JP2002345457A - T-cell strain and its use - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a T-cell strain suitable for the efficient screening for finding a drug such as an anti-HIV agent in high efficiency. SOLUTION: The T-cell strain contains a reporter gene having LTR sequence of HIV and has expressed CCR5.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD [0001] The present invention relates to (1) a CCR5 gene having a reporter gene having an LTR sequence of HIV;
A T cell line (preferably a human T cell line) expressing
(2) a method for measuring i) the infection efficiency of HIV or ii) the reaction efficiency of membrane fusion involving the envelope glycoprotein of HIV, which comprises using the cell line; and (3) using the cell line. Characterized by i) a compound that changes the infection efficiency of HIV, ii) a compound that changes the reaction efficiency of membrane fusion involving the envelope glycoprotein of HIV, or ii.
i) a method for screening a compound that acts on the HIV LTR,
(4) A compound obtained by using the screening method and a drug containing the compound are provided.

[0002]

2. Description of the Related Art Human immunodeficiency virus (HIV) is a retrovirus encoding its own genetic information in ribonucleic acid (RNA), and is known as a causative virus of acquired immunodeficiency syndrome (AIDS). HIV is classified into two types, type 1 and type 2, based on differences in its nucleotide sequence. In particular, human immunodeficiency virus type 1 (HIV-1) is being studied selectively because it has a higher number of infected people and is more pathogenic than type 2, and its life cycle is well understood. . HIV-1 entry into target cells is initiated by the binding of the viral envelope glycoprotein to CD4 (cluster of differentiation 4) and specific chemokine receptors on the target cell surface, and ultimately to the viral outer membrane and target. It is established by the fusion of the cell membrane of the cell and the release of the viral core into the cell. The virus that has entered the target cell converts its genetic information from RNA into deoxyribonucleic acid (DNA) using its own reverse transcriptase, and is integrated into the host genomic DNA by its own integrase to become a provirus. . Proviruses utilize host cell enzymes to transcribe and translate their sequences, eventually forming mature virus particles and budding from the cells. It is estimated that the number of offspring virus particles that germinate from one infected cell in an HIV-1 infected body is about 1000 particles, and it is considered that HIV-1 is a virus having a very high proliferation ability. In this way, HIV-1 enters,
Proliferation is repeated by repeating the life cycle of reverse transcription, integration, transcription, translation, particle formation, and budding, but it is known that genetic diversity is extremely high due to the low accuracy of the reverse transcription reaction. This genetic diversity is a major cause of emergence of viruses (resistance viruses) in which substances that inhibit the growth of HIV-1 (anti-HIV-1 drugs) are ineffective. HIV, especially HIV
Substances that inhibit the growth of -1 (anti-HIV-1 drugs) are expected to prevent the development of AIDS in HIV-1-infected individuals, and thus are widely screened. To date, reverse transcriptase inhibitors and inhibitors of proteases derived from HIV-1 that are involved in particle formation (protease inhibitors) have actually been HIV-
It has been confirmed that it is clinically administered to infected individuals and suppresses the growth of HIV-1. However, as mentioned earlier, the emergence of resistant viruses due to the genetic diversity of HIV-1 has led to the development of anti-HIV-
In some cases, one drug has become invalid. Existing anti-HIV
Since all -1 drugs may become ineffective, the development of anti-HIV-1 drugs with a novel mechanism of action is strongly desired. HIV-1 depends on the type of chemokine receptor used during infection.
Divided into groups. That is, CCR5 directional (R5) HIV, which uses CD4 and CC chemokine receptor 5 (CCR5) during infection
-1 and CXCR4 directional (X4) HIV-1 using CD4 and CXC chemokine receptor 4 (CXCR4). HIV-1 infection remains asymptomatic for several to more than a dozen years, after which AIDS develops, but R5 HIV-1 is primarily isolated during the asymptomatic phase, and is primarily associated with AIDS. Is known to be X4 HIV-1. It is known that HIV-1 is actively growing even in the asymptomatic period, but it is thought that inhibiting HIV-1 growth during this period can more effectively prevent the development of AIDS Therefore, screening for compounds that suppress the growth of R5 HIV-1 is very widely performed. However, cell lines cultured in the laboratory generally do not express sufficient amounts of CCR5 and do not result in sufficient R5 HIV-1 infection (Lijun Wu et al., Journal of Experimental
Medicine, 185, 1681-1691 (1997)). Therefore, R5 HI
Preparation of V-1 and various infection experiments are performed using peripheral blood mononuclear cells prepared from blood donated volunteers,
The reproducibility of infection experiments is not very high due to the different proliferation of HIV-1 depending on the donor, hindering efficient anti-R5 HIV-1 drug screening. By the way, HIV
After infection, it continues to proliferate in activated T cells such as lymph nodes in the asymptomatic period ranging from several years to about ten years before the onset of AIDS. Therefore, development of anti-HIV drugs requires CCR5-expressing T
It is important to examine the effect of the drug on the multiple infection system of HIV in cells. However, the stock T
The cells had low expression of CCR5 and could not be infected with R5HIV. In addition, CCR such as MAGI-CCR5 cells
Non-T cell lines expressing 5 are known, but these cells can be infected with HIV but are not expected to proliferate. Therefore, several groups including us have produced and reported human T cell lines expressing CCR5 (Baba, M.,
et.al., AIDS Research and Human Retroviruses, 16,
935-941 (2000)). One such cell line is CCR5-directed HIV.
It can be used for screening for compounds that suppress the growth of R5 HIV, but it is necessary to detect the growth of HIV by ELISA and is not suitable for efficient screening. Generally, to detect HIV proliferation efficiently, HIV Tat (trans-acting tr
anscriptional activator) [Sodroski, J., et. al.,
Science, 229 , 74-77 (1985)], a T cell line carrying a reporter gene activated is used, but such a T cell line is susceptible to R5 HIV because it does not express CCR5. No (Gervaix, A., et.a
l., Proceedings of the National Academy of Science
s USA, 94 , 4653-4658 (1997)).

[0003]

To date, there is no known T cell line that expresses CCR5 and has a reporter gene activated by HIV Tat. Therefore, if a T cell line that expresses CCR5 and has a reporter gene activated by HIV Tat can be established, efficient screening for substances that suppress the growth of R5 HIV-1 will be reproduced. And the HIV repeats the above-mentioned life cycle to the T cell line multiple times (multi-roun
d) Since an evaluation system for infection can be constructed, anti-HIV in an environment similar to HIV infection to HIV target cells in vivo
It is possible to perform efficient and sensitive screening of drugs. Efficient and reproducible screening increases the likelihood of discovery of anti-R5HIV-1 drugs and can provide significant industrial benefits. The present invention relates to HIV L
Has a reporter gene having a TR sequence, and
An object of the present invention is to provide a T cell line expressing CCR5, isolate and produce the cell line, and provide a screening method using the T cell line.

[0004]

Means for Solving the Problems In view of the above problems, the present inventors have conducted intensive studies and have found that the LTR (long ter
The present inventors have succeeded in establishing a T cell line which has a reporter gene having a (minal repeat) sequence and expresses CCR5, and as a result of further studies, completed the present invention.

[0005] That is, the present invention provides: (1) a T cell line that has a reporter gene having an HIV LTR sequence and expresses CCR5; (2) the LTR sequence is represented by SEQ ID NO: 1. The T according to the above (1), which is the same or substantially the same nucleotide sequence as the nucleotide sequence.
(3) the above-mentioned (1), wherein the reporter gene is an enzyme gene;
(4) the T cell line according to (3), wherein the enzyme is alkaline phosphatase; (5) the T cell line according to (1), wherein the T cell line is a human-derived cell line; (6) the T cell line according to (1), wherein the T cell line is derived from the MOLT-4 / CCR5 cell line (FERM BP-7060); (7) the MOLT-4 / CCR5 / LTR-SEAP cell line (FERM BP) (7) a method for measuring the infection efficiency of HIV, which comprises using the T cell line according to (1); (9) HIV is HIV. (10) The method according to (8), wherein HIV is R5 HIV-1; (11) The method according to (8), wherein HIV is HIV present in a clinical sample. (11a) the method according to (8), wherein HIV is HIV-1 present in a clinical sample; (11b) the method according to (8), wherein HIV is R5 HIV-1 present in a clinical sample. Method; (12) Test The T cell line according to (1) above is cultured in the presence of the compound to assay (preferably, quantitatively measure) the change in HIV infection efficiency, thereby changing the HIV infection efficiency. (13) (1) The T cell line according to (1) and (2)
(I) HIV envelope glycoprotein and (ii) HIV L
A method for assaying (preferably, quantitatively measuring) the reactivity of cell membrane fusion produced by mixing and culturing cells expressing a transcription factor that activates TR; )) And the (2)
(I) HIV envelope glycoprotein and (ii) HIV L
Assay the reactivity of cell membrane fusion generated by mixing and culturing cells expressing a transcription factor that activates TR (transcription activator) in the presence of a test compound (preferably,
(15) A method for screening a compound that alters the reactivity of cell membrane fusion, characterized by using the T cell line according to (1) above. (16) a method for screening a compound that suppresses activated HIV LTR, which comprises using the T cell line according to (1); (17) an HIV LTR is activated by HIV Tat HIV LTR
(18) the method according to (16), wherein the HIV LTR is an HIV LTR activated by NFκB; (19) the HIV obtained by the method according to (12).
(20) the compound according to (19), which inhibits HIV infection efficiency; (21) the compound according to (19), which promotes HIV infection efficiency; (22) the (14) A) a compound that alters the reactivity of cell membrane fusion obtained by the method according to the above); (23) a compound according to the above (22) that inhibits cell membrane fusion; (24) a compound according to the above (22) that promotes cell membrane fusion; (25) HIV obtained by the method according to (15) above
(26) the compound according to (25), which activates the HIV LTR; (27) the compound according to (25), which suppresses the HIV LTR; (28) the method according to (16). (29) A compound capable of suppressing the activated HIV LTR obtained by the method according to the above (17); (30) a compound suppressing the activated HIV LTR obtained by the method according to the above (17). A compound that suppresses the activated HIV LTR, which is obtained by the method of (31); (31) a retroviral vector infection efficiency promoter comprising the compound of (21), (24) or (26) above; (32) the agent according to the above (31), wherein the retroviral vector is derived from HIV; (33) the agent according to the above (19), (20), (22), (2)
3), (25), (27), (28), (29) or a pharmaceutical composition comprising the compound according to any one of (30); (34) the above-mentioned () which is an anti-HIV drug; (35) The composition according to (33), which is a prophylactic / therapeutic agent for AIDS; (36) The composition according to (1) for the manufacture of a prophylactic / therapeutic agent for AIDS.
9), (20), (22), (23), (25), (2)
7), any one of (28), (29) or (30)
(37) Use of the compound or a salt thereof according to the above (37), (19), (20), (22), (2)
3) Prevention and treatment of AIDS by administering a pharmacologically effective amount of the compound or a salt thereof according to any one of (25), (27), (28), (29) and (30). (38) a method for evaluating the combined effect of two or more compounds having anti-HIV activity.

[0006]

BEST MODE FOR CARRYING OUT THE INVENTION A TCR cell line carrying a reporter gene having the HIV LTR sequence of the present invention and expressing CCR5 is a TCR cell line expressing CCR5 (preferably MOLT- 4 / CCR5 cell line) by introducing a reporter gene having an HIV LTR sequence. The T cell line used here (preferably human-derived T
Cell lines and the like) include, for example, immortalized T cell lines obtained by cloning cancerous T cells such as human leukemia T cells. Cloning is performed according to various known methods. Specifically, there is a method of cloning immortalized cells from a human leukemia T cell line, focusing on the fact that cancerous tissue continues to proliferate permanently. The immortalized T cell line thus obtained is transformed by a method known per se, and the CCR5 gene is expressed in the cell to obtain CCR5.
Can be produced. Specifically, Proceedings of National Academic Science USA
of the National Academy of Sciences USA), 1999, Vol. 96, pp. 5698-5703.
It is performed by transforming the immortalized T cell line with DNA3.1-CCR5. The transformation is performed by a method known per se,
For example, Sambrook et al.'S manual (Molecular Cloning: A Laboratory Manual), Cold Spring Harbor Laboratory Press.
Can be performed using a general method according to A preferred example of a T cell line is the Journal of the National Cancer Institute.
national Cancer Institute), 49, 891-895
And the MOLT-4 cell line described in 1972, and a preferred example of the T cell line expressing CCR5 is the MOLT-4 clone 8 cell line [Journal of Virology. Virology), 1986 3
Mon., pp. 1159-1162], a “T cell line capable of infecting a CCR5-directed human immunodeficiency virus” obtained by transforming an immortalized T cell line by a method known per se. Specifically, MOLT-4 / CCR5 (FERM BP-706) obtained in Reference Example 1 described later.
0) A strain is mentioned as a preferable example. The T cell line expressing CCR5 thus obtained is transformed by a method known per se, and the LTR sequence of HIV (here, the LTR sequence may use the entire nucleotide sequence, May be used, but some base sequences [eg, Kimpton, J., et.
al., Journal of Virology, 66 , 2232-2239 (1992), etc.].
SEQ ID NO: 1 described below (that is, 5′-cttcaagaactgctgac
atcgagcttgctacaagggactttccgctggggactttccagggaggcgt
ggcctgggcgggactggggagtggcgagccctcagatgctgcatataagc
agctgctttttgcctgtactgggtctctctggttagaccagatctgagcc
tgggagctctctggctaactagggaacccactgcttaagcctcaataaag
It is preferable to use a base sequence represented by ctt-3 ′) to produce a T cell line that retains the reporter gene of the present invention and expresses CCR5. be able to. Here, as the preferable partial nucleotide sequence of the LTR sequence, the same nucleotide sequence as the nucleotide sequence represented by SEQ ID NO: 1 may be used, but the same effect as the nucleotide sequence represented by SEQ ID NO: 1 is obtained. Any nucleotide sequence may be used as long as it is a base sequence to be played (ie, a nucleotide sequence substantially identical to the nucleotide sequence represented by SEQ ID NO: 1). It may be a base sequence in which one or more bases are substituted or deleted, or a base sequence in which one or more bases are added to the base sequence represented by SEQ ID NO: 1. Specific examples of reporter genes having the HIV LTR sequence include LTR-SEAP (secreted form of human placental).
alkaline phosphatase) and LTR-β galactosidase. As the reporter gene, β-galactosidase, chloramphenicol acetyltransferase, luciferase, alkaline phosphatase, human growth hormone, green fluorescent protein and other genes are used. Genes of enzymes such as chloramphenicol acetyltransferase, luciferase, and alkaline phosphatase are preferred, and the enzyme is preferably alkaline phosphatase. Among them, LTR-SEAP and the like are preferably used as the reporter gene having the HIV LTR sequence. As a specific example of a T cell line that has a reporter gene having the HIV LTR sequence and expresses CCR5, MOLT-4 / CCR5 / LTR-SE obtained in Example 1 described below is used.
A preferred example is the AP (FERM BP-7350) strain.
The T cell line thus obtained can be subjected to various screenings by culturing it in a medium used for culturing the T cell line (eg, RPMI1640 medium or the like). 15 ° C to about 55 ° C, preferably about 20 ° C to about 45 ° C, more preferably about 25 ° C.
C to about 40C. The culturing time is about 1 hour to about 6 months, preferably about 1.5 hours to about 60 days. The culture is preferably performed under an atmosphere such as carbon dioxide. The concentration of carbon dioxide is about 3 to 10 (V / V)%.

[0007] The TCR cell line having the reporter gene having the LTR sequence of HIV of the present invention and expressing CCR5 and, if necessary, a test compound and / or HIV are used to evaluate the HIV infection efficiency. Measurement and screening, assay (preferably quantitative measurement) of membrane fusion reactivity involving HIV envelope glycoprotein, screening of reaction efficiency, screening of compounds that alter HIV infection efficiency (promotion, inhibition, etc.) Screens for compounds that alter (enhance, inhibit, etc.) the efficiency of membrane fusion involving HIV envelope glycoproteins, act on the HIV LTR (activate HIV LTR, suppress HIV LTR, activate HI
Screening of compounds that suppress V LTR, etc.). Test compounds include, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, sera, and the like. Or a substance produced by deriving a known compound by a known method.

[0008] Each method will be described below. Measurement and Screening of HIV Infection Efficiency HIV cells are infected by a method known per se to a T cell line that has a reporter gene having an HIV LTR sequence and expresses CCR5. That is, in a medium used for culturing a T cell line (eg, RPMI1640 medium or the like), a reporter gene having an HIV LTR sequence is retained and CCR5
This is performed by culturing a T cell line expressing HIV and HIV. HIV is a laboratory strain commonly used in the laboratory and clinical isolates and HIV isolated from HIV-infected individuals
HIV in clinical specimens (eg, blood, etc.) from infected individuals
(Preferably, HIV-1; more preferably, R5 HIV-1; even more preferably, HIV present in a clinical sample; and as HIV present in a clinical sample, preferably, HIV present in a clinical sample. -1; more preferably, R5 HIV-1) present in clinical samples. The culturing temperature is about 15 ° C to about 55 ° C, preferably about 20 ° C to about 45 ° C, more preferably about 25 ° C to about 40 ° C. The culturing time is about 1 hour to about 2 months, preferably about 1.5 hours to about 30 days, and more preferably about 2 hours to about 20 days. The culture is performed in an atmosphere of carbon dioxide. The concentration of carbon dioxide is about 3 to 10 (V / V)%. Establishment of human immunodeficiency virus infection can be detected by measuring an increase in the amount of HIV in the culture supernatant of the T cell line. The measurement of the amount of HIV is performed by a method known per se, that is, 1) the amount of HIV RNA is measured by RT-
2) Enzyme-labeled immunoassay for the amount of p24 antigen (eg, Retro-Tek HIV-1 p24 Antigen ELISA ki)
t, manufactured by Zepto Metrix, USA,
3) a method of measuring the enzyme activity of HIV reverse transcriptase, or 4) a method of measuring the amount of reporter protein or its activity. Preferably, the method is carried out by measuring the activity of the reporter enzyme. More preferably, the measurement is performed by measuring the activity of a reporter enzyme in the culture supernatant. Particularly preferably, the alkaline phosphatase activity in the culture supernatant is measured by a method known per se (eg, a colorimetric method, a luminescent method and a fluorescent method). Method). Here, by using HIV present in a clinical specimen, for example, it is also possible to determine whether HIV capable of infecting is present in a body fluid (eg, blood, semen, etc.) of an antibody-positive patient It is. Assay for reactivity of membrane fusion involving HIV envelope glycoprotein and screening for reaction efficiency (1) A TCR cell line carrying a reporter gene having the HIV LTR sequence and expressing CCR5 (2) )
(I) HIV envelope glycoprotein and (ii) HIVLT
A reporter activity is detected (preferably, measured; more preferably, the reactivity of cell membrane fusion produced by mixing with a cell expressing a transcription factor that activates R or by mixing and culturing in the presence of a test compound. (Quantitative measurement), it is possible to carry out an assay, and it is also possible to apply to screening for reaction efficiency. Here, the reporter activity is detected (preferably, measured; more preferably, quantitatively) without preparing an extract of the fused cells (for example, without isolating the extract of the fused cells).
It is more preferable to detect the alkaline phosphatase activity in the culture supernatant by a method known per se (eg, a coloring method, a luminescent method, a fluorescent method, etc.). -A (i) the envelope glycoprotein of HIV and (i)
i) Preparation of cells expressing a transcription factor (eg, Tat, etc.) that activates the HIV LTR The HIV envelope glycoprotein can be any of the HIV-1 and HIV-2 strain-derived HIV envelope glycoproteins. . Any of R5, X4 and R5X4 can be used for chemokine directing, but it is preferable to use HIV-1 derived HIV envelope glycoprotein.
HIV envelope glycoproteins derived from the HIV-1 strain utilizing R5 (R5 HIV-1) are preferred, and particularly the JR5 of R5 HIV-1.
-FL strain [Koyanagi, Y., et. Al., Science, 236 , 8
19-822 (1987)]. HIV envelope glycoprotein and HIV L
Both a plasmid vector and a viral vector can be used for transient expression of a transcription factor that activates TR (eg, Tat or the like). The gene can be introduced by a method known per se, for example, a calcium phosphate method, a lipofection method, an electroporation method,
Any of the DEAE dextran method and the like can be used. Cell lines expressing HIV envelope glycoproteins and transcriptional activators (eg, Tat) include cell lines derived from mammals (eg, guinea pig, mouse, cat, dog, pig, sheep, cow, monkey, human, etc.) (Preferably,
Although a human-derived cell line can be used, it is preferable to use a cell line having high gene transfer efficiency and high expression efficiency, and preferable examples include a cell line having SV40 large T antigen. Particularly preferably, a human fetal kidney-derived cell line 293T [DuBridge, RB, et. Al., Molecula
r and Cellular Biology, 7 , 379-387 (198
7)]. Preparation of 293T cells expressing HIV envelope glycoprotein and a transcriptional activator (eg, Tat) can be performed by a method known per se. Specifically, it can be carried out by the following method or a method analogous thereto. First, about 0.1 × 10 ⁶ cells to about 2 × 1 per 10 cm 2 of the culture dish area.
0 ⁶ cells, preferably about 0.5 × 10 ⁶ cells to about 1.
5 × 10 ⁶ cells, more preferably about 1 × 10 ⁶ cells, are seeded, and a medium (eg, Dulbecco's modified Eagle medium (DMEM) is inactivated with fetal calf serum (ICN) at a concentration of 10% (v / v).
Penicillin-streptomycin was used as penicillin G sodium and streptomycin sulfate at 100 U each.
/ ml, 100 μg / ml, etc.) at 37 ° C., 5% CO ₂ . On the next day, remove the culture solution, add the previously prepared DNA-lipid solution, and add 37 ° C., 5% CO ₂ at about 2 hours to about 10 hours, preferably about 4 hours to about 8 hours, more preferably about 4 hours to about 8 hours. Incubate for 6 hours. After the culture, the DNA-lipid solution was removed, and the medium was added for about 12 hours to about 4 days.
Culture is preferably performed at 37 ° C. and 5% CO ₂ for about 1 to about 3 days, more preferably for about 2 days. The DNA-lipid solution is prepared by mixing the DNA solution and the lipid solution, and mixing at room temperature (about 15 to 35 ° C.) for about 5 minutes to about 2 hours, preferably about 15 minutes to about 1 hour, more preferably about 30 minutes.
It can be prepared by reacting for minutes. DN
Solution A is a DM containing no additives such as inactivated fetal bovine serum.
DN in EM medium or OPTI-MEM medium (Gibco)
It can be prepared by adding A. The medium is
About 10 μl per 10 cm 2 of culture dish area
To about 1000 μl, preferably about 50 μl to about 500 μl, more preferably about 100 μl. DN
A is Env (envelope glycoprotein) expression vector, Re
v A mixture of a [regulation of virion-protein expression] expression vector and a transcriptional activator expression vector (eg, a Tat expression vector, etc.), and the env expression vector is about 0.1 μg per 10 cm 2 of culture dish area.
To about 10 μg, preferably about 0.2 μg to about 2 μg.
μg, more preferably about 0.6 μg; Rev expression vector is about 0.01 μg to about 1 μg, preferably about 0.05 μg.
μg to about 0.5 μg, more preferably about 0.2 μg;
About 0.1 μg to about 10 μg, preferably about 0.1 μg, of a transcription activator expression vector (eg, Tat expression vector, etc.).
2 μg to about 2 μg, more preferably about 1.0 μg is used. A more preferred amount ratio is about 0.6: 0.2:
1.0. The lipid solution is a DMEM medium or OPTI-ME containing no additive such as inactivated fetal bovine serum.
It can be prepared by adding a lipid reagent (eg, Lipofectamine (Gibco), etc.) to M medium (Gibco). The culture medium is about 10 μl to about 1000 μl, preferably about 50 μl to about 500 μl, more preferably about 1 μl per 10 cm 2 of culture dish area.
Use 00 μl. The lipid reagent has a culture dish area of 10
About 0.1μl to about 100 per square centimeter
Use μl, preferably about 1 μl to about 10 μl, more preferably about 6 μl. Screening for Compounds that Alter HIV Infection Efficiency T cell lines carrying a reporter gene having the HIV LTR sequence and expressing CCR5 are infected with HIV in the presence of the test compound. As described above, H in the culture supernatant
By measuring the amount of IV and selecting a compound that changes the increase in the amount of HIV, a substance that changes the infection efficiency of HIV can be screened. Screening for a compound that alters the efficiency of membrane fusion reaction involving HIV envelope glycoprotein (i) In the absence of a test compound, (1) a reporter gene having the HIV LTR sequence is retained and CCR5 is (2) test cell lines expressing (2) (i) HIV envelope glycoprotein and (ii) cells expressing a transcription factor that activates the HIV LTR, and (2) a test compound. In the presence of (1) a TCR that has a reporter gene having the HIV LTR sequence and expresses CCR5.
Changes in cell membrane fusion reactivity and reaction efficiency when cell line and cells expressing (2) (i) HIV envelope glycoprotein and (ii) transcription factor that activates HIV LTR are mixed and cultured. By quantifying and comparing reporter activity in each case, it is possible to screen for a compound that alters the reactivity of the cell membrane fusion, and in each case, preparing an extract of the fused cells However, it is preferable to assay the change in the reactivity of cell membrane fusion by quantifying the reporter activity (e.g., without isolating the extract of the fused cells), more preferably alkaline phosphatase in the culture supernatant. Tace activity can be determined by a method known per se (eg, a coloring method,
(Emission method and fluorescence method). Screening for compounds that act on the HIV LTR The compounds that act on the HIV LTR include i) compounds that activate the HIV LTR, ii) compounds that suppress the HIV LTR, iii)
A compound that suppresses the activated HIV LTR. The activated HIV LTR refers to an HIV LTR activated by HIV Tat, NFκB, or the like. A T cell line carrying a reporter gene having an HIV LTR sequence, and expressing a CCR5 or a cell line in which the LTR is retained is activated under the same conditions as described above in the presence of a test compound. Reporter activity after culture (preferably reporter activity in culture supernatant)
By measuring, a substance that acts on the HIV LTR can be screened.

The compounds that can be obtained by using the screening method of the present invention include the test compounds described above, for example, peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissues. A compound selected from extracts, plasma, etc., which changes the infection efficiency of HIV; a compound which changes the reaction efficiency of membrane fusion involving the envelope glycoprotein of HIV; (1) LTR of HIV
Has a reporter gene having a sequence and has a CC
Cell membrane fusion produced by mixing and culturing a T cell line expressing R5 and (2) cells expressing a transcription factor that activates the (i) HIV envelope glycoprotein and (ii) the HIV LTR. Compound that changes the reactivity of HIV; HIV LT
And compounds acting on R. As a specific example,
For example, a compound that inhibits HIV infection efficiency; a compound that promotes HIV infection efficiency; a compound that inhibits cell membrane fusion; a compound that promotes cell membrane fusion; a compound that activates HIV LTR; a compound that suppresses HIV LTR; Activated HIV LTR
Wherein the compound that promotes the infection efficiency of HIV or the cell membrane fusion is, for example, a compound for promoting the infection efficiency of a retrovirus vector (preferably, an HIV-derived retrovirus vector). It is also useful as a reagent.

The compound obtainable by the screening method of the present invention (hereinafter sometimes abbreviated as the compound of the present invention) may be a prodrug, may form a salt, or may be a hydrate. It may be a thing. Here, the prodrug is a compound that is converted into the compound of the present invention by a reaction with an enzyme or stomach acid under physiological conditions in a living body, that is, the compound of the present invention is enzymatically oxidized, reduced, hydrolyzed, etc. Any compound may be used as long as it is a compound that changes, or a compound that undergoes hydrolysis or the like by gastric acid or the like to change into the compound of the present invention. Examples of the prodrug of the compound of the present invention include compounds in which the amino group of the compound of the present invention is acylated, alkylated, and phosphorylated (eg, the amino group of the compound of the present invention is eicosanoylated, alanylated,
Pentylaminocarbonylation, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methoxycarbonylation, tetrahydrofuranylation, pyrrolidylmethylation, pivaloyloxymethylation, tert-butylated A compound in which the hydroxyl group of the compound of the present invention is acylated, alkylated, phosphorylated or borated (eg, the hydroxyl group of the compound of the present invention is acetylated, palmitoylated, propanoylated, pivaloylated, succinylated, Compounds in which the carboxyl group of the compound of the present invention is esterified or amidated (eg, fumarylation, alanylation, dimethylaminomethylcarbonylated compound, etc.)
The carboxyl group of the compound of the present invention is esterified with ethyl,
Phenyl esterification, carboxymethyl esterification, dimethylaminomethyl esterification, pivaloyloxymethyl esterification, ethoxycarbonyloxyethyl esterification, phthalidyl esterification, (5-methyl-2-oxo-1,3-dioxolene- 4-yl) methyl esterification, cyclohexyloxycarbonylethyl esterification, methylamidated compound, etc.). These compounds can be produced from the compound of the present invention by a method known per se. In addition, the prodrug of the compound of the present invention changes to the compound of the present invention under physiological conditions as described in Hirokawa Shoten, 1990, "Development of Pharmaceuticals," Vol. 7, pp. 163 to 198, Molecular Design. It may be something.

The compounds obtainable by using the screening method of the present invention may form salts, and pharmacologically and physiologically acceptable salts are used as such salts. For example, salts with inorganic bases, salts with organic bases, salts with inorganic acids, salts with organic acids, salts with basic or acidic amino acids and the like are used. Preferable examples of the salt with an inorganic base include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt and magnesium salt; and aluminum salt and ammonium salt. Preferable examples of the salt with an organic base include salts with trimethylamine, triethylamine, pyridine, picoline, ethanolamine, diethanolamine, triethanolamine, dicyclohexylamine, N, N'-dibenzylethylenediamine, and the like. Preferred examples of salts with inorganic acids include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, and the like. Preferred examples of salts with organic acids include, for example, formic acid, acetic acid, trifluoroacetic acid, fumaric acid, oxalic acid,
Tartaric acid, maleic acid, citric acid, succinic acid, malic acid,
Salts with methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid and the like are used. Preferred examples of the salt with a basic amino acid include, for example, salts with arginine, lysine, ornithine, and preferred examples of the salt with an acidic amino acid include, for example, salts with aspartic acid, glutamic acid, and the like. Can be

The compounds obtainable by the screening method of the present invention (preferably, compounds that inhibit infection efficiency and cell membrane fusion) are useful as anti-HIV drugs (preventive / therapeutic drugs for HIV infection). However, it is preferably used as a prophylactic / therapeutic agent for AIDS. When a compound that can be obtained by using the screening method of the present invention is used as the above-mentioned therapeutic / prophylactic agent, it can be carried out according to conventional means. The compounds can be administered per se or as a suitable pharmaceutical composition. The pharmaceutical composition used for the administration is a pharmacologically acceptable carrier with the compound,
A diluent or excipient may be included. Such compositions are provided in dosage forms suitable for oral or parenteral administration. That is, for example, as a composition for oral administration, solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules,
Examples include powders, capsules (including soft capsules), syrups, emulsions, suspensions and the like. Such a composition is produced by a method known per se and contains a carrier, diluent or excipient commonly used in the field of formulation. For example, lactose, starch, sucrose, magnesium stearate and the like are used as carriers and excipients for tablets. As a composition for parenteral administration, for example, injections, suppositories and the like are used, and the injections are intravenous injections,
It includes dosage forms such as subcutaneous injections, intradermal injections, intramuscular injections, and infusions. Such injections are prepared according to a method known per se, for example, by dissolving, suspending or emulsifying the compound in a sterile aqueous or oily liquid usually used for injections. As an aqueous liquid for injection, for example,
Physiological saline, isotonic solution containing glucose and other adjuvants are used, and suitable solubilizing agents such as alcohol (eg, ethanol), polyalcohol (eg, propylene glycol, polyethylene glycol), nonionic interface Activator [eg, polysorbate 80, HCO-50 (poly
oxyethylene (50mol) adduct of hydrogenated cast
or oil)]. As the oily liquid, for example, sesame oil, soybean oil, and the like are used, and benzyl benzoate, benzyl alcohol, and the like may be used in combination as a solubilizing agent. The prepared injection is usually filled in a suitable ampoule. Suppositories for rectal administration are prepared by mixing the above compound with a conventional suppository base. The above-mentioned oral or parenteral pharmaceutical composition is conveniently prepared in a unit dosage form so as to be compatible with the dosage of the active ingredient. Examples of such dosage unit dosage forms include tablets, pills, capsules, injections (ampoules), suppositories and the like, and usually 5 to 50 per dosage unit dosage form.
It is preferable that the compound contains 0 mg, especially 5 to 100 mg for injection, and 10 to 250 mg for other dosage forms. Each of the above-mentioned compositions may contain other active ingredients (for example, a reverse transcriptase inhibitor, a protease inhibitor, etc.) as long as an undesirable interaction is not caused by the combination with the above compound. Since the preparation thus obtained is safe and has low toxicity, for example, mammals (eg, mouse, rat, rabbit, sheep, pig, cow, horse, bird, cat, dog, monkey, chimpanzee, human, etc.) Can be administered.

The dose of the compound varies depending on its action, target disease, subject of administration, administration route and the like. For example, when a CCR5 antagonist is orally administered for the purpose of treating AIDS, it is generally used for an adult (body weight 60 kg). ), About 0.1 mg to 5 g, preferably about 10 mg to 4 g, more preferably about 100 mg to 3 g per day. The dosage for parenteral administration varies depending on the subject of administration, the target disease, etc. For example, when a CCR5 antagonist is usually administered to adults (as 60 kg) in the form of an injection for the purpose of treating AIDS About 0.01 mg to 2 g per day, preferably about 0.1 mg to 1 g
It is convenient to administer about g, more preferably about 0.1 mg to 500 mg, by intravenous injection. In the case of other animals, the amount can be administered in terms of 60 kg.

The "anti-HIV effect" in the method for evaluating the combined effect of two or more compounds having an anti-HIV effect is as follows.
Reverse transcriptase inhibition, protease inhibition, integrase inhibition, Tat inhibition, envelope inhibition, its receptor inhibition and the like. In this case, the “two or more compounds” may have the same or different anti-HIV effects. In addition, all chemokine-directed viruses of R5, X4 and R5X4 can be used as HIV for evaluation. Specifically, the “method of evaluating the effect of combination” is specifically described as “screening of a compound that changes the infection efficiency of HIV” and “the screening of a compound that changes the reaction efficiency of membrane fusion involving the envelope glycoprotein of HIV”. Screening "and" Screening of compounds acting on HIV LTR ", and the same methods as in Example 3 below. That is, the evaluation can be performed by comparing the evaluation result of the single agent with the result of the evaluation using a combination of two or more drugs. According to this method, anti-H
The effect of the combined use of IV drugs can be easily evaluated, and is extremely useful clinically.

MOLT-4 / CCR5 / LT obtained in Example 1 described later
The R-SEAP strain has been deposited with the National Institute of Advanced Industrial Science and Technology, Biotechnology and Industrial Technology Research Institute (NIBH) on November 8, 2000, under the deposit number FE.
RMBP-7350, deposited on October 13, 2000 at the Institute of Fermentation (IFO), Deposit Number IFO
No. 50526 has been deposited. The MOLT-4 / CCR5 strain obtained in Reference Example 1 described below was prepared on February 2, 2000.
From 9th, Ministry of International Trade and Industry, Institute of Industrial Science and Technology
IBH) under accession number FERM BP-7060.
Fermentation Research Institute (IF) from January 27, 2000
O) and deposit number IFO 50521.

[0016]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Embodiments of the present invention will be described below in detail, but the present invention is not limited thereto. Also,
Unless otherwise noted, individual genetic manipulation techniques are described in the manual of Sombrook et al. ((Molecular Cloning: A
Laboratory Manual), Cold Spring Harbor Laboratory Press).

Reference Example 1 Establishment of MOLT-4 / CCR5 Cell Line (1) Determination of Selective Agent (Geneticin) Concentration MOLT-4 cells were cultured under the conditions of 37 ° C. and 5% carbon dioxide.
RP containing 0% fetal bovine serum (FBS, manufactured by ICN (ICN), USA), 100 U / ml penicillin G (manufactured by Life Technology, USA), 100 μg / ml streptomycin (manufactured by Life Technology, USA)
MI1640 medium (Life Technology, USA)
(Hereinafter referred to as MOLT-4 basic medium). 100, 200, 300, in MOLT-4 basal medium
400, 500, 600, 700, 800, 900, 1
Geneticin (Geneticin, manufactured by Life Technology Co., USA) was added at 2,000 μg / ml, and 2 × 10 ³ cells / ml was added.
After culturing for a week, the growth of the cells was observed under a microscope, and the minimum concentration that completely suppressed the growth was determined. (2) Transfection 15 μl of cellfectin (Cellfectin, manufactured by Life Technology, USA) in 250 μl of RPMI1640 medium without FBS, penicillin G and streptomycin
Was added as a lipid solution and added to the wells of a 24-well cell culture plate. RPMI 164 also without additives
3.2 μg of pcDNA3.1-CCR5 (Baba et al., Proceedings National Academic
Science U.S.A. (Proceedings of the N)
ational Academy of Sciences, USA), 1999, 9
6, 5698-5703) to give a DNA solution. This DNA solution is mixed with the lipid solution, and
After standing for 0 min, 250 μl of DNA from A1 well
-The lipid mixture was removed. MOL suspended in RPMI1640 medium without addition to 8 × 10 ⁶ cells / ml
T-4 cells were added in an amount of 50 μl and cultured at 37 ° C. for 4 hours under 5% carbon dioxide. In addition, 15% FBS, 100U /
600 μl of RPMI1640 medium containing 100 ml / ml of penicillin G and 100 μg / ml of streptomycin was added and cultured for 2 days. The total volume of this culture was 1 mg / ml Genetic
1 containing 10 ml of MOLT-4 basic medium containing in
The cells were transferred to a 00 mm culture dish, and the culture was continued under the conditions of 37 ° C. and 5% carbon dioxide, the culture solution was replaced at appropriate times, and Geneticin-resistant cells were grown. (3) Preparation of feeder cells MOLT-4 cells were suspended in a phosphate buffer (PBS (manufactured by Life Technology, USA)) at 1 × 10 ⁷ cells / ml, and 200 μl was dispensed into a sample tube. . 20 μl of 0.5 mg / ml mitomycin C (manufactured by Wako Pure Chemical Industries, Japan) solution was added thereto, and reacted at 37 ° C. for 30 minutes. After washing 5 times with MOLT-4 basic medium, 1 mg / ml Genet was adjusted to 1 × 10 ⁵ cells / ml.
The cells were suspended in MOLT-4 basal medium containing icin. (4) Single cell cloning 100 μl of the above feeder cells were dispensed into a 96-well cell culture plate. Proliferate Geneticin-resistant cells by 3cel
MOLT containing 1mg / ml Geneticin to be ls / ml
-4 The suspension was suspended in a basal medium, and dispensed into a 96-well cell culture plate to which feeder cells had been previously added. The growth of the cells was observed under a microscope, the proliferating cells were separated, and the culture scale was increased in a timely manner. (5) Examination of CCR5 expression The Geneticin-resistant clone obtained in the above (4) was used to prepare a reaction mixture [2% (V / V) FBS, 0.1% (W / V) sodium azide]
(Wako Pure Chemical Industries, Japan) / phosphate buffer], and suspended in 40 μl of the same reaction solution. 10
μl of fluorescein isothioanaate [(fluores
cein isothiocyanate (FITC)]-labeled anti-CCR5 antibody clone 2D7 (Farmingen, USA) was added and reacted at 4 ° C. for 45 minutes. Separate the cells and add 1
After washing 3 times with the above reaction solution, the suspension was suspended in 300 μl of the reaction solution, and the antibody binding was analyzed using a Flow Cytometer (JASCO CytoACE-300, manufactured by JASCO Corporation, Japan). When compared, apparently anti-CCR
5 antibody peak shifted to the right (high fluorescence intensity side) and CC
A MOLT4 / CCR5 cell line [FERM BP-7060; IFO 50521] in which R5 expression was confirmed was obtained.

Example 1 Establishment of MOLT-4 / CCR5 / LTR-SEAP Cell Line (1) Determination of Selective Drug (Puromycin) Concentration MOLT-4 / CCR5 cells were cultured at 37 ° C. under 5% CO 2 gas.
0% fetal calf serum (FBS, manufactured by ICN, Inc., USA), 100 U / ml penicillin G (manufactured by Life Technology, USA), 100 μg / ml streptomycin (manufactured by Life Technology, USA), 500 μg / ml
RPMI1640 medium (manufactured by Life Technology, Inc., containing mlG418 sulfate (manufactured by Life Technology, USA)
(USA) (hereinafter abbreviated as MOLT-4 / CCR5 basal medium). 0.1, 0.2, 0.5, 1.0 in MOLT-4 / CCR5 basic medium
Add μg / ml puromycin (Puromycin, Sigma, USA), culture at 2 × 10 ³ cells / ml for 1 week, observe the cell growth under a microscope, and determine the minimum concentration that completely suppresses the growth. did. (2) Construction of LTR-SEAP Primer A: gga using genomic DNA of HIV-1 infected cells as a template
PCR was performed using gatcttcaagaactgctgacatcgagc (SEQ ID NO: 2) and primer B: aggcaagctttattgaggcttaagcagtgg (SEQ ID NO: 3) to amplify a part of the LTR sequence. The amplified sequence is digested with restriction enzymes BglII and HindIII, and BglII / HindIII of pSEAP2-Basic (Clontech).
LTR-SEAP was obtained by incorporation into the site. (3) Transfection Suspended in 800 μl of OPTI-MEM (Gibco) medium in a 6-well culture dish
1 × 10 ⁶ cells were added. 200 μl of DNA-lipid solution was added to the cells, and the cells were cultured at 37 ° C. and 5% CO ₂ for 4 hours. 20% after culture
1 ml of RPMI1640 medium containing FBS was added, and the cells were cultured at 37 ° C. and 5% CO ₂ for 3 days. The DNA-lipid solution was prepared by mixing the DNA solution and the lipid solution. DNA solution is 100 μl O
1 μg LTR-SEAP and 0.1 μg pPURO (CLONTE
CH). 100μ lipid solution
6 μl of Lipofectamine2000 (Life
Technology Co., USA). Three days later, one quarter of the cells were filled with 100 ml of MOLT-4 / CCR5 basal medium containing 0.1 μg / ml Puromycin.
The cells were transferred to a mm culture dish, cultivation was continued at 37 ° C. and 5% carbon dioxide, the culture solution was replaced at appropriate times, and Puromycin-resistant cells were grown. (4) Preparation of feeder cells MOLT-4 cells were suspended in a phosphate buffer (PBS (manufactured by Life Technology, USA)) at 1 × 10 ⁷ cells / ml, and 200 μl was dispensed into a sample tube. . 20 μl of 0.5 mg / ml mitomycin C (manufactured by Wako Pure Chemical Industries, Japan) solution was added thereto, and reacted at 37 ° C. for 30 minutes. After washing 5 times with MOLT-4 / CCR5 basic medium, 1 × 10
Contains 0.1 μg / ml Puromycin to be ⁵ cells / ml
The cells were suspended in MOLT-4 / CCR5 basal medium. (5) Single cell cloning 100 μl of the above feeder cells was dispensed into a 96-well cell culture plate. 3 cels of Puromycin resistant cells growing
MOLT- containing 0.1 μg / ml Puromycin to be ls / ml
The suspension was suspended in 4 / CCR5 basic medium, and 100 μl was dispensed into a 96-well cell culture plate to which feeder cells had been added (0.3 cells per well). The growth of the cells was observed under a microscope, the proliferating cells were separated, and the culture scale was increased in a timely manner. (6) Reporter activation depending on HIV Tat HIV-Tat was added to the Puromycin resistant clone obtained in (5) above.
The expression vector was transfected by a method known per se. After culturing for 2 days, the alkaline phosphatase activity of the supernatant was measured using the Great EscAPe SEAP Chemiluminescence Dete
ction Kits (Clontech). Puromycin with increased alkaline phosphatase activity due to Tat
Resistant clones were selected (FIG. 1). (7) Confirmation of expression of CCR5 and CD4 on cell surface Puromycin resistant clone obtained in (5) above was used as a reaction solution [2% (V / V) FBS, 0.1% (W / V) sodium azide
(Wako Pure Chemical Industries, Japan) / phosphate buffer], and suspended in 40 μl of the same reaction solution. 10
μl of fluorescein isothioanaate [(fluores
cein isothiocyanate (FITC)]-labeled anti-CCR5 antibody clone 2D7 (Pharmingen, USA) or FITC-labeled control antibody (Pharmingen) was added and reacted at 4 ° C. for 45 minutes. After the reaction, each well was washed three times with 1 ml of the above reaction solution, suspended in 600 μl of the reaction solution, and analyzed for antibody binding with a Flow Cytometer (JASCO CytoACE-300, manufactured by JASCO Corporation, Japan). The results are shown in FIGS. MOLT-4 / CCR5 / LTR-SEAP cell line [FER
MBP-7350; anti-CC against IFO 50526]
The binding of the R5 antibody (FIG. 2) is clearly shifted to the right (high fluorescence intensity) compared to the binding of the control antibody (FIG. 3).
Expression of CCR5 was confirmed on the cell surface of the MOLT-4 / CCR5 / LTR-SEAP cell line.

Example 2 Measurement of HIV-1 Infection, Viral Antigen Amount and Alkaline Phosphate Activity Assay for confirming that alkaline phosphatase activity is an indicator of virus proliferation as well as p24 antigen amount as follows: Was done. 2 × 10 ⁴ MOLT-4 / CCR5 / LTR-SEAP cells and various CCID ₅₀ (50% infectious cell virus) virus were mixed and cultured at 37 ° C. under 5% CO 2.
On day 5 after infection, a quarter was subcultured and cultured for another 5 days.
On day 10 after infection, collect the culture supernatant and use the following measurement method.
The amount of p24 antigen and alkaline phosphatase activity were measured. Viruses are HIV-1 BaL strain and CXCR4 tropic for CCR5
Directed HIV-1 3B strain was used. Fig. 4 (HIV-
1 BaL strain) and FIG. 5 (HIV-13B strain). In the figure, the vertical axis represents the amount of p24 antigen (pg / ml) and the amount of chemiluminescence (RLU),
The horizontal axis indicates the amount of virus (CCID ₅₀ / well). The experiments were performed using three wells and showed the mean and standard deviation. An increase in the amount of p24 antigen and alkaline phosphatase activity in accordance with the amount of virus used was observed, indicating that alkaline phosphatase activity can be an indicator of virus growth in the same manner as the amount of p24 antigen. 1) Measurement of the amount of p24 antigen The amount of p24 antigen was determined by Rep manufactured by ZeptoMetrix.
The measurement was performed using a tro-TEK p24 antigen ELISA kit (retrotech p24 antigenizer kit). The culture supernatant appropriately diluted using the diluent was added to the ELISA strips previously washed with the washing solution, and reacted at 37 ° C. for 2 hours. After washing, a detection antibody was added and reacted at 37 ° C. for 1 hour.
After washing, a secondary antibody was added and reacted at 37 ° C. for 30 minutes. After washing, a chromogenic substrate was added and reacted at room temperature for 30 minutes, and then a stop solution was added to stop the color development. Measure the absorbance at 450 nm and use the calibration curve created using the standard
The amount of p24 antigen was calculated. 2) Measurement of alkaline phosphatase activity Alkaline phosphatase activity was measured using a Great EscAPe SEAP Detection Kit (Great Escape Sheep Detection Kit) manufactured by CLONTECH. Add 50 μl of the diluted solution to 15 μl of the culture supernatant, and
The reaction was performed for 30 minutes. After the temperature of the reaction solution was returned to room temperature, 50 μl was transferred to a white plate, and 50 μl of an assay buffer was added, followed by a reaction at room temperature for 5 minutes. Add 50 μl of luminescent substrate, and add
After reacting for 0 minutes, the amount of chemiluminescence was measured with a luminometer.

Example 3 Evaluation of Compound's Anti-HIV-1 Activity 2 × 10 ⁴ MOLT-4 / CCR5 / LTR-SEAP cells and 1000 CCID ₅₀
(50% cultured cell-infected virus) and various concentrations of test compounds (Table 1) were mixed and cultured for 5 days at 37 ° C under 5% carbon dioxide. One quarter was subcultured and cultured for another 5 days. On day 10 after infection, collect the culture supernatant,
The alkaline phosphatase activity was measured. Compound anti
HIV-1 activity (inhibition rate) was calculated by the following equation. Inhibition rate (%) = (1− (chemiluminescence ¹ / chemiluminescence ² )) × 100 Chemiluminescence ¹ = chemiluminescence when test compound was added (ii)
-Chemiluminescence without virus infection (iii) Chemiluminescence ² = Chemiluminescence without test compound added (i)-Chemiluminescence without virus infection (i
ii) MOLT-4 / CCR5 / LTR-
50% of compounds calculated using alkaline phosphatase activity as an index when HIV-1 BaL strain was infected to SEAP cell line
Table 2 shows the results obtained by measuring the virus growth inhibitory activity (EC ₅₀ ) and the 90% virus growth inhibitory activity (EC ₉₀ ). As is evident from Table 2, anti-HIV-1 activity was observed in all four compounds, although there was a difference in strength. The compounds used in the examples are the four known compounds shown in Table 1.

[0021]

[Table 1]

[Table 2]

[0022]

Industrial Applicability The T cell line according to the present invention has a reporter gene having an HIV LTR sequence and has a CCR5
, Which allows HIV to be infected multiple times, and furthermore, the reporter gene allows the
The degree of IV multiple infections can be easily measured. Therefore, for example, it is useful for screening a compound or a salt thereof having a preventive / therapeutic effect on a disease caused by HIV such as AIDS.

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the LTR sequence obtained in Example 1 (2). [SEQ ID NO: 2] Primer A used in Example 1 (2)
Is shown. [SEQ ID NO: 3] Primer B used in Example 1 (2)
Is shown.

[0024]

[Sequence List] [SEQUENCE LISTING] <110> Takeda Chemical Industries, Ltd. <120> T-lymphoblastoid cell line and Use Thereof <130> 181124 <150> JP 2000-350685 <151> 2000-11-17 <160> 3 <210> 1 <211> 220 <212> DNA <213> Virus <400> 1 CTTCAAGAAC TGCTGACATC GAGCTTGCTA CAAGGGACTT TCCGCTGGGG ACTTTCCAGG 60 GAGGCGTGGC CTGGGCGGGA CTGGGGAGTG GCGAGCCCTC AGATGCTGCA TATAAGCAGC 120 TGCTTTTTGC CTGTACTGGG TCTCTCTGGT TAGACCAGAT CTGAGCCTGG GAGCTCTCTG 180 GCTAACTAGG GAACCCACTG CTTAAGCCTC AATAAAGCTT 220 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <400> 2 GGAGATCTTC AAGAACTGCT GACATCGAGC 30 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <400> 3 AGGCAAGCTT TATTGAGGCT TAAGCAGTGG 30

[Brief description of the drawings]

FIG. 1. After transiently introducing an HIV-1 Tat expression vector or a control vector into a MOLT-4 / CCR5 / LTR-SEAP cell line, the alkaline phosphatase activity in the culture supernatant was measured. The vertical axis indicates the amount of luminescence per second (RLU) of alkaline phosphatase in 1 μl of the culture supernatant.

FIG. 2 shows a Flow Cytometer chart in which an anti-CCR5 antibody is bound to a MOLT-4 / CCR5 / LTR-SEAP cell line.

FIG. 3 shows a Flow Cytometer chart in which a control antibody is bound to a MOLT-4 / CCR5 / LTR-SEAP cell line.

FIG. 4 is a graph showing the amount of p24 antigen in the culture supernatant and the alkaline phosphatase activity after infecting the MOLT-4 / CCR5 / LTR-SEAP cell line with the HIV-1 BaL strain.

FIG. 5 is a graph showing the amount of p24 antigen in the culture supernatant and the alkaline phosphatase activity after infecting the MOLT-4 / CCR5 / LTR-SEAP cell line with the HIV-1 3B strain.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61K 45/00 A61P 31/18 4C062 A61P 31/18 C12Q 1/02 4C063 C12N 15/09 ZNA G01N 33/15 Z 4C065 C12Q 1/02 33/50 Z 4C084 G01N 33/15 C07D 217/26 4C086 33/50 309/14 // C07D 217/26 405/04 309/14 471/14 102 405/04 C12N 5/00 B 471/14 102 15/00 ZNAA F term (reference) 2G045 BB20 BB51 CB01 FA16 FA29 FB01 FB03 FB14 GC10 GC15 4B024 AA01 AA14 BA11 BA63 CA01 DA03 FA10 GA11 GA18 HA11 4B063 QA19 QQ02 QQ03 QQ33 QQ79 QQ91 QR48 QR77 QS24 QS36 QS38 QX01 4B065 AA93X AA93Y AB01 AC20 BA02 BC07 CA24 CA27 CA44 CA46 4C034 AN10 4C062 AA15 4C063 AA01 BB02 CC73 DD29 EE01 4C065 AA01 AA04 BB09 CC08 DD04 EE03 HH02 KK09 LL04 PP02 4C084 AA17 MA17 MA22 MA23 MA35 MA37 MA41 MA52 MA66 NA14 ZC552 4C086 BA07 BC30 BC42 CB11 GA02 GA07 MA01 MA04 ZC55

Claims (38)

[Claims] 1. A T cell line carrying a reporter gene having an HIV LTR sequence and expressing CCR5. 2. The T cell line according to claim 1, wherein the LTR sequence is the same or substantially the same as the nucleotide sequence represented by SEQ ID NO: 1. 3. The T cell line according to claim 1, wherein the reporter gene is an enzyme gene. 4. The T cell line according to claim 3, wherein the enzyme is alkaline phosphatase. 5. The method according to claim 1, wherein the T cell line is a human-derived cell line.
The described T cell line. 6. The T cell line according to claim 1, wherein the T cell line is derived from a MOLT-4 / CCR5 cell line (FERM BP-7060). 7. MOLT-4 / CCR5 / LTR-SEA
2. A P cell line (FERM BP-7350).
The described T cell line. 8. A method for measuring HIV infection efficiency, comprising using the T cell line according to claim 1. 9. The method according to claim 8, wherein the HIV is HIV-1. 10. The method according to claim 8, wherein the HIV is R5 HIV-1. 11. The method according to claim 8, wherein the HIV is HIV present in a clinical specimen. 12. A method for screening a compound that changes HIV infection efficiency, comprising culturing the T cell line according to claim 1 in the presence of a test compound and assaying the change in HIV infection efficiency. . 13. The T cell line according to claim 1 and (2)
(I) HIV envelope glycoprotein and (ii) H
A method for assaying the reactivity of cell membrane fusion produced by mixing and culturing cells that express a transcription factor that activates an IV LTR. 14. The T cell line according to claim 1 and (2)
(I) HIV envelope glycoprotein and (ii) H
Assaying the reactivity of cell membrane fusion produced by mixing and culturing cells expressing a transcription factor that activates an IV LTR in the presence of a test compound,
A method for screening a compound that changes the reactivity of cell membrane fusion. 15. A method for screening a compound acting on HIV LTR, comprising using the T cell line according to claim 1. 16. A method for screening a compound that suppresses activated HIV LTR, comprising using the T cell line according to claim 1. 17. The method according to claim 16, wherein the HIV LTR is an HIV LTR activated by HIV Tat. 18. The method according to claim 16, wherein the HIV LTR is an NFκB-activated HIV LTR. 19. Obtained by the method of claim 12,
A compound that changes the infection efficiency of HIV. 20. The method according to claim 19, which inhibits the infection efficiency of HIV.
A compound as described. 21. The method according to claim 19, which promotes HIV infection efficiency.
A compound as described. 22. Obtained by the method of claim 14.
A compound that alters the reactivity of cell membrane fusion. 23. The compound according to claim 22, which inhibits cell membrane fusion. 24. The compound according to claim 22, which promotes cell membrane fusion. 25. Obtained by the method of claim 15.
Compound acting on HIV LTR. 26. The method according to claim 25, which activates the HIV LTR.
A compound as described. 27. The method according to claim 25, which suppresses HIV LTR.
A compound as described. 28. Obtained by the method of claim 16.
A compound that suppresses an activated HIV LTR. 29. Obtained by the method of claim 17.
A compound that suppresses an activated HIV LTR. 30. Obtained by the method of claim 18.
A compound that suppresses an activated HIV LTR. (31) An agent for promoting the infection efficiency of a retroviral vector, comprising the compound according to (21), (24) or (26). 32. The agent according to claim 31, wherein the retroviral vector is derived from HIV. 33. The method of claim 19, 20, 22, 23, 25,
A pharmaceutical composition comprising the compound according to any one of 27, 28, 29 or 30. 34. The composition according to claim 33, which is an anti-HIV drug. (35) the agent which is a prophylactic / therapeutic agent for AIDS;
A composition as described. 36. The method of claim 19, 20, 22, 23, 25, 27, 28, 29 for the manufacture of a prophylactic / therapeutic agent for AIDS.
Or a use of the compound or a salt thereof according to any one of 30. 37. The method according to claim 19,20,22,23,25,
31. A method for preventing or treating AIDS, comprising administering a pharmacologically effective amount of the compound according to any one of 27, 28, 29 or 30 or a salt thereof. 38. A method for evaluating the combined effect of two or more compounds having an anti-HIV activity.