JP2002291479A - Food inspection method - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a food inspection method capable of sensitively inspecting, from raw materials to processed goods, whether they are genetically recombined or not in a short time. SOLUTION: This method comprises a step (S101) wherein the food sample to be inspected is pulverized, a step (S102) wherein the DNA is extracted from the pulverized sample, a step (S103) wherein the extracted DNA is hybridized with a probe having homology with the genetically recombined body, a step (S104) wherein the product of hybridization is anchored on a substrate, a step (S105) wherein the substrate is visualized by using a scanning probe microscope and a step (S106) wherein the sample is determined whether it is genetically recombined or not based on the image data of the visualized image.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an inspection method for inspecting a micro structure at a cell level, a biomolecule level, a gene level or an atomic level in a crop or food.

[0002]

2. Description of the Related Art In recent years, genetically modified foods (Genetically
Inspection methods for distinguishing Modified Organisms (GMOs) have attracted attention. In the future, the Ministry of Agriculture and Fisheries and the Ministry of Health, Labor and Welfare have decided to require the labeling of 31 GMOs, so that businesses that perform inspections on behalf of food companies and distributors are starting up. In order to determine whether or not a food is produced using genetically modified foods, it is sufficient to check for the presence of artificially introduced genes. At present, PCR (polymerase chain reac
method and ELISA (enzyme linked immunosorbent ass)
ay method).

[0003] In the inspection method by the PCR method, a fine gene fragment called a primer is used, which is reacted with a specific gene introduced by genetic recombination, and the target gene is amplified by several tens to several million times. To amplify it and make it possible to perform tests. Specifically, first, a primer is selected so that the introduced gene is amplified only when the sample is GMO, and the sample is subjected to PCR using the primer. Then, by electrophoresis (ethidium bromide staining) of the obtained PCR product, if there is DNA amplified by PCR (that is, GMO),
It is detected as an electrophoretic band. If the sample is a non-genetically modified food (hereinafter abbreviated as nonGMO), the specific gene is not amplified by PCR and thus is not detected as an electrophoretic band. Therefore, it can be determined whether GMO or non-GMO by the presence or absence of the electrophoretic band (see Table 1).

[0004]

[Table 1] On the other hand, while the test method by PCR directly examines a newly introduced gene by genetic recombination, the test method by ELISA uses an antigen-antibody reaction to determine the presence or absence of the protein expressed and produced by that gene. It is a method of detecting.
Using a test paper composed of an antibody to GMO (primary antibody), an enzyme-labeled antibody (secondary antibody), and a coloring solution, the difference in the coloring can be measured by an absorbance measurement method to determine the presence or absence of GMO ( See Table 1).

[0005]

The above-mentioned test method using the PCR method has a high test accuracy, but requires the use of PCR to check for contamination (contamination) between samples and PCR inhibitors. In this case, it is not possible to increase the amount of very short DNA, so that processed foods and soy sauce and soybean oil, whose genes have been shortened, cannot be inspected, are expensive, and the inspection process is complicated and the inspection time is long. There is a problem (see Table 2).

[0006] The above-described ELISA test method is simpler than the above-described PCR test method, and has the advantages of being inexpensive and having a short test time. However, proteins are easily denatured by heat,
This method has a problem that it cannot be used for a processed product subjected to a heat treatment. There is also a problem that the detection limit is one order of magnitude worse than the test method by the PCR method (see Table 2).

[0007]

[Table 2] Therefore, the present invention has been made in view of the above problems, by visualizing each DNA using the technology of visualization and measurement method, by measuring the length and shape, from raw materials to processed products, It is an object of the present invention to provide a food inspection method which enables a highly sensitive and short time inspection of a microstructure of a sample.

[0008]

Means for Solving the Problems In order to achieve the above object, the present inventors have applied a biomolecule visualization / measurement technique to a novel GMO inspection method (HVM method: hybridization visible method).
method) established.

[0009] A first feature of the present invention is a step of crushing a sample to be tested, a step of extracting DNA from the crushed sample, and a step of using the extracted DNA as a probe homologous to the genetically modified product. Hybridization step, anchoring the product obtained by hybridization on a substrate, visualizing the substrate using a scanning probe microscope, and microscopic structure of the sample from the shape information of the visualized image. Judge. "Determining the microstructure" means determining the structure at the atomic level or the biomolecule level, for example, determining whether the sample is a genetically modified food.

A second feature of the present invention is that a step of crushing a sample to be inspected, a step of extracting DNA from the crushed sample, and a step of homogenizing the extracted DNA with a genetically modified product And the step of hybridizing with a biotinylated probe that binds to the magnetic particles, the step of binding the magnetic particles to the biotinylated probe, and the step of extracting a hybridization product with the magnetic particles with a magnet, Anchoring the hybridization product on a substrate, visualizing the substrate using a scanning probe microscope, and determining whether or not the food is a genetically modified food from the shape information of the visualized image. It is in that. According to such a genetically modified food inspection method, each DNA is visualized using a visualization / measurement technique, and its length and shape are measured. It is possible to inspect whether it is a genetically modified food with high sensitivity and in a short time.

[0011]

BEST MODE FOR CARRYING OUT THE INVENTION (Summary of the Present Invention) In the food testing method (HVM method) of the present invention, a sample DNA is hybridized with a probe DNA in order to change the sample DNA to be tested into a specific shape. This is a simple and high-quality test method in which the hybridization product is visualized and the microstructure at the biomolecule level is determined from the DNA shape information.

The inspection process of the food inspection method (HVM method) of the present invention is basically performed as follows, as shown in FIG.

(A) In step S101, the sample is crushed.

(B) In step S102, DNA is extracted.

(C) In step S103, a probe DNA (nonGMO) having homology to GMO and a sample DNA
(GMO) is hybridized.

(D) In step S104, the hybridization product is anchored on the substrate.

(E) In step S105, the hybridization product is visualized by a visualization / measurement method.

(F) In step S106, the presence or absence of GMO as a micro structure of the sample is determined from the shape of the visualized image.

As described above, there are six steps.

Next, first to second embodiments of the present invention will be described with reference to the drawings. In the following description of the drawings, the same or similar parts are denoted by the same or similar reference numerals. However, it should be noted that the drawings are schematic, and the relationship between the thickness and the plane dimension, the ratio of the thickness of each layer, and the like are different from actual ones. Therefore, specific thicknesses and dimensions should be determined in consideration of the following description. In addition, it is needless to say that the drawings include portions having different dimensional relationships and ratios.

(First Embodiment) FIG. 2 is a flow chart showing details of a genetically modified food inspection method (HVM method) as an example of a food inspection method according to a first embodiment of the present invention. It is. Hereinafter, each step will be described.

(A) First, in step S200,
DNA extraction of a sample to be tested and preparation of a DNA probe that hybridizes with a target recombinant gene are performed. The form of the sample to be tested is not particularly limited as long as it contains DNA, and the raw materials (soy, corn,
It can be used from potatoes) to processed products (such as those subjected to heat treatment), but it is necessary to extract DNA from the sample in order to be able to hybridize the sample DNA with the probe DNA. Therefore, the sample is appropriately crushed (step S101 in FIG. 1), and the protein,
DNA is extracted by removing lipids and other cell components (step S102 in FIG. 1). The extracted sample DNA is preferably a sample suspended in a buffer. The DNA probe is prepared so as to specifically hybridize to the target DNA. The probe DNA can be obtained by cloning or, if shorter, chemically synthesized. The length of the probe DNA varies from 12 to several thousand bases, but the probe DNA does not need to be completely complementary to the DNA to be detected and is effective for specifically binding to the DNA probe to be detected. If the length is long, only a part of the DNA molecule may be complementary. Generally, DNA probes have unique labels (radioactive or chemical labels)
This makes it possible to trace the incorporation into the double-stranded DNA by hybridization, but the DNA probe used in the present invention may be left unlabeled.

(B) The mixing of the sample DNA and the DNA probe requires that the higher-order structure of the sample DNA and the DNA probe in the mixed sample be eliminated, and that the complementary sequences hybridize. Therefore, the sample DNA and the DNA probe may be mixed before heat denaturation in step S210, or may be mixed after heat denaturation of the sample DNA and DNA probe, respectively. Therefore, step S21
In step 0, the mixed sample of the DNA probe and the sample DNA is denatured by heat or exposed to a high pH (pH> = 13) to thereby form a complementary base binding the double helix of the double helix of the DNA probe and the sample DNA. Break the pair and dissociate the double helix into single strands. The heat denaturation of the mixed sample in step S210 is not particularly limited as long as it dissolves the higher order structure of the nucleic acid molecule in the mixed sample and dissociates into single strands.
For example, using a temperature controller for PCR or a thermostat, etc., the reaction is carried out at 80 to 100 ° C., preferably 100 ° C.
The time required for heat denaturation is determined by the properties of the sample DNA and DNA probe in the mixed sample, and is at least 3 minutes, more preferably 10 minutes.

(C) Next, in order to hybridize the sequence in the sample DNA with the above DNA probe (step S103 in FIG. 1), the temperature of the mixed sample heat-denatured in step S210 is lowered. Sample DNA and D
When the NA probe hybridizes, a single-stranded and double-stranded mixed sample in which both ends or ends are single-stranded is formed. Conditions for lowering the temperature of hybridization (how to lower the temperature, final temperature drop, etc.)
It is determined according to the degree of homology between the DNA probe and the sample DNA, the concentration of the DNA probe, and the concentration of the sample DNA complementary to the DNA probe. The conditions can be adjusted by the salt concentration at the time of hybridization. Other conditions relating to hybridization require that the hybridizing DNA be capable of freely changing its structure, and do not allow the non-hybridizing portion of the DNA to assume a higher-order structure. must not.

(D) The mixed sample obtained by the above-mentioned hybridization is immobilized on a substrate for observation with a scanning probe microscope in order to form an image with a scanning probe microscope (anchoring in step S104 in FIG. 1). Do). The substrate for immobilization is not particularly limited as long as it does not significantly inhibit the shape and structural change of the DNA to be immobilized, and is used for observation with a scanning probe microscope such as a silicon substrate or a glass substrate. Any material that allows the probe to be immobilized may be used, and it is preferable to use mica (mica substrate) having a cleavage surface on the surface. For example, when mica is used as the substrate, the sample suspension is adsorbed on the substrate surface simply by dropping a sample suspension on a freshly peeled surface of the mica with a pipette. More preferably, since the cleaved mica surface has a negative charge, the mica is converted to a divalent cation (Mg (II)) before sample adsorption in order to electrostatically bond the negative charge from the phosphate group of DNA. It is good to soak in a solution such as (E) As a technique for visualizing and measuring the substrate on which the sample obtained as described above is fixed, a scanning probe microscope is used. Here, "scanning probe microscope" is a general term for a scanning microscope that scans a fine probe on the surface of an object and observes the surface with atomic resolution.
Scanning tunneling microscop
y; STM), atomic force microscop
y; AFM). AFM is roughly classified into a repulsion type, an attraction type, a tapping type ("tapping type" is a registered trademark of Digital Instruments Inc.) and the like. Research in this area is undergoing significant progress, and friction microscopy (Latera)
l force microscopy (LFM), Maxwell stress microscope, magnetic force microscopy (MF)
M), new microscopes such as photon scanning tunneling microscopes are being developed. In view of the gist, the scanning probe microscope in the present invention is not limited to a currently known one, but also includes a microscope having an atomic-level resolution that will be developed in the future.

(F) Steps S220 to S250 show typical visualized images when the hybridization products are visualized and measured using the above-mentioned scanning probe microscope (step S105 in FIG. 1).

(F-1) In step S220,
When the sample DNA is GMO, the DNA introduced by genetic recombination is located at the DNA end of GMO, and the DNA
This is the case where the DNA probe hybridizes to the end. D
A single strand complementary to the base pair at the DNA end of the GMO hybridized with the NA probe is released, and the shape of the DNA end is Y
A character-shaped visualized image is obtained.

(F-2) In step S230,
Same as step S220, except that the DNA
This is the case where, when there are several base sequences that do not hybridize with the probe, they complementarily bind. If attention is paid to the shape of the DNA at the end, a visualized image in which the portion where the DNA probe has hybridized is spherical is obtained.

(F-3) In step S240,
When the sample DNA is GMO, the DNA introduced by genetic recombination is located in the middle of the GMO DNA,
This is the case where the DNA probe hybridizes in the middle of NA. GMO DN specifically hybridized with DNA probe
A has a hybridized double-stranded portion and a non-hybridized single-stranded portion. Since this single-stranded portion has a unique globular structure, the shape of the sample DNA hybridized with the DNA probe is a visualized image consisting of a hybridized linear portion and a non-hybridized spherical portion. Is obtained.

(F-4) When the sample DNA is nonGMO, the shapes of the unhybridized single-stranded DNA probe and the unhybridized sample DNA are as follows:
The whole becomes spherical. In step S250, the shapes of the hybridized double-stranded DNA probe and the hybridized sample DNA show a visualized image in which the whole is linear.

As described above, according to the method for testing a genetically modified food according to the first embodiment of the present invention, the DNA
Imaging the specific shape of the molecule generated by hybridization with the probe, and using that information to determine whether GMO DNA having a sequence complementary to the probe is present in the sample It is. Therefore, the genetically modified food inspection method according to the present invention is a highly sensitive inspection method that visualizes each DNA and measures the length and shape, as compared with the conventional inspection method, and has a high accuracy. Inspection method.

An example according to the first embodiment of the present invention will be described below.

Preparation of measurement sample DNA: Genetically modified soybean (GMO soybean) (Round-up ready soybean: manufactured by Monsanto) and non-genetically modified soybean (nonGMO soybean)
Soybean) is crushed with a mortar and pestle, and a suitable buffer solution, for example,
The cells were suspended in 100 mM Tris buffer (pH 8.0), a protein denaturant was added, and DNA was extracted. In this GMO soybean, a 20-mer sequence RR01 (tggcgcccat) was added to the CP4EPSPS region of the herbicide resistance gene.
ggcctgcatg) and a 24-mer sequence RR02 (ccttcgcaa) in the P-E35S region
gacccttcctctata). The extracted DNA can be concentrated or buffer exchanged by adding ethanol or isopropanol. Through such an operation, a measurement sample DNA of 60 ng / ml was obtained.

Preparation of DNA probe: First, the 20-mer sequence RR
PCR is performed using 01 (tggcgcccatggcctgcatg) and the RR02 sequence of the GMO soybean as primers, and using genetically modified soybean DNA as a template. Next, in order to remove primers, enzymes, substrates, etc. contained in the reaction solution after PCR, Amersham Pharmacia's GFX PCR DNA and Gel Band Purification Kit
Perform column chromatography using RR01 and
A gene fragment 509 bp (RR102) in the region flanked by RR02 was obtained.
This DNA was dissolved in a buffer to prepare a DNA probe.

Hybridization: The DNA probe homologous to the GMO thus obtained is hybridized with the above-described DNA for measurement by heating the DNA at 100 ° C. for 10 minutes in a 10 mM Tris buffer (pH 7.6). The strand was sufficiently single-stranded, and then rapidly cooled to 60 ° C. and incubated for 30 minutes to form a duplex. Further, the reaction solution after the incubation was stored at 4 ° C. until analysis. Although any device may be used for these series of steps, commercially available PCR
Temperature controller (programmed thermal controller:
Funakoshi) is convenient.

Preparation of Sample Substrate: Next, magnesium chloride was added to the reaction solution after incubation stored at 4 ° C. so as to have a final concentration of 10 mM, and the resulting sample suspension was cleaned of mica (mica substrate). 50 μl is dropped on the cleavage plane. Then, after standing at room temperature for 5 minutes, the sample was washed with 5 ml of sterilized water and dried with nitrogen gas to obtain a measurement sample.

Visualization / measurement of measurement sample: The measurement sample obtained above is fixed on a sample stage of a scanning probe microscope (Nanoscope IIIa, manufactured by Digital Instruments, USA), and is most suitable for measurement of a soft sample. It was imaged (visualized) in a simple tapping mode. FIG. 3 shows an example of the visualization. The obtained visualized image is shown in step S in FIG.
Since it has the same shape as the hybridization DNA image of 230, it can be seen that the genetically modified DNA is at the end of GMO soybean. If the genetically modified DNA is located at the center of the GMO soybean, the image of step S240 in FIG. 2 is obtained (image with clumps at both ends of the DNA). It becomes a double-stranded DNA image as in S250. Thus, from the visualized image, it can be distinguished from GMO, which region is genetically modified, and non-GMO.

(Second Embodiment) The method for testing a genetically modified food according to the second embodiment of the present invention is compared with the method for testing a genetically modified food according to the first embodiment of the present invention. Then, in place of the DNA probe used in the method for testing a genetically modified food according to the first embodiment of the present invention, using a DNA probe labeled with biotin, binding the magnetic particles via the biotin, The difference is that a hybridization product with magnetic particles is selectively extracted by a magnet.

FIG. 4 is a flowchart showing the details of the method for testing genetically modified food (HVM method) according to the second embodiment of the present invention. Hereinafter, only the differences from the method for testing a genetically modified food according to the first embodiment of the present invention will be described step by step.

(A) First, in step S300,
DNA extraction of a sample to be tested and preparation of a biotinylated DNA probe that hybridizes with a target recombinant gene are performed. The biotinylated DNA probe is obtained by labeling (labeling) biotin at the end of the DNA probe so that the probe can bind to the magnetic particles via biotin. As the magnetic particles, magnetic particles coated with streptavidin (or avidin) that binds to biotin of the biotinylated DNA probe are used.

(B) The mixing of the sample DNA and the biotinylated DNA probe requires that the higher-order structure of the sample DNA and the DNA probe in the mixed sample be eliminated, and that the complementary sequences hybridize. is there. Therefore, the sample DNA and the DNA probe may be mixed before heat denaturation in step S310, or may be mixed after heat denaturation of the sample DNA and DNA probe, respectively. Therefore, in step S310, the DNA probe and the sample DNA
Heat denaturation or exposure to high pH (pH> = 13) breaks the complementary base pair binding the duplex of the DNA probe and the double helix of the sample DNA, and reduces the double helix. Dissociates into main chains.

(C) Next, the temperature of the mixed sample heat-denatured in step S310 is lowered, and its base sequence in the sample DNA is hybridized with the DNA probe (step S103 in FIG. 1).

(D) Subsequently, the mixed sample obtained by the above hybridization is sufficiently mixed with magnetic particles coated with streptavidin (or avidin),
Incubation is performed so that biotin as a biotinylated DNA probe and streptavidin as magnetic particles bind to biotin / avidin.

(E) Only the hybridization products to which the magnetic particles are bound are selectively extracted from the above hybridization products using a magnet.

(F) The extracted hybridization product of magnetic particle binding is immobilized on a substrate for observation with a scanning probe microscope in order to image it with a scanning probe microscope (step S104 in FIG. 1). Anchoring in).

(G) Steps S320 to S350 show typical visualized images when the hybridization products immobilized on the substrate are visualized and measured using a scanning probe microscope (step S10 in FIG. 1).
5).

(G-1) In step S320,
When the sample DNA is GMO, the DNA introduced by genetic recombination is located at the DNA end of GMO, and the DNA
This is the case where a biotinylated DNA probe bound to a magnetic particle is hybridized to the end. Biotinylated DN bound to magnetic particles
A single strand complementary to the base pair at the DNA end of the GMO hybridized with the A probe is released, and step S2 in FIG.
A visualized image is obtained in which the shape of the magnetic particles is further added to the Y-shaped shape of the DNA end in 20.

(G-2) In step S330,
This is the same as step S320, except that when there are several bases at the DNA end of the GMO that do not hybridize with the biotinylated DNA probe bound to the magnetic particles, they complementarily bind to each other. Focusing on the DNA shape at the end, a visualized image is obtained in which the magnetic particle-bound biotinylated DNA probe hybridizes to the spherical shape in step S230 in FIG.

(G-3) In step S340,
When the sample DNA is GMO, the DNA introduced by genetic recombination is located in the middle of the GMO DNA,
This is a case where a biotinylated DNA probe bound to a magnetic particle is hybridized between NAs. GMO DNA specifically hybridized to magnetic particle-bound biotinylated DNA probes
Has a hybridized double-stranded portion and a non-hybridized single-stranded portion. Since the single-stranded portion has a globular structure peculiar to the single-stranded portion, the shape of the sample DNA hybridized with the magnetic particle-bound biotinylated DNA probe is different from that of the linear portion hybridized in step S240 in FIG. A visualized image is obtained in which the shape of the magnetic particles is further added to the shape consisting of the non-hybridized spherical portion.

(G-4) When the sample DNA is nonGMO, the shape of the unhybridized single-stranded biotinylated DNA probe bound to the magnetic particles shows a whole spherical visualized image.

An example according to the second embodiment of the present invention will be described below.

In order to further enhance the sensitivity of the HVM method, as shown in FIG. 4, the end of the DNA probe is labeled with biotin, the magnetic particles are bound, and the hybridization product with the magnetic particles is picked up by a magnet. Was. DNA pro
FIGS. 5 and 6 are schematic diagrams of images visualized by binding the magnetic particles by labeling the ends of the beads with biotin.

According to the above examples, according to the genetically modified food inspection method (HVM method) according to the present invention, there is no need to amplify DNA by PCR. 1) Contamination between samples and the inhibition of PCR inhibitors No confirmation is required.

2) It is also used for processed foods, soy sauce and soybeans that have been decomposed into short pieces, and in principle all GMOs can be tested.

3) The detection limit is equivalent to that of the PCR method, and it is inexpensive.

4) The HVM method has a smaller number of steps and a shorter inspection time than the conventional method.

The above effect was obtained.

[0058]

According to the food inspection method of the present invention, each DNA can be visualized and its length and shape can be measured by utilizing the visualization / measurement technique.

Therefore, according to the food inspection method of the present invention, it is possible to inspect, from raw materials to processed products, microstructures such as whether or not they are genetically modified foods in a short time with high sensitivity. is there.

[Brief description of the drawings]

FIG. 1 is a diagram illustrating the principle of the present invention.

FIG. 2 is a flowchart showing details of a method for testing a recombinant food according to the first embodiment of the present invention.

FIG. 3 is an example in which a GMO is visualized using the recombinant food inspection method according to the first embodiment of the present invention.

FIG. 4 is a flowchart illustrating details of a method for testing a recombinant food according to a second embodiment of the present invention.

FIG. 5 is a schematic view of an image obtained by visualizing a GMO using the method for testing a recombinant food according to the second embodiment of the present invention.

FIG. 6 is a schematic diagram of an image obtained by visualizing a GMO using the method for testing a recombinant food according to the second embodiment of the present invention.

────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] November 20, 2001 (2001.11.
20)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0033

[Correction method] Change

[Correction contents]

Preparation of measurement sample DNA: Genetically modified soybean (GMO soybean) (Round-up ready soybean: manufactured by Monsanto) and non-genetically modified soybean (nonGMO soybean)
Soybean) is crushed with a mortar and pestle, and a suitable buffer solution such as
The cells were suspended in 100 mM Tris buffer (pH 8.0), a protein denaturant was added, and DNA was extracted. Herbicide resistance to this GMO soybean
20-mer sequence RR01 in the CP4EPSPS region of the gene: tggcgcccatg
gcctgcatg (SEQ ID NO: 1) and 24mer sequence in P-E35S region
RR02: Contains ccttcgcaagacccttcctctata (SEQ ID NO: 2)
ing. The extracted DNA can be concentrated or buffer exchanged by adding ethanol or isopropanol. Through such an operation, a measurement sample DNA of 60 ng / ml was obtained.

[Procedure amendment 2]

[Document name to be amended] Statement

[Correction target item name] 0034

[Correction method] Change

[Correction contents]

Preparation of DNA probe: First, the 20-mer sequence RR
01: tggcgcccatggcctgcatg (SEQ ID NO: 1) and GMO
Sequence RR02: ccttcgcaagacccttcctctata (sequence number
No .: 2) is used as primer to mold recombinant soybean DNA.
Perform PCR as a template. Next, to remove primers, enzymes, substrates, etc. contained in the reaction solution after PCR, GFX PCR DNA and Gel Band Purificati of Amersham Pharmacia
Perform column chromatography using on Kit
And a gene fragment 509 bp (RR102) in the region flanked by RR02 was obtained. This DNA was dissolved in a buffer to prepare a DNA probe.

[Procedure amendment 3]

[Document name to be amended] Statement

[Correction target item name] 0059

[Correction method] Change

[Correction contents]

Therefore, according to the food inspection method of the present invention, it is possible to inspect, from raw materials to processed products, microstructures such as whether or not they are genetically modified foods in a short time with high sensitivity. is there.

[Sequence List] SEQUENCE LISTING <110> Research Institute of Biomolecule Metrology <120> A method of detection of food <140> JP P2001-100826 <141> 2001-03-30 <160> 2 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <400> 1 tggcgcccat ggcctgcatg 20 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <400> 2 ccttcgcaag acccttcctc tata 24

 ──────────────────────────────────────────────────続 き Continued on the front page F term (reference) 4B024 AA05 AA11 AA19 CA01 CA09 HA11 HA13 HA14 4B063 QA01 QA13 QA17 QA20 QQ04 QQ09 QQ16 QQ43 QR32 QR35 QR38 QR56 QS12 QS34 QS39 QX01

Claims (2)

[Claims] 1. A step of crushing a sample to be tested, a step of extracting DNA from the crushed sample, and a step of hybridizing the extracted DNA with a probe homologous to a genetically modified product Anchoring a product obtained by the hybridization on a substrate; visualizing the substrate using a scanning probe microscope; determining a microstructure of the sample from shape information of the visualized image. A food inspection method. 2. The step of hybridizing comprises: a step of hybridizing the extracted DNA with a biotinylated probe that is homologous to the genetic recombinant and binds to a magnetic particle; 2. A method according to claim 1, wherein the method comprises the steps of binding particles and extracting a hybridization product with the magnetic particles by a magnet.