FH16716 is 21 repeats, FJ14474 is 27 repeats CAG.
Has repeat. The nucleotide sequence of the ORF portion of each clone is shown in the sequence listing. SEQ ID NO: 1 in the sequence listing is HH00
456, SEQ ID NO: 3 is HG00622, SEQ ID NO: 5 is H
H01321, SEQ ID NO: 7 corresponds to FH16716, and SEQ ID NO: 9 corresponds to FJ14474. These clones were novel genes that had not been reported yet as a result of homology search. In addition, the amino acid sequences encoded by these genes were estimated, and
Described in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, and SEQ ID NO: 10.

(Design of Primer) Based on the nucleotide sequence containing these CAG repeats, a polynucleotide to be used as a primer was designed from the nucleotide sequence on the 5 'side (U) and 3' side (R) adjacent to the CAG repeat portion. And
It was synthesized by a method known per se. Table 1 shows the sequence of each primer.
Shown in

[0039]

[Table 1] ─────────────────────────────────HH00456-U: 5'-GCC TTC TCT CCT ACA CTA CAC CC-3 '(SEQ ID NO: 11) HH00456-R: 5'-GCT GGC TTG GTA GAG ATT GGG C-3' (SEQ ID NO: 12) HG00622-U: 5'-GCA CAT TTC CAG CTT CTC AGG C-3 '(SEQ ID NO: 13) HG00622-R: 5'-GCC CTG GAT CTG TGG AAC TTG C-3' (SEQ ID NO: 14) HH01321-U: 5'-CTT CAT GCC TAC CAG TCG GGC C-3 '(SEQ ID NO: 15) HH01321-R: 5'-GGC GAG GTT TTG GTA ATG GAG GG-3 '(SEQ ID NO: 16) FH16716-U: 5'-GGC CAA ACT CAT GCA GCA GAA AC-3' (SEQ ID NO: 17) FH16716- R: 5'-GAC CAA TTT GAA GTC TGA TTT GAG TG-3 '(SEQ ID NO: 18) FJ14474-U: 5'-TCC ACA GCC CGT AAC CTT AAC C-3' (SEQ ID NO: 19) FJ14474-R: 5 '-TGG TGG ATG CTC TGT GGC TGC-3' (SEQ ID NO: 20) ─────────────────────────────────

[0040]

[Experimental example 1] (Gene separation and analysis) Human genome DN
A PCR reaction was performed using 80 ng of A as a template DNA and the primers prepared in Example 1. The PCR reaction solution was a total volume of 20 μl, a mixture of 1 × LA PCR buffer (manufactured by Takara), 2.5 mM MgCl ₂ , 0.4 mM dNTP, 0.2 μM 5 ′ primer, 0.2 μM FITC label 3 'Primer,
And 0.05 U / μl Takara LA-Taq
(Manufactured by Takara). PCR reaction at 94 ° C
For 5 minutes, 94 ° C. for 1 minute, −65 ° C. for 30 seconds, −72 ° C. for 3 minutes, 20 cycles, and 72 ° C. for 7 minutes.

The obtained PCR product was then used for ALF II
DNA sequencer (Amersham Phar
macia) and electrophoresed on a 6% sequencing gel. 5 µl of reaction stop solution in 1 µl of PCR product
Was added and reacted at 95 ° C. for 5 minutes to obtain a sample for electrophoresis. The electrophoresis results are analyzed using a software fragment manager (Fragment Manager) (Ame
rsham Pharmacia),
The size of the PCR product was analyzed. As a size marker, Sizer50-500 (Amersham Ph)
armacia) was used.

Using primers derived from HG00622 (SEQ ID NOS: 13 and 14 in the sequence listing), gene analysis was performed on 105 healthy human samples. Amplified DNA
The fragments were 153 bp, 156 bp, 168 bp in size.
And it was revealed that a polymorphism exists in this gene. This difference in the size of the DNA fragments reflects the difference in the number of CAG repeats. According to the combination of the sizes of the DNA fragments detected in each sample, there are four types of samples, namely, 153 bp homo, 156 bp homo,
153 bp and 156 bp, or 153 bp and 168 b
p. The percentages of humans having the DNA fragment of each combination are 34.3%, 15.2%, and 47.
6%, or 2.90%.

Using HG00622 as a polymorphic marker,
Analysis of the DNA fragment containing the AG repeat was performed using the parent and child DNA samples. FIG. 1 shows the results of analysis using HG00622-derived primers (SEQ ID NOS: 13 and 14 in the sequence listing). The DNA fragment containing the CAG repeat derived from this gene on the paternal (A1) allele was 15
It turned out to be 0 bp and 156 bp. Mother (A
2) DN containing CAG repeat derived from this gene
The A fragment was 153 bp and 156 bp. On the other hand, DNA fragments containing CAG repeats have been determined in children so as to reflect their chromosomes. For example, in the case of this gene, both the first child (A3) and the second child (A4) have acquired 150 bp from the father and 153 bp from the mother. This analysis revealed a fragment involved in sex from parent to child.

[0044]

[Experimental Example 2] Gene analysis was performed on 104 healthy human samples in the same manner as in Experimental Example 1 using primers derived from HH01321 (SEQ ID NOS: 15 and 16 in the sequence listing).
As a result, the size is 124 bp, 130 bp, 133 b
Three kinds of DNA fragments of p were detected, and it was revealed that polymorphism was present in this gene. Depending on the combination of the sizes of the DNA fragments detected in each sample,
Type, ie, 124bp, 130bp, 130bp
Homo, 124 bp and 133 bp, 130 bp and 133
bp or 133 bp homo. The ratio of humans having each combination of DNA fragments was 1
6.3%, 64.4%, 1.00%, 17.3%, or 1.00%.

Using HH01321 as a polymorphic marker, C
Analysis of the DNA fragment containing the AG repeat was performed using the parent and child DNA samples. FIG. 2 shows the results of analysis using primers derived from HH01321 (SEQ ID NOS: 15 and 16 in the sequence listing). The DNA fragment containing the CAG repeat derived from this gene on the father (A1) allele was 13
0bp and 133bp were found. Mother (A
2) DN containing CAG repeat derived from this gene
The A fragment was 124 bp and 130 bp. On the other hand, DNA fragments containing CAG repeats have been determined in children so as to reflect their chromosomes. For example, in the case of this gene, the first child (A3) has
bp and 133 bp derived from the father have been obtained. In the second child (A4), 130 bp derived from the mother and 133 bp derived from the father have been obtained.
bp has been obtained. This analysis revealed a fragment involved in sex from parent to child.

[0046]

EXPERIMENTAL EXAMPLE 3 Using the primers derived from FH16716 (SEQ ID NOS: 17 and 18 in the sequence listing), gene analysis was performed on 34 healthy human samples in the same manner as in Experimental Example 1. As a result, the size is 104 bp, 113 bp, 116 b
p, 119 bp, 122 bp, 125 bp 6 types of DN
A fragment was detected, which revealed that a polymorphism was present in this gene. Depending on the combination of the sizes of the DNA fragments detected in each sample, there are seven types of samples, namely, 104 bp, 113 bp, 113 bp homozygous, 11 bp.
3 bp and 116 bp, 113 bp and 119 bp, 113
bp and 122 bp, 113 bp and 125 bp, or 1
It could be classified as a 22 bp homo. The ratio of the human having the DNA fragment of each combination is 2.94% and 58.
8%, 2.94%, 2.94%, 26.5%, 2.94
%, Or 2.94%.

Using FH16716 as a polymorphic marker,
Analysis of the DNA fragment containing the AG repeat was performed using the parent and child DNA samples. FIG. 3 shows the results of analysis using the primers derived from FH16716 (SEQ ID NOS: 17 and 18 in the sequence listing). The DNA fragment containing the CAG repeat derived from this gene on the allele of the father (A1) was 12
It was found to be 2 bp homozygous. The DNA fragment of the mother (A2) containing the CAG repeat derived from this gene was 113 bp homologous. On the other hand, children have CAG repeats that reflect their parents' chromosomes.
The NA fragment has been determined. For example, in the case of the present gene, both the first child (A3) and the second child (A4) are derived from the father.
22 bp and 113 bp derived from the mother. This analysis revealed a fragment involved in sex from parent to child.

[0048]

EXPERIMENTAL EXAMPLE 4 Using human primers derived from HH00456 (SEQ ID NOS: 11 and 12 in the sequence listing), gene analysis was performed on 107 human samples in the same manner as in Experimental Example 1. As a result, only two types having a size of 289 bp or 292 bp were obtained. D detected in each sample
The combination of the sizes of the NA fragments was 99.0% for the homology of 289 bp and 1.00% for the combination of 289 bp and 292 bp.

[0049]

Example 5 Using a primer derived from FJ14474 (SEQ ID NOS: 19 and 20 in the sequence listing), a DNA fragment containing a CAG repeat was analyzed for a parent-child DNA sample in the same manner as in Experimental Example 1. The result is shown in FIG. C derived from this gene on the allele of father (A1), mother (A2), first child (A3), and second child (A4)
All of the DNA fragments containing the AG repeat showed 141 bp, and no polymorphism was observed in this gene.

[0050]

As described above, the present invention has been achieved by finding novel genes rich in polymorphism and having a large number of CAG repeats and polypeptides encoded by the genes, and utilizing these. . According to the present invention, by analyzing the polymorphism of the gene according to the present invention using the polynucleotide according to the present invention as a probe, it is possible to diagnose the genealogy and diseases derived from the number of CAG repeats, such as genetic diagnosis of polyglutamine disease. Become. Furthermore, the present invention can provide a method for screening for a preventive and / or therapeutic agent for polyglutamine disease using the above-mentioned gene and a polypeptide encoded by the gene, and a preventive and / or therapeutic agent for polyglutamine disease. . That is, the present invention contributes to early detection of polyglutamine disease, and is also useful for elucidation of polyglutamine disease and prevention and / or treatment of polyglutamine.

[0051]

[Sequence Listing Free Text] SEQ ID NO: 11; polynucleotide designed based on the nucleotide sequence of SEQ ID NO: 1 in the Sequence Listing. SEQ ID NO: 12; a polynucleotide designed based on the nucleotide sequence of SEQ ID NO: 1 in the sequence listing. SEQ ID NO: 13; a polynucleotide designed based on the nucleotide sequence of SEQ ID NO: 3 in the sequence listing. SEQ ID NO: 14; a polynucleotide designed based on the nucleotide sequence of SEQ ID NO: 3 in the sequence listing. SEQ ID NO: 15: polynucleotide designed based on the nucleotide sequence of SEQ ID NO: 5 in the sequence listing SEQ ID NO: 16; a polynucleotide designed based on the nucleotide sequence of SEQ ID NO: 5 in the sequence listing. SEQ ID NO: 17; a polynucleotide designed based on the nucleotide sequence of SEQ ID NO: 7 in the sequence listing. SEQ ID NO: 18; a polynucleotide designed based on the nucleotide sequence of SEQ ID NO: 7 in the sequence listing. SEQ ID NO: 19: polynucleotide designed based on the nucleotide sequence of SEQ ID NO: 9 in the sequence listing SEQ ID NO: 20; a polynucleotide designed based on the nucleotide sequence of SEQ ID NO: 9 in the sequence listing.

[0052]

[Sequence List] SEQUENCE LISTING <110> KAZUSA DNA RESEARCH INSTITUTE DAIICHI PHARMACEUTICAL CO., LTD <120> Marker for genealogical diagnosis <130> NP01-1082 <140> <141> <150> JP P2000-236839 <151> 2000-08-04 <150> JP P2001-108723 <151> 2001-04-06 <160> 20 <170> PatentIn Ver. 2.1 <210> 1 <211> 3459 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (3459) <400> 1 atg ggg gac aca gcg ccc ccg cag gcc ccc gca gga ggg cta ggg ggg 48 Met Gly Asp Thr Ala Pro Pro Gln Ala Pro Ala Gly Gly Leu Gly Gly 1 5 10 15 gcc tct ggg gcg ggg ctc ctt gga ggg ggc tca gtc acc ccg aga gtg 96 Ala Ser Gly Ala Gly Leu Leu Gly Gly Gly Ser Val Thr Pro Arg Val 20 25 30 cac agt gct atc gtg gag cgc ctc cgg gct cgg atc gct gtc tgc cgc 144 His Ser Ala Ile Val Glu Arg Leu Arg Ala Arg Ile Ala Val Cys Arg 35 40 45 caa cac cac ctg agc tgt gaa gga cga tat gaa cga ggt agg gcc gag 192 Gln His His Leu Ser Cys Glu Gly Arg Tyr Glu Arg Gly Arg Ala Glu 50 55 60 agc tca gac cgg gaa aga gaa agc acc ttg cag ctc ctg agc ctt gta 240 Ser Ser Asp Arg Glu Arg Glu Ser Thr Leu Gln Leu Leu Ser Leu Val 65 70 75 80 cag cat ggc cag ggg gca agg aaa gct ggc aaa cac acc aag gcc acc 288 Gln His Gly Gln Gly Ala Arg Lys Ala Gly Lys His Thr Lys Ala Thr 85 90 95 gcc act gct gcc acc act aca gcc cct cca ccg ccc cct gct gcc cct 336 Ala Thr Ala Ala Thr Thr Thr Ala Pro Pro Pro Pro Pro Ala Ala Pro 100 105 110 cct gcg gcc tcc caa gca gca gca aca gca gcc cca ccg ccc cca cca 384 Pro Ala Ala Ser Gln Ala Ala Ala Thr Ala Ala Pro Pro Pro Pro Pro 115 120 125 gac tat cac cat cac cac cag cag cac ctg ctg aac agt agc aat aat 432 Asp Tyr His His His Gln Gln His Leu Leu Asn Ser Ser Asn Asn 130 135 140 ggt ggc agt ggt ggg ata aac gga gag cag cag ccg ccc gct tca acc 480 Gly Gly Ser Gly Gly Ile Asn Gly Glu Gln Gln Pro Pro Ala Ser Thr 145 150 155 160 cca ggg gac cag agg aac tca gcc ctg att gcg ctc cag ggt tcc ttg 528 Pro Gly Asp Gln Arg Asn Ser Ala Leu Ile Ala Leu Gln Gly Ser Leu 165 170 175 aaa aaa aga aaa cag gta gtt aac cta tct cct gcc aac agc aag cga ccc 576 Lys Arg Lys Gln Val Val Asn Leu Ser Pro Ala Asn Ser Lys Arg Pro 180 185 190 aat ggc ttt gtg gac aac tca ttt ctt gat atc aaa aga att cgt gtt 624 Asn Gly Phe Val Asp Asn Ser Phe Leu Asp Ile Lys Arg Ile Arg Val 195 200 205 ggg gag aat ctc tct gca gga caa ggt ggc ctc caa ata aac aat gga 672 Gly Glu Asn Leu Ser Ala Gly Gln Gly Gly Leu Gln Ile Asn Asn Gly 210 215 220 caa agt cag att atg tca ggg acc ttg cct atg agc caa gca ccc ctg 720 Gln Ser Gln Ile Met Ser Gly Thr Leu Pro Met Ser Gln Ala Pro Leu 225 230 235 240 cga aag act aac act ctg cca tcc cat aca cat tct cct ggc aat ggc 768 Arg Lys Thr Asn Thr Leu Pro Ser His Thr His Ser Pro Gly Asn Gly 245 250 255 ctg ttt aac atg ggc tta aag gag gta aag aag gag cca gga gag act 816 Leu Phe Asn Met Gly Leu Lys Glu Val Lys Lys Glu Pro Gly Glu Thr 260 265 270 ctg tct tgc agt aag cac atg gat ggc caa atg acc caa gag aat att 864 Leu Ser Cys Ser Lys His Met Asp Gly Gln Met Thr Gln Glu Asn Ile 275 280 280 tttt cct aat agg tac gga gac gac cct gga gaa caa ctg atg gat cct 912 Phe Pro Asn Arg Tyr Gly Asp Asp Pro Gly Glu Gln Leu Met Asp Pro 290 295 300 gag ctg cag gaa ctg ttc aat gaa ctg acc agt atact 960 Glu Leu Gln Glu Leu Phe Asn Glu Leu Thr Asn Ile Ser Val Pro Pro 305 310 315 320 atg agt gac ctt gaa ctg gag aac atg atc aat gcc acc ata aag cag 1008 Met Ser Asp Leu Glu Leu Glu Asn Met Ile Asn Al a Thr Ile Lys Gln 325 330 335 gat gac cca ttt aac att gac ttg ggt cag caa agc cag agg agc aca 1056 Asp Asp Pro Phe Asn Ile Asp Leu Gly Gln Gln Ser Gln Arg Ser Thr 340 345 350 cct agg ccc tcc tta ccc atg gag aaa ata gtg atc aaa agt gaa tac 1104 Pro Arg Pro Ser Leu Pro Met Glu Lys Ile Val Ile Lys Ser Glu Tyr 355 360 365 tca ccg ggc ttg act cag ggc ccc tca ggc tct cct cag ctg agg ccc 1152 Ser Proly Leu Thr Gln Gly Pro Ser Gly Ser Pro Gln Leu Arg Pro 370 375 380 cca tca gct ggc ccc gca ttc tcc atg gcc aac tct gcc ctc tcc act 1200 Pro Ser Ala Gly Pro Ala Phe Ser Met Ala Asn Ser Ala Leu Ser Thr 385 390 395 400 tcg tct cca atc cct tca gtc cct cag agc cag gct cag cct cag aca 1248 Ser Ser Pro Ile Pro Ser Val Pro Gln Ser Gln Ala Gln Pro Gln Thr 405 410 415 ggc tcc gga gca agc cgg gcc ttg cca agc tgg cag gaa gta tcc cat 1296 Gly Ser Gly Ala Ser Arg Ala Leu Pro Ser Trp Gln Glu Val Ser His 420 425 430 gcc cag cag ctc aaa cag ata gct gct aat cgt cag cag cat gcc cgg 1344 Ala Gln Gln Leu Lys Gln Il e Ala Ala Asn Arg Gln Gln His Ala Arg 435 440 445 atg cag cag cac cag cag cag cac cag cct acc aac tgg tca gcc ttg 1392 Met Gln Gln His Gln Gln Gln His Gln Pro Thr Asn Trp Ser Ala Leu 450 455 460 ccc tcc tct gct gga cca tca cca ggt cca ttt ggg cag gag aaa atc 1440 Pro Ser Ser Ala Gly Pro Ser Pro Gly Pro Phe Gly Gln Glu Lys Ile 465 470 470 475 480 ccc agc cct tct ttt ggt cag cag aca ttc agc cca cag ac tcc ccc 1488 Pro Ser Pro Ser Phe Gly Gln Gln Thr Phe Ser Pro Gln Ser Ser Pro 485 490 495 atg cct ggg gta gct ggc ggc agc ggc cag tcg aaa gta atg gct aac 1536 Met Pro Gly Val Ala Gly Gly Ser Gly Gln Ser Lys Val Met Ala Asn 500 505 510 tac atg tac aag gcc ggc ccc tca gcc cag ggt ggg cac cta gat gtc 1584 Tyr Met Tyr Lys Ala Gly Pro Ser Ala Gln Gly Gly His Leu Asp Val 515 520 525 ctc atg cag caa aag cct cag gat ctc agt cga agt ttt att aac aac 1632 Leu Met Gln Gln Lys Pro Gln Asp Leu Ser Arg Ser Phe Ile Asn Asn 530 535 540 ccg cac cca gcc atg gag ccc cgt cag ggc aac acc aag cct ttg ttt 1680 Pro His Pro Ala Met Glu Pro Arg Gln Gly Asn Thr Lys Pro Leu Phe 545 550 555 560 cat ttt aac tca gat caa gcg aac cag cag atg cct tct gtt ttg cct 1728 His Phe Asn Ser Asp Gln Ala Asn Gln Gln Met Pro Ser Val Leu Pro 565 570 575 tcc cag aac aag cct tct ctc cta cac tac acc caa cag caa cag cag 1776 Ser Gln Asn Lys Pro Ser Leu Leu His Tyr Thr Gln Gln Gln Gln Gln 580 585 590 caa cag cag cag cag cag cag cag cag cag cag cag caa cag cag cag cag 1824 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 595 600 605 cag caa cag caa cag caa cag caa cag cag agt tca att tca gct caa 1872 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Ser Ser Ile Ser Ala Gln 610 615 620 caa cag caa cag cag cag agc tca att tca gcc caa cag cag cag cag 1920 Gln Gln Gln Gln Gln Gln Gln Ser Ser Ile Ser Ala Gln Gln Gln Gln Gln 625 630 630 635 640 cag caa caa cag cag cag cag cag caa caa caa cag caa caa cag cag 1968 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 645 650 655 cag cag cag cag caa caa cca tct tct cag cct gcc caa ct cta cca 2016 Gln Gln Gln Gln Gln Gln Pro Ser Ser Gln Pro Ala Gln Ser Leu Pro 660 665 670 agc cag cct ttg cta agg tca cct ttg cca ctt cag caa aag ctc cta 2064 Ser Gln Pro Leu Leu Arg Ser Pro Leu Pro Leu Gln Gln Lys Leu Leu 675 680 685 ctt cag caa atg cag aat cag ccc att gca gga atg gga tac caa gtc 2112 Leu Gln Gln Met Gln Asn Gln Pro Ile Ala Gly Met Gly Tyr Gln Val 690 695 700 tcc caa caa cag aga cag gat caa cac tct gtg gta ggc cag aac aca 2160 Ser Gln Gln Gln Arg Gln Asp Gln His Ser Val Val Gly Gln Asn Thr 705 710 715 720 ggc ccc agt cca agt cct aac ccc tgc tca aat cca aac act gga agt 2208 Gly Pro Ser Pro Ser Pro Asn Pro Cys Ser Asn Pro Asn Thr Gly Ser 725 730 735 ggt tac atg aac tcc cag caa tca ctg ttg aat cag caa ttg atg gga 2256 Gly Tyr Met Asn Ser Gln Gln Ser Leu Leu Asn Gln Gln Leu Met Gly 740 745 750 aag aag cag act cta cag agg cag atc atg gag cag aaa cag caa ctt 2304 Lys Lys Gln Thr Leu Gln Arg Gln Ile Met Glu Gln Lys Gln Gln Leu 755 760 765 ctt ctc cag cag cag atg ctg gct c gcg gag aaa att gct cca caa 2352 Leu Leu Gln Gln Gln Met Leu Ala Asp Ala Glu Lys Ile Ala Pro Gln 770 775 780 gat cag ata aac cga cat ttg tca agg cca cct cca gat tat aaa gac 2400 Asp Gln Ile Asn His Leu Ser Arg Pro Pro Pro Asp Tyr Lys Asp 785 790 795 800 caa aga aga aat gtg ggc aat atg caa cca act gct cag tat tct ggt 2448 Gln Arg Arg Asn Val Gly Asn Met Gln Pro Thr Ala Gln Tyr Ser Gly 805 810 815 ggc tca tcc aca ata agc tta aac tct aac cag gct ttg gca aac cca 2496 Gly Ser Ser Thr Ile Ser Leu Asn Ser Asn Gln Ala Leu Ala Asn Pro 820 825 830 gtt tca aca cac acc att tta act ccc aat tcc agc ctc ctg tct act 2544 Val Ser Thr His Thr Ile Leu Thr Pro Asn Ser Ser Leu Leu Ser Thr 835 840 845 tct cac ggg aca aga atg cca tca tta tct aca gca gtt cag aat atg 2592 Ser His Gly Thr Arg Met Pro Ser Leu Ser Thr Ala Val Gln Asn Met 850 855 860 ggg atg tat gga aat ctg cct tgt aat caa cct aac aca tac agt gtc 2640 Gly Met Tyr Gly Asn Leu Pro Cys Asn Gln Pro Asn Thr Tyr Ser Val 865 870 875 875 880 act tca gg a atg aat caa ttg acc caa cag aga aac cca aag caa ttg 2688 Thr Ser Gly Met Asn Gln Leu Thr Gln Gln Arg Asn Pro Lys Gln Leu 885 890 895 tta gca aat caa aac aac cct atg atg cca cgg cca cct acc tta ggg 2736 Leu Ala Asn Gln Asn Asn Pro Met Met Pro Arg Pro Pro Thr Leu Gly 900 905 910 cca agt aat aat aac aat gta gcc act ttt gga gct gga tct gtt ggt 2784 Pro Ser Asn Asn Asn Asn Asn Val Ala Thr Phe Gly Ala Gly Ser Val Gly 915 920 925 aat tca caa caa ttg aga cca aat tta acc cat agt atg gca agc atg 2832 Asn Ser Gln Gln Leu Arg Pro Asn Leu Thr His Ser Met Ala Ser Met 930 935 940 cca cca cag aga aca tca aac gta atg atc aca tcc aac aca act gca 2880 Pro Pro Gln Arg Thr Ser Asn Val Met Ile Thr Ser Asn Thr Thr Ala 945 950 9555 960 cca aac tgg gcc tct caa gaa gga aca agc aaa cag caa gaa gcc ctg 2928 Pro Asn Trp Ala Ser Gln Glu Gly Thr Ser Lys Gln Gln Glu Ala Leu 965 970 975 acg tct gca gga gtc cgc ttc ccc aca ggt aca cct gca gcc tat acc 2976 Thr Ser Ala Gly Val Arg Phe Pro Thr Gly Thr Pro Ala Ala Tla Thr 980 985 990 cca aat cag tca ctg caa cag gca gta ggt agc cag caa ttt tcc cag 3024 Pro Asn Gln Ser Leu Gln Gln Ala Val Gly Ser Gln Gln Phe Ser Gln 995 1000 1005 agg gca gtg gct cct cct aac cag tta aca cca gca gtg caa atg aga 3072 Arg Ala Val Ala Pro Pro Asn Gln Leu Thr Pro Ala Val Gln Met Arg 1010 1015 1020 ccc atg aac caa atg agc caa aca cta aat ggg caa acc atg ggt ccc 3120 Pro Met Asn Gln Met Ser Gln Thr Leu Asn Gly Gln Thr Met Gly Pro 1025 1030 1035 1040 ctc agg ggt ctg aat ctc aga ccc aat cag cta agc aca cag att ttg 3168 Leu Arg Gly Leu Asn Leu Arg Pro Asn Gln Leu Ser Thr Gln Ile Leu 1045 1050 1055cct a aat cag tca gga aca ggg ttg aat cag tcg agg acg ggc 3216 Pro Asn Leu Asn Gln Ser Gly Thr Gly Leu Asn Gln Ser Arg Thr Gly 1060 1065 1070 atc aac cag cca cca tcc ctg acg ccc agc aat ttt cct tca ccc acc Ile Asn Gln Pro Pro Ser Leu Thr Pro Ser Asn Phe Pro Ser Pro Asn 1075 1080 1085 caa agt tcc agg gct ttt caa gga act gac cac agc agt gac tta gct 3312 Gln Ser Ser Arg Ala Phe Gln Gl y Thr Asp His Ser Ser Asp Leu Ala 1090 1095 1100 ttt gac ttc ctc agc caa caa aat gat aac atg ggc cct gcc cta aac 3360 Phe Asp Phe Leu Ser Gln Gln Asn Asp Asn Met Gly Pro Ala Leu Asn 1105 1110 1115 1120 agt gat gct gat ttc att gat tct tta ttg aag aca gag cct ggt aat 3408 Ser Asp Ala Asp Phe Ile Asp Ser Leu Leu Lys Thr Glu Pro Gly Asn 1125 1130 1135 gat gac tgg atg aaa gac atc aat ctt gat gaa atc ttg aat 3456 Asp Asp Trp Met Lys Asp Ile Asn Leu Asp Glu Ile Leu Gly Asn Asn 1140 1145 1150 tcc 3459 Ser <210> 2 <211> 1153 <212> PRT <213> Homo sapiens <400> 2 Met Gly Asp Thr Ala Pro Pro Gln Ala Pro Ala Gly Gly Leu Gly Gly 1 5 10 15 Ala Ser Gly Ala Gly Leu Leu Gly Gly Gly Ser Val Thr Pro Arg Val 20 25 30 His Ser Ala Ile Val Glu Arg Leu Arg Ala Arg Ile Ala Val Cys Arg 35 40 45 Gln His His Leu Ser Cys Glu Gly Arg Tyr Glu Arg Gly Arg Ala Glu 50 55 60 Ser Ser Asp Arg Glu Arg Glu Ser Thr Leu Gln Leu Leu Ser Leu Val 65 70 75 80 Gln His Gly Gln Gly Ala Arg Lys Ala Gly Lys His Thr Lys Ala Thr 85 90 95 Ala Thr Ala Ala Thr Thr Thr Ala Pro Pro Pro Pro Pro Ala Ala Pro 100 105 110 Pro Ala Ala Ser Gln Ala Ala Ala Thr Ala Ala Pro Pro Pro Pro Pro 115 120 125 Asp Tyr His His His His Gln Gln His Leu Leu Asn Ser Ser Asn Asn 130 135 140 Gly Gly Ser Gly Gly Ile Asn Gly Glu Gln Gln Gln Pro Pro Ala Ser Thr 145 150 155 160 Pro Gly Asp Gln Arg Asn Ser Ala Leu Ile Ala Leu Gln Gly Ser Leu 165 170 175 Lys Arg Lys Gln Val Val Asn Leu Ser Pro Ala Asn Ser Lys Arg Pro 180 185 190 Asn Gly Phe Val Asp Asn Ser Phe Leu Asp Ile Lys Arg Ile Arg Val 195 200 205 Gly Glu Asn L eu Ser Ala Gly Gln Gly Gly Leu Gln Ile Asn Asn Gly 210 215 220 Gln Ser Gln Ile Met Ser Gly Thr Leu Pro Met Ser Gln Ala Pro Leu 225 230 235 240 Arg Lys Thr Asn Thr Leu Pro Ser His Thr His Ser Pro Gly Asn Gly 245 250 255 Leu Phe Asn Met Gly Leu Lys Glu Val Lys Lys Glu Pro Gly Glu Thr 260 265 270 Leu Ser Cys Ser Lys His Met Asp Gly Gln Met Thr Gln Glu Asn Ile 275 280 285 285 Phe Pro Asn Arg Tyr Gly Asp Asp Pro Gly Glu Glu Gln Leu Met Asp Pro 290 295 300 Glu Leu Gln Glu Leu Phe Asn Glu Leu Thr Asn Ile Ser Val Pro Pro 305 310 315 320 Met Ser Asp Leu Glu Leu Glu Asn Met Ile Asn Ala Thr Ile Lys Gln 325 330 335 Asp Asp Pro Phe Asn Ile Asp Leu Gly Gln Gln Ser Gln Arg Ser Thr 340 345 345 350 Pro Arg Pro Ser Leu Pro Met Glu Lys Ile Val Ile Lys Ser Glu Tyr 355 360 365 Ser Pro Gly Leu Thr Gln Gly Pro Ser Gly Ser Pro Gln Leu Arg Pro 370 375 380 Pro Ser Ala Gly Pro Ala Phe Ser Met Ala Asn Ser Ala Leu Ser Thr 385 390 395 400 400 Ser Ser Pro Ile Pro Ser Val Pro Gln Ser Gln Ala Gln Pro Gln Thr 405 410 415 Gly Ser GlyAla Ser Arg Ala Leu Pro Ser Trp Gln Glu Val Ser His 420 425 430 Ala Gln Gln Leu Lys Gln Ile Ala Ala Asn Arg Gln Gln His Ala Arg 435 440 445 Met Gln Gln His Gln Gln Gln His Gln Pro Thr Asn Trp Ser Ala Leu 450 455 460 Pro Ser Ser Ala Gly Pro Ser Pro Pro Gly Pro Phe Gly Gln Glu Lys Ile 465 470 475 480 Pro Ser Pro Ser Phe Gly Gln Gln Thr Phe Ser Pro Gln Ser Ser Pro 485 490 495 Met Pro Gly Val Ala Gly Gly Ser Gly Gln Ser Lys Val Met Ala Asn 500 505 510 510 Tyr Met Tyr Lys Ala Gly Pro Ser Ala Gln Gly Gly His Leu Asp Val 515 520 525 Leu Met Gln Gln Lys Pro Gln Asp Leu Ser Arg Ser Phe Ile Asn Asn 530 535 540 Pro His Pro Ala Met Glu Pro Arg Gln Gly Asn Thr Lys Pro Leu Phe 545 550 555 560 His Phe Asn Ser Asp Gln Ala Asn Gln Gln Met Pro Ser Val Leu Pro 565 570 575 Ser Gln Asn Lys Pro Ser Leu Leu His Tyr Thr Gln Gln Gln Gln Gln 580 585 590 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 595 600 605 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Ser Ser Ile Ser Ala Gln 610 615 620 620 Gln Gln Gln Gln Gln Gln Ser Ser Ile Ser Ala Gln Gln Gln Gln Gln 625 630 635 640 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 645 650 655 Gln Gln Gln Gln Gln Gln Pro Ser Ser Gln Pro Ala Gln Ser Leu Pro 660 665 670 Ser Gln Pro Leu Leu Arg Ser Pro Leu Pro Leu Gln Gln Lys Leu Leu 675 680 685 Leu Gln Gln Met Gln Asn Gln Pro Ile Ala Gly Met Gly Tyr Gln Val 690 695 700 Ser Gln Gln Gln Arg Gln Asp Gln His Ser Val Val Gly Gln Asn Thr 705 710 715 720 720 Gly Pro Ser Pro Ser Pro Asn Pro Cys Ser Asn Pro Asn Thr Gly Ser 725 730 735 Gly Tyr Met Asn Ser Gln Gln Ser Leu Leu Asn Gln Gln Leu Met Gly 740 745 750 Lys Lys Gln Thr Leu Gln Arg Gln Ile Met Glu Gln Lys Gln Gln Leu 755 760 765 Leu Leu Gln Gln Gln Met Leu Ala Asp Ala Glu Lys Ile Ala Pro Gln 770 775 780 Asp Gln Ile Asn Arg His Leu Ser Arg Pro Pro Pro Asp Tyr Lys Asp 785 790 795 800 Gln Arg Arg Asn Val Gly Asn Met Gln Pro Thr Ala Gln Tyr Ser Gly 805 810 815 Gly Ser Ser Thr Ile Ser Leu Asn Ser Asn Gln Ala Leu Ala Asn Pro 820 825 830 Val Ser Thr Hi s Thr Ile Leu Thr Pro Asn Ser Ser Leu Leu Ser Thr 835 840 845 Ser His Gly Thr Arg Met Pro Ser Leu Ser Thr Ala Val Gln Asn Met 850 855 860 Gly Met Tyr Gly Asn Leu Pro Cys Asn Gln Pro Asn Thr Tyr Ser Val 865 870 875 880 Thr Ser Gly Met Asn Gln Leu Thr Gln Gln Arg Asn Pro Lys Gln Leu 885 890 895 Leu Ala Asn Gln Asn Asn Pro Met Met Pro Arg Pro Pro Thr Leu Gly 900 905 910 Pro Ser Asn Asn Asn Asn Val Ala Thr Phe Gly Ala Gly Ser Val Gly 915 920 925 Asn Ser Gln Gln Leu Arg Pro Asn Leu Thr His Ser Met Ala Ser Met 930 935 940 Pro Pro Gln Arg Thr Ser Asn Val Met Ile Thr Ser Asn Thr Thr Ala 945 950 955 960 Pro Asn Trp Ala Ser Gln Glu Gly Thr Ser Lys Gln Gln Glu Ala Leu 965 970 975 Thr Ser Ala Gly Val Arg Phe Pro Thr Gly Thr Pro Ala Ala Tyr Thr 980 985 990 Pro Asn Gln Ser Leu Gln Gln Ala Val Gly Ser Gln Gln Phe Ser Gln 995 1000 1005 Arg Ala Val Ala Pro Pro Asn Gln Leu Thr Pro Ala Val Gln Met Arg 1010 1015 1020 Pro Met Asn Gln Met Ser Gln Thr Leu Asn Gly Gln Thr Met Gly Pro 1025 1030 1035 1040 Leu A rg Gly Leu Asn Leu Arg Pro Asn Gln Leu Ser Thr Gln Ile Leu 1045 1050 1055 Pro Asn Leu Asn Gln Ser Gly Thr Gly Leu Asn Gln Ser Arg Thr Gly 1060 1065 1070 Ile Asn Gln Pro Pro Ser Leu Thr Pro Ser Asn Phe Pro Ser Pro Asn 1075 1080 1085 Gln Ser Ser Arg Ala Phe Gln Gly Thr Asp His Ser Ser Asp Leu Ala 1090 1095 1100 Phe Asp Phe Leu Ser Gln Gln Asn Asp Asn Met Gly Pro Ala Leu Asn 1105 1110 1115 1120 Ser Asp Ala Asp Phe Ile Asp Ser Leu Leu Lys Thr Glu Pro Gly Asn 1125 1130 1135 Asp Asp Trp Met Lys Asp Ile Asn Leu Asp Glu Ile Leu Gly Asn Asn 1140 1145 1150 Ser <210> 3 <211> 3327 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (3327) <400> 3 atg gct ttc tta act cag cga acc atc cag gag ctg ttt gaa gtt tat 48 Met Ala Phe Leu Thr Gln Arg Thr Ile Gln Glu Leu Phe Glu Val Tyr 1 5 10 15 tct ccc atg gat gat gct ggc ttc ccg gtc aaa gct gag gag ttt gtg 96 Ser Pro Met Asp Asp Ala Gly Phe Pro Val Lys Ala Glu Glu Phe Val 20 25 30 gtg ctt tct cag gaa cct tct gtc acg gaa acc att gca ccc aaa att 144 Val Leu Ser Gln Glu Pro Ser Val Thr Glu Thr Ile Ala Pro Lys Ile 35 40 45 gca aga cct ttc ata gag gcc ctc aag agt att gag tat ctg gag gag 192 Ala Arg Pro Phe Ile Glu Ala Leu Lys Ser Ile Glu Tyr Leu Glu Glu 50 55 60 gat gcc cag aag tcc gca cag gag ggg gtg ctg gga cca cac act gat 240 Asp Ala Gln Lys Ser Ala Gln Glu Gly Val Leu Gly Pro His Thr Asp 65 70 75 80 gct ctg tca tca gac tct gag aac atg ccg tgt gat gaa gaa cca tcc 288 Ala Leu Ser Ser Asp Ser Glu Asn Met Pro Cys Asp Glu Glu Pro Ser 85 90 95 caa tta gag gag cta gct gac ttc atg gag cag ctt aca cca att gaa 336 Gln Leu Glu Glu Leu Ala Asp Phe Met Glu Gln Leu Thr Pro Ile Glu 100 105 110 aaa tat gct tta aat tac ctg gaa tta ttc cat act tct att gag caa 384 Lys Tyr Ala Leu Asn Tyr Leu Glu Leu Phe His Thr Ser Ile Glu Gln 115 120 125 gaa aag gag aga aac agt gag gac gca gtg atg act gcagtg agg gca 432 Glu Lys Glu Arg Asn Ser Glu Asp Ala Val Met Thr Ala Val Arg Ala 130 135 140 tgg gag ttc tgg aac ctg aag acc ctg cag gag agg gag gcc cgg ctg 480 Trp Glu Phe Trp Asn Leu Lys Thr Leu Gln Glu Arg Glu Ala Arg Leu 145 150 155 160 cgg ctg gag cag gag gag gcg gag ctc ctg acc tac acg cga gag gat 528 Arg Leu Glu Gln Glu Glu Ala Glu Leu Leu Thr Tyr Thr Arg Glu Asp 165 170 175 gcc tac agc atg tat gtc tac gaa gat gtc gat ggg cag aca gaa 576 Ala Tyr Ser Met Glu Tyr Val Tyr Glu Asp Val Asp Gly Gln Thr Glu 180 185 190 gtc atg ccg ctc tgg acc cca ccc acc ccg ccg cag gac gac agc gac 624 Pro Leu Trp Thr Pro Pro Thr Pro Pro Gln Asp Asp Ser Asp 195 200 205 atc tac ctc gac tcg gtc atg tgt ctc atg tat gaa gcc act ccc atc 672 Ile Tyr Leu Asp Ser Val Met Cys Leu Met Tyr Glu Ala Thr Pro Il e 210 215 220 cca gag gct aag ctg ccc cct gtg tac gtg agg aag gag cgg aag cga 720 Pro Glu Ala Lys Leu Pro Pro Val Tyr Val Arg Lys Glu Arg Lys Arg 225 230 235 240 cac aaa aca gac ccc tca gct gca ggc agg aag aag aag cag cgt cac 768 His Lys Thr Asp Pro Ser Ala Ala Gly Arg Lys Lys Lys Gln Arg His 245 250 255 ggg gag gcg gtc gtc cct cct cgg tcc ctg ttt gac cgc gca aca cca 816 Gly Glu Ala Val Pro Pro Arg Ser Leu Phe Asp Arg Ala Thr Pro 260 265 270 gga ctt ctg aaa att cgc aga gag ggc aag gag cag aag aag aat att 864 Gly Leu Leu Lys Ile Arg Arg Glu Gly Lys Glu Gln Lys Lys Asn Ile 275 280 285 285 ctg aag cag cag gtg cca ttc gcc aag ccc ctg cca act ttt gcc 912 Leu Leu Lys Gln Gln Val Pro Phe Ala Lys Pro Leu Pro Thr Phe Ala 290 295 300 aaa ccc aca gct gag cct ggt caa gac aac ccc gag tgg ctc atg agt 960 Lys Pro Thr Ala Glu Pro Gly Gln Asp Asn Pro Glu Trp Leu Ile Ser 305 310 315 320 gag gac tgg gcg ctg ctg cag gct gta aag cag tta ctg gag ctg cct 1008 Glu Asp Trp Ala Leu Leu Gln Ala Val Lys Gln L eu Leu Glu Leu Pro 325 330 335 ttg aac ctc aca atc gtg tca cct gct cac aca cct aat tgg gat ctt 1056 Leu Asn Leu Thr Ile Val Ser Pro Ala His Thr Pro Asn Trp Asp Leu 340 345 350 gtc agt gac gtt gtt aac tcc tgt agc cga atc tac cgc tct tcc aaa 1104 Val Ser Asp Val Val Asn Ser Cys Ser Arg Ile Tyr Arg Ser Ser Lys 355 360 365 cag tgc cgg aat cgc tac gag aat gtc atc att cca cga gag gag ggg 1152 Gln Cys Arg Asn Arg Tyr Glu Asn Val Ile Ile Pro Arg Glu Glu Gly 370 375 380 aag agt aaa aac aac cgt cct ctc cgt acg agc cag atc tat gcc cag 1200 Lys Ser Lys Asn Asn Arg Pro Leu Arg Thr Ser Gln Ile Tyr Ala Gln 385 390 395 400 gat gag aat gcc aca cac acc cag ctg tac acg agc cac ttt gac tta 1248 Asp Glu Asn Ala Thr His Thr Gln Leu Tyr Thr Ser His Phe Asp Leu 405 410 415 atg aaa atg act gct ggc aag agg agt ccc cca atc aaa cct ctg ctt 1296 Met Lys Met Thr Ala Gly Lys Arg Ser Pro Pro Ile Lys Pro Leu Leu 420 425 430 ggc atg aat ccc ttt cag aag aac ccc aag cac gcg tct gtg ttg gca 1344 Gly Met Asn Pro Phe Gln Ly s Asn Pro Lys His Ala Ser Val Leu Ala 435 440 445 gaa agt gga atc aac tat gac aag ccg ctg cct ccc atc cag gtg gca 1392 Glu Ser Gly Ile Asn Tyr Asp Lys Pro Leu Pro Pro Ile Gln Val Ala 450 455 460 tct ctc cgt gca gag cga atc gca aaa gag aaa aag gct ctg gct gat 1440 Ser Leu Arg Ala Glu Arg Ile Ala Lys Glu Lys Lys Ala Leu Ala Asp 465 470 475 475 480 cag cag aag gca cag cag ccg gcc ccg gcc cag ccc cag 1488 Gln Gln Lys Ala Gln Gln Pro Ala Val Ala Gln Pro Pro Pro Pro Gln 485 490 ccg cag ccc cca cca ccc ccg cag cag cca ccg cca ccg ctg cca caa 1536 Pro Gln Pro Pro Pro Pro Gln Gln Pro Pro Pro Pro Leu Pro Gln 500 505 510 cca cag gca gcg ggc agc cag ccg cca gca ggg cca cca gct gtc cag 1584 Pro Gln Ala Ala Gly Ser Gln Pro Pro Ala Gly Pro Pro Ala Val Gln 515 520 525 ccc caa ccc cag cca cag ccc cag acc cag cca cag cct gtg cag gcc 1632 Pro Gln Pro Gln Pro Gln Pro Gln Thr Gln Pro Gln Pro Val Gln Ala 530 535 540 cca gcg aag gcg cag ccc gca atc acg acg ggg ggc agt gca gcc gta 1680 Pro Al a Lys Ala Gln Pro Ala Ile Thr Thr Gly Gly Ser Ala Ala Val 545 550 555 560 ctg gca gga acc att aaa aca tca gtt act ggg acg agc atg ccc act 1728 Leu Ala Gly Thr Ile Lys Thr Ser Val Thr Gly Thr Ser Met Pro Thr 565 570 575 ggt gcc gtg agt gga aat gtg atc gtg aac acc atc gca ggg gtc cca 1776 Gly Ala Val Ser Gly Asn Val Ile Val Asn Thr Ile Ala Gly Val Pro 580 585 590 gct gcc acc ttc cag tcc atc aac aag cgc ctg gcg tcg cca gtg gct 1824 Ala Ala Thr Phe Gln Ser Ile Asn Lys Arg Leu Ala Ser Pro Val Ala 595 600 605 cct ggg gcc ttg act acg ccg gga ggc tct gct ccc gcc cag gtg gtg 1872 Pro Gly Ala Le Pro Gly Gly Ser Ala Pro Ala Gln Val Val 610 615 620 620 cac acc cag ccc ccg cca cgg gca gtc ggc tcc cca gcc acg gcg acc 1920 His Thr Gln Pro Pro Pro Arg Ala Val Gly Ser Pro Ala Thr Ala Thr 625 630 635 640 cct gac ctg gtg tcc atg gca acg act cag ggt gtt cga gcg gtc act 1968 Pro Asp Leu Val Ser Met Ala Thr Thr Gln Gly Val Arg Ala Val Thr 645 650 655 tct gtg aca gcc tcg gcc gtg gtc act acc aac ctg acc cca gtg cag 2016 Ser Val Thr Ala Ser Ala Val Val Thr Thr Asn Leu Thr Pro Val Gln 660 665 670 acc ccg gca cgg tct ttg gtg ccc caa gtg tcc caa gcc aca gga gtt 2064 Thr Pro Ala Arg Ser Leu Val Pro Gln Val Ser Gln Ala Thr Gly Val 675 680 685 cag ctc cct gga aaa acc atc aca cct gca cat ttc cag ctt ctc agg 2112 Gln Leu Pro Gly Lys Thr Ile Thr Pro Ala His Phe Gln Leu Leu Arg 690 695 700 cag cag cag cag cag cag caa caa cag cag cag cag cag cag cag cag 2160 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 705 710 715 720 cag cag cag cag cag cag cag caa cag cag cag cag caa cag acg 2208 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Thr Thr 725 730 735 acg acc tct cag gtg caa gtt cca cag atc cag ggc cag gcc cag tcc 2256 Thr Thr Ser Gln Val Gln Val Pro Gln Ile Gln Gly Gln Ala Gln Ser 740 745 750 cca gca cag atc aaa gct gtg ggc aag ctg acg ccg gaa cac ctc atc 2304 Pro Ala Gln Ile Lys Ala Val Gly Lys Leu Thr Pro Glu His Leu Ile 755 760 765 aaa atg cag aag cag aaa ctg cag tg ccc ccg cag ccc cca ccg cca 2352 Lys Met Gln Lys Gln Lys Leu Gln Met Pro Pro Gln Pro Pro Pro Pro 770 775 780 cag gcc cag tct gcg ccc ccg cag cca aca gcc caa gtg caa gtg cag 2400 Gln Ala Gln A Pro Pro Gln Pro Thr Ala Gln Val Gln Val Gln 785 790 795 800 acc tcg cag ccg ccg cag cag cag agc ccc cag ctc acg acg gtc acg 2448 Thr Ser Gln Pro Pro Gln Gln Gln Ser Pro Gln Leu Thr Thr Thr Thr 805 810 815 gcc cca agg cct ggt gcc ctg ctg acg ggc acc acc gtg gcc aac ctc 2496 Ala Pro Arg Pro Gly Ala Leu Leu Thr Gly Thr Thr Val Val Ala Asn Leu 820 825 830 cag gtg gcc cgg ctc acc cgg gtt ccc act tct cag ct cag gcg caa 2544 Gln Val Ala Arg Leu Thr Arg Val Pro Thr Ser Gln Leu Gln Ala Gln 835 840 845 ggg cag atg cag acc cag gca ccc cag cca gcc cag gtg gcc ttg gcg 2592 Gly Gln Met Gln Thr Gln Ala Pro Gln Pro Ala Gln Val Ala Leu Ala 850 855 860 aag cct ccg gtg gtg tcc gtc ccg gca gct gtg gtc tcc tca ccg gga 2640 Lys Pro Pro Val Val Ser Val Pro Ala Ala Val Val Ser Ser Pro Gly 865 870 875 875 880 gtc acc ac c ctg ccc atg aac gtc gcg ggg atc agc gtg gcg atc ggt 2688 Val Thr Thr Leu Pro Met Asn Val Ala Gly Ile Ser Val Ala Ile Gly 885 890 895 cag cca cag aag gca gca gga cag acc gtg gtg gcc cag cccgt 2736 Gln Pro Gln Lys Ala Ala Gly Gln Thr Val Val Ala Gln Pro Val His 900 905 910 atg cag cag ctg ctg aag ctg aag cag cag gcc gtc cag cag cag aag 2784 Met Gln Gln Leu Leu Lys Leu Lys Gln Gln Ala Val Gln Gln Gln Lys 915 920 925 gcc atc cag ccc cag gct gca cag ggc ccg gca gcc gtc cag cag aag 2832 Ala Ile Gln Pro Gln Ala Ala Gla Gln Gly Pro Ala Ala Val Gln Gln Lys 930 935 940 atc acc gca cag atg acc acc cct ggc gcg cag cag aag gtt gcc 2880 Ile Thr Ala Gln Gln Ile Thr Thr Pro Gly Ala Gln Gln Lys Val Ala 945 950 955 960 tac gcc gcg cag ccg gcc ctt aag acc cag ttt ctt acc aca ccc atc 2928 Tyr Ala Gln Pro Ala Leu Lys Thr Gln Phe Leu Thr Thr Pro Ile 965 970 975 tcc cag gcc cag aaa ctg gcc ggg gcc cag caa gtg cag acc cag atc 2976 Ser Gln Ala Gln Lys Leu Ala Gly Ala Gln Gln Val Gln Thr Gln Ile 98 0 985 990 cag gtt gca aaa ctt cct caa gtt gtt caa cag caa aca ccc gtg gcc 3024 Gln Val Ala Lys Leu Pro Gln Val Val Gln Gln Gln Thr Pro Val Ala 995 1000 1005 agc atc cag caa gtt gcc tct gct tcc cag cag gct tct cca cag act 3072 Ser Ile Gln Gln Val Ala Ser Ala Ser Gln Gln Ala Ser Pro Gln Thr 1010 1015 1020 gtg gcg ctc acg cag gcg acg gcg gcc ggg cag cag gtg cag atg atc 3120 Val Ala Leu Thr Gln Ala Thr Ala Ala Gly Gln Gln Val Gln Met Ile 1025 1030 1035 1040 cct gca gtg acc gcg act gcc cag gtg gtt cag cag aaa ctc att cag 3168 Pro Ala Val Thr Ala Thr Ala Gln Val Val Gln Gln Lys Leu Ile Gln 1045 1050 1055 cag cag gtg gtg acc acg gcg tcg gcc ccg ctc cag act cca ggc gct 3216 Gln Gln Val Val Thr Thr Ala Ser Ala Pro Leu Gln Thr Pro Gly Ala 1060 1065 1070 ccc aac cca gcc cag gtg ccc gcc agc tcc gac agc ccag cag 3264 Pro Asn Pro Ala Gln Val Pro Ala Ser Ser Asp Ser Pro Ser Gln Gln 1075 1080 1085 ccc aag tta cag atg agg gtc cct gct gtc agg cta aag aca cct act 3312 Pro Lys Leu Gln Met Arg Val P ro Ala Val Arg Leu Lys Thr Pro Thr 1090 1095 1100 aag cct ccg tgc cag 3327 Lys Pro Pro Cys Gln 1105 <210> 4 <211> 1109 <212> PRT <213> Homo sapiens <400> 4 Met Ala Phe Leu Thr Gln Arg Thr Ile Gln Glu Leu Phe Glu Val Tyr 1 5 10 15 Ser Pro Met Asp Asp Ala Gly Phe Pro Val Lys Ala Glu Glu Phe Val 20 25 30 Val Leu Ser Gln Glu Pro Ser Val Thr Glu Thr Ile Ala Pro Lys Ile 35 40 45 Ala Arg Pro Phe Ile Glu Ala Leu Lys Ser Ile Glu Tyr Leu Glu Glu 50 55 60 Asp Ala Gln Lys Ser Ala Gln Glu Gly Val Leu Gly Pro His Thr Asp 65 70 75 80 Ala Leu Ser Ser Asp Ser Glu Asn Met Pro Cys Asp Glu Glu Pro Ser 85 90 95 Gln Leu Glu Glu Leu Ala Asp Phe Met Glu Gln Leu Thr Pro Ile Glu 100 105 110 Lys Tyr Ala Leu Asn Tyr Leu Glu Leu Phe His Thr Ser Ile Glu Gln 115 120 125 Glu Lys Glu Arg Asn Ser Glu Asp Ala Val Met Thr Ala Val Arg Ala 130 135 140 Trp Glu Phe Trp Asn Leu Lys Thr Leu Gln Glu Arg Glu Ala Arg Leu 145 150 155 160 Arg Leu Glu Gln Glu Glu Ala Glu Leu Leu Thr Tyr Thr Arg Glu Asp 165 170 175 Ala Tyr Ser Met Glu Tyr Val Tyr Glu Asp Val Asp Gly Gln Thr Glu 180 185 190 Val Met Pro Leu Trp Thr Pro Pro Thr Pro Pro Gln Asp Asp Ser Asp 195 200 205 Ile Tyr Leu A sp Ser Val Met Cys Leu Met Tyr Glu Ala Thr Pro Ile 210 215 220 Pro Glu Ala Lys Leu Pro Pro Val Tyr Val Arg Lys Glu Arg Lys Arg 225 230 235 240 His Lys Thr Asp Pro Ser Ala Ala Gly Arg Lys Lys Lys Gln Arg His 245 250 255 Gly Glu Ala Val Val Pro Pro Arg Ser Leu Phe Asp Arg Ala Thr Pro 260 265 270 Gly Leu Leu Lys Ile Arg Arg Glu Gly Lys Glu Gln Lys Lys Asn Ile 275 280 285 285 Leu Leu Lys Gln Gln Val Pro Phe Ala Lys Pro Leu Pro Thr Phe Ala 290 295 300 Lys Pro Thr Ala Glu Pro Gly Gln Asp Asn Pro Glu Trp Leu Ile Ser 305 310 315 320 Glu Asp Trp Ala Leu Leu Gln Ala Val Lys Gln Leu Leu Glu Leu Pro 325 330 335 Leu Asn Leu Thr Ile Val Ser Pro Ala His Thr Pro Asn Trp Asp Leu 340 345 350 Val Ser Asp Val Val Asn Ser Cys Ser Arg Ile Tyr Arg Ser Ser Lys 355 360 365 Gln Cys Arg Asn Arg Tyr Glu Asn Val Ile Ile Pro Arg Glu Glu Gly 370 375 380 Lys Ser Lys Asn Asn Arg Pro Leu Arg Thr Ser Gln Ile Tyr Ala Gln 385 390 395 400 Asp Glu Asn Ala Thr His Thr Gln Leu Tyr Thr Ser His Phe Asp Leu 405 410 415 Met Lys Met T hr Ala Gly Lys Arg Ser Pro Pro Ile Lys Pro Leu Leu 420 425 430 Gly Met Asn Pro Phe Gln Lys Asn Pro Lys His Ala Ser Val Leu Ala 435 440 445 Glu Ser Gly Ile Asn Tyr Asp Lys Pro Leu Pro Pro Ile Gln Val Ala 450 455 460 Ser Leu Arg Ala Glu Arg Ile Ala Lys Glu Lys Lys Ala Leu Ala Asp 465 470 475 480 Gln Gln Lys Ala Gln Gln Pro Ala Val Ala Gln Pro Pro Pro Pro Gln 485 490 495 Pro Gln Pro Pro Pro Pro Pro Gln Gln Pro Pro Pro Pro Leu Pro Gln 500 505 510 Pro Gln Ala Ala Gly Ser Gln Pro Pro Ala Gly Pro Pro Ala Val Gln 515 520 525 525 Pro Gln Pro Gln Pro Gln Pro Gln Thr Gln Pro Gln Pro Val Gln Ala 530 535 540 Pro Ala Lys Ala Gln Pro Ala Ile Thr Thr Gly Gly Ser Ala Ala Val 545 550 555 560 Leu Ala Gly Thr Ile Lys Thr Ser Val Thr Gly Thr Ser Met Pro Thr 565 570 575 Gly Ala Val Ser Gly Asn Val Ile Val Asn Thr Ile Ala Gly Val Pro 580 585 590 Ala Ala Thr Phe Gln Ser Ile Asn Lys Arg Leu Ala Ser Pro Val Ala 595 600 605 Pro Gly Ala Leu Thr Thr Pro Gly Gly Ser Ala Pro Ala Gln Val Val 610 615 615 620 His Thr Gln ProPro Pro Arg Ala Val Gly Ser Pro Ala Thr Ala Thr 625 630 635 640 640 Pro Asp Leu Val Ser Met Ala Thr Thr Gln Gly Val Arg Ala Val Thr 645 650 655 Ser Val Thr Ala Ser Ala Val Val Thr Thr Asn Leu Thr Pro Val Gln 660 665 670 Thr Pro Ala Arg Ser Leu Val Pro Gln Val Ser Gln Ala Thr Gly Val 675 680 685 Gln Leu Pro Gly Lys Thr Ile Thr Pro Ala His Phe Gln Leu Leu Arg 690 695 700 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 705 710 715 720 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Thr Thr 725 730 735 Thr Thr Ser Ser Gln Val Gln Val Pro Gln Ile Gln Gly Gln Ala Gln Ser 740 745 750 Pro Ala Gln Ile Lys Ala Val Gly Lys Leu Thr Pro Glu His Leu Ile 755 760 765 Lys Met Gln Lys Gln Lys Leu Gln Met Pro Pro Gln Pro Pro Pro 770 775 780 780 Gln Ala Gln Ser Ala Pro Pro Gln Pro Thr Ala Gln Val Gln Val Gln 785 790 795 800 Thr Ser Gln Pro Pro Gln Gln Gln Ser Pro Gln Leu Thr Thr Val Thr 805 810 815 Ala Pro Arg Pro Gly Ala Leu Leu Thr Gly Thr Thr Val Ala Asn Leu 820 825 830 Gln Val Ala Arg Leu Thr Arg Val Pro Thr Ser Gln Leu Gln Ala Gln 835 840 845 Gly Gln Met Gln Thr Gln Ala Pro Gln Pro Ala Gln Val Ala Leu Ala 850 855 860 Lys Pro Pro Val Val Ser Val Pro Ala Ala Val Val Ser Ser Pro Gly 865 870 875 880 Val Thr Thr Leu Pro Met Asn Val Ala Gly Ile Ser Val Ala Ile Gly 885 890 895 Gln Pro Gln Lys Ala Ala Gly Gln Thr Val Val Ala Gln Pro Val His 900 905 910 Met Gln Gln Leu Leu Lys Leu Lys Gln Gln Ala Val Gln Gln Gln Lys 915 920 925 925 Ala Ile Gln Pro Gln Ala Ala Gln Gly Pro Ala Ala Val Gln Gln Lys 930 935 940 Ile Thr Ala Gln Gln Ile Thr Thr Pro Gly Ala Gln Gln Lys Val Ala 945 950 955 960 Tyr Ala Ala Gln Pro Ala Leu Lys Thr Gln Phe Leu Thr Thr Pro Ile 965 970 975 Ser Gln Ala Gln Lys Leu Ala Gly Ala Gln Gln Val Gln Thr Gln Ile 980 985 990 Gln Val Ala Lys Leu Pro Gln Val Val Gln Gln Gln Thr Pro Val Ala 995 1000 1005 Ser Ile Gln Gln Val Ala Ser Ala Ser Gln Gln Ala Ser Pro Gln Thr 1010 1015 1020 Val Ala Leu Thr Gln Ala Thr Ala Ala Gly Gln Gln Val Gln Met Ile 1025 1030 1035 1040 Pro A la Val Thr Ala Thr Ala Gln Val Val Gln Gln Lys Leu Ile Gln 1045 1050 1055 Gln Gln Val Val Thr Thr Ala Ser Ala Pro Leu Gln Thr Pro Gly Ala 1060 1065 1070 Pro Asn Pro Ala Gln Val Pro Ala Ser Ser Asp Ser Pro Ser Gln Gln 1075 1080 1085 Pro Lys Leu Gln Met Arg Val Pro Ala Val Arg Leu Lys Thr Pro Thr 1090 1095 1100 Lys Pro Pro Cys Gln 1105 <210> 5 <211> 4920 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (4920) <400> 5 atg cag tct ttt cga gaa agg tgt ggt ttc cat ggc aaa caa cag aac 48 Met Gln Ser Phe Arg Glu Arg Cys Gly Phe His Gly Lys Gln Gln Asn 1 5 10 15 tac cag cag acc tcg cag gaa aca tca cgc cta gag aat tac agg cag 96 Tyr Gln Gln Thr Ser Gln Glu Thr Ser Arg Leu Glu Asn Tyr Arg Gln 20 25 30 ccg agt cag gcc ggg cta agc tgc gac cgg cag cgg ctg ctc gcc aag 144 Pro Ser Gln Ala Gly Leu Ser Cys Asp Arg Gln Arg Leu Leu Ala Lys 35 40 45 gac tat tat aac ccg cag cct tac ccg agc tat gag ggt ggc gct ggc 192 Asp Tyr Tyr Asn Pro Gln Pro Tyr Pro Ser Tyr Glu Gly Gly Ala Gly 50 55 60 acg ccc tct ggc act gca gcc gcg gtg gcc gcc gac aag tac cac cga 240 Thr Pro Ser Gly Thr Ala Ala Ala Val Ala Ala Asp Lys Tyr His Arg 65 70 75 80 ggc agc aag gcc ctg ccc aca cag caa ggc ctg cag ggg agg ccg gct 288 Gly Ser Lys Ala Leu Pro Thr Gln Gln Gly Leu Gln Gly Arg Pro Ala 85 90 95 ttc cct ggc tac ggc gtc cag gac agc agc ccc tac cca ggc cgc tat 336 Phe Pro Gly Tyr Gly Val Gln Asp Ser Ser Tyr Pro Gly Arg Tyr 100 105 110 gct ggt gag gag agc ctt cag gct tgg ggg gcc cca cag cca cca ccc 384 Ala Gly Glu Glu Ser Leu Gln Ala Trp Gly Ala Pro Gln Pro Pro Pro 115 120 125 cca cag ccg cag cca cta cct gca ggg gtg gcc aag tat gat gag aac 432 Pro Gln Pro Gln Pro Leu Pro Ala Gly Val Ala Lys Tyr Asp Glu Asn 130 135 140 ttg atg aaa aag aca gca gtg ccc ccc agc agg cag tat gca gag cag 480 Leu Met Lys Lys Thr Ala Val Pro Pro Ser Arg Gln Tyr Ala Glu Gln 145 150 155 160 ggc gcc cag gtg ccc ttt cgg act cac tcc ctg cac gtc cag cag cca 528 Gly Ala Gln Val Pro Phe Arg Thr His Ser Leu His Val Gln Gln Pro 165 170 175 ccg ccg ccc cag cag ccc ctg gca tac ccc aag ctc caa agg cag aag 576 Pro Pro Pro Gln Gln Pro Leu Ala Tyr Pro Lys Leu Gln Arg Gln Lys 180 185 190 ctg cag aac gac att gcc tcc cct ctg ccc ttc ccc cag ggt acc cac 624 Leu Gln Asn Asp Ile Ala Ser Pro Leu Pro Phe Pro Gln Gly Thr His 195 200 205 ttt cct cag cat tcc cag tcc ttc ccc acc tcc tcc acc tac tcc tcc 672 Phe Pro Gln His Ser Gln Ser Phe Pro Thr Ser Ser Thr Tyr Ser Se r 210 215 220 tct gtc cag ggt ggt ggg cag ggg gcc cac tcc tat aag agt tgc aca 720 Ser Val Gln Gly Gly Gly Gln Gly Ala His Ser Tyr Lys Ser Cys Thr 225 230 235 240 gca ccg act gcc cag ccc cat gac agg ccg ctg act gcc agc tcc agc 768 Ala Pro Thr Ala Gln Pro His Asp Arg Pro Leu Thr Ala Ser Ser Ser 245 250 255 ctg gcc ccg ggg cag cgg gtc cag aat ctt cat gcc tac cag tcg ggc 816 Leu Ala Pro Gly Gln Arg Val Gln Asn Leu His Ala Tyr Gln Ser Gly 260 265 270 cgc ctc agc tat gac cag cag cag cag cag cag cag cag cag cag cag 864 Arg Leu Ser Tyr Asp Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 275 280 ca cag caa gcc ctt cag agc cgg cac cat gcc cag gaa acc ctc cat 912 Gln Gln Gln Ala Leu Gln Ser Arg His His Ala Gln Glu Thr Leu His 290 295 300 tac caa aac ctc gcc aag tat cag cac tac ggg cag caa ggc cag ggc 960 Tyr Gln Asn Leu Ala Lys Tyr Gln His Tyr Gly Gln Gln Gly Gln Gly 305 310 315 320 tac tgc cag ccg gac gca gcc gtc cgg acc cca gag cag tac tac cag 1008 Tyr Cys Gln Pro Asp Ala Ala Val Arg Thr ProGlu Gln Tyr Tyr Gln 325 330 335 acc ttc agc ccc agc tcc agc cac tca ccc gcc cgc tcc gtg ggc cgc 1056 Thr Phe Ser Pro Ser Ser Ser Ser His Ser Pro Ala Arg Ser Val Gly Arg 340 345 350 tca cct tcc tac agt tcc aca ccg tcg ccg ctg atg cca aac ctg gag 1104 Ser Pro Ser Tyr Ser Ser Thr Pro Ser Pro Leu Met Pro Asn Leu Glu 355 360 365 aac ttt ccc tac agc cag cag ccg ctc agc acc ggg gcc ttc ccc gca 1152 Asn Phe Pro Tyr Ser Gln Gln Pro Leu Ser Thr Gly Ala Phe Pro Ala 370 375 380 ggg atc act gac cac agc cac ttc atg ccc ctg ctc aat ccc tcc cca 1200 Gly Ile Thr Asp His Ser His Phe Met Pro Leu Leu Asn Pro Ser Pro 385 390 395 400 acg gat gcc acc agc tct gtg gac acc cag gct ggc aac tgc aag ccc 1248 Thr Asp Ala Thr Ser Ser Val Asp Thr Gln Ala Gly Asn Cys Lys Pro 405 410 415 ctt cag aag gac aag ctc cct gag aac ctg ctg tcg gat ctc agc ctg 1296 Leu Gln Lys Asp Lys Leu Pro Glu Asn Leu Leu Ser Asp Leu Ser Leu 420 425 430 cag agc ctc acg gcg ctg acc tca cag gtg gag aac atc tcc aac acc 1344 Gln Ser Leu Thr Alau hr Ser Gln Val Glu Asn Ile Ser Asn Thr 435 440 445 gtc cag cag ctg ctg ctc tcc aag gct gct gtg ccg cag aag aaa ggt 1392 Val Gln Gln Leu Leu Leu Ser Lys Ala Ala Val Pro Gln Lys Lys Gly 450 455 460 460gtc aag aac ctc gtg tcc agg acc cca gag cag cat aaa agc cag cac 1440 Val Lys Asn Leu Val Ser Arg Thr Pro Glu Gln His Lys Ser Gln His 465 470 470 475 480 tgc agc ccc gaa ggg agc ggc tac tca gcc gag ccc gca gg aca ccg 1488 Cys Ser Pro Glu Gly Ser Gly Tyr Ser Ala Glu Pro Ala Gly Thr Pro 485 490 ctg tca gag ccg ccg agc agc acg cca cag tcc acg cat gcg gag ccg 1536 Leu Ser Glu Pro Pro Ser Ser Thr Pro Gln Ser Thr His Ala Glu Pro 500 505 510 cag gag gcc gac tac ctg agc ggc tcc gag gac cca ctg gag cgc agc 1584 Gln Glu Ala Asp Tyr Leu Ser Gly Ser Glu Asp Pro Leu Glu Arg Ser 515 520 525 ttc ctc tac tg agc gcc cgt ggc agc cct gcc agg gtc aac agc 1632 Phe Leu Tyr Cys Asn Gln Ala Arg Gly Ser Pro Ala Arg Val Asn Ser 530 535 540 aac tcg aag gcc aag ccc gag tcc gtg tcc acc tgt tct gtg acc tct 1680 Asn r Lys Ala Lys Pro Glu Ser Val Ser Thr Cys Ser Val Thr Ser 545 550 555 560 cct gac gac atg tcc acc aaa tct gac gac tcc ttc cag agc cta cac 1728 Pro Asp Asp Met Ser Thr Lys Ser Asp Asp Ser Phe Gln Ser Leu His 565 570 575 ggc agt ctg ccg ctc gac agc ttc tcc aag ttc gtg gcg ggt gag cgg 1776 Gly Ser Leu Pro Leu Asp Ser Phe Ser Lys Phe Val Ala Gly Glu Arg 580 585 590 590 gac tgt ccg cg ccg ccg ctg ctg gca cag gag gac ctg gcc 1824 Asp Cys Pro Arg Leu Leu Leu Ser Ala Leu Ala Gln Glu Asp Leu Ala 595 600 605 tcc gag atc ctg ggg ctg cag gaa gcc atc ggt gag aag gcc gac aaa 1872 Ser Gly Leu Leu Gln Glu Ala Ile Gly Glu Lys Ala Asp Lys 610 615 620 gct tgg gct gaa gca ccc agc ctg gtc aag gac agc agc aag cca ccc 1920 Ala Trp Ala Glu Ala Pro Ser Leu Val Lys Asp Ser Ser Lys Pro Pro 625 630 635 ttc tcg ctg gag aac cac agc gcc tgc ctg gac tct gtg gcc aag agt 1968 Phe Ser Leu Glu Asn His Ser Ala Cys Leu Asp Ser Val Ala Lys Ser 645 650 655 gcg tgg ccc cgg cct ggg gag cca gag gcc cg tcc ttg cag 2016 Ala Trp Pro Arg Pro Gly Glu Pro Glu Ala Leu Pro Asp Ser Leu Gln 660 665 670 ctg gac aag ggc ggc aat gcc aag gac ttc agc cca ggg ctg ttt gaa 2064 Leu Asp Lys Gly Gly Asn Ala Lys Ser Pro Gly Leu Phe Glu 675 680 685 gac cct tcc gtg gcc ttc gct acg cct gac ccc aaa aag aca act ggt 2112 Asp Pro Ser Val Ala Phe Ala Thr Pro Asp Pro Lys Lys Thr Thr Gly 690 695 700 cct ctc tcc ttt ggt acc aag ccc acc ctt ggg gtt cct gct cca gac 2160 Pro Leu Ser Phe Gly Thr Lys Pro Thr Leu Gly Val Pro Ala Pro Asp 705 710 715 720 720 ccc act aca gca gct ttt gac tgt ttc ccg gac aca acc gct gcc agc 2208 Pro Thr Thr Ala Ala Phe Asp Cys Phe Pro Asp Thr Thr Ala Ala Ser 725 730 735 tca gcg gac agc gcc aac ccc ttt gcc tgg cca gag gaa aac ctg ggg 2256 Ser Ala Asp Ser Ala Asn Pro Phe Ala Trp Pro Glu Glu Asn Leu Gly 740 745 750 gat gct tgt ccc agg tgg gga ttg cac cct ggc gag ctt acc aag ggc 2304 Asp Ala Cys Pro Arg Trp Gly Leu His Pro Gly Glu Leu Thr Lys Gly 755 760 765 ctg gag cag ggt ggg aag gcc tca gat ggc atc agc aaa ggg gac acc 2352 Leu Glu Gln Gly Gly Lys Ala Ser Asp Gly Ile Ser Lys Gly Asp Thr 770 775 780 cat gag gct tcg gcc tgc ctg ggc ttc cag gag gag gac ccc cct ggg 2400 His Glu Ala Ser Cys Leu Gly Phe Gln Glu Glu Asp Pro Pro Gly 785 790 795 800 gag aag gtg gcc tcg ttg ccc ggg gac ttc aag cag gag gag gtg ggt 2448 Glu Lys Val Ala Ser Leu Pro Gly Asp Phe Lys Gln Glu Glu Val Gly 805 815 ggg gtg aag gag gag gca ggt ggg ctg ctg cag tgc ccc gag gtg gcc 2496 Gly Val Lys Glu Glu Ala Gly Gly Leu Leu Gln Cys Pro Glu Val Ala 820 825 830 aag gct gac cgg tgg ctg gag gac tg cgt tcc acc gcc 2544 Lys Ala Asp Arg Trp Leu Glu Asp Ser Arg His Cys Cys Ser Thr Ala 835 840 845 gac ttc ggg gac ctc cca ctg ctg cca ccc acc agc agg aag gag gac 2592 Asp Phe Gly Asp Leu Pro Leu Leu Pro Thr Ser Arg Lys Glu Asp 850 855 860 ctg gaa gct gag gag gag tac tcc tcc cta tgt gag ctc ctg ggc agc 2640 Leu Glu Ala Glu Glu Glu Tyr Ser Ser Leu Cys Glu Leu Leu Gly Ser 865 870 870 875 880 ccc gag ag agg cct ggc atg cag gac ccg ctg tca ccc aag gcc cca 2688 Pro Glu Gln Arg Pro Gly Met Gln Asp Pro Leu Ser Pro Lys Ala Pro 885 890 895 ctc atc tgc acc aag gag gag gtg gag gag gtg actg gcc tcc 2736 Leu Ile Cys Thr Lys Glu Glu Val Glu Glu Val Leu Asp Ser Lys Ala 900 905 910 ggc tgg ggc tct ccg tgc cac ctc tca ggg gag tcc gtc atc ctg ctg 2784 Gly Trp Gly Ser Pro Cys His Leu Ser Gly Glu Ser Val Ile Leu Leu 915 920 925 ggc cct aca gtg ggc acc gag tca aag gtc cag agc tgg ttt gag tcc 2832 Gly Pro Thr Val Gly Thr Glu Ser Lys Val Gln Ser Trp Phe Glu Ser 930 935 940 tct ctg tca cac atg aag cca g gaa gag ggg cct gat ggg gag cga 2880 Ser Leu Ser His Met Lys Pro Gly Glu Glu Gly Pro Asp Gly Glu Arg 945 950 955 960 gct cca ggg gat tcc acc acc tcg gac gcc tct ctg gcc cag aag ccc 2928 Ala Pro Gly Asp Ser Thr Thr Ser Asp Ala Ser Leu Ala Gln Lys Pro 965 970 975 aac aag cct gct gtg ccc gag gcg ccc atc gca aag aaa gag cct gtg 2976 Asn Lys Pro Ala Val Pro Glu Ala Pro Ile Ala Lys Lys Glu Pro Val 98 0 985 990 cca cgg ggc aaa agc tta cgg agc cgt cgg gtg cac cgg ggg ctg ccc 3024 Pro Arg Gly Lys Ser Leu Arg Ser Arg Arg Val His Arg Gly Leu Pro 995 1000 1005 gag gcc gag gac tcc cca tgc agg gca cca gt ctg ccc aaa gac ctc 3072 Glu Ala Glu Asp Ser Pro Cys Arg Ala Pro Val Leu Pro Lys Asp Leu 1010 1015 1020 ttg ctc cct gaa tcc tgc aca ggg ccc ccc cag gga cag atg gaa ggg 3120 Leu Leu Pro Glu Ser Cys Thr Pro Pro Gln Gly Gln Met Glu Gly 1025 1030 1035 1040 gct gga gcc cca ggc cgg ggg gcc tcg gaa ggg ctc ccc agg atg tgt 3168 Ala Gly Ala Pro Gly Arg Gly Ala Ser Glu Gly Leu Pro Arg Met Cys 1045 1050 1055 c tct ctc acg gcc ctg agt gag ccc cgc acg ccc gga ccc cca 3216 Thr Arg Ser Leu Thr Ala Leu Ser Glu Pro Arg Thr Pro Gly Pro Pro 1060 1065 1070 ggc ctg acc acc acc cct gca ccc cca gac aaa ctg ggg ggc aag cag 3264 Gly Leu Thr Thr Thr Pro Ala Pro Pro Asp Lys Leu Gly Gly Lys Gln 1075 1080 1085 cga gcc gcc ttc aag tcg ggc aag cgg gtg ggg aag ccc tca ccc aag 3312 Arg Ala Ala Pla Lys Ser Gly Lys Arg Val Gly Lys Pro Ser Pro Lys 1090 1095 1100 gct gcc tcc agc ccc agc aac ccg gcc gcc ctg cct gtg gcc tcc gac 3360 Ala Ala Serla Ser Ser Pro Ser Asn Pro Ala Ala Leu Pro Val Ala Ser Asp 1105 1110 1115 1120 agc agc ccg atg ggc tcc aag acc aag gag aca gac tca ccc agc acg 3408 Ser Ser Pro Met Gly Ser Lys Thr Lys Glu Thr Asp Ser Pro Ser Thr 1125 1130 1135 cct ggc aag gac cag cgc tcc atg atc ctt cgg tca cgc acc aaa acc 3456 Pro Gly Lys Asp Gln Arg Ser Met Ile Leu Arg Ser Arg Thr Lys Thr 1140 1145 1150 cag gag atc ttc cac tcc aag cgg cgg agg ccc tct gag ggc cgg ctc 3504 Gln Glu Ile Phe His Ser Lys Arg Arg Arg Pro Ser Glu Gly Arg Leu 1155 1160 1165 ccc aac tgc cgt gcc acc aag aag ctc ctc gac aac agc cac ttg ccc 3552 Pro Asn Cys Arg Ala Thr Lys Lys Leu Leu Asp Asn Ser His Leu Pro 1170 1175 1180 gcc aca ttcc aag gtc ag gtc agc ccc cag aag gag ggc agg gtg agc 3600 Ala Thr Phe Lys Val Ser Ser Ser Pro Gln Lys Glu Gly Arg Val Ser 1185 1190 1195 1200 cag cgg gca agg gtc ccc aaa cct ggt gca ggc agc aag ctc tct gac 3648 Gln Arg Ala Arg Val Pro Lys Pro Gly Ala Gly Ser Lys Leu Ser Asp 1205 1210 1215 cgg ccc ctc cat gcg ctc aaa agg aag tcg gcc ttc atg gcg ccg gtc 3696 Arg Pro Leu His Ala Leu Lys Arg Ala Phe Met Ala Pro Val 1220 1225 1230 ccc acc aag aag cgg aac ctg gtc ttg cgg agc cgc agc agc agc agc 3744 Pro Thr Lys Lys Ars Asg Len Val Leu Arg Ser Arg Ser Ser Ser Ser 1235 1240 1245 agc aac gcc agt aat ggg gga gat ggg aag gag gag agg cct gag 3792 Ser Asn Ala Ser Gly Asn Gly Gly Asp Gly Lys Glu Glu Arlu Pro Glu 1250 1255 1260 ggt tcc ccc acc ctc ttc aag agg atg tct tct ccc aag aaa gcc aag 3840 Gly Pro Thr Leu Phe Lys Arg Met Ser Ser Pro Lys Lys Ala Lys 1265 1270 1275 1280 ccc acc aag ggc aat ggc gag cct gcc aca aag ctc cca ccc ccg gag 3888 Pro Thr Lys Gly Asn Gly Glu Pro Ala Thr Lys Leu Pro Pro Pro Glu 1285 1290 1295 acc ccc gat gcc tgc ctc aag ctc gcc tct cgg gca gcc ttc cag ggg 3936 Thr Pro Asp Ala Cys Leu Lys Leu Ala Ser Arg Ala Ala Phe Gln Gly 1300 1305 1310 gcc atg aa g acc aag gtg ctg cca ccc cgg aag ggc cgg ggc ctg aag 3984 Ala Met Lys Thr Lys Val Leu Pro Pro Arg Lys Gly Arg Gly Leu Lys 1315 1320 1325 ctg gaa gcc atc gtg cag aag atc acc tcg ccc agcct ccc agcct 4032 Leu Glu Ala Ile Val Gln Lys Ile Thr Ser Pro Ser Leu Lys Lys Phe 1330 1335 1340 gca tgt aaa gcg cca ggg gcc tct cct ggt aat cct ctg agc cca tcc 4080 Ala Cys Lys Ala Pro Gly Ala Ser Pro Gly Asn Pro Leu Ser Pro Ser 1345 1350 1355 1360 ctt tcc gac aaa gac cgt ggg ctc aag ggt gct ggg ggc agc cca gtg 4128 Leu Ser Asp Lys Asp Arg Gly Leu Lys Gly Ala Gly Gly Ser Pro Val 1365 1370 1375 ggg gtg gaga gata gc g aat gtg ggc acc ggg cag aag ctc cca 4176 Gly Val Glu Glu Gly Leu Val Asn Val Gly Thr Gly Gln Lys Leu Pro 1380 1385 1390 act tct ggg gct gat ccg tta tgc aga aat cca acc aac aga tcc tta 4224 Thr Ser Gly Ala Asp Pro Leu Cys Arg Asn Pro Thr Asn Arg Ser Leu 1395 1400 1405 aaa ggc aaa ctc atg aac agt aag aaa ctg tct tct act gac tgt ttc 4272 Lys Gly Lys Leu Met Asn Ser Lys Lys Leu Ser Ser Thr Asp Cys Phe 1410 1415 1420 aaa acc gag gcc ttc aca tcc ccg gag gcc ctg cag cct ggg ggg act 4320 Lys Thr Glu Ala Phe Thr Ser Pro Glu Ala Leu Gln Pro Gly Gly Thr 1425 1430 1435 1440 gcc ctg gcg cct aag aag agg agc cgg aaa ggc cgg gca ggg gcc cat 4368 Ala Leu Ala Pro Lys Lys Arg Ser Arg Lys Gly Arg Ala Gly Ala His 1445 1450 1455 gga ctc tcc aaa ggc ccg ctg gag aag cgg ccc tat ctt ggc ccg gct 4 416 Lys Gly Pro Leu Glu Lys Arg Pro Tyr Leu Gly Pro Ala 1460 1465 1470 ctg ctc ctg act ccc cga gac agg gcc agt ggc aca caa ggg gcc agt 4464 Leu Leu Leu Thr Pro Arg Asp Arg Ala Ser Gly Thr Gln Gly Ala Ser 1475 1480 1485 gag gac aac tct ggt gga gga ggc aag aag cca aag atg gag gag ctg 4512 Glu Asp Asn Ser Gly Gly Gly Gly Lys Lys Pro Lys Met Glu Glu Leu 1490 1495 1500 ggc ctg gcc tcc cag ccc ccg gag ggc cag ccc cag aca 4560 Gly Leu Ala Ser Gln Pro Pro Glu Gly Arg Pro Cys Gln Pro Gln Thr 1505 1510 1515 1520 agg gca cag aaa cag cca ggc cac acc aac tac agc agc tat tcc aag 4608 A rg Ala Gln Lys Gln Pro Gly His Thr Asn Tyr Ser Ser Tyr Ser Lys 1525 1530 1535 cgg aag cgc ctc act cgg ggc cgg gcc aag aac acc acc tct tca ccc 4656 Arg Lys Arg Leu Thr Arg Gly Arg Ala Lys Asn Thr Thr Ser Ser Pro 1540 1545 1550 tgt aag ggg cgt gcc aag cga cga cga cag cag cag gtg ctg ccc ctg 4704 Cys Lys Gly Arg Ala Lys Arg Arg Arg Gln Gln Gln Val Leu Pro Leu 1555 1560 1565 gat ccc gca gag cct cga atc aag tac att tcc tct tgc aag 4752 Asp Pro Ala Glu Pro Glu Ile Arg Leu Lys Tyr Ile Ser Ser Cys Lys 1570 1575 1580 cgg ctg agg tca gac agc cgg acc ccc gcc ttc tca ccc ctg gag ccc 4800 Arg Leu Arg Serp Serp Arg Thr Pro Ala Phe Ser Pro Leu Glu Pro 1585 1590 1595 1600 agc ctg gga gcg caa aac cca aga agc ggc cag aac gca cct ccg gct 4848 Ser Leu Gly Ala Gln Asn Pro Arg Ser Gly Gln Asn Ala Pro Pro Ala 1605 1610 1615 ccg gcg gac gcg cga ccg ttg tgc acc acc agg gac cgc cgc gcc tac 4896 Pro Ala Asp Ala Arg Pro Leu Cys Thr Thr Arg Asp Arg Arg Ala Tyr 1620 1625 1630 tct gca cgg gag cag gga cag c gc 4920 Ser Ala Arg Glu Gln Gly Gln Arg 1635 1640 <210> 6 <211> 1640 <212> PRT <213> Homo sapiens <400> 6 Met Gln Ser Phe Arg Glu Arg Cys Gly Phe His Gly Lys Gln Gln Asn 1 5 10 15 Tyr Gln Gln Thr Ser Gln Glu Thr Ser Arg Leu Glu Asn Tyr Arg Gln 20 25 30 Pro Ser Gln Ala Gly Leu Ser Cys Asp Arg Gln Arg Leu Leu Ala Lys 35 40 45 Asp Tyr Tyr Asn Pro Gln Pro Tyr Pro Ser Tyr Glu Gly Gly Ala Gly 50 55 60 Thr Pro Ser Gly Thr Ala Ala Ala Val Ala Ala Asp Lys Tyr His Arg 65 70 75 80 Gly Ser Lys Ala Leu Pro Thr Gln Gln Gly Leu Gln Gly Arg Pro Ala 85 90 95 Phe Pro Gly Tyr Gly Val Gln Asp Ser Ser Pro Tyr Pro Gly Arg Tyr 100 105 110 Ala Gly Glu Glu Ser Leu Gln Ala Trp Gly Ala Pro Gln Pro Pro Pro 115 120 125 Pro Gln Pro Gln Pro Leu Pro Ala Gly Val Ala Lys Tyr Asp Glu Asn 130 135 140 Leu Met Lys Lys Thr Ala Val Pro Pro Ser Arg Gln Tyr Ala Glu Gln 145 150 155 160 Gly Ala Gln Val Pro Phe Arg Thr His Ser Leu His Val Gln Gln Pro 165 170 175 Pro Pro Pro Gln Gln Pro Leu Ala Tyr Pro Lys Leu Gln Arg Gln Lys 180 185 190 Leu Gln Asn Asp Ile Ala Ser Pro Leu Pro Phe Pro Gln Gly Thr His 195 200 205 Phe Pro Gln Hi s Ser Gln Ser Phe Pro Thr Ser Ser Thr Tyr Ser Ser 210 215 220 Ser Val Gln Gly Gly Gly Gln Gly Ala His Ser Tyr Lys Ser Cys Thr 225 230 235 240 Ala Pro Thr Ala Gln Pro His Asp Arg Pro Leu Thr Ala Ser Ser Ser 245 250 255 Leu Ala Pro Gly Gln Arg Val Gln Asn Leu His Ala Tyr Gln Ser Gly 260 265 270 Arg Leu Ser Tyr Asp Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 275 280 285 285 Gln Gln Gln Ala Leu Gln Ser Arg His His Ala Gln Glu Thr Leu His 290 295 300 Tyr Gln Asn Leu Ala Lys Tyr Gln His Tyr Gly Gln Gln Gly Gln Gly 305 310 315 320 Tyr Cys Gln Pro Asp Ala Ala Val Arg Thr Pro Glu Gln Tyr Tyr Gln 325 330 335 Thr Phe Ser Pro Ser Ser Ser His Ser Pro Ala Arg Ser Val Gly Arg 340 345 350 Ser Pro Ser Tyr Ser Ser Thr Pro Ser Pro Leu Met Pro Asn Leu Glu 355 360 365 Asn Phe Pro Tyr Ser Gln Gln Pro Leu Ser Thr Gly Ala Phe Pro Ala 370 375 380 Gly Ile Thr Asp His Ser His Phe Met Pro Leu Leu Asn Pro Ser Pro 385 390 395 400 400 Thr Asp Ala Thr Ser Ser Val Asp Thr Gln Ala Gly Asn Cys Lys Pro 405 410 415 Leu Gln Lys A sp Lys Leu Pro Glu Asn Leu Leu Ser Asp Leu Ser Leu 420 425 430 Gln Ser Leu Thr Ala Leu Thr Ser Gln Val Glu Asn Ile Ser Asn Thr 435 440 445 Val Gln Gln Leu Leu Leu Ser Lys Ala Ala Val Pro Gln Lys Lys Gly 450 455 460 Val Lys Asn Leu Val Ser Arg Thr Pro Glu Gln His Lys Ser Gln His 465 470 475 480 Cys Ser Pro Glu Gly Ser Gly Tyr Ser Ala Glu Pro Ala Gly Thr Pro 485 490 495 Leu Ser Glu Pro Pro Ser Ser Thr Pro Gln Ser Thr His Ala Glu Pro 500 505 510 Gln Glu Ala Asp Tyr Leu Ser Gly Ser Glu Asp Pro Leu Glu Arg Ser 515 520 525 Phe Leu Tyr Cys Asn Gln Ala Arg Gly Ser Pro Ala Arg Val Asn Ser 530 535 540 Asn Ser Lys Ala Lys Pro Glu Ser Val Ser Thr Cys Ser Val Thr Ser 545 550 555 560 Pro Asp Asp Met Ser Thr Lys Ser Asp Asp Ser Phe Gln Ser Leu His 565 570 575 Gly Ser Leu Pro Leu Asp Ser Phe Ser Lys Phe Val Ala Gly Glu Glu Arg 580 585 590 Asp Cys Pro Arg Leu Leu Leu Ser Ala Leu Ala Gln Glu Asp Leu Ala 595 600 605 Ser Glu Ile Leu Gly Leu Gln Glu Ala Ile Gly Glu Lys Ala Asp Lys 610 615 620 620 Ala Trp Ala GluAla Pro Ser Leu Val Lys Asp Ser Ser Lys Pro Pro 625 630 635 640 Phe Ser Leu Glu Asn His Ser Ala Cys Leu Asp Ser Val Ala Lys Ser 645 650 655 Ala Trp Pro Arg Pro Gly Glu Pro Glu Ala Leu Pro Asp Ser Leu Gln 660 665 670 Leu Asp Lys Gly Gly Asn Ala Lys Asp Phe Ser Pro Gly Leu Phe Glu 675 680 685 Asp Pro Ser Val Ala Phe Ala Thr Pro Asp Pro Lys Lys Thr Thr Gly 690 695 700 Pro Leu Ser Phe Gly Thr Lys Pro Thr Leu Gly Val Pro Ala Pro Asp 705 710 715 715 720 Pro Thr Thr Ala Ala Phe Asp Cys Phe Pro Asp Thr Thr Ala Ala Ser 725 730 730 735 Ser Ala Asp Ser Ala Asn Pro Phe Ala Trp Pro Glu Glu Asn Leu Gly 740 745 750 Asp Ala Cys Pro Arg Trp Gly Leu His Pro Gly Glu Leu Thr Lys Gly 755 760 765 Leu Glu Gln Gly Gly Lys Ala Ser Asp Gly Ile Ser Lys Gly Asp Thr 770 775 780 His Glu Ala Ser Ala Cys Leu Gly Phe Gln Glu Glu Asp Pro Pro Gly 785 790 795 800 Glu Lys Val Ala Ser Leu Pro Gly Asp Phe Lys Gln Glu Glu Val Gly 805 810 815 Gly Val Lys Glu Glu Ala Gly Gly Leu Leu Gln Cys Pro Glu Val Ala 820 825 830 Lys Ala Asp Arg Trp Leu Glu Asp Ser Arg His Cys Cys Ser Thr Ala 835 840 845 Asp Phe Gly Asp Leu Pro Leu Leu Pro Pro Thr Ser Arg Lys Glu Asp 850 855 860 Leu Glu Ala Glu Glu Glu Tyr Ser Ser Leu Cys Glu Leu Leu Gly Ser 865 870 875 880 Pro Glu Gln Arg Pro Gly Met Gln Asp Pro Leu Ser Pro Lys Ala Pro 885 890 895 Leu Ile Cys Thr Lys Glu Glu Val Glu Glu Val Leu Asp Ser Lys Ala 900 905 910 Gly Trp Gly Ser Pro Cys His Leu Ser Gly Glu Ser Val Ile Leu Leu 915 920 925 Gly Pro Thr Val Gly Thr Glu Ser Lys Val Gln Ser Trp Phe Glu Ser 930 935 940 Ser Leu Ser His Met Lys Pro Gly Glu Glu Gly Pro Asp Gly Glu Arg 945 950 955 960 Ala Pro Gly Asp Ser Thr Thr Ser Asp Ala Ser Leu Ala Gln Lys Pro 965 970 975 Asn Lys Pro Ala Val Pro Glu Ala Pro Ile Ala Lys Lys Glu Pro Val 980 985 990 Pro Arg Gly Lys Ser Leu Arg Ser Arg Arg Val His Arg Gly Leu Pro 995 1000 1005 Glu Ala Glu Asp Ser Pro Cys Arg Ala Pro Val Leu Pro Lys Asp Leu 1010 1015 1020 Leu Leu Pro Glu Ser Cys Thr Gly Pro Pro Gln Gly Gln Met Glu Gly 1025 1030 1035 1040 Ala G ly Ala Pro Gly Arg Gly Ala Ser Glu Gly Leu Pro Arg Met Cys 1045 1050 1055 Thr Arg Ser Leu Thr Ala Leu Ser Glu Pro Arg Thr Pro Gly Pro Pro 1060 1065 1070 Gly Leu Thr Thr Thr Pro Ala Pro Pro Asp Lys Leu Gly Gly Lys Gln 1075 1080 1085 Arg Ala Ala Phe Lys Ser Gly Lys Arg Val Gly Lys Pro Ser Pro Lys 1090 1095 1100 Ala Ala Ser Ser Pro Ser Asn Pro Ala Ala Leu Pro Val Ala Ser Asp 1105 1110 1115 1120 Ser Ser Pro Met Gly Ser Lys Thr Lys Glu Thr Asp Ser Pro Ser Thr 1125 1130 1135 Pro Gly Lys Asp Gln Arg Ser Met Ile Leu Arg Ser Arg Thr Lys Thr 1140 1145 1150 Gln Glu Ile Phe His Ser Lys Arg Arg Arg Pro Ser Glu Gly Arg Leu 1155 1160 1165 Pro Asn Cys Arg Ala Thr Lys Lys Leu Leu Asp Asn Ser His Leu Pro 1170 1175 1180 Ala Thr Phe Lys Val Ser Ser Ser Pro Gln Lys Glu Gly Arg Val Ser 1185 1190 1195 1200 Gln Arg Ala Arg Val Pro Lys Pro Gly Ala Gly Ser Lys Leu Ser Asp 1205 1210 1215 Arg Pro Leu His Ala Leu Lys Arg Lys Ser Ala Phe Met Ala Pro Val 1220 1225 1230 Pro Thr Lys Lys Arg Asn Leu Val Leu Arg Ser Arg Ser Ser Ser Ser 1235 1240 1245 Ser Asn Ala Ser Gly Asn Gly Gly Asp Gly Lys Glu Glu Arg Pro Glu 1250 1255 1260 Gly Ser Pro Thr Leu Phe Lys Arg Met Ser Ser Pro Lys Lys Ala Lys 1265 1270 1275 1280 Pro Thr Lys Gly Asn Gly Glu Pro Ala Thr Lys Leu Pro Pro Glu 1285 1290 1295 Thr Pro Asp Ala Cys Leu Lys Leu Ala Ser Arg Ala Ala Phe Gln Gly 1300 1305 1310 Ala Met Lys Thr Lys Val Leu Pro Pro Arg Lys Gly Arg Gly Leu Lys 1315 1320 1325 Leu Glu Ala Ile Val Gln Lys Ile Thr Ser Pro Ser Leu Lys Lys Phe 1330 1335 1340 Ala Cys Lys Ala Pro Gly Ala Ser Pro Gly Asn Pro Leu Ser Pro Ser 1345 1350 1355 1360 Leu Ser Asp Lys Asp Arg Gly Leu Lys Gly Ala Gly Gly Ser Pro Val 1365 1370 1375 Gly Val Glu Glu Gly Leu Val Asn Val Gly Thr Gly Gln Lys Leu Pro 1380 1385 1390 Thr Ser Gly Ala Asp Pro Leu Cys Arg Asn Pro Thr Asn Arg Ser Leu 1395 1400 1405 Lys Gly Lys Leu Met Asn Ser Lys Lys Leu Ser Ser Thr Asp Cys Phe 1410 1415 1420 Lys Thr Glu Ala Phe Thr Ser Pro Glu Ala Leu Gln Pro Gly Gly Thr 1425 1430 1435 1440 Ala Leu Ala Pro Lys Lys Arg Ser Arg Lys Gly Arg Ala Gly Ala His 1445 1450 1455 Gly Leu Ser Lys Gly Pro Leu Glu Lys Arg Pro Tyr Leu Gly Pro Ala 1460 1465 1470 Leu Leu Leu Thr Pro Arg Asp Arg Ala Ser Gly Thr Gln Gly Ala Ser 1475 1480 1485 Glu Asp Asn Ser Gly Gly Gly Gly Lys Lys Pro Lys Met Glu Glu Leu 1490 1495 1500 Gly Leu Ala Ser Gln Pro Pro Glu Gly Arg Pro Cys Gln Pro Gln Thr 1505 1510 1515 1520 Arg Ala Gln Lys Gln Pro Gly His Thr Asn Tyr Ser Ser Tyr Ser Lys 1525 1530 1535 Arg Lys Arg Leu Thr Arg Gly Arg Ala Lys Asn Thr Thr Ser Ser Pro 1540 1545 1550 Cys Lys Gly Arg Ala Lys Arg Arg Arg Gln Gln Gln Val Leu Pro Leu 1555 1560 1565 Asp Pro Ala Glu Pro Glu Ile Arg Leu Lys Tyr Ile Ser Ser Cys Lys 1570 1575 1580 Arg Leu Arg Ser Asp Ser Arg Thr Pro Ala Phe Ser Pro Leu Glu Pro 1585 1590 1595 1600 Ser Leu Gly Ala Gln Asn Pro Arg Ser Gly Gln Asn Ala Pro Pro Ala 1605 1610 1615 Pro Ala Asp Ala Arg Pro Leu Cys Thr Thr Arg Asp Arg Arg Ala Tyr 1620 1625 1630 Ser Ala Arg Glu Glu Gln Gly Gln Arg 1635 1640 <210> 7 <211> 3399 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (3399) <400> 7 atg ggg gat ttc gca gcc ccc gct gct gcc gcg aat ggc agt agt att 48 Met Gly Asp Phe Ala Ala Pro Ala Ala Ala Ala Ala Asn Gly Ser Ser Ile 1 5 10 15 tgc atc aac agt agc ctg aac agc agc ctc ggc ggg gcc ggg atc ggt 96 Cys Ile Asn Ser Ser Leu Asn Ser Ser Leu Gly Gly Ala Gly Ile Gly 20 25 30 gtg aat aat act ccc aat agt act ccc gct gct ccg agt agc aat cac 144 Val Asn Asn Thr Pro Asn Ser Thr Pro Ala Ala Pro Ser Ser Asn His 35 40 45 ccg gca gcc ggt gga tgc ggc ggc tcc ggg ggc ccc ggc ggc ggt tcg 192 Pro Ala Ala Gla Gly Gly Cys Gly Gly Ser Gly Gly Pro Gly Gly Gly Ser 50 55 60 gcg gcc gtt ccc aag cac agc acc gtg gtg gag cgg ctc cgc cag cgc 240 Ala Ala Val Pro Lys His Ser Thr Val Val Glu Arg Leu Arg Gln Arg 65 70 75 80 atc gag ggc tgc cgt cgg cac cac gtc aac tgc gag aac agg tac cag 288 Ile Glu Gly Cys Arg Arg His His Val Asn Cys Glu Asn Arg Tyr Gln 85 90 95 cag gct cag gtg gag cag ctg gag ctg gag cgc cgg gac acc gtg agc 336 Gln Ala Gln Val Glu Gln Leu Glu Leu Glu Arg Arg Asp Thr Val Ser 100 105 110 ctc tac cag cgg acc ctg gag cag agg gcc aag aaa tcg ggc gcc ggc 384 Leu Tyr Gln Arg Thr Leu Glu Gln Arg Ala Lys Lys Ser Gly Ala Gly 115 120 125 acc ggc aaa cag cag cac ccg agc aaa ccc cag gag gag gct 432 Thr Gly Lys Gln Gln His Pro Ser Lys Pro Gln Gln Asp Ala Glu Ala 130 135 140 gcc tcg gcg gag cag agg aac cac acg ctg atc atg cta caa gag act 480 Ala Ser Ala Glu Gln Arg Asn His Thr Leu Ile Met Leu Gln Glu Thr 145 150 155 160 gtg aaa agg aag ttg gaa gga gct cga tca cca ctt aat gga gac cag 528 Val Lys Arg Lys Leu Glu Gly Ala Arg Ser Pro Leu Asn Gly Asp Gln 165 170 175 cag aat ggt gct tgt gat ggg aat ttt tct ccg act agc aaa cga att 576 Gln Asn Gly Ala Cys Asp Gly Asn Phe Ser Pro Thr Ser Lys Arg Ile 180 185 190 cga aag gac att tct gcg ggg atg gaa gcc atc aac aat ttg ccc agt Lys Asp Ile Ser Ala Gly Met Glu Ala Ile Asn Asn Leu Pro Ser 195 200 205 aac atg cca ctg cct tca gct tct cct ctt cac caa ctt gac ctg aaa 672 Asn Met Pro Leu Pro Ser Ala Ser Pro Leu His Gln Leu Asp Leu Lys 210 215 220 cct tct ttg ccc ttg cag aac agt gga act cac act cct ggg ctt cta 720 Pro Ser Leu Pro Leu Gln Asn Ser Gly Thr His Thr Pro Gly Leu Leu 225 230 235 240 gaa gat cta agt aag aat ggt agg ctc cct gag att aaa ctt cct gtc 768 Glu Asp Leu Ser Lys Asn Gly Arg Leu Pro Glu Ile Lys Leu Pro Val 245 250 255 aac ggt tgc agt gac ctg gag gat agc ttc acc atc ttg cag agc aaa 816 Asn Gly Cyslu Asp Leu Asp Ser Phe Thr Ile Leu Gln Ser Lys 260 265 270 270 gac ctc aaa caa gaa cct ctc gat gac cct act tgc ata gac aca tca 864 Asp Leu Lys Gln Glu Pro Leu Asp Asp Pro Thr Cys Ile Asp Thr Ser 275 280 285 gaa aca tct ctt tca aat cag aac aag ctg ttc tca gac att aat ctg 912 Glu Thr Ser Leu Ser Asn Gln Asn Lys Leu Phe Ser Asp Ile Asn Leu 290 295 300 aat gat cag gag tgg caa gaa tta ata gat gaa ttg gcc aac 960 Asn Asp Gln Glu Trp Gln Glu Leu Ile Asp Glu Leu Ala Asn Thr Val 305 310 315 320 cct gag gat gac ata cag gac ctg ttc aac gaa gac ttt gaa gag aag 1008 Pro Glu Asp Asp Ile Gln Asp Leu Phe Asn Glu p Phe Glu Glu Lys 325 330 335 aag gag cca gaa ttc tcg cag cca gca act gag acc cct ctc tcc cag 1056 Lys Glu Pro Glu Phe Ser Gln Pro Ala Thr Glu Thr Pro Leu Ser Gln 340 345 350 gag agt gcg agc gtg aag agc gac ccc tct cac tct ccc ttc gca cat 1104 Glu Ser Ala Ser Val Lys Ser Asp Pro Ser His Ser Pro Phe Ala His 355 360 365 gtc tcc atg gga tct ccc cag gcg agg cct tct tct tct ggt cct ccc 1152 Val Ser Met Gly Ser Pro Gln Ala Arg Pro Ser Ser Ser Gly Pro Pro 370 375 380 ttt tct act gtc tcc acg gcc act agt tta cct tct gtt gcc agc act 1200 Phe Ser Thr Val Serr Ala Thr Ser Leu Pro Ser Val Ala Ser Thr 385 390 395 400 ccc gca gct cca aac cct gca agc tca cca gca aac tgt gct gtc cag 1248 Pro Ala Ala Pro Asn Pro Ala Ser Ser Pro Ala Asn Cys Ala Val Gln 405 410 415 tcc cct caa act cca aac caa gcc cac act cca ggc caa gct cca cct 1296 Ser Pro Gln Thr Pro Asn Gln Ala His Thr Pro Gly Gln Ala Pro Pro 420 425 430 cgg cct gga aat ggt tat ctc ctg aat ccg gca gca gtg aca gtg gcc 1344 Arg Pro Gly Asn Gly Tyr Leu Leu Asn Pro Ala Ala Val Thr Val Ala 435 440 445 ggt tca gcg tca ggg cct gtg gct gtg ccc agc tct gac atg tct cca 1392 Gly Ser Ala Ser Gly Pro Val Ala Val Pro Ser Ser Asp Met Ser Pro 450 455 460 gca gaa cag ctc aaa cag atg gct gca cag cag caa caa agg gcc aaa 1440 Ala Glu Gln Leu Lys Gln Met Ala Ala Gln Gln Gln Gln Arg Ala Lys 465 470 475 475 480 ctc atg cag cag aaa cag caa cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag cag 1488 Leu Met Gln Gln Lys Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 485 490 495 cag caa cag cag cag cag cag cag caa cag cac tca aat cag act tca 1536 Gln Gln Gln Gln Gln Gln Gln Gln Gln His Ser Asn Gln Thr Ser 500 505 510 aat tgg tct ccc tta gga cct ccc tct agt cca tat gga gca gct ttt 1584 Asn Trp Ser Pro Leu Gly Pro Pro Ser Ser Pro Tyr Gly Ala Ala Phe 515 520 525 act gca gaa aaa cca aat agc cca atg atg tac ccc caa gcc ttt aac 1632 Thr Ala Glu Lys Pro Asn Ser Pro Met Met Tyr Pro Gln Ala Phe Asn 530 535 540 aac caa aac cct ata gtg cct cca atg gca aac aac ctg cag aag aca 1680 Asn Gln Asn Pro Ile Val Pro Pro Met Ala Asn Asn Leu Gln Lys Thr 545 550 555 560 aca atg aat aac tac ctc cct cag aat cac atg aat atg atc aat cag 1728 Thr Met Asn Asn Tyr Leu Pro Gln Asn His Met Asn Met Ile Asn Gln 565 570 575 cag cca aat aac ttg ggt aca aac tcc tta aac aaa cag cac aat att 1776 Gln Pro Asn Asn Leu Gly Thr Asn Ser Leu Asn Lys Gln His Asn Ile 580 585 590 590 ctg act tat ggc aac act aaa ccc ctg acc cac ttc aat gca gac ctg 1824 Leu Thr Tyr Gly Asn Thr Lys Pro Leu Thr His Phe Asn Ala Asp Leu 595 600 605 agt cag agg atg aca cca cca gtg gcc aac ccc aac aaa aac ccc ttg 1872 Ser Gln Arg Met Thr Pro Pro Val Ala Asn Pro Asn Lys Asn Pro Leu 610 615 620 atg ccg tat atc cag cag cag caa cag cag cag caa cag caa cag cag 1920 Met Pro Tyr Ile Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 625 630 630 635 640 cag cag cag cag cag cag ccg cca cct cca cag ctc cag gcc ccc agg 1968 Gln Gln Gln Gln Gln Gln Pro Pro Pro Pro Gln Leu Gln Ala Pro Arg 645 650 655 gca cac ctg agc gaa gac cag aaa cgc ctg ctt ctc ag cag aaa 2016 Ala His Leu Ser Glu Asp Gln Lys Arg Leu Leu Leu Met Lys Gln Lys 660 665 670 gga gtg atg aat cag ccc atg gct tac gct gca ctt cca tcc cac ggt 2064 Gly Val Met Asn Gln Pro Met Ala Tyr Ala Ala Leu Pro Ser His Gly 675 680 685 cag gag cag cat cca gtt gga ctt ccc cga acc aca ggc ccc atg cag 2112 Gln Glu Gln His Pro Val Gly Leu Pro Arg Thr Thr Gly Pro Met Gln 690 695 700 tcc tcc gtg ccc cca ggc tca ggt ggc atg gtc tca gga gcc agt ccc 2160 Ser Ser Val Pro Pro Gly Ser Gly Gly Met Val Ser Gly Ala Ser Pro 705 710 710 720 gca ggc ccc ggc ttc ctg ggc agc cag ccc caa gca gcc atc atg aag 2208 Ala Gly Pro Gly Phe Leu Gly Ser Gln Pro Gln Ala Ala Ile Met Lys 725 730 735 cag atg ctc att gat cag cgg gcc cag ttg ata gag cag cag aag caa 2256 Gln Met Leu Ile Asp Gln Arg Ala Gln Leu Ile Glu Gln Gln Gln 740 745 750 cag ttc ctg cgg gag caa agg cag cag cag cag cag cag cag cag att 2304 Gln Phe Leu Arg Glu Gln Arg Gln Gln Gln Gln Gln Gln Gln Gln Gln Ile 755 760 765 ttg gcg gaa cag cag tt g a cat cta ccc cgg cag cac ctc 2352 Leu Ala Glu Gln Gln Leu Gln Gln Ser His Leu Pro Arg Gln His Leu 770 775 780 cag cca cag cgg aat cca tac cca gtg cag cag gtc aat cag ttt caa 2400 Gln Pro Gln Arg Asn Pro Tyr Pro Val Gln Gln Val Asn Gln Phe Gln 785 790 795 800 ggt tct ccc cag gat ata gca gcc gta aga agc caa gca gcc ctc cag 2448 Gly Ser Pro Gln Asp Ile Ala Ala Val Arg Ser Gln Ala Ala Leu Gln 805 810 815 agc atg cga acg tca cgg ctg atg gca cag aac gca ggc atg atg gga 2496 Ser Met Arg Thr Ser Arg Leu Met Ala Gln Asn Ala Gly Met Met Gly 820 825 830 ata gga ccc tcc cag aac cct ggg acg atg gcc acc gct gcg cag 2544 Ile Gly Pro Ser Gln Asn Pro Gly Thr Met Ala Thr Ala Ala Ala Gln 835 840 845 tcg gag atg gga ctg gcc cct tat agc acc acg cct acc agc caa cca 2592 Ser Glu Met Gly Leu Ala Pro Tyr Ser Thr Thr Pro Thr Ser Gln Pro 850 855 860 gga atg tac aat atg agc aca ggc atg acc caa atg ttg cag cat cca 2640 Gly Met Tyr Asn Met Ser Thr Gly Met Thr Gln Met Leu Gln His Pro 865 870 875 880 aac caa agt ggc atg agc atc aca cat aac caa gcc cag gga ccg agg 2688 Asn Gln Ser Gly Met Ser Ile Thr His Asn Gln Ala Gln Gly Pro Arg 885 890 895 895 caa cct gcc tct ggg cag ggg gtt gga atg gtg agt ggc ttt ggt cag Gln Pro Ala Ser Gly Gln Gly Val Gly Met Val Ser Gly Phe Gly Gln 900 905 910 agc atg ctg gtg aac tca gcc att acc cag caa cat cca cag atg aaa 2784 Ser Met Leu Val Asn Ser Ala Ile Thr Gln Gln His Pro Gln Met Lys 915 920 925 ggg cca gta ggc cag gcc ttg cct agg ccc caa gcc cct cca agg ctg 2832 Gly Pro Val Gly Gln Ala Leu Pro Arg Pro Gln Ala Pro Pro Arg Leu 930 935 940 cag agc ctt atg gga aca gtc cag gga gca caa agc tgg caa cag 2880 Gln Ser Leu Met Gly Thr Val Gln Gln Gly Ala Gln Ser Trp Gln Gln 945 950 955 960 agg agc ttg cag ggc atg cct ggg agg act agt gga gaa ttg gga cca 2928 Arg Ser Leu Gln Met Pro Gly Arg Thr Ser Gly Glu Leu Gly Pro 965 970 975 ttc aac aat ggc gcc agc tac cct ctt caa gct ggg cag ccg aga ctg 2976 Phe Asn Asn Gly Ala Ser Tyr Pro Leu Gln Ala Gly Gln Pro Arg Leu 980 985 990 acc aag cag cac ttc cca cag gga ctg agc cag tca gtc gtg gat gct 3024 Thr Lys Gln His Phe Pro Gln Gly Leu Ser Gln Ser Val Val Asp Ala 995 1000 1005 aac acg ggc aca gtg agg acc ctc aac cca gcc atg ggt cgg cag 3072 Asn Thr Gly Thr Val Arg Thr Leu Asn Pro Ala Ala Met Gly Arg Gln 1010 1015 1020 atg atg cca tcg ctc ccg ggg cag caa ggc acc agc cag gcg agg cca 3120 Met Met Pro Ser Leu Pro Gly Gln Gln Gly Thr Ser Gln Ala Arg Pro 1025 1030 1035 1040 atg gtc atg tct ggc ctg agc cag gga gtc cca ggc atg cca gcg ttc 3168 Met Val Met Ser Gly Leu Ser Gln Gly Val Pro Gly Met Pro Ala Phe 1045 1050 c55acg cca gca cag cag cag ata ccc agt ggc agc ttt gct cca 3216 Ser Gln His Pro Ala Gln Gln Gln Ile Pro Ser Gly Ser Phe Ala Pro 1060 1065 1070 agc agc cag agc caa gcc tat gag cgg aat gcc cct cag gac gtg tca Ser Ser Gln Ser Gln Ala Tyr Glu Arg Asn Ala Pro Gln Asp Val Ser 1075 1080 1085 tac aat tac agt ggc gac gga gct ggg ggt tcc ttc cct ggc ctc ccg 3312 Tyr Asn Tyr Ser Gly Asp Gly Al a Gly Gly Ser Phe Pro Gly Leu Pro 1090 1095 1100 gac ggt gca gac ctt gtg gac tcc atc atc aaa ggc ggg cca ggg gac 3360 Asp Gly Ala Asp Leu Val Asp Ser Ile Ile Lys Gly Gly Pro Gly Asp 1105 1110 1115 1120 gag tgg atg cag gag ctt gat gaa ttg ttt ggt aac ccc 3399 Glu Trp Met Gln Glu Leu Asp Glu Leu Phe Gly Asn Pro 1125 1130 <210> 8 <211> 1133 <212> PRT <213> Homo sapiens <400> 8 Met Gly Asp Phe Ala Ala Pro Ala Ala Ala Ala Asn Gly Ser Ser Ile 1 5 10 15 Cys Ile Asn Ser Ser Leu Asn Ser Ser Leu Gly Gly Ala Gly Ile Gly 20 25 30 Val Asn Asn Thr Pro Asn Ser Thr Pro Ala Ala Pro Ser Ser Asn His 35 40 45 Pro Ala Ala Gly Gly Cys Gly Gly Ser Gly Gly Pro Gly Gly Gly Gly Ser 50 55 60 Ala Ala Val Pro Lys His Ser Thr Val Val Glu Arg Leu Arg Gln Arg 65 70 75 80 Ile Glu Gly Cys Arg Arg His His Val Asn Cys Glu Asn Arg Tyr Gln 85 90 95 Gln Ala Gln Val Glu Gln Leu Glu Leu Glu Arg Arg Asp Thr Val Ser 100 105 110 Leu Tyr Gln Arg Thr Leu Glu Gln Arg Ala Lys Lys Ser Gly Ala Gly 115 120 125 Thr Gly Lys Gln Gln His Pro Ser Lys Pro Gln Gln Asp Ala Glu Ala 130 135 140 Ala Ser Ala Glu Gln Arg Asn His Thr Leu Ile Met Leu Gln Glu Thr 145 150 155 160 Val Lys Arg Lys Leu Glu Gly Ala Arg Ser Pro Leu Asn Gly Asp Gln 165 170 175 Gln Asn Gly Ala Cys Asp Gly Asn Phe Ser Pro Thr Ser Lys Arg Ile 180 185 190 Arg Lys Asp Ile Ser Ala Gly Met Glu Ala Ile Asn Asn Leu Pro Ser 195 200 205 Asn Met Pro L eu Pro Ser Ala Ser Pro Leu His Gln Leu Asp Leu Lys 210 215 220 Pro Ser Leu Pro Leu Gln Asn Ser Gly Thr His Thr Pro Gly Leu Leu 225 230 235 240 Glu Asp Leu Ser Lys Asn Gly Arg Leu Pro Glu Ile Lys Leu Pro Val 245 250 255 Asn Gly Cys Ser Asp Leu Glu Asp Ser Phe Thr Ile Leu Gln Ser Lys 260 265 270 Asp Leu Lys Gln Glu Pro Leu Asp Asp Pro Thr Cys Ile Asp Thr Ser 275 280 285 Glu Thr Ser Leu Ser Asn Gln Asn Lys Leu Phe Ser Asp Ile Asn Leu 290 295 300 Asn Asp Gln Glu Trp Gln Glu Leu Ile Asp Glu Leu Ala Asn Thr Val 305 310 315 320 Pro Glu Asp Asp Ile Gln Asp Leu Phe Asn Glu Asp Phe Glu Glu Lys 325 330 335 Lys Glu Pro Glu Phe Ser Gln Pro Ala Thr Glu Thr Pro Leu Ser Gln 340 345 350 Glu Ser Ala Ser Val Lys Ser Asp Pro Ser His Ser Pro Phe Ala His 355 360 365 Val Ser Met Gly Ser Pro Gln Ala Arg Pro Ser Ser Ser Gly Pro Pro 370 375 380 Phe Ser Thr Val Ser Thr Ala Thr Ser Leu Pro Ser Val Ala Ser Thr 385 390 395 400 Pro Ala Ala Pro Asn Pro Ala Ser Ser Pro Ala Asn Cys Ala Val Gln 405 410 415 Ser Pro Gln T hr Pro Asn Gln Ala His Thr Pro Gly Gln Ala Pro Pro 420 425 430 Arg Pro Gly Asn Gly Tyr Leu Leu Asn Pro Ala Ala Val Thr Val Ala 435 440 445 Gly Ser Ala Ser Gly Pro Val Ala Val Pro Ser Ser Asp Met Ser Pro 450 455 460 Ala Glu Gln Leu Lys Gln Met Ala Ala Gln Gln Gln Gln Arg Ala Lys 465 470 475 480 Leu Met Gln Gln Lys Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 485 490 495 495 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln His Ser Asn Gln Thr Ser 500 505 510 Asn Trp Ser Pro Leu Gly Pro Pro Ser Ser Pro Tyr Gly Ala Ala Phe 515 520 525 Thr Ala Glu Lys Pro Asn Ser Pro Met Met Tyr Pro Gln Ala Phe Asn 530 535 540 Asn Gln Asn Pro Ile Val Pro Pro Met Ala Asn Asn Leu Gln Lys Thr 545 550 555 560 Thr Met Asn Asn Tyr Leu Pro Gln Asn His Met Asn Met Ile Asn Gln 565 570 575 Gln Pro Asn Asn Leu Gly Thr Asn Ser Leu Asn Lys Gln His Asn Ile 580 585 590 Leu Thr Tyr Gly Asn Thr Lys Pro Leu Thr His Phe Asn Ala Asp Leu 595 600 605 Ser Gln Arg Met Thr Pro Pro Val Ala Asn Pro Asn Lys Asn Pro Leu 610 615 620 Met Pro Tyr IleGln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 625 630 635 640 Gln Gln Gln Gln Gln Gln Pro Pro Pro Pro Gln Leu Gln Ala Pro Arg 645 650 655 Ala His Leu Ser Glu Asp Gln Lys Arg Leu Leu Leu Met Lys Gln Lys 660 665 670 Gly Val Met Asn Gln Pro Met Ala Tyr Ala Ala Leu Pro Ser His Gly 675 680 685 Gln Glu Gln His Pro Val Gly Leu Pro Arg Thr Thr Gly Pro Met Gln 690 695 700 Ser Ser Val Pro Pro Gly Ser Gly Gly Met Val Ser Gly Ala Ser Pro 705 710 715 720 720 Ala Gly Pro Gly Phe Leu Gly Ser Gln Pro Gln Ala Ala Ile Met Lys 725 730 735 Gln Met Leu Ile Asp Gln Arg Ala Gln Leu Ile Glu Gln Gln Lys Gln 740 745 750 Gln Phe Leu Arg Glu Gln Arg Gln Gln Gln Gln Gln Gln Gln Gln Ile 755 760 765 Leu Ala Glu Gln Gln Leu Gln Gln Ser His Leu Pro Arg Gln His Leu 770 775 780 Gln Pro Gln Arg Asn Pro Tyr Pro Val Gln Gln Val Asn Gln Phe Gln 785 790 795 800 Gly Ser Pro Gln Asp Ile Ala Ala Val Arg Ser Gln Ala Ala Leu Gln 805 810 815 Ser Met Arg Thr Ser Arg Leu Met Ala Gln Asn Ala Gly Met Met Gly 820 825 830 Ile Gly Pro Ser Gln Asn Pro Gly Thr Met Ala Thr Ala Ala Ala Gln 835 840 845 Ser Glu Met Gly Leu Ala Pro Tyr Ser Thr Thr Pro Thr Ser Gln Pro 850 855 860 Gly Met Tyr Asn Met Ser Thr Gly Met Thr Gln Met Leu Gln His Pro 865 870 875 880 Asn Gln Ser Gly Met Ser Ile Thr His Asn Gln Ala Gln Gly Pro Arg 885 890 895 Gln Pro Ala Ser Gly Gln Gly Val Gly Met Val Ser Gly Phe Gly Gln 900 905 910 Ser Met Leu Val Asn Ser Ala Ile Thr Gln Gln His Pro Gln Met Lys 915 920 925 Gly Pro Val Gly Gln Ala Leu Pro Arg Pro Gln Ala Pro Pro Arg Leu 930 935 940 Gln Ser Leu Met Gly Thr Val Gln Gln Gly Ala Gln Ser Trp Gln Gln 945 950 955 960 Arg Ser Leu Gln Gly Met Pro Gly Arg Thr Ser Gly Glu Leu Gly Pro 965 970 975 Phe Asn Asn Gly Ala Ser Tyr Pro Leu Gln Ala Gly Gln Pro Arg Leu 980 985 990 Thr Lys Gln His Phe Pro Gln Gly Leu Ser Gln Ser Val Val Asp Ala 995 1000 1005 Asn Thr Gly Thr Val Arg Thr Leu Asn Pro Ala Ala Met Gly Arg Gln 1010 1015 1020 Met Met Pro Ser Leu Pro Gly Gln Gln Gly Thr Ser Gln Ala Arg Pro 1025 1030 1035 1040 Met V al Met Ser Gly Leu Ser Gln Gly Val Pro Gly Met Pro Ala Phe 1045 1050 1055 Ser Gln His Pro Ala Gln Gln Gln Ile Pro Ser Gly Ser Phe Ala Pro 1060 1065 1070 Ser Ser Gln Ser Gln Ala Tyr Glu Arg Asn Ala Pro Gln Asp Val Ser 1075 1080 1085 Tyr Asn Tyr Ser Gly Asp Gly Ala Gly Gly Ser Phe Pro Gly Leu Pro 1090 1095 1100 Asp Gly Ala Asp Leu Val Asp Ser Ile Ile Lys Gly Gly Pro Gly Asp 1105 1110 1115 1120 Glu Trp Met Gln Glu Leu Asp Glu Leu Phe Gly Asn Pro 1125 1130 <210> 9 <211> 2598 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (2598) <400> 9 atg tca ctg agg gca gcc aca tca tcc ctc agt gaa gag cag gtc tct 48 Met Ser Leu Arg Ala Ala Thr Ser Ser Leu Ser Glu Glu Gln Val Ser 1 5 10 15 gag ctg agg gac aac ctg ccc aag gag gtc agg ttg agc ccc aag ctt 96 Glu Leu Arg Asp Asn Leu Pro Lys Glu Val Arg Leu Ser Pro Lys Leu 20 25 30 atc ctc gac cca aag agc agt gtg acc cct gcc atc atc tcg gcc gcc 144 Ile Leu Asp Pro Lys Ser Ser Val Thr Pro Ala Ile Ile Ser Ala Ala 35 40 45 cta cag caa gtg gtt cac aat aag agt cta gtc act gct ggt ggg gct 192 Leu Gln Gln Val Val His Asn Lys Ser Leu Val Thr Ala Gly Gly Ala 50 55 60 ttg ggg aac ccc ccc agc agg ggt gag aga agg ctg gag gcc agc atg 240 Leu Gly Asn Pro Pro Ser Arg Gly Glu Arg Arg Leu Glu Ala Ser Met 65 70 75 80 ggg agg cca gag gtt agc atg atg agc agc agt gcc aag ag aat ctg 288 Gly Arg Pro Glu Val Ser Met Met Ser Ser Ser Ala Ser Lys Asn Leu 85 90 95 aag ttc aaa att agc ccc agt gct cca gag acc tca tgg aat tct caa 336 Lys Phe Lys Ile Ser Pro Ser Ala Pro Glu Thr Ser Trp Asn Ser Gln 100 105 110 cat cag ctg ggt gca gag gtc tct tcc agc ccc aga gca ccc aca ggc 384 His Gln Leu Gly Ala Glu Val Ser Ser Ser Pro Arg Ala Pro Thr Gly 115 120 125 agc cgg gct gac agc ctg cac ctc tcc caa caa gag gag agt ctg cct 432 Ser Arg Ala Asp Ser Leu His Leu Ser Gln Gln Glu Asp Ser Leu Pro 130 135 140 gtt caa aat ttc cct ccc aaa agc tat ctt ttg cga aca agc cga gag 480 Val Gln Asn Phe Pro Pro Lys Ser Tyr Leu Leu Leu Arg Thr Ser Arg Glu 145 150 155 160 tca gtg ggc aag caa gct aca ggg gag gtg gca ggc aaa ggc ggg cca 528 Ser Val Gly Lys Gln Ala Thr Gly Glu Val Ala Gly Lys Gly Gly Pro 165 170 175 gt gtg ggt ggt aag ccc acc ctg cag aag cag ggc acc atc tcc agc caa 576 Val Gly Gly Lys Pro Thr Leu Gln Lys Gln Gly Thr Ile Ser Ser Gln 180 185 190 ggg gag aag gcg cag ctg gag agc aca ccc aaa aga agc aag ctc Galu Gly 624 Gly Lys Ala Gln Leu Glu Ser Thr Pro Lys Arg Ser Lys Leu Glu 195 200 205 gag acc agc ctg gtt ccc cga gct acc tac ccc atg gct ctg cag agc 672 Glu Thr Ser Leu Val Pro Arg Ala Thr Tyr Pro Met Ala Leu Gln Ser 210 215 220 ccc agc tgc cag tca aga agc cac agc ccc agc tgc cag cct cat ggc 720 Pro Ser Cys Gln Ser Arg Ser His Ser Pro Ser Cys Gln Pro His Gly 225 230 235 240 cac agc ccc agc agc cag tct cga ggt cag agc ccc agc tgc caa cct 768 His Ser Pro Ser Ser Gln Ser Arg Gly Gln Ser Pro Ser Cys Gln Pro 245 250 255 cga ggc cag agc cca ctg agg tct cag gct gcc agc cgg cag gtg agc 816 Arg Gly Gln Ser Pro Leu Arg Ser Gln Ala Ala Ser Arg Gln Val Ser 260 265 270 acc atg ccc tct agg aag ctt gaa aca act ctc aat gga gcc cac tcg 864 Thr Met Pro Ser Arg Lys Leu Glu Thr Thr Leu Asn Gly Ala His Ser 275 280 285 acc tct gaa ggc cct gcc aaa ccc aag tca tcc cga ggt cct ttc cgg 912 Thr Ser Glu Gly Pro Ala Lys Pro Lys Ser Ser Arg Gly Pro Phe Arg 290 295 300 cta cgc aat tta ttc tct gcc acc ttc cca acc cgc cag aag aag gag 960 Leu Arg Asn Leu Phe Ser Ala Thr Phe Pro Thr Arg Gln Lys Lys Glu 305 310 315 320 aca gat gag cgg cag gcc caa ctg cag aag gta aag cag tat gaa ctg 1008 Thr Asp Glu Arg Gln Ala Gln Leu Gln Lys Val Ly s Gln Tyr Glu Leu 325 330 335 gag ttc ctt gag gaa ctt cta aag cca cca agc cag ggg gag ctg cca 1056 Glu Phe Leu Glu Glu Leu Leu Lys Pro Pro Ser Gln Gly Glu Leu Pro 340 345 350 350 ggc acc gag tac ctg cct cca gca cct ggc cgc tgc agc tgc cag 1104 Gly Thr Glu Tyr Leu Gln Pro Pro Ala Pro Gly Arg Cys Ser Cys Gln 355 360 365 ctc cgc agc agc cct gtg cag cag ggg cct ggc atg tcc cgt gag cag 115 Ser Pro Val Gln Gln Gly Pro Gly Met Ser Arg Glu Gln 370 375 380 agg cgc agc tgt gac tgc aag cgc atc tgc cgg ggg ggc cgg cca caa 1200 Arg Arg Ser Cys Asp Cys Lys Arg Ile Cys Arg Gly Gly Arg Pro Gln 385 390 395 400 gcc acc cag aca cca gtg ccc agc ctc cgg ggg agg gaa agg gac aga 1248 Ala Thr Gln Thr Pro Val Pro Ser Leu Arg Gly Arg Glu Arg Asp Arg 405 410 415 gtc ctc cct agc cag agg cag cca gag gct cca ggc gtg agc ctc 1296 Val Leu Pro Ser Gln Arg Gln Pro Glu Ala Gly Pro Gly Val Ser Leu 420 425 430 agc agc ccc atc aat gtc cag cgc att cgt tct acc agc ctg gag tcc 1344 Ser Ser Pro Ile Asn Val Gl n Arg Ile Arg Ser Thr Ser Leu Glu Ser 435 440 445 cga gag tgc cga tcg gac cct gag agt ggt gtt tcg tgc ctg acc acg 1392 Arg Glu Cys Arg Ser Asp Pro Glu Ser Gly Val Ser Cys Leu Thr Thr 450 455 460 tgt gcc tcg ggg ggc gag tgt ctg gga gct ccc aat tac agg aaa ctg 1440 Cys Ala Ser Gly Gly Glu Cys Leu Gly Ala Pro Asn Tyr Arg Lys Leu 465 470 475 475 480 atg cgc cgc tac agt atc agt gag gtg gac ca gcc tcg 1488 Met Arg Arg Tyr Ser Ile Ser Glu Leu Asp Gln Gly Asp Arg Ala Ser 485 490 495 ctg acc tcg gat gtc tac cca cat cct ccc ctg ggc atg ctg ccc agg 1536 Leu Thr Ser Asp Val Tyr Pro His Pro Pro Leu Gly Met Leu Pro Arg 500 505 510 gag gcc aag gag gta gag gca agc ctc ccc ata gcc ttg ggt ccc aaa 1584 Glu Ala Lys Glu Val Glu Ala Ser Leu Pro Ile Ala Leu Gly Pro Lys 515 520 525 525 agc agg tct ctg gag ccg acg ctg gga gac ccc tcc tac gtc cag 1632 Ser Arg Ser Leu Glu Ser Pro Thr Leu Gly Asp Pro Ser Tyr Val Gln 530 535 540 gtt gcc cca gag acc aaa ggc ccc aga cag atg gcc gtg ttc tca ctg 1680 Val Ala Pro Glu Thr Lys Gly Pro Arg Gln Met Ala Val Phe Ser Leu 545 550 555 560 ccc gag gag gtg tac cgg aag cct gcc gag cta gac gag gac agt gag 1728 Pro Glu Glu Val Tyr Arg Lys Pro Ala Glu Leu Asp Glu Asp Ser Glu 565 570 575 agc agc aag tgc tgc tcc atc cgc tac tgc ttc tac tac cgc aag tgt 1776 Ser Ser Lys Cys Cys Ser Ile Arg Tyr Cys Phe Tyr Tyr Arg Lys Cys 580 585 590 590 gac atg gca gat gat gat gat gat agat gat gat gat ag gat gag ctc tcc tac tct 1824 Asp Met Ala Asp Asp Ala Ser Asp Gly Lys Asp Glu Leu Ser Tyr Ser 595 600 605 atc ccc atg aag atc ctg cct ggc atg aag ctg gac gag cag gtg gtg 1872 Ile Pro Met Lys Gly Met Lys Leu Asp Glu Gln Val Val 610 615 620 cct gtg gtg agc agg acc ctg cag gtg ctg gat gct gct acc tgc agc 1920 Pro Val Val Ser Arg Thr Leu Gln Val Leu Asp Ala Ala Thr Cys Ser 625 630 635 640 agc agc agc cct gag gcc tcc cgc act cag gag att gac ctc cgt gtg 1968 Ser Ser Ser Pro Glu Ala Ser Arg Thr Gln Glu Ile Asp Leu Arg Val 645 650 655 tcc acc ttc gag ggg agc ctg gcc aag atc aat gcc ctg c gg gcc cat 2016 Ser Thr Phe Glu Gly Ser Leu Ala Lys Ile Asn Ala Leu Arg Ala His 660 665 670 gcc tat ggc ctc cct gat ggc ttc ctg gct gcc cgg ctg gac acc aac 2064 Ala Tyr Gly Leu Pro Asp Gly Phe Leu Ala Ala Arg Leu Asp Thr Asn 675 680 685 gag ctg ctg aca gtc ctg cgg cag tgt gtg gcc agc ccc gag gcc cgt 2112 Glu Leu Leu Thr Val Val Leu Arg Gln Cys Val Ala Ser Pro Glu Ala Arg 690 695 700 gcc ccc aag ccc ggt tct cag atc tcc gag tat aag ctt gag cta 2160 Ala Pro Lys Pro Tyr Val Ser Gln Ile Ser Glu Tyr Lys Leu Glu Leu 705 710 715 720 gct ctc aag ttc aag gag ctc cgg gcc tcc tgc cgc cgt gtg gcc aat 208 Leu Lys Phe Lys Glu Leu Arg Ala Ser Cys Arg Arg Val Ala Asn 725 730 735 gtg gac aag agc cca act cac atg ctg gca gcc atc acg ggc agc ttc 2256 Val Asp Lys Ser Pro Thr His Met Leu Ala Ala Ile Thr Gly Ser Phe 740 745 750 cag gtg ctg agc agc ctc att gag acc ttc gtg cgg ctg gtg ttc att 2304 Gln Val Leu Ser Ser Leu Ile Glu Thr Phe Val Arg Leu Val Phe Ile 755 760 765 gtg cgc tcc gag gcc cag g ctg ctg gcc aag gta gaa gag 2352 Val Arg Ser Glu Ala Gln Arg Gln Glu Leu Leu Ala Lys Val Glu Glu 770 775 780 gtg gtg agg aac tac acc ttc ctg ctg cgt gca gct gag gag tcc aca 2400 Valyrg Thr Phe Leu Leu Arg Ala Ala Glu Glu Ser Thr 785 790 795 800 gcc cgt aac ctt aac cag cag cag cag caa caa caa cag cag cag cag 2448 Ala Arg Asn Leu Asn Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 805 810 815 caa caa caa cag cag cag caa caa caa cag cag cag cag cag cag cag 2496 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 820 825 830 gtg gca gca gct gca ggg gca gcc aca gag cca ggc tcc cca 2544 Val Ala Ala Ala Ala Gly Ala Ala Thr Glu His Pro Pro Gly Ser Pro 835 840 845 act tcg gcg act gtt atg agc aca ttc acc cac tcc tta aaa acc ctt 2592 Thr Ser Ala Thr Val Met Ser Thr Phe Thr His Ser Leu Lys Thr Leu 850 855 860 att aag 2598 Ile Lys 865 <210> 10 <211> 866 <212> PRT <213> Homo sapiens <400> 10 Met Ser Leu Arg Ala Ala Thr Ser Ser Leu Ser Glu Glu Gln Val Ser 1 5 10 15 Glu Leu Arg Asp Asn Leu Pro Lys Glu Val Arg Leu Ser Pro Lys Leu 20 25 30 Ile Leu Asp Pro Lys Ser Ser Val Thr Pro Ala Ile Ile Ser Ala Ala 35 40 45 Leu Gln Gln Val Val His Asn Lys Ser Leu Val Thr Ala Gly Gly Aly 50 55 60 Leu Gly Asn Pro Pro Ser Arg Gly Glu Arg Arg Leu Glu Ala Ser Met 65 70 75 80 Gly Arg Pro Glu Val Ser Met Met Ser Ser Ser Ala Ser Lys Asn Leu 85 90 95 Lys Phe Lys Ile Ser Pro Ser Ala Pro Glu Thr Ser Trp Asn Ser Gln 100 105 110 His Gln Leu Gly Ala Glu Val Ser Ser Ser Pro Arg Ala Pro Thr Gly 115 120 125 Ser Arg Ala Asp Ser Leu His Leu Ser Gln Gln Glu Asp Ser Leu Pro 130 135 140 Val Gln Asn Phe Pro Pro Lys Ser Tyr Leu Leu Arg Thr Ser Arg Glu 145 150 155 160 Ser Val Gly Lys Gln Ala Thr Gly Glu Val Ala Gly Lys Gly Gly Pro 165 170 175 Val Gly Gly Lys Pro Thr Leu Gln Lys Gln Gly Thr Ile Ser Ser Gln 180 185 190 Gly Glu Lys Ala Gln Leu Glu Ser Thr Pro Lys Arg Ser Lys Leu Glu 195 200 205 Glu Thr Ser Leu Val Pro Arg Ala Thr Tyr Pro Met Ala Leu Gln Ser 210 215 220 Pro Ser Cys Gln Ser Arg Ser His Ser Pro Ser Cys Gln Pro His Gly 225 230 235 240 His Ser Pro Ser Ser Gln Ser Arg Gly Gln Ser Pro Ser Cys Gln Pro 245 250 255 Arg Gly Gln Ser Pro Leu Arg Ser Gln Ala Ala Ser Arg Gln Val Ser 260 265 270 Thr Met Pro Ser Arg Lys Leu Glu Thr Thr Leu Asn Gly Ala His Ser 275 280 285 Thr Ser Glu Gly Pro Ala Lys Pro Lys Ser Ser Arg Gly Pro Phe Arg 290 295 300 Leu Arg Asn Leu Phe Ser Ala Thr Phe Pro Thr Arg Gln Lys Lys Glu 305 310 315 320 Thr Asp Glu Arg Gln Ala Gln Leu Gln Lys Val Lys Gln Tyr Glu Leu 325 330 335 Glu Phe Leu Glu Glu Leu Leu Lys Pro Pro Ser Gln Gly Glu Leu Pro 340 345 350 Gly Thr Glu Tyr Leu Gln Pro Pro Ala Pro Gly Arg Cys Ser Cys Gln 355 360 365 Leu Arg Ser Ser Pro Val Gln Gln Gly Pro Gly Met Ser Arg Glu Gln 370 375 380 Arg Arg Ser Cys Asp Cys Lys Arg Ile Cys Arg Gly Gly Arg Pro Gln 385 390 395 400 Ala Thr Gln Thr Pro Val Pro Ser Leu Arg Gly Arg Glu Arg Asp Arg 405 410 415 Val Leu ProSer Gln Arg Gln Pro Glu Ala Gly Pro Gly Val Ser Leu 420 425 430 Ser Ser Pro Ile Asn Val Gln Arg Ile Arg Ser Thr Ser Leu Glu Ser 435 440 445 Arg Glu Cys Arg Ser Asp Pro Glu Ser Gly Val Ser Cys Leu Thr Thr 450 455 460 Cys Ala Ser Gly Gly Glu Cys Leu Gly Ala Pro Asn Tyr Arg Lys Leu 465 470 475 480 Met Arg Arg Tyr Ser Ile Ser Glu Leu Asp Gln Gly Asp Arg Ala Ser 485 490 495 Leu Thr Ser Asp Val Tyr Pro His Pro Pro Leu Gly Met Leu Pro Arg 500 505 510 Glu Ala Lys Glu Val Glu Ala Ser Leu Pro Ile Ala Leu Gly Pro Lys 515 520 525 Ser Arg Ser Leu Glu Ser Pro Thr Leu Gly Asp Pro Ser Tyr Val Gln 530 535 540 Val Ala Pro Glu Thr Lys Gly Pro Arg Gln Met Ala Val Phe Ser Leu 545 550 555 560 Pro Glu Glu Val Tyr Arg Lys Pro Ala Glu Leu Asp Glu Asp Ser Glu 565 570 575 Ser Ser Lys Cys Cys Ser Ile Arg Tyr Cys Phe Tyr Tyr Arg Lys Cys 580 585 590 Asp Met Ala Asp Asp Ala Ser Asp Gly Lys Asp Glu Leu Ser Tyr Ser 595 600 605 Ile Pro Met Lys Ile Leu Pro Gly Met Lys Leu Asp Glu Gln Val Val 610 615 615 620 Pro Val Val Ser Arg Thr Leu Gln Val Leu Asp Ala Ala Thr Cys Ser 625 630 635 640 Ser Ser Ser Pro Glu Ala Ser Arg Thr Gln Glu Ile Asp Leu Arg Val 645 650 655 Ser Thr Phe Glu Gly Ser Leu Ala Lys Ile Asn Ala Leu Arg Ala His 660 665 670 Ala Tyr Gly Leu Pro Asp Gly Phe Leu Ala Ala Arg Leu Asp Thr Asn 675 680 685 Glu Leu Leu Thr Val Leu Arg Gln Cys Val Ala Ser Pro Glu Ala Arg 690 695 700 Ala Pro Lys Pro Tyr Val Ser Gln Ile Ser Glu Tyr Lys Leu Glu Leu 705 710 715 715 Ala Leu Lys Phe Lys Glu Leu Arg Ala Ser Cys Arg Arg Val Ala Asn 725 730 735 735 Val Asp Lys Ser Pro Thr His Met Leu Ala Ala Ile Thr Gly Ser Phe 740 745 750 Gln Val Leu Ser Ser Leu Ile Glu Thr Phe Val Arg Leu Val Phe Ile 755 760 765 Val Arg Ser Glu Ala Gln Arg Gln Glu Leu Leu Ala Lys Val Glu Glu 770 775 780 Val Val Arg Asn Tyr Thr Phe Leu Leu Arg Ala Ala Glu Glu Ser Thr 785 790 795 800 Ala Arg Asn Leu Asn Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 805 810 815 Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln Gln 820 825 830 Val Ala Ala Al a Ala Gly Ala Ala Thr Glu His Pro Pro Gly Ser Pro 835 840 845 Thr Ser Ala Thr Val Met Ser Thr Phe Thr His Ser Leu Lys Thr Leu 850 855 860 Ile Lys 865 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed polynucleotide based on the base sequence of the sequence No.1 in the present sequence listing <400> 11 gccttctctc ctacactaca ccc 23 <210> 12 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed polynucleotide based on the base sequence of the sequence No.1 in the present sequence listing <400> 12 gctggcttgg tagagattgg gc 22 <210> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed polynucleotide based on the base sequence of the sequence No. 3 in the present sequence listing <400> 13 gcacatttcc agcttctcag gc 22 <210> 14 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed polynucleotide based on the base sequence of the sequence No. 3 in the present sequence listing <400> 14 gccctggatc tgtggaactt gc 22 <210> 15 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed polynucleotide based on the base sequence of the sequence NO.5 in the present sequence listing <400> 15 cttcatgcct accagtcggg cc 22 <210> 16 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed polypeptide based on the aminoacid sequence of the sequence NO.6 in the present sequence listing <400> 16 ggcgaggttt tggtaatgga ggg 23 <210> 17 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed polynucleotide based on the base sequence of the sequence NO.7 in the present sequence listing <400> 17 ggccaaactc atgcagcaga aac 23 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed polynucleotide based on the base sequence of the sequence NO.7 in the present sequence listing <400> 18 gaccaatttg aagtctgatt tgagtg 26 <210> 19 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed polynucleotide based on the base sequence of the sequence No. 9 of the present sequence listing <400> 19 tccacagccc gtaaccttaa cc 22 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Designed polynucleotide based on the base sequence of the sequence No. 9 of the present sequence listing <400> 20 tggtggatgc tctgtggctg c 21

[Brief description of the drawings]

FIG. 1. Family analysis of HG00622 gene polymorphism
It is a figure which shows the result performed by analysis of the DNA fragment containing AG repeat. In the figure, A1 is a father, A2 is a mother, A3
And A4 show the analysis results of the child.

FIG. 2. Family analysis of HH01321 gene polymorphism
It is a figure which shows the result performed by analysis of the DNA fragment containing AG repeat. In the figure, A1 is a father, A2 is a mother, A3
And A4 show the analysis results of the child.

FIG. 3. Family analysis of FH16716 gene polymorphism
It is a figure which shows the result performed by analysis of the DNA fragment containing AG repeat. In the figure, A1 is a father, A2 is a mother, A3
And A4 show the analysis results of the child.

FIG. 4 is a view showing the results of a pedigree analysis of the FJ14474 gene, which was performed by analyzing a DNA fragment containing a CAG repeat. In the figure, A1 indicates the analysis result of the father, A2 indicates the analysis result of the mother, and A3 and A4 indicate the analysis results of the child.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 35/76 A61K 39/395 D 4C084 38/00 N 4C085 39/395 45/00 4C087 48/00 4H045 45 / 00 A61P 25/28 48/00 C07K 14/47 A61P 25/28 16/18 C07K 14/47 C12N 1/15 16/18 1/19 C12N 1/15 1/21 1/19 C12P 21/02 C 1 / 21 C12Q 1/02 5/10 1/68 A C12P 21/02 G01N 33/15 Z C12Q 1/02 33/50 Z 1/68 33/53 D G01N 33/15 M 33/50 33/566 33 / 53 C12N 15/00 ZNAA 5/00 A 33/566 A61K 37/02 (72) Inventor Takahiro Nagase 1532-3 Yana, Kisarazu-shi, Chiba Kazusa DeNA Research Institute (72) Michio Oishi Inventor 1532-3 Yana, Kisarazu-shi, Chiba Inside the Kazusa DeNA Institute (72) Inventor Hiroshi Yokota 1-16-13 Kita-Kasai, Edogawa-ku, Tokyo Daiichi Pharmaceutical Co., Ltd.Tokyo R & D Center (72) Inventor Michio Isono Edogawa-ku, Tokyo 1-16-13 Kita Kasai Daiichi Pharmaceutical Co., Ltd. Tokyo Research and Development Center F-term (reference) 2G045 AA40 DA12 DA13 DA36 FB02 FB03 4B024 AA01 AA11 BA44 BA80 CA04 GA11 HA12 HA15 4B063 QA01 QA12 QA19 QQ42 QQ79 QR55 QR59 QR80 QS24 QS25 QS34 4B064 AG01 AG31 CA19 CC24 DA01 DA13 4B065 AA93Y AB01 AC14 CA24 CA44 CA46 4C084 AA02 AA06 AA13 AA17 CA18 CA28 NA14 ZA022 4C085 AA13 AA14 CC05 CC22 DD33 DD86 4C087 BB33 BB63 ACA4A BC3A BC4A BC3A BC8 EA50 FA74

Claims (27)

[Claims] 1. A polynucleotide selected from the following group: a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9, or a complementary strand thereof At least 70% or more amino acid sequence homology with a polypeptide encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or SEQ ID NO: 9 in the sequence listing And a polynucleotide encoding a polypeptide having a polyglutamine sequence or its complementary strand, a polynucleotide that hybridizes with the above-mentioned polynucleotide or its complementary strand under stringent conditions, Deletion or substitution of one or several amino acids in the base sequence of the complementary strand, Pressure, and / or polynucleotide having a mutation such as insertion, and polynucleotides or their complementary strand containing any one of the polynucleotides from above. 2. A polynucleotide having at least about 10 consecutive nucleotide sequences in the nucleotide sequence of the polynucleotide according to claim 1. 3. A polynucleotide comprising the partial nucleotide sequence of the polynucleotide according to claim 1, wherein the polynucleotide comprises the nucleotide sequence according to any one of SEQ ID NO: 11 to SEQ ID NO: 20 in the sequence listing. 4. A polypeptide selected from the following group: (A) SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5,
A polypeptide encoded by a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 or SEQ ID NO: 9, wherein SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10 in the sequence listing (B) a polypeptide having at least 70% or more amino acid sequence homology with the polypeptide of (A), and having a polyglutamine sequence;
(C) a polypeptide having a mutation such as deletion, substitution, addition, and / or insertion of one or several amino acids in the polypeptide of (A) and having a polyglutamine sequence; and (D) a polypeptide having a polyglutamine sequence. A polypeptide containing the polypeptide of A), (B), or (C). 5. A recombinant vector comprising the polynucleotide according to claim 1 or a complementary strand thereof. 6. The recombinant vector according to claim 5, wherein the recombinant vector is an expression recombinant vector. 7. A transformant transformed by the recombinant vector according to claim 5 or 6. 8. The method for producing a polypeptide according to claim 4, comprising a step of culturing a transformant transformed with the recombinant vector according to claim 6. 9. An antibody that immunologically recognizes the polypeptide according to claim 4. 10. A compound that interacts with the polynucleotide of claim 1 to inhibit its expression and / or interacts with the polypeptide of claim 4 to bind the polypeptide to TAF130. A method for identifying a compound that inhibits, the polynucleotide according to claim 1,
A polypeptide according to claim 4, a vector according to claim 5 or 6, a transformant according to claim 7, or an antibody according to claim 9, wherein at least one of them is used. how to. 11. A method for identifying a compound that interacts with the polynucleotide of claim 1 and inhibits its expression, wherein the method comprises the steps of: By contacting the polynucleotide with a compound to be screened to evaluate the interaction of the compound, and then detecting the presence or absence or change of a signal generated by the interaction of the compound with the polynucleotide, Determining whether the compound interacts with the polynucleotide to inhibit its expression. 12. A method for identifying a compound that interacts with the polypeptide according to claim 4 and inhibits the binding between the polypeptide and TAF130, wherein the interaction between the compound and the polypeptide is enabled. Under the conditions described above, the polypeptide is brought into contact with a compound to be subjected to screening to evaluate the interaction of the compound, and then the presence or absence or change of a signal caused by the interaction between the compound and the polypeptide Detecting whether the compound interacts with the polypeptide to inhibit binding to TAF130. 13. A compound identified by the method according to any one of claims 10 to 12. 14. A compound that interacts with the polynucleotide according to claim 1 to inhibit its expression, or interacts with the polypeptide according to claim 4 to inhibit the binding of the polypeptide to TAF130. Compound. 15. The polynucleotide according to any one of claims 1 to 3, the polypeptide according to claim 4,
The vector according to claim 5 or 6, the transformant according to claim 7, the antibody according to claim 9, or the claim 13.
Or a pharmaceutical composition comprising at least one of the compounds according to 14. 16. A compound that interacts with the polynucleotide of claim 1 to inhibit its expression and / or interacts with the polypeptide of claim 4 to bind the polypeptide to TAF130. A pharmaceutical composition comprising an inhibitory compound. 17. The pharmaceutical composition according to claim 15, which is an agent for preventing and / or treating polyglutamine disease. 18. A means for quantitatively or qualitatively measuring the polynucleotide according to claim 1 or the polypeptide according to claim 4. 19. A means for diagnosing a disease associated with the polynucleotide according to claim 1 or the polypeptide according to claim 4, wherein the means according to claim 18 is used. 20. The diagnostic means according to claim 19, wherein said disease is polyglutamine disease. 21. A means for diagnosing polyglutamine disease, characterized by analyzing the length of the nucleotide sequence encoding polyglutamine in the polynucleotide according to claim 1. 22. A diagnostic means for polyglutamine disease according to claim 21, wherein the polynucleotide according to claim 2 and / or 3 is used. 23. A family diagnostic means characterized by analyzing a base sequence length encoding polyglutamine in the polynucleotide according to claim 1 as a polymorphic marker. 24. SEQ ID NO: 13, SEQ ID NO: 1 in the sequence listing
24. The family diagnostic means according to claim 23, wherein a polynucleotide comprising the nucleotide sequence of SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, or SEQ ID NO: 18 is used as a probe. 25. The family diagnostic means according to claim 24, wherein the combination of polynucleotides comprising the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14 in the sequence listing and SEQ ID NO: 15 and SEQ ID NO: 16 in the sequence listing A family diagnosis using a combination of polynucleotides consisting of the nucleotide sequences of SEQ ID NO: 17 and SEQ ID NO: 18 in the Sequence Listing alone or in combination of two or more. means. 26. SEQ ID NO: 11 and SEQ ID NO: 12 in the sequence listing
And / or SEQ ID NO: 19 and SEQ ID NO: 2 in the sequence listing.
26. The family diagnostic means according to claim 24 or 25, wherein a combination of polynucleotides comprising the base sequence described in 0 is used as a negative control. 27. A reagent kit for use in the means according to any one of claims 18 to 26, wherein the polynucleotide according to any one of claims 1 to 3 and the polynucleotide according to claim 4 A reagent kit comprising at least one polypeptide or the antibody according to claim 9.