JP2002345485A - Method for estimating genotype of fertility restorative gene locus for oryza sativa bt-type male sterile cytoplasm - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a method for detecting the fertility restorative gene (Rf-1 gene) of Oryza sativa individuals for RT-type male sterile cytoplasm having been utilized for raising hybrid rice. SOLUTION: This method comprises detecting the Rf-1 gene by making use of the fact that a plurality of PCR marker loci present in the proximity of the Rf-1 gene locus link with the Rf-1 gene locus. More specifically, this method comprises easily and accurately investigating the presence/absence of the Rf-1 gene and screening Rf-1 gene homo-type individual(s) by assaying the genotype of the plurality of PCR marker loci present in the proximity of the Rf-1 gene locus by making use of the fact that the Rf-1 gene locus lies between the new PCR marker loci, i.e. S12564 Tsp509I locus and C1361 MwoI locus, present on the Oryza sativa 10th chromosome.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a BT used for growing Japonica rice-Japonica rice hybrid rice.
The present invention relates to a method for detecting a fertility restoring gene (Rf-1 gene) of a rice plant with respect to a male sterile cytoplasm.

[0002] More specifically, the present invention relates to a DNA marker locus S12564 Ts in which the Rf-1 locus is present on rice chromosome 10.
Utilizing the loci between the p509I locus and the C1361 MwoI locus, by detecting PCR markers present in the vicinity, it is possible to investigate the presence or absence of the Rf-1 gene and select Rf-1 gene homozygous individuals. , Simple and accurate methods.

[0003]

2. Description of the Related Art Since rice is a self-fertile plant, when crosses are made between varieties, first, in order to avoid self-fertilization, all stamens in the spikelets are removed immediately before the spikelets of the rice flower. Next, it is necessary to fertilize using pollen derived from the crossed pollen parent variety. However, it is not possible to produce large quantities of hybrid seeds on a commercial scale with such manual crossing methods.

[0004] Therefore, in the production of hybrid rice,
A ternary method utilizing cytoplasmic male sterility has been utilized. The ternary method is a sterile line that has a male sterile cytoplasm, a recovery line that has a Rf-1 gene, and a nuclear gene that is identical to the sterile line and has a sterile cytoplasm. It refers to a method that uses a maintenance system that is not used. Using these three varieties, (i) fertilizing the pollen of the restoration line to the sterile line to obtain hybrid seeds, and (ii) fertilizing the pollen of the maintenance line to the sterile line Can maintain a sterile line.

[0005] In using the BT type male sterile cytoplasm in the three-line method, in order to cultivate a rice strain as a recovery line, the growing rice must have the Rf-1 gene in each step of breeding. In the final stage, it is necessary to confirm that the Rf-1 gene is homozygously possessed. In addition, in the three-line method, in order to check that the variety used for the recovery line has the Rf-1 gene, or to confirm whether the obtained hybrid seeds have restored fertility, the Rf-1 gene May need to be examined.

Conventionally, in order to estimate the genotype of the Rf-1 locus in a plant, first, a plant (F1) is formed from crossed seeds crossed with a test line, and then an F1 plant is formed. After selfing, the seed formation rate is above a certain level (for example, 70 to 80).
%) Or more. The test line refers to a maintenance line, a sterile line, or a set of both lines, and is appropriately selected depending on whether the cytoplasm of the target individual to be tested is BT type, normal cytoplasm, or unknown. In the case of a sterile line, the individual is crossed as a mother, and in the case of a maintenance line, the individual is crossed as a father.

However, in order to carry out these methods,
It takes enormous effort and time. In addition, since seed fertility is easily affected by environmental factors, it may become sterile regardless of genotype composition when investigated in a poor environment such as low temperature and lack of sunshine. There was a problem that genotype estimation could not be performed accurately.

[0008] In order to solve such a problem, a method of discriminating the presence of the Rf-1 gene by a molecular biological method has recently been proposed. It is a method for examining the presence or absence of the Rf-1 gene by detecting a base sequence linked to the Rf-1 gene (hereinafter, referred to as a DNA marker). Incidentally, since the DNA sequence of the Rf-1 gene has not been decoded, it is impossible with current technology to directly detect the Rf-1 gene.

For example, the rice Rf-1 locus is located on chromosome 10 and is a DNA marker (RFLP marker) that can be used for restriction fragment length polymorphism (RFLP) analysis.
It is reported to be between G291 and G127 (Fuku
ta et al. 1992, Jpn J. Breed. 42 (supl.1) 164-16
Five). Thus, the DNA marker loci linked to the Rf-1 gene
By investigating the genotype of G291 and G127, Rf-1
Methods for estimating the genotype of a locus are known.

[0010] However, there are several problems with conventional molecular biology methods. The first problem is that in the conventional method, the marker used is an RFLP marker, and it is necessary to perform Southern blot analysis to detect this. To perform Southern blot analysis, it is necessary to purify several micrograms of DNA from the test individual, and a series of operations consisting of restriction enzyme treatment, electrophoresis, blotting, hybridization with a probe, and signal detection Because of the necessity of performing the procedure, a great deal of labor was required, and it took about one week to obtain the test results.

The second problem is that the RFLP marker loci G291 and G127
Genetic map distance of about 30 cM (about 9000 k for rice DNA)
(equivalent to bp), it is considered that the possibility of double recombination is about several percent, and the genotype of the Rf-1 locus cannot always be estimated accurately.

A third problem is that the existence of the Rf-1 gene is
When estimated by detecting the RFLP marker loci G291 and G127, the fertility restoration lines selected as a result of breeding include:
In addition to the Rf-1 gene, the gene region between the RFLP marker loci G291 and G127 is also introduced. As a result, the introduction
The DNA sequence will have a chromosomal region from the Rf-1 gene donor parent of 30 cM or more, and there is a risk of introducing a poor gene that may be present in the introduced DNA region at the same time as the Rf-1 gene. there were.

In order to solve such a problem, a dominant DNA marker linked to the Rf-1 locus (JP-A-7-222588) and a co-dominant DNA marker (JP-A-9-313187) have been developed. These markers are linked to the Rf-1 locus at a genetic distance of 1.6 ± 0.7 cM (equivalent to about 480 kbp in rice DNA) and 3.7 ± 1.1 cM (equivalent to about 1110 kbp in rice DNA), respectively. , The two loci are in a positional relationship sandwiching the Rf-1 locus. Therefore, dominant PCR marker loci and co-dominant P
The CR marker locus can deduce the presence of the Rf-1 gene by detecting the presence of both. Also, the use of co-dominant PCR markers allows one to infer whether the genotype of the Rf-1 locus is homo or hetero.

However, there are still some problems when using these PCR markers. Since this codominant marker has a genetic distance of 3.7 ± 1.1 cM from the Rf-1 locus, the problem of high recombination frequency with the Rf-1 locus has not been sufficiently solved. As a result, the co-dominant marker itself can be accurately detected to a homo-type or a hetero-type, but when recombination occurs between the co-dominant marker locus and the Rf-1 locus, Rf-1
There is a problem that it is not possible to accurately estimate the genotype of a locus, particularly to estimate a homozygous or heterozygous type. On the other hand, when estimating the genotype of the Rf-1 locus using a dominant marker, the individual with a homologous Rf-1 gene (Rf-1 / Rf-1) and a heterozygous individual (Rf-1 / rf-1) without detecting both. Therefore, even if the genotype of the Rf-1 locus is estimated by using the above-described co-dominant marker and the dominant marker in combination, it is not possible to accurately discriminate the homo-type and the hetero-type related to the Rf-1 gene. In addition, in the case of performing PCR using a dominant marker, if a PCR product is not obtained, it cannot be denied that the PCR product may be caused by a problem in experimental operation. Furthermore, the gene distance between these co-dominant and dominant markers is about 5.3 cM (about 1590 kbp), which limits the length of the introduced chromosome region from the Rf-1 gene donor parent to a short length. Therefore, there is also a problem that import of a poor gene contained in this region cannot be suppressed.

Further, Japanese Patent Application Laid-Open No. 2000-139465 discloses that
A co-dominant PCR marker developed based on the base sequence of an RFLP marker located near the Rf-1 gene on chromosome 0 is described. However, many of these PCR markers have a problem that the gene distance from the Rf-1 gene is more than about 1 cM.

[0016]

An object of the present invention is to provide an Rf-1
By developing multiple codominant PCR markers that are closely linked to the locus and that sandwich the Rf-1 locus, the presence of the Rf-1 locus and whether it is heterozygous or homozygous It is an object of the present invention to provide a method for simply and accurately estimating the presence of a substance.

[0017]

SUMMARY OF THE INVENTION The present invention provides a method for detecting the Rf-1 gene which is a recovery gene for the BT type male sterile cytoplasm used in hybrid rice cultivation. More specifically, the present inventors have identified the location of the Rf-1 locus in a very narrow range on chromosome 10. The present invention, based on the results, exists near the Rf-1 locus
The present invention provides a method for detecting the Rf-1 gene by developing PCR markers and utilizing the fact that these PCR markers are linked to the Rf-1 locus. Specifically, the present invention relates to the Rf-1 locus, a PCR marker locus S1256 present on rice chromosome 10.
4 By using the loci between the Tsp509I locus and the C1361 MwoI locus to detect a novel PCR marker present in the vicinity, the presence or absence of the Rf-1 gene was investigated and the Rf-1 gene homozygous individual , Simple and accurate.

When PCR is performed using a primer pair designed for a specific region near the marker Rf-1 locus, and the product is treated with a specific restriction enzyme and subjected to electrophoresis, a Japonica strain is obtained. Different size bands may be observed with the Indica strain. In such a case, a band characteristic of the Indica strain is defined as an Rf-1 linked band in this specification. According to the present invention, the Rf-1 locus is located on the rice chromosome 10 PCR marker loci S12564 Tsp509I locus and C13
Since it has been found that the gene will sit between the 61 MwoI locus, PCR markers in the vicinity thereof can be appropriately developed and used by those skilled in the art.

For example, the present invention is selected from the following group:
By detecting whether at least one of the PCR markers is present in the genome of the test rice, it is determined whether the test individual has the Rf-1 gene linked to these PCR markers: (1 Marker 1: Genomic using DNA having sequences of SEQ ID NO: 1 and SEQ ID NO: 2 as primers
PCR is performed, and based on the presence or absence of a restriction enzyme EcoRI recognition site in the obtained product, a polymorphism between Japonica strain and Indica strain rice is detected. PCR marker R1877 EcoRI; (2) Marker 2: SEQ ID NO: Genomic using DNA having sequences of ID NO: 3 and SEQ ID NO: 4 as primers
Perform PCR, and based on the presence or absence of the restriction enzyme HindIII recognition site in the obtained product, to detect a polymorphism between the rice of Japonica strain and Indica strain, PCR marker G4003 HindI
II (SEQ ID NO: 19); (3) Marker 3: Genomic using DNA having sequences of SEQ ID NO: 5 and SEQ ID NO: 6 as primers
PCR is performed, and based on the presence or absence of a restriction enzyme MwoI recognition site in the resulting product, a PCR marker C1361 MwoI (S
(4) Marker 4: Genomic using DNA having sequences of SEQ ID NO: 7 and SEQ ID NO: 8 as primers
PCR is performed, and based on the presence or absence of a restriction enzyme MwoI recognition site in the obtained product, a polymorphism between the rice of Japonica strain and Indica strain is detected, and a PCR marker G2155 MwoI (S
(5) Marker 5: Genomic using DNA having sequences of SEQ ID NO: 9 and SEQ ID NO: 10 as primers
PCR is performed, and based on the presence or absence of a restriction enzyme MspI recognition site in the obtained product, a PCR marker G291 MspI (SE) is used to detect a polymorphism between rice of Japonica strain and Indica strain.
(6) Marker 6: genomic PCR was performed using DNA having the sequence of SEQ ID NO: 11 and SEQ ID NO: 12 as a primer, and the restriction enzyme BslI was recognized in the obtained product. PCR marker R2303 BslI, detecting polymorphism between Japonica and Indica rice based on the presence or absence of the site
(SEQ ID NO: 23); (7) Marker 7: Genomic PCR was performed using DNA having the sequence of SEQ ID NO: 13 and SEQ ID NO: 14 as a primer, and the restriction enzyme BstUI in the resulting product was used. PCR marker S10019 BstU to detect polymorphism between rice of Japonica and Indica strains based on the presence or absence of the recognition site
I (SEQ ID NO: 24); (8) Marker 8: Genomic PCR was performed using DNA having the sequence of SEQ ID NO: 15 and SEQ ID NO: 16 as a primer, and the restriction enzyme in the obtained product was used. Based on the presence or absence of a KpnI recognition site, a PCR marker S10602 KpnI that detects a polymorphism between Japonica and Indica rice
(SEQ ID NO: 25); and (9) marker 9: a genomic PCR using DNA having the sequence of SEQ ID NO: 17 and SEQ ID NO: 18 as a primer, and a restriction enzyme in the obtained product. Based on the presence or absence of the Tsp509I recognition site, PCR marker S12564 Ts to detect polymorphism between Japonica and Indica rice
p509I (SEQ ID NO: 26).

[0020] The above-mentioned PCR marker has the Rf-1 locus, which has nine RFLP marker regions R1877 on rice chromosome 10;
G291, R2303, S12564, C1361, S10019, G4003, S1060
2 and likely to sit near G2155 (Fu
kuta et al. 1992, Jpn J. Breed. 42 (supl.1) 164-16
5 results of RFLP linkage analysis and Harushima et al. 19
98, Genetics 148 479-494), and these RFLP markers were converted to a codominant PCR marker, the CAPS or dCAPS marker (Michaels and Amasino 1998, as described in Example 1 below). Th
e Plant Journal14 (3) 381-385; Neff et al. 1998, Th
e Plant Journal 14 (3) 387-392). By this conversion, the above PCR marker was obtained.

Among these PCR markers, the PCR marker
R1877 EcoRI, G291 MspI (SEQ ID NO: 22), R2303 BslI
(SEQ ID NO: 23) and S12564 Tsp509I (SEQ ID NO: 2
6) and a PCR marker C1361 MwoI (SEQ ID NO:
20), S10019 BstUI (SEQ ID NO: 24), G4003 HindIII
The group consisting of (SEQ ID NO: 19), S10602 KpnI (SEQ ID NO: 25), and G2155 MwoI (SEQ ID NO: 21)
It is located on the opposite side of the chromosome across the Rf-1 locus. Therefore, in a preferred embodiment of the present invention, (a) PCR markers R1877 EcoRI, G291 MspI, R2303 BslI and S12564
At least one PCR selected from the group consisting of Tsp509I
Marker, and (b) PCR marker C1361MwoI, S10019 B
stUI, G4003 HindIII, S10602 KpnI, and G2155 MwoI
By detecting the Rf-1 linked band with at least one PCR marker each selected from the group consisting of:
-1 Detect the presence of the gene. At that time, from the above group (a)
As a marker closest to the Rf-1 gene, at least PCR
It is preferred to use the marker S12564 Tsp509I and at least C1361 MwoI from the group of (b) above. If both the Rf-1 linked band by the PCR marker of (a) and the Rf-1 linked band by the PCR marker of (b) are detected in the genome of the test rice, the rice has the Rf-1 gene. The probability can be estimated with very high probability.

In another embodiment of the present invention, the Rf-1 linked band is detected by at least two PCR markers from the group (a) and at least two PCR markers from the group (b). For example, among the markers in the groups (a) and (b), in the genetic map shown in FIG. 1, a marker closer to the Rf-1 gene detects an Rf-1 linkage band, and a marker farther from the Rf-1 gene. By selecting a rice individual from which no Rf-1 linkage band is detected, it is possible to select a rice having the Rf-1 gene but containing as little unnecessary gene region as possible. Also in this case, it is preferable that at least one of the markers in each of the groups (a) and (b) is a PCR marker S12564 Tsp509I and C1361 MwoI, respectively. That is, two PCR marker loci S125
64 Tsp509I and C1361 MwoI are 0.
Only 3 cM away. By utilizing this property, the chromosomal region introduced from the Rf-1 gene donor parent can be reduced to 1 cM
Can be narrowed to the extent. As a result, donor parent Rf-1
It is possible to minimize the possibility that an inferior gene that may be present near the gene is introduced into the recovery line.

Primer In another aspect, the present invention also provides the following primer pair for amplifying the PCR marker. These primer pairs were also obtained as described in Example 1. (1) Primer pair 1: The primer pairs for amplifying PCR marker R1877 EcoRI are SEQ ID NO: 1 and SEQ ID NO.
It has the nucleotide sequence of NO: 2. (2) Primer pair 2: The primer pair for amplifying G4003 HindIII has the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4. (3) Primer pair 3: The primer pair for amplifying C1361 MwoI has the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6. (4) Primer pair 4: The primer pair for amplifying G2155 MwoI has the nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 8. (5) Primer pair 5: The primer pair for amplifying G291 MspI has the nucleotide sequences of SEQ ID NO: 9 and SEQ ID NO: 10. (6) Primer pair 6: The primer pair for amplifying R2303 BslI has the nucleotide sequences of SEQ ID NO: 11 and SEQ ID NO: 12. (7) Primer pair 7: The primer pair for amplifying S10019 BstUI has the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14. (8) Primer pair 8: The primer pair for amplifying S10602 KpnI has the nucleotide sequences of SEQ ID NO: 15 and SEQ ID NO: 16. (9) Primer pair 9: The primer pair for amplifying S12564 Tsp509I has the nucleotide sequences of SEQ ID NO: 17 and SEQ ID NO: 18.

By using each of these primer pairs, the corresponding PCR marker can be amplified from the rice genome and detected. Further, the use of a slightly longer nucleotide sequence containing these specific nucleotide sequences or a nucleotide sequence slightly shorter than these specific nucleotide sequences as a primer is within the scope of the present invention.

Detection of Rf-1 Gene In order to detect the Rf-1 gene in the test rice genome by the method of the present invention, any of the above-mentioned PCR markers is detected from the test rice genome using the primer of the present invention. Amplify by PCR and detect by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method.

In the PCR-RFLP method, when a polymorphism is present at a restriction enzyme recognition site in a DNA fragment sequence amplified by PCR between varieties to be compared, any type is determined from the cleavage pattern by the restriction enzyme. (DE Harry, et al., Theor Appl Genet (1998) 9
7: 327-336).

The DNA of the test rice genome to be used as a template for PCR was obtained from Edwards et al. (Nucleic Acids Res. 8 (6): 1
349, 1991). More preferably, DNA purified by a standard method is used. CTAB method (MurrayM.G., Et al., Nucleic Aci
ds Res. 8 (19): 4321-5, 1980) is a particularly preferred extraction method. The concentration of DNA used as a template for performing PCR is preferably 0.5 ng / μl in final concentration.

The method of PCR is well known. For example,
Genomic DNA used as template: 50 ng, dNTP: 200 μM each, ExT
Using aq ^TM (TAKARA) 5U, for example, one cycle of 2 minutes at 94 ° C, then 1 minute at 94 ° C, 1 minute at 58 ° C, 2 minutes at 72 ° C
30 cycles per minute, and finally at 72 ° C for 2 cycles.
This can be done by performing one minute cycle. Alternatively, perform one cycle of 2 minutes at 94 ° C, and then
It is also possible to carry out 30 cycles of 1 minute at 58 ° C., 1 minute at 72 ° C., and finally 1 cycle at 72 ° C. for 2 minutes. Alternatively, in another embodiment, one cycle of 2 minutes at 94 ° C. followed by 30 seconds at 94 ° C.
It can also be carried out by performing 35 cycles of 30 seconds at 58 ° C and 30 seconds at 72 ° C as one cycle, and finally performing one cycle of 2 minutes at 72 ° C.

The obtained PCR product is cleaved with a restriction enzyme corresponding to a restriction site present in each PCR marker in order to examine a restriction enzyme fragment length polymorphism. This cleavage is carried out by incubating at the recommended reaction temperature of the restriction enzyme to be used for several hours to one day. Each amplified PCR sample cut with the restriction enzymes is analyzed by electrophoresis on, for example, about 0.7% to 2% agarose gel or about 3% MetaPhor ^™ agarose gel. For example,
The gel is visualized in ethidium bromide under ultraviolet light.

It is confirmed whether the following bands are present on the visualized gel according to the primer pair used.

[0031]

[Table 1] ---------------------------------------------- ------------------------ Approximate size of detected band (bp) --------------- -------------------------------------------------- ----- Detection of marker 1 by primer pair 1 (R1877 EcoRI) When the test rice genome homozygously has the Rf-1 gene: 1500 and 1700 When the test rice genome has the Rf-1 gene heterozygously: 1500, 1700 and 3200 When the tested rice genome does not have the Rf-1 gene: 3200 --------------------------------- ------------------------------------- Detection of marker 2 by primer pair 2 (G4003 HindIII) When the test rice genome has the Rf-1 gene homozygously: 362 When the test rice genome has the Rf-1 gene heterozygously: 95, 267, and 362 When the test rice genome does not have the Rf-1 gene: 95 and 267- -------------------------------------------------- ------------------- Primer Detection of marker 3 by pair 3 (C1361 MwoI) When the tested rice genome has the Rf-1 gene homologously: 50 and 107 When the tested rice genome has the Rf-1 gene heterozygously: 25, 50, 79 and 107 Test rice genome without Rf-1 gene: 25, 50 and 79 --------------------------------- ------------------------------------- Detection of marker 4 by primer pair 4 (G2155 MwoI) When the test rice genome has the Rf-1 gene homozygously: 25, 27 and 78 When the test rice genome has the Rf-1 gene heterozygously: 25, 27, 78 and 105 The test rice genome does not have the Rf-1 gene Case: 25 and 105 --------------------------------------------- ------------------------- Detection of marker 5 by primer pair 5 (G291 MspI) When the test rice genome has homozygous Rf-1 gene : 25, 49 and 55 The tested rice genome has Rf-1 gene heterozygously Pass: 25, 49, 55 and 104 When the rice genome to be tested does not have the Rf-1 gene: 25 and 104 ------------------------- --------------------------------------------- Primer 6 marker Detection of 6 (R2303 BslI) When the tested rice genome has the Rf-1 gene homozygously: 238, 655, and 679 When the tested rice genome has the Rf-1 gene heterozygously: 238, 655, 679, and 1334 The tested rice genome Has no Rf-1 gene: 238 and 1334 ------------------------------------- --------------------------------- Detection of marker 7 by primer pair 7 (S10019 BstUI) -1 gene is homozygous: 130, 218 and 244 When the tested rice genome has the Rf-1 gene heterozygously: 130, 218, 244 and 462 When the tested rice genome does not have the Rf-1 gene: 130 and 462 ------------------------------------------------- --------------------- Detection of marker 8 by primer pair 8 (S10602 KpnI) When the test rice genome has the Rf-1 gene homozygously: 724 When the test rice genome has the Rf-1 gene heterozygously: 117, 607 and 724 Without Rf-1 gene: 117 and 607 -------------------------------------- -------------------------------- Detection of marker 9 by primer pair 9 (S12564 Tsp509I) When 1 gene is homozygous: 41 and 117 When the test rice genome has the Rf-1 gene heterozygously: 26, 41, 91 and 117 When the test rice genome does not have the Rf-1 gene: 26, 41 and 91 -------------------------------------------------- --------------------

[0032]

(1) In the method of the present invention, the DNA of the marker to be detected is amplified by PCR using the PCR-RFLP method, so that the detection can be performed easily in a short time without performing Southern blot analysis. be able to. RF for Southern blot analysis
Compared with the LP method, there is also an advantage that the amount of DNA used in the PCR-RFLP method may be as small as several nanograms. The degree of purification of the DNA used does not have to be very high, and a crude extract of DNA can be used as it is. In the present invention, in order to more reliably examine the presence of the PCR marker to be detected, a combination of the PCR-RFLP method and sequencing may be used.

(2) The PCR markers of the present invention are all co-dominant markers. A co-dominant marker refers to a marker that can distinguish a hetero individual from a dominant homo individual. When detecting the genotype segregation ratio of hybrids obtained by crossing heterozygous individuals, it is possible to use a dominant marker that is a marker that can only identify whether or not it has a dominant gene On the other hand, an individual having a dominant trait and an individual having a recessive trait can only be distinguished at a ratio of 3: 1, whereas when a co-dominant marker is used, a dominant homo individual: a hetero individual: a heterozygous individual To
It can be detected at a ratio of 1: 2: 1. Therefore,
Of the nine co-dominant markers disclosed in the present invention, Rf-
By identifying the genotype using two codominant markers present so as to sandwich one locus, the genotype of the Rf-1 gene to be introduced can be homozygous or heterozygous (that is, Rf-1 / Rf-1, Rf-1 / rf-1, or rf-1 / rf-
1) can be accurately identified.

For example, PCR markers S12564 Tsp509I and C13
Taking the assay using 61 MwoI as an example, when the genotype of the Rf-1 locus is heterozygous, the Rf-1 gene is an S12564 marker region that is not cleaved by the restriction enzyme Tsp509I and a C1361 marker that is not cleaved by the restriction enzyme MwoI. The rf-1 gene linked to the region and present on the other allele is linked to the S12564 Tsp509I marker cut with the restriction enzyme Tsp509I and the C1361 MwoI marker cut with the restriction enzyme MwoI. As a result, for each marker
By performing PCR, two kinds of PCR products having a polymorphism at the Tsp509I restriction enzyme site are amplified for the S12564 marker, and the restriction enzyme M is used for the C1361 marker region.
Two PCR products with polymorphism at the woI site are amplified. Cleavage of each of the two PCR products with the corresponding restriction enzyme shows a different restriction fragment pattern as compared to the homozygous case.

(3) PCR marker loci S12564 Tsp509I and C1361
MwoI means that the Rf-1 locus is located on chromosome 10 and that the PCR marker loci S12564 Tsp509I and C1361
The genetic distance between MwoI and Rf-1 gene is 0.1 cM each
(Corresponding to about 30 kbps) and 0.2 cM (corresponding to about 60 kbps). Considering the chiasma interference that makes it difficult to switch around at one location during meiosis, there is little possibility of double transfer between marker loci that are only 0.3 cM apart from each other . Therefore, by examining the genotype of both marker loci, the Rf
This shows that the genotype of the -1 locus can be accurately estimated.

In the present specification, the genetic distance is cM
(Centimorgan) as a unit. 1 cM is
The genetic distance at which the recombination rate is 1%, i.e., of all gametes
1% is the genetic distance at which recombination occurs between the two loci. Since the probability of recombination varies greatly from species to species, the number of base pairs corresponding to 1 cM varies from species to species. In the case of rice used in the present invention, although it varies depending on the position on the chromosome, it is known that on average, 1 cM corresponds to about 300 kbps of DNA.

(4) As described above, Rf disclosed in the present invention
S12564T, two PCR markers closely linked to the -1 locus
The sp509I locus and the C1361 MwoI locus are 0.
Only 3 cM away. By utilizing this property, the chromosomal region introduced from the Rf-1 gene donor parent can be reduced to 1 cM
Degree. As a result, even if an inferior gene exists near the Rf-1 gene of the donor parent, the inferior gene introduced simultaneously with the Rf-1 gene can be efficiently identified. The possibility of being introduced can be greatly reduced. Therefore, the PCR markers S12564 Tsp509I locus and C1361 Mwo
By using the I locus, the possibility of introducing a poor gene is reduced to 1/30 or less compared to the case where the conventional marker loci G291 and G127 loci having a map distance of 30 cM or more are used. can do.

(5) In another embodiment of the present invention, the PCR marker of the present invention can be used to distinguish between Japonica rice and Indica rice. As mentioned above,
The PCR marker of the present invention is a marker that can discriminate between two species by utilizing the presence of a nucleotide polymorphism in the sequence of a restriction enzyme site between Japonica rice and Indica rice. For example, when Japonica rice and Indica rice are mixed in the seed rice, it becomes important to distinguish Japonica rice from Indica rice, for example, as a result of cultivation, it becomes impossible to harvest a desired variety of rice. In the method of the present invention, the PCR marker can be amplified using about several nanograms of DNA, and thus it can be identified for each seed grain.

[0039]

The present invention will be described in the following examples.
These are intended to illustrate the invention, but not to limit the scope of the invention.

Example 1 RFLP marker around Rf-1 locus
In this example, the RFLP marker 9 around the Rf-1 locus was used.
(R1877, G291, R2303, S12564, C1361, S10019, G40
03, S10602, G2155) were used as PCR markers.

(1) Materials and Methods Nine RFLP markers (R1877, G291, R230) around the Rf-1 locus
3, S12564, C1361, S10019, G4003, S10602, G2155) were purchased from the Agricultural and Biological Resources Institute of the Ministry of Agriculture, Forestry and Fisheries, and the insertion base sequence in the vector was determined. Of the rice varieties in the text, Asomi Nori, Koshihikari and Nipponbare are Japonica rice, IR24 and
Kasalath is Indica rice.

(2) Preparation of Asominori Genomic Library Total DNA was extracted from Asominori green leaves by the CTAB method. After partial digestion with MboI, NaCl density gradient centrifugation (6-20%
The size fractionation was performed by a linear gradient, 20 ° C., 37,000 rpm, 4 hours, total volume 12 ml). A part of each fraction (about 0.5 ml) was subjected to electrophoresis, and a fraction containing 15 to 20 kb DNA was selected and purified. The library was prepared using Lambda DASH II (Strata
gene) as a vector and in accordance with the attached protocol. Giga Pack III Gold for packaging
(Stratagene) was used. After packaging, SM Buffe
500 μl of r and 20 μl of chloroform were added. 20 μl of chloroform was added to the supernatant after centrifugation to obtain a library solution.

When 5 μl of a 50-fold dilution of the library solution was used to infect XL-1 Blue MRA (P2), 83 plaques appeared. 4.15 × 10 ⁵ per library
pfu, and 8.3 × 10
^The calculation covers ⁹ bp. Rice genome (4 × 10 ⁸ b
It was considered to be a library of sufficient size for p).

(3) Isolation of genomic clones corresponding to R1877, C1361 and G4003 For C1361 and G4003, after isolating a plasmid containing an RFLP marker probe, the RFLP marker probe portion was separated by restriction enzyme treatment and electrophoresis. The target DNA was recovered using a DNA recovery filter (Takara SUPREC-01). For R1877, primers were designed for both ends of the marker probe, and
Was used as a template for PCR, the product was electrophoresed, and recovered by the method described above. The recovered DNA is rediprime DNA lab
Labeling was performed using an elling system (Amersham Pharmacia), and used as a probe for library screening. In addition, PCR was performed by a conventional method (the same applies hereinafter).

Screening of the library was performed by a conventional method after blotting plaques on Hybond-N + (Amersham Pharmacia). After the first screening, the area around the positive plaque was punched out, suspended in SM buffer, and subjected to the second screening. After the 2nd screening, a positive plaque was punched out, and a 3rd screening was performed to separate a single plaque.

After the isolated target plaque was suspended in the SM buffer, the phage was primarily grown by the plate lysate method. Using the obtained phage growth solution, secondary growth was performed by the shake culture method, and then Lambda starter kit (QIAG
EN) was used to purify the phage DNA.

For each marker, 1st screening was performed using eight plates. 10 μl of the library solution was used per plate. As a result of performing the 3rd screening, four, three, and three genomic clones corresponding to R1877, C1361, and G4003 were isolated, respectively.

(4) Conversion of R1877 to a PCR marker The isolated genomic clone was analyzed, and the site responsible for RFLP, ie, Ec which was present in IR24 but not in Asominori, was analyzed.
PCR marker conversion was performed by identifying the oRI site.

The following analysis was performed on the four isolated clones. First, using the T3 and T7 primers, the nucleotide sequences at both ends of the inserted fragment of each clone were determined.

Next, outward primers were designed for both ends of the marker probe, combined with T3 and T7 primers (a total of 4 primer combinations), and PCR was performed using each clone as a template.

After digestion of each clone with NotI and EcoRI, the length of the inserted fragment and the length of each EcoRI fragment were estimated by electrophoresis. As a result of these analyses, the positional relationship between the clones could be clarified. In RFLP analysis, marker probe RI877 uses Nipponbare 20 kb,
Kasalath detects a 6.4 kb EcoRI fragment (ftp: /
/ftp.staff.or.jp/pub/geneticmap98/parentsouthern/c
hr10 / R1877.JPG), it was possible to estimate the approximate position of the EcoRI site that was present in IR24 but not in Asominori. Therefore, a primer combination designed to amplify the periphery (SEQ ID NO: 1 × SEQ ID N
O: 2), 1 minute at 94 ° C, 1 minute at 58 ° C, 2 minutes at 72 ° C
Genomics with 30 cycles of PCR conditions with 1 cycle per minute
PCR was performed. After treating the obtained PCR product with EcoRI, 0.7
Electrophoresis on a% agarose gel. As a result, expected polymorphism was observed between Asominori and IR24. That is, P
EcoRI treatment of the CR product (about 3200 bp) resulted in IR24 1500
It was cut at bp and 1700 bp, but not at Asominori. Asino Minori-RIL of IR24 (Recombinant
As a result of mapping this PCR marker using (Inbred Line), it was located in the same region as the RFLP marker locus R1877, and it was proved that the RFLP marker R1877 was converted into a PCR marker.
Named oRI.

(5) Conversion of G4003 to PCR marker The isolated genomic clone was analyzed, and the HiLP which was present in the site responsible for RFLP, ie, Asominori but not in IR24 was analyzed.
By identifying the ndIII site, a PCR marker was formed.

The same analysis as for R1877 was performed to clarify the positional relationship among the three clones isolated. In RFLP analysis, 3kb in Nipponbare and 10kb in Kasalath by marker probe G4003
HindIII fragment is detected (ftp: //ftp.staff.or.j
p / pub / geneticmap98 / parentsouthern / chr10 / R1877.JPG)
By thinking in conjunction with
Was presumed to be one of the two candidate sites. Therefore, using a primer combination designed to amplify around each HindIII site, 94
Genomic PCR was performed under the conditions of 30 cycles at 30 ° C., 30 seconds at 58 ° C., and 30 seconds at 72 ° C. for one cycle. After the obtained PCR product was treated with HindIII, it was electrophoresed on a 2% agarose gel.
The site was shown to be a polymorphic site. That is, PCR
As a result, the product (362 bp) was treated with HindIII,
And 267 bp, whereas IR24 did not. The primer for amplifying the polymorphic site is SEQ ID
NO: 3 and SEQ ID NO: 4. Result of mapping, RF
It was proved that the LP marker G4003 was converted to a PCR marker, and this marker was used in the present invention for G4003 HindIII
(SEQ ID NO: 19).

(6) PCR Marking of C1361 Primers were designed based on the nucleotide sequence information of the isolated genomic clone. Asino Minori, Koshihikari, Kasa
PCR was performed using the total DNA of lath and IR24 as a template, and the product was subjected to electrophoresis and then recovered by the method described above. Using the recovered DNA as a template, the nucleotide sequence of each variety was decoded by ABI Model 310 to search for mutations that could be used for polymorphism generation.

The same analysis as for R1877 was performed, and the approximate positional relationship among the three clones isolated could be clarified. However, it was clarified that there was a region around the C1361 marker where PCR amplification was difficult or a region where the nucleotide sequence could not be decoded, and it was considered difficult to identify the site responsible for RFLP. Therefore, we focused on the region where a relatively long PCR product (2.7 kb) was obtained, and decided to try dCAPS. Asanominori, Koshihikari, Kasalath, and IR24 were used to compare the base sequences of genomic PCR products in the same region. As a result, six sites showing polymorphism between Japonica rice and Indica rice could be found. For one of them, dCAP
S conversion was performed. During this process, SEQ ID N
O: 5 and SEQ ID NO: 6 at 94 ° C for 30 seconds, 58 ° C
PCR was performed under PCR conditions of 35 cycles, one cycle of 30 seconds at 72 ° C. and 30 seconds. After treating the resulting PCR product with MwoI, 3
Analysis was performed by electrophoresis on% MetaPhor ^™ agarose. Asominori cuts at two places, about 25bp, 50b
A band of p and 79 bp was observed, and the DNA was cleaved at one site in IR24, and bands of about 50 bp and 107 bp were observed. As a result of the mapping, it was proved that the RFLP marker C1361 was converted into a PCR marker, and this marker was designated as C1361 in the present invention.
1 MwoI (SEQ ID NO: 20).

(7) Conversion of G2155 to a PCR marker Primers were designed for both ends of the marker probe,
PCR was performed using Asominori, Koshihikari, IR24 and IL216 (a line in which the Rf-1 gene was introduced into Koshihikari by backcrossing, the genotype was Rf-1 / Rf-1) as a template. Purification of PCR products and search for mutations that can be used for polymorphism generation were performed by the methods described above.

As a result of comparing the nucleotide sequences of the corresponding regions of the test varieties, the varieties / lines (IR24 and IL216) having the Rf-1 gene-
Three mutations were found among varieties not carrying the Rf-1 gene (Asominori and Koshihikari). One of them was used to convert to dCAPS. In this process, using SEQ ID NO: 7 and SEQ ID NO: 8 as primers at 94 ° C.
30 seconds, 30 seconds at 58 ° C, 30 seconds at 72 ° C
PCR was performed under the cycle PCR conditions. After the obtained PCR product was treated with MwoI, it was analyzed by electrophoresis with 3% MetaPhor ^™ agarose. Asominori was cut at one site and bands of about 25 bp and 105 bp were observed. IR24 was cut at two sites and bands of about 25 bp, 27 bp and 78 bp were observed. As a result of mapping, it was proved that the RFLP marker G2155 was converted to a PCR marker, and this marker was named G2155 MwoI (SEQ ID NO: 21) in the present invention.

(8) PCR Marking of G291 Primers were designed for the internal sequence of the marker probe, PCR was performed with various combinations of primers, and a primer combination capable of obtaining an amplification product of an expected size was searched. . Total DNA of Asominori, Koshihikari, IR24 and IL216, based on primer combinations found by the search
Was used as a template for PCR. Purification of PCR products and search for mutations that can be used for polymorphism generation were performed by the methods described above.

Using the primers designed for the marker probe sequence, genomic PCR of the test variety was performed,
The nucleotide sequences of the products were compared. As a result, four mutations were found between cultivars / lines (IR24 and IL216) having Rf-1 gene and cultivars not carrying Rf-1 gene (Asinominori and Koshihikari). One of them was used to convert to dCAPS. In this process, using SEQ ID NO: 9 and SEQ ID NO: 10 as primers, 94 ° C. for 30 seconds, 58 ° C. for 30 seconds,
One cycle of 30 seconds at 72 ° C under 35 PCR conditions
PCR was performed. After treating the obtained PCR product with MspI, 3% MetaP
Analysis was performed by electrophoresis on hor ^™ agarose. R
Approximately 25 b
Bands of p, 49 bp, and 55 bp were observed, and in the cultivar not having the Rf-1 gene, cleavage was performed at one site, and bands of about 25 bp and 104 bp were observed. As a result of mapping, the RFLP marker G291 is set to PC
The marker was proved to be converted to the R marker, and this marker was named G291 MspI (SEQ ID NO: 22) in the present invention.

(9) Conversion of R2303 to PCR marker A primer was designed for the internal sequence of the marker probe, and PCR was performed using Asominori, total DNA of IR24 and Kasalath as a template. The purification of the product and the search for mutations that can be used for polymorphism generation were performed by the method described above.

As a result of comparing the nucleotide sequences of the corresponding regions of the test varieties, a variation between Japonica rice and Indica rice was found. Since this mutation occurred at the BslI recognition site, it was used as a CAPS marker as it was. In this process, using SEQ ID NO: 11 and SEQ ID NO: 12 as primers,
The PCR was performed under the conditions of 30 cycles, with one cycle consisting of 1 minute at 58 ° C. and 2 minutes at 72 ° C. Bsl
After I treatment, analysis was performed by electrophoresis on 2% agarose. Japonica rice is cut at one place, about 238 bp, 1
A band of 334 bp was observed, and in Indica rice, it was cleaved at two places, and bands of about 238 bp, 655 bp and 679 bp were observed. As a result of mapping, it was proved that the RFLP marker R2303 was converted to a PCR marker, and this marker was named R2303 BslI (SEQ ID NO: 23) in the present invention.

(10) Conversion of S10019 into a PCR marker The conversion of S10019 into a PCR marker was performed according to the method of converting R2303 into a PCR marker.

As a result of comparing the nucleotide sequences of the corresponding regions of the test varieties, a variation between Japonica rice and Indica rice was found. Since this mutation occurred at the BstUI recognition site, it was used directly as the CAPS marker. In this process, using SEQ ID NO: 13 and SEQ ID NO: 14 as primers,
The PCR was carried out under a PCR condition of 30 cycles, each cycle consisting of 1 minute at 58 ° C. and 1 minute at 72 ° C. The obtained PCR product is
After UI treatment, analysis was performed by electrophoresis on 2% agarose. Japonica rice is cut at one place, about 130bp
, 462 bp, and bands were cut at two sites in Indica rice, and bands of about 130 bp, 218 bp, and 244 bp were observed. As a result of mapping, the RFLP marker S10019
It was proved that it was converted to a marker, and this marker was named BstUI (SEQ ID NO: 24) in the present invention.

(11) Conversion of S10602 to a PCR marker S10602 was converted to a PCR marker according to the method of converting R2303 to a PCR marker.

As a result of comparing the nucleotide sequences of the corresponding regions of the test varieties, a variation between Japonica rice and Indica rice was found. Using the mutation, CAPS was performed. In this process, SEQ ID NO: 15 and SEQ ID NO: 16 were used as primers.
PCR was performed under the conditions of 33 cycles, with 1 cycle at 94 ° C, 1 minute at 58 ° C, and 1 minute at 72 ° C. After the obtained PCR product was treated with KpnI, it was analyzed by electrophoresis on 2% agarose. Japonica rice was cut at one site and bands of about 117 bp and 607 bp were observed. Indica rice was not cut and a band of 724 bp was observed. As a result of mapping, it was proved that the RFLP marker S10602 was converted to a PCR marker, and this marker was named S10602 KpnI (SEQ ID NO: 25) in the present invention.

(12) Conversion of S12564 to a PCR Marker Conversion of S12564 to a PCR marker was performed according to the method of converting R2303 to a PCR marker.

As a result of comparing the base sequences of the corresponding regions of the test varieties, a mutation between Japonica rice and Indica rice was found. Using the mutation, dCAPS was performed. In this process, SEQ ID NO: 17 and SEQ ID NO: 18 were used as primers.
30 seconds at 94 ° C, 30 seconds at 58 ° C, 30 seconds at 72 ° C
One cycle was performed under 35 PCR conditions.
After the obtained PCR product was treated with Tsp509I, it was analyzed by electrophoresis with 3% MetaPhor ^™ agarose. In Japonica rice, bands were cut at two sites, and 26 bp, 41 bp, and 91 bp bands were observed.Indica rice was cut at one site, 41 bp, 1 bp
A 17 bp band was observed. Result of mapping, RFLP
It was proved that the marker S12564 was converted to a PCR marker, and this marker was used in the present invention for Tsp509I (SEQ
D NO: 26).

Example 2 Mapping of the Rf-1 Locus DNA was extracted from 1042 individuals in an F1 population prepared by applying MS-FR Koshihikari pollen to MS Koshihikari and subjected to analysis. Here, MS Koshihikari is Koshihikari whose cytoplasm has been replaced with BT-type male sterile cytoplasm (generation: BC10F
1). MS-FR Koshihikari is Rf-1 derived from IR8.
This is a strain in which the gene has been introduced into MS Koshihikari (Rf-1 locus heterozygous).

First, it is considered that the Rf-1 locus is sandwiched.
The genotype of each individual at the R1877 EcoRI and G2155 MwoI marker loci was investigated. R1877 EcoRI seat or G21
Japonica rice homozygous individuals with 55 MwoI loci
Recombinants between the marker loci were considered. Next, for each recombinant, G291 MspI locus, R2303 BslI locus, S12564 Ts
p509I locus, C1361 MwoI locus, S10019 BstUI locus, G4003 HindI
The genotypes of the II locus and the S10602 KpnI locus were investigated to identify recombination sites.

As a result of genotyping the R1877 EcoRI locus and the G2155 MwoI locus, 46 individuals were found to be recombinants near the Rf-1 locus. Table 2 shows the results of investigating the genotypes of the marker loci near the Rf-1 locus for these recombinants. In the above crosses, it was reported that only pollen having the Rf-1 gene was capable of fertilizing in individuals having BT-type male sterile cytoplasm (C. Shinjyo, JAPAN. J. GEN.
ETICS Vol.44, No.3: 149-156 (1969))
The locus could be located on the detailed linkage map (Figure 1).

[0071]

[Table 2]

In the present invention, in order to examine the genotype of a marker locus closely linked to the Rf-1 locus, a novel codominant PCR marker S
9 new co-dominance, including 12564 Tsp509I and C1361 MwoI
A PCR marker was developed. These novel co-dominant PCR markers can provide a simple and accurate method for estimating the genotype of the Rf-1 locus. Using the PCR marker of the present invention, Japonica rice-investigation of the presence or absence of the Rf-1 gene for the BT type male sterile cytoplasm used for growing Japonica rice hybrid rice and selection of Rf-1 gene homozygous individuals, It was simple and accurate. Therefore, the PCR marker of the present invention can be efficiently used for growing hybrid rice. Further, in the method of the present invention, since the genotype is directly detected from the DNA sequence, the genotype of the Rf-1 locus can be determined without being affected by environmental factors.

[0073]

[Sequence List] <110> JAPAN TOBACCO INC. <120> A method for genotyping the locus which is involved in restoratio n of the rice BT type cytoplasmic male sterility. <130> 991698 <160> 26 <210> 1 <211> 24 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of R1877 EcoRI marker se quence. <400> 1 cattcctgct tccatggaaa cgtc 24 <210> 2 <211> 33 <212> DNA <213> artificial sequence < 223> Oligonucleotide primer for amplification of R1877 EcoRI marker se quence. <400> 2 ctctttctgt atacttgagc tttgacatct gac 33 <210> 3 <211> 20 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of G4003 HindIII marker sequence. <400> 3 gatcgacgag tacctgaacg 20 <210> 4 <211> 24 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of G4003 HindIII marker sequence. <400> 4 aatagttgga ttgtcctcaa aggg 24 <210> 5 <211> 27 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of C1361 MwoI marker seq uence. <400> 5 aaagcaaccg acttcagtgg catcacc 27 <210> 6 <211> 24 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of C1361 MwoI marker seq uence. <400> 6 ctggacttca tttccctgca gagc 24 < 210> 7 <211> 27 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of G2155 MwoI marker seq uence. <400> 7 gaccaccaat taactgatta agctggc 27 <210> 8 <211> 27 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of G2155 MwoI marker seq uence. <400> 8 tttctggctc caataatcag ctgtagc 27 <210> 9 <211> 27 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of G291 MspI marker sequence. <400> 9 ctgctgcagc aagctgcacc gaaccgg 27 <210> 10 <211> 24 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of G291 MspI marker sequence. <400> 10 acattttttc ttccgaaact tccg 24 <210> 11 <211> 24 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for ampli fication of R2303 BslI marker seq uence. <400> 11 atggaaagat acactagaat gagc 24 <210> 12 <211> 24 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of R2303 BslI marker seq uence. <400> 12 atcttatata gtggcaggaa agcc 24 <210> 13 <211> 24 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of S10019 BstUI marker s equence. <400> 13 aacaatctta tcctgcacag actg 24 <210> 14 <211 > 24 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of S10019 BstUI marker s sequence. <400> 14 gtcacataga agcagatggg ttcc 24 <210> 15 <211> 24 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of S10602 KpnI marker se quence. <400> 15 agctgttgag agttctatgc cacc 24 <210> 16 <211> 24 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of S10602 KpnI marker se quence. <400> 16 tagccatgca acaagatgtc atac 24 <210> 17 <211> 26 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of S12564 Tsp509I marker sequence. <400> 17 ctagttagac cgaataactg aggttc 26 <210> 18 <211> 27 <212> DNA <213> artificial sequence <223> Oligonucleotide primer for amplification of S12564 Tsp509I marker sequence. <400> 18 tttgtgggtt tgtggcattg agaaaat 27 <210> 19 <211> 2240 <212> DNA <213> Oryza sativa L. <223> PCR marker G4003 HindIII <400> 19 gcggccgctc cgggaagtcg agcgagtaga cgcccctgac gccgtcggcgcgtcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgcgtcgcgcgcgcgcgcgcgcgcgcgtc cgtcgcgcgg cgccgcccgt 120 tgatcgtcac cggcgccgtg ctccgcagca ggtacgcctg cgtcacgttg atcgacgagt 180 acctgaacga tccctgtggg ttcggcctcg ccgctccggc actcaggttc cacctgccca 240 atgcaaaaaa ccaaaaccca aaagcttaat gcgaataata catcattcca cgtatttaaa 300 aaaataattt ataggtaaaa tttttataat gtattttagc gacgtaaatg tcaatgctga 360 gaaataaacg ataatacttt aaatgaagtt ctaaaattta aattttggca tcggttgatg 420 ttggataaag aaaacgatgg aggctagtaa tttttcttct tttttaagta tctagattgt 480 catatattga atttttcagt ttttcatccc tttgaggaca atcc aactat tattttcctt 540 ttcttatgta aaaggttgaa caacatattc aaacataaaa aaataaaatt aaatgaaata 600 aatttacaat tcataaaatt tacagaattt atgttaagaa aatattcaaa cttagataat 660 aataaagcaa caaaatcgta ctaaaaagaa gtataattgt acattgtata ctactactcc 720 tacaatttta gacttagaat ttttaatttc ctgaaatcta gtaatgccat ttttttcttt 780 ctagttgaac cagacagtaa gtttaactcg aaacttataa gctaatgagc gaagtcgggc 840 aattcactcg tacctgacgg agcgagcttg gttcatggag aaggacttgt cgaactggtc 900 ctggggaggg tcggggagcg ggccggaggc ccgcccccgg gagttggagt agcggaggac 960 ggcgacgccg gcgacgcggc gccacacggt gtcgttcacc atgcgcgcgc tggcgacgac 1020 gtagtagtcg gagctcgcgt tctggtcggt ggtgacgagg aaggagtagg actggccgac 1080 gtggacgtcc aggttggtgt agttctgctg cgtcgtgtag gagccctccg tctccaccag 1140 caccatgttg tgcccctgga tcctgaagtt gaggctcgtc gacgtcccca cgttgtgcac 1200 tcggatcctg tacgtcttgc ctgtgtcccc acaccgacgt cgccgacaca cgcgcaaaag 1260 ataatagact cattgtaagt aggtagtaac cttctccgtt tcatattata aatcgtttga 1320 ttatattttt gttagttaaa cttctttaag ttttttttct ataaacttaa ttaaatc taa 1380 agaattttaa taaaaaaaat caaacgactt ataatataaa atggatggag tagttgcatc 1440 aatttgtgga tgaagcaaac aagattatat ccttttcatg agggtgaaag tattcagtga 1500 acaattcgtc agtttcaagt ttcatgaaat cggacagggt ctctgaaagt ctgtattttt 1560 ggtactgttg gattgactac tctggcttct gttgtcacat cttttgtatc ctagtttcgg 1620 taaaaaaaat tttggcattt ttactcctat cgttgatctg tttaactgaa accattgcat 1680 gatatactac tagcagacaa aactggtgaa aattcacgag aatgaacttt ttgtcagtta 1740 agcattagcg gacagcttca gtaagcagag caggctgcct taaggcttaa agcactatct 1800 tccacaacac tttgtcctac aatcaaattc caaatttact atcacaaaaa gcgaaggaac 1860 taactaaacc ttactcctac tagtactact gctatgacta tgaaacaaga ttccaatcca 1920 aagaaaacac agtgctcgat cagcatgata aaagcaacga aacctgctca tccagctgcc 1980 aaaatgccac cccactgact ctacgtacgt actacgtatt gacgctgtaa aaaactagcc 2040 gtagtacaga gaagaggacc caaagtttcg tcaaaaattt tattttaccc ggatccacat 2100 tgatggtctc gtactcgatg ccggccggga caaggctgtc gttgtacctg tacgggccct 2160 tgccgttaat cagcacgccg tccggcatcc cgaggtcctt gccactgtcc agcatcttcc 22 20 tcagatcctg caacgaattc 2240 <210> 20 <211> 2601 <212> DNA <213> Oryza sativa L. <223> PCR marker C1361 MwoI <400> 20 tcttgctgag atccaagttg cggtaacttt gcctttttct ttttttcgg tttttcttagt tttttcgg tttttttcgg tttttttcgg tttttttcgg tttttcgg tttttgttg ttgaaaggga tcaatttgct aggagtacat gattctaaaa 180 gcgatttcga aataaaacac agttctcgat ctcatacctg aaaacaaaag gcccatactg 240 tgtaaactgt gattatgctt ctgttaaatg ggatatttgt acaaaattga cgccaaccac 300 ctataaacag attgtgagct tttatcttag taaaataaaa tgtgacattc tactcagtgt 360 tcagtgatcc gatgtcgtct cttctgcgta caacttctaa cagccgtttt cggtagtaca 420 aactagcgaa acaccaaaaa cgcagcattt gagttctgga atacgctgaa attgttagaa 480 tcaaccacga aaccaaaatc attgttcaga aacgttgcaa cgagataaaa cacaagaact 540 tgttttaaca aagcatacgg acagtacata tacggttaca acacccagtc tttatacagt 600 tctgctggag ttccatctac tggctgtcat tgtatctcag gacagacagg ttaacatagg 660 tacaacacaa ttacaggcta aaccgaagcg aactacactg tcagcatctc taacagtatc 720 gtcaagtag tctcattag a acgtccctgg cagaatccct 780 ctcgtttctg gcagcgacga ggcacggtcc atggccttag caggacatct cacccgtcag 840 ctgcatagaa agcaaccgac ttcagtggaa tcacctcctg ctcctgcaaa aaagttggtt 900 cgatcaatca cgcgtttaat ccaaaacaaa atgggtatta attatgctag cctatgaagc 960 tacctcagag ttctctattt gctctgcagg gaaatgaagt ccagtggaac agttctcaag 1020 cacctcaggg ctcttcatcc atgctttgtg tgcttcaatg gctttcagct tatagcgaaa 1080 catctgcgat acggatctaa aattaaggat gtcgacaatt acttaacaca acaaataatt 1140 gaagcaggtc cagttaaaga aaagtagcag cgaagaatag cactctgaag tctgaacctc 1200 agataaagaa atggttggtt tttccagttc atctccctca acatggattc cagtaccctg 1260 gcattctggg caaaggatgg atgttatttt cttaggtgca ttttttgcct ttcttcctcg 1320 attgcttttt cccttgcttg caattttgtc tgctagcatc tcatattggc ataaaatagt 1380 ccagtgcaca aggcaagaag tgtgaaacaa atgaaatgcc tgcaaaatta gccgtacaaa 1440 gtcattggag gttgcagcag aatactacaa atttttaaag aagaaactat acactgtcta 1500 tgttttgctt gaaatgaatt caaccacttt gcattatacg gtttggaatc cctggtttgt 1560 gagaactgta attccattac aacagtgaag aagttaccat aactaatg aa tggaaattag 1620 tcaaatgcct aattttttag gtttgcttta atttatttat ctgtgagaaa tgctaagcat 1680 gtcatgcgtt gctatcttca agaaatacta agaaactgca aaggcaaaga atgtttgaaa 1740 taacttaccc cgcttgagtt tctactgctg caggctagat ttcctgtctt gcagttgagc 1800 aaggtagcta catccttttc aagaagcatt ggtcgcccac aaatatcaca agctttctca 1860 gcagcaaggc gcttctgctt acgcaactcc ctcctcatag atttggtgga taagaggcca 1920 acttgaagat tgtgtgaagt acctgtcggg gaacctgtta tgatagcttg gctattgtca 1980 tgggcggagc tgctttgctc attcgactcc tctgaagatg cttcttgatc tgaaaatgac 2040 ttctttcttc tctttccacg gtgtccagca tcatcaatca cgaagaaaga tccagcagag 2100 ataggaaggt cctgatcatc agaagaccac ttcctgccca actcaattgt ataagagaag 2160 ttgacaatgg caaagtcaga ttgctcatag gtgtcacact catccaagcc atgggagcca 2220 tcctgtccta cccaagcaca ccagatcttg ctaatctttt tacttccttt gctagcttcc 2280 cataacctgt atgcaatatt tccatatccc aaaagatgca caggcaaatc cgaaacaaca 2340 tcctttagca atacactagg aataacgaga ggaccgtcag ttccactttg gtttgacagc 2400 acatgatctt cagatacaga agcagttcta ccattaccat gcgcatttgc acc acggcgt 2460 gtgccttttg cgccattgcg agagctagaa tcatctctca acctcgaagt cacttcagtg 2520 tcgttcgctg gaaccagagc cagctctctg gtgttctgcg agctcgagtc cagcaagagc 2580 gggtcttga c2c gggtcttga c1c gccgagtc <1> g> <g> cgc1c <g> cgc1c <g> cgc1c <g> cgccgc1c <g> cgccgc1c <g> ccctctgctt gatccagtgt acatccatgg gttaggacag attagttact cagttaatta 60 agtgtgagac tggaaaaaaa tatctgacgg cagttttata agttgagtga ttgaactagt 120 gaaagttcag ttaactgtca acggctgtag atttgggatg gcagactgtt ctgagtcaaa 180 atgaagcttt tactgtgcgt ggttaccagg tgcagtaaaa taatttcaga tctaatcgca 240 gtaaaaaaat gtagtactat atgttaagac gagattggtc ggtcaaaatc tatctggccc 300 tttacatctc ccaaatgtta cctcagttgc aggtggtaaa aaaaaatcac tcgtttcacg 360 tgatgtcggc agatcatgga ccatgtctca aatgctgaaa ctctgaacaa tcaacaaaaa 420 aatccaacca gatgagctgt gcaactgata attgatcatc acactatttg caactcatct 480 ttcatgtaga tggaacttca atcccgaaga aataatgaca gcaaaatgct gcgatcctga 540 agaaaggatg gcggcaaaat ggcagcgata aaaaaaaaat ggttgacca tgaagataga 600g agat aagagctagc taagctagct aggtagagtt 660 ggatggaaga gtagtagtat gagatagagc atggagcgcg acaactcaag tggatgctaa 720 agtaaaaggc attctcttct cttgtttgga atcagaaaag aaaagaaaag acttgagctg 780 cttggctgga atgtttggtt ggatcatgcg cgctctcctt agcttagctc gccaagaaat 840 cctcgcttca tctctctcaa taattcaaag ccacgagctc tctgctcata tccagtgcga 900 cgattcccgt taatgcaaat gcattatatc cagttcgaaa tgttacaatt cttgcgtttg 960 cagcaagcca gcaagtggtg tgaattgttt aatccctcgt gcatttcaac gaaattctct 1020 cacaaattcg cattgacttc tttcttagca caattagtaa gcagtgacaa ataaagaatt 1080 tttgaacagg atgtctttcc aaggaaggtg agatttttta tgtggatagc aaggatcgcc 1140 tttccttagc atgaagagaa tgtgatcaac tttacacctt gcttacgatt atggccttaa 1200 tttttgatac cctaaacagg agcacatcac atgcatgtcg acctgagacc accaattaac 1260 tgattaagtt ggcatttcag atgcatccgt cagttacatg atcaggtgat cgatggatca 1320 actgtaggtt tca 1333 <210> 22 <211> 863 <212> DNA <213> Oryza sativa L. <223> PCR marker G291 MspI <400> 22 cgaacaggat caaaagtaga cgacgagggc atttagaagg agaggaattg tatttgttcc 60 cggtat ttaa tttttaaatt tgtggtcgga agtttcggaa gaaaaaatgt gctcatgagt 120 gattattggc tctgaacacc aacctctctt ttcgttgatt ccttctgagg tgttgggtgt 180 tgggacacga tgctgccgcc gacacgacac cgggttccac aatacactaa tctactcgcg 240 acaccttcat tgaactgcat ataattattt agaaagtcca ttaacacatc ttataaaacc 300 ttgttgaatc atataatcat tctataaagt ctatttgaac atcttatgaa aaaataagat 360 ctgacctagt cgttacactc tcttacattt tccattagcc taactaattc cgtgcaggaa 420 acgcccaaaa ataatagtac caatagtcca ctaatcccgt gccagaggcc gccaatgatt 480 agtgattaac ccaaaaaaca taatcatcat cacacgccgc taatgaccag ctctcgctta 540 gctcatccca caggcggccc ccacacgcca ctcctgccat gtgggcccac ctttcacacc 600 ccccaccaac cagaaaaaaa actcccccaa aaaaaaaact tttaatgctt atctcgcggc 660 agtataaaag gcgaccccac cacccacaca caatcacagt cagcgaccca acccaacccg 720 agccgaggag tcgagtcgtg tgaaaattac gaaattgccc ttcgactcca ccaccaccac 780 ccaccggcga ggcgaggaga ggagaaaaat tgggaggaaa aaaaaaggga aaaagaaaaa 840 gggtggagga gatttttgcg aag 863 <210> 23 < 211> 1510 <212> DNA <213> Oryza sativa L. <223> PCR mark er R2303 BslI <400> 23 tgccatgaag acctatggaa agaatatctt cttctcactc tgtgaatggt gagtttactc 60 tctgtaacat ttagggctag gtcgaaggaa catgaagcat tgctgattca ctccactgtg 120 tttttttttt ctgtataggg ggaaagaaaa tcctgctaca tgggcaggcc gcatgggtaa 180 cagctggaga acaactggcg acatcgccga caactggggc aggttctact catcctctct 240 ttaaccctgt ttacatagtt cttgagtttt tcagtactga tcgtaattgc cctgttattt 300 cagtatgaca tctcgtgcag acgaaaatga ccaatgggct gcctatgctg gacctggtgg 360 atggaatggt aagaacttga gatgtatctg ttcctaggtt gcttaaccat ttgagagctt 420 caaaatgatc aacatatgtt tctgctgtgc aatatcagat cctgacatgc ttgaagtggg 480 aaatggtggg atgtctgaag ctgagtaccg gtcacacttc agtatctggg cactagcaaa 540 ggtaccatag catgttctat gtactaataa ttttgctgca atgttgaact tctttgcatt 600 tcctcactgc aagttttgct tgaattgttc aggctcctct tttgatcgga tgcgatgtgc 660 gctcaatgag ccagcagacg aagaacatac tcagcaactc ggaggtgatc gctgtcaacc 720 aaggcaagcc ttctcagttt cacatgctta gatttagcca tacctcttgg atatttcacc 780 atactcataa tgtaactctc tgaacagata gtctaggtgt ccaaggaaag aaagtacaat 84 0 ctgacaacgg attggaggta tcccttcaat ggcttccaaa tttgcagttt ctcattgtcc 900 cataagcctt ggcatgatca tgactaactc tgaagctgac aatactttgt gtaaatttgt 960 cggtaggttt gggccgggcc actcagcaac aacaggaagg ctgtggtgct ctggaacagg 1020 cagtcatacc aggcaaccat cactgcacat tggtcgaaca tcgggctcgc tggatcggtc 1080 gcggtcactg ctcgtgatct atgggcggta aagcctttgc tttcttcaga gctcaaagta 1140 gaacatcttc tcttcagaat tcagagttca taacaaattt ctgtcaattg tgcagcactc 1200 ttcgttcgcg gctcagggac agatatcagc atcggtggcg cctcatgact gcaagatgta 1260 tgtcttgaca ccaaactagt cagcaaagaa aagcagcaca ggttagtacg tgtccggcga 1320 atacagctaa attgatcagg attcaggaag aaggtttgca atttgcaagg attggtagag 1380 ctggaaatgg gatgccattt ggttatgtat gtagaaataa gctgtaagcc tgtaagcgta 1440 tatgtaatca gccgtcaaat gctggcgagt gtatttctga agtttgcaac gaaagttgca 1500 gcaataaaaa 1510 <210> 24 <211> 1016 <212> DNA <213> Oryza sativa L. < 223> PCR marker BstUI <400> 24 tggggattct tttctttaag caatttaaca ttattgtcct aacaatatac acaatattgg 60 tttttctttc agtatcaaat aattctttta cttttgaaaa cacatt tgca atgtgttgga 120 aacacaatta tatcttgcac ttccttttgg aaatttaatc atttgaaaac tgattcgcgt 180 ttcatggctg taatcttctc ttgcgaacat cgctctttct ttgatggttc tctgttgaga 240 agaagagcaa ccaagtaaat tttcgaaatg tttttttgtt ctttctattc accattgcag 300 gttgtcaaag ccatcgagaa ggccataccg attccgagag cgcaacccat tgccttggat 360 ggcccagcaa gggaagagct gaaggccatg gaggcgcaga aggtcgagat cgaccgcacc 420 gcggcgctcc aggtgcgccg tgagctttgg ctggggctgg catacctcgt cgtccagact 480 gccggcttca tgaggctcac attctgggag ctctcatggg atgtcatgga acccatctgc 540 ttctatgtga cctccatgta cttcatggcc ggctacacct tcttcctccg gaccaagaag 600 gagccctcct tcgagggctt cttcgagagc cggttcgcgg cgaagcagaa gcggttgatg 660 cacgcccggg atttcgatct ccgccggtat gacgagctcc ggcgagcctg tggcctgccg 720 gtggttcgga ctccgacgag cccctgcaga ccgtcgtcgt cgtcgtcgtc gtcttcgacg 780 caggagagcc attgccattc ttactgccat tgccaatgat ctttgtgctg ttctgttctg 840 ttgtcagaat tttttcatgc ccagtttatg ggggttaagc tagcttctcc attgtaccgt 900 tctgatgtgc ggatgatgcg atgcaaagca tagtttgttg aagagatgac aaggcagatt 960 ttagcttgaa aacctggagg tgagaaaaaa aaatcctgat gtgtttgtgt gtgtga 1016 <210> 25 <211> 676 <212> DNA <213> Oryza sativa L. <223> PCR marker S10602 KpnI <400> 25 accaccttca tatgaagtag gatt gag attacgagca tga tg 120 caagtttgta gcttactact acagtacttc taataagttt tgtctgttga gattttattg 180 ctgatttcta tgcatggtca tctttttgac aggccatcca gtcttatcgt gctgagagtg 240 aaactgagct caacctggca gctggtgact atatagttgt ccggaaggta cggccctatc 300 ttcccattgg acatgtttct aaccataaac atatctttgc tggacttttg tgggcaaagt 360 tggctacact aaacttgtgt tcattaacct gctcaatcag gtgtcaaaca atggatgggc 420 agaaggtgaa tgcagaggga aagctggctg gttcccttac gactacatcg agaaaaggga 480 ccgtgtgctt gcaagtaaag tcgcccaggt cttctaggcg ttcaatgagc catacataca 540 taaccctggt gttgtacact gtattatgat cgttcgtgat cttcaaagac cctctgatca 600 gagaaatcac aaatattctt ttgttctatt attgtgtcatta tcactacccc ttttgtcaaa 660 accagtgcag cctttt 676 <210> 26 <211> 1059 <212> DNA <212> 223> PCR marker Tsp509I <400> 26 gcgagatcat gaacttgatt ttctggttgc catattgggc ttgcttgtta accttgtaga 60 gaaggatagc cttaataggt aagtccctca catgcttcct tccatttgct caattcatat 120 cagtgttact gttctggcag ttccttgggg tcaggactca gaaacatcca attaatgttc 180 atgttctctt aacgactcag aaatacttta taacctctcc acagggtacg gctttcatct 240 gcccgtgttc ctgttgatct atctcagaat ccacagagtg aagagacaca gagagatgtc 300 atagcactcc tctgttctgt attcttagca agtcaaggtg ctagtgaagc ttctggaact 360 atatcaccgg taattcaaaa ttcttcaagt tccttttgta tgtagattat atctttgtaa 420 aactcggcat ttattacctg ctctttgttt caaaaagcag tattttattt tgctccttag 480 cataggtcag cagaacagtt gatcttattc agaaaacaat attttgcatg taacatactg 540 ttatctatga gatgaaaatt aatgcatgtg taataatgtc aatgataaat atttgctatc 600 tgaatccagt ctaccaactc tagttagacc gaattactga ggttctattt caaagaataa 660 tttagtgcac catttgttca actactatga agtaaaatgg tattcccttc tattgacatc 720 gggttagaag tgaaaggcca tcttaatgcg atgttctcaa tgccacaaac ccacaaattt 780 cattaacaca tacagattat tattaacata gctataaatt ggatttccag aag cttgagt 840 tgaatttatt ttgttacaat tgaaagcact gggaacatta gcattttttt ttagttcttg 900 gttattgcaa tttataatgt tatacagaac tgtgtacctc acaatgcatt cattatgaca 960 ttctatgaac catgg ttctattgatcag ttgattcagag gg gtg

[Brief description of the drawings]

FIG. 1 shows a genetic map in which the Rf-1 locus on chromosome 10 is located on a linkage map in relation to a marker.

 ──────────────────────────────────────────────────続 き Continued on the front page (72) Inventor Toshio Yamamoto 700 Oranova, Higashihara, Toyotamachi, Iwata-gun, Shizuoka Prefecture (72) Inventor Naoto Nitta 700-Higashihara, Toyotamachi, Iwata-gun, Shizuoka Prefecture Orinoba, Inc. (72) Inventor Naoki Takemori 700 Higashihara, Toyota-machi, Iwata-gun, Shizuoka Prefecture F-term in Orinova Co., Ltd. (Reference) QR08 QR14 QR55 QR59 QR62 QS12 QS25 QS34

Claims (6)

[Claims] 1. A test rice individual or seed using the fact that the fertility restoring gene (Rf-1 gene) locus is located between the RFLP marker locus S12564 locus on rice chromosome 10 and the C1361 locus. A method for identifying whether or not has the Rf-1 gene. 2. The following PCR markers: (1) D having the sequence of SEQ ID NO: 1 and SEQ ID NO: 2
Perform genomic PCR using NA as a primer,
PCR marker R1877 EcoRI, which detects a polymorphism between Japonica and Indica rice based on the presence or absence of a restriction enzyme EcoRI recognition site in the obtained product; (2) SEQ ID NO: 3 and SEQ ID NO having a sequence of NO: 4
Perform genomic PCR using NA as a primer,
(3) SEQ ID NO: 5 and SEQ ID NO: 5, a PCR marker that detects a polymorphism between a Japonica strain and an Indica strain based on the presence or absence of a restriction enzyme HindIII recognition site in the obtained product. NO having a sequence of NO: 6
Perform genomic PCR using NA as a primer,
PCR marker C1361 MwoI, which detects a polymorphism between Japonica and Indica rice plants based on the presence or absence of a restriction enzyme MwoI recognition site in the obtained product; (4) SEQ ID NO: 7 and SEQ ID NO having the sequence of NO: 8
Perform genomic PCR using NA as a primer,
PCR marker G2155 MwoI for detecting a polymorphism between Japonica and Indica rice plants based on the presence or absence of the restriction enzyme MwoI recognition site in the obtained product; (5) SEQ ID NO: 9 and SEQ ID NO: D having a sequence of 10
Perform genomic PCR using NA as a primer,
PCR marker G291 MspI for detecting a polymorphism between Japonica and Indica rice plants based on the presence or absence of the restriction enzyme MspI recognition site in the obtained product; (6) SEQ ID NO: 11 and SEQ ID NO: Performing genomic PCR using DNA having a sequence of 12 as a primer, and detecting a polymorphism between Japonica and Indica strain rice in the obtained product based on the presence or absence of a restriction enzyme BslI recognition site. (7) Genomic PCR using DNA having the sequence of SEQ ID NO: 13 and SEQ ID NO: 14 as a primer, and the presence or absence of a restriction enzyme BstUI recognition site in the obtained product PCR marker S10019 BstUI, which detects a polymorphism between Japonica and Indica rice based on genomic DNA using primers with DNA having the sequence of SEQ ID NO: 15 and SEQ ID NO: 16 Perform PCR and obtain PCR marker S10602 KpnI, which detects a polymorphism between Japonica and Indica rice based on the presence or absence of the restriction enzyme KpnI recognition site in the obtained product; and (9) SEQ ID NO: 17 and SEQ ID Genomic PCR using DNA having the sequence of NO: 18 as a primer to detect polymorphism between Japonica and Indica rice based on the presence or absence of the restriction enzyme Tsp509I recognition site in the obtained product PCR marker S12564 Tsp509I;
The method according to claim 1, wherein at least one of the PCR markers selected from the group consisting of is detected. (3) (a) PCR markers R1877 EcoRI, G291 Msp
I, R2303 BslI and at least one PCR marker selected from the group consisting of S12564 Tsp509I, and (b) PC
R marker C1361 MwoI, S10019 BstUI, G4003 HindIII,
When both at least one PCR marker selected from the group consisting of S10602 KpnI and G2155 MwoI is present in the amplification product, it is determined that the test rice plant individual or seed has the Rf-1 gene. 3. The method according to 2. 4. The PCR markers S12564 Tsp509I and C1361
4. The method according to claim 3, wherein the presence of MwoI is checked. 5. A gene at a locus around the Rf-1 locus of a test individual, using two or more of the PCR markers of at least one of the groups (a) and (b) described in claim 3. A method of examining a transchromosomal region derived from an Rf-1 gene donor parent by testing the type. 6. The primer used in the method of claim 2, which has a sequence of any one of SEQ ID NOs: 1 to 18.