JP2002238550A - Microorganism for degrading halogenated hydrocarbon and method for environmental cleanup using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new microorganism capable of degrading halogenated hydrocarbons such as trichloroethylene, to provide an activator for the microorganism, and to provide a method for environmental cleanup using the microorganism and the activator. SOLUTION: The microorganism for degrading halogenated hydrocarbons is the one belonging to Genus Ralstonia such as Ralstonia sp. EFZ4B strain, capable of being activated by cyclohexanone. As the cyclohexanone is low toxic and inexpensive, a practical method for environmental clean up is obtained by using the microorganism.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for purifying an environment contaminated with a halogen-substituted hydrocarbon such as trichloroethylene, a microorganism used for the method, an activator for the microorganism, and a method for selecting the microorganism. .

[0002]

2. Description of the Related Art Halogen-substituted hydrocarbons such as trichloroethylene are frequently used as cleaning solvents in various industrial processes, and are one of the causative substances of environmental pollution, such as soil pollution and wastewater pollution. As a microbiological purification method for such a contaminated environment, a biodegrading method is used in which a microorganism activator is added to the contaminated environment to activate microorganisms naturally existing in the contaminated environment to decompose the contaminant. -In addition to the stimulation method, there is a bioaugmentation method in which a microorganism having the capability of decomposing pollutants is added to a polluted environment to decompose the pollutants.

In this bioaugmentation method, an activator for microorganisms added to the contaminated environment, that is, a substance for promoting the growth of the microorganisms and / or for inducing the decomposability of the contaminants is usually used. Is done. However, depending on the selection of the activator, there is a risk of cross-contamination by the activator itself, and the treatment cost may be increased. Therefore, it is preferable that the microorganism used for the bioaugmentation method be one which is activated by a low-toxic and inexpensive substance and has a high resolution for halogen-substituted hydrocarbons.

As a microorganism for purifying an environment contaminated with a halogen-substituted hydrocarbon, JP-A-10-52259 discloses N16-1 belonging to the genus Burkholderia.
Strain, N15-1 strain and N15-2 strain are described. Japanese Patent Publication No. 11-514532 describes the M07 strain. However, a microorganism belonging to the genus Ralstonia and having the ability to degrade a halogen-substituted hydrocarbon is not known.

[0005]

Accordingly, the present invention provides a novel microorganism which is activated by low-toxic and inexpensive substances and has the ability to degrade halogen-substituted hydrocarbons; A method for purifying an environment contaminated by halogen-substituted hydrocarbons; and a novel method for selecting microorganisms that can be used in this method.

[0006]

As a result of various studies to solve the above-mentioned problems, the present inventors have found that they belong to the genus Ralstonia and have a halogen-substituted hydrocarbon resolution which can be activated by cyclohexanone. The microorganism was isolated and the present invention was completed. Accordingly, the present invention provides a strain FEZ4B (FERM P-18190) belonging to the genus Ralstonia and having the ability to degrade a halogen-substituted hydrocarbon.

The present invention is also characterized in that cyclohexanol or cyclohexanone or both, and a microorganism belonging to the genus Ralstonia and having the ability to degrade a halogen-substituted hydrocarbon are added to an environment contaminated with a halogenated hydrocarbon. The environmental purification method. The invention also relates to Ralstonia (Ralstonia) grown in an environment contaminated with halogen-substituted hydrocarbons in the presence of cyclohexanol and / or cyclohexanone.
The present invention provides an environmental purification method characterized by adding a microorganism belonging to the genus nia) and having the ability to degrade a halogen-substituted hydrocarbon.

The present invention further provides a method for isolating or selecting a halogen-substituted hydrocarbon-degrading bacterium which can be activated by cyclohexanone, comprising the steps of (1) incubating a medium containing a microorganism separation source sample, a halogen-substituted hydrocarbon and cyclohexanol, Selecting a medium in which the added halogen-substituted hydrocarbon is reduced, and (2) culturing the microorganisms present in the medium selected in step 1 in a medium containing the halogen-substituted hydrocarbon and cyclohexanone. And selecting a microorganism having the ability to degrade a halogen-substituted hydrocarbon.

The present invention further provides a method for isolating or selecting a halogen-substituted hydrocarbon-degrading bacterium which can be activated by cyclohexanone. (1) A sample expected to contain the microorganism, a medium containing a halogen-substituted hydrocarbon and cyclohexanone And selecting a medium in which the added halogen-substituted hydrocarbon has been reduced, and (2) isolating a halogen-substituted hydrocarbon-degrading bacterium that can be activated by cyclohexanone from the medium selected in the step (1). And a method comprising:

[0010]

DETAILED DESCRIPTION OF THE INVENTION The halogen-substituted hydrocarbons to be cracked according to the invention are preferably chlorinated hydrocarbons, of which trichloroethylene is of practical importance. The environment to be purified in the present invention is not particularly limited, but soil and drainage are particularly important for practical use.

In the isolation of a microorganism having the ability to degrade a halogen-substituted hydrocarbon, the first step involves, as a first step, a microorganism isolation source sample, cyclohexanol as an activator, and trichloroethylene as a halogen-substituted hydrocarbon. Incubate the medium and select a medium that has reduced trichlorethylene in the medium. The microorganism isolation source sample is not particularly limited, but it is preferable to use various soils or wastewater. As the basal medium for separation,
NH ₄ NO ₃ , (NH ₄ ) ₂ SO ₄ , NaNO ₃ etc. as an inorganic nitrogen source, Na ₂ PO ₄ , KH ₂ PO functioning as a phosphorus source or as a buffer
_4th class metal sources such as CaSO ₄・ 2H ₂ O, MgSO ₄・ 7H ₂ O, FeSO ₄
· 7H ₂ O, etc., it is preferred if it contains yeast extract and the like as organic trophic factors, preferably in order to increase the efficiency of the microorganisms of the selection does not contain carbohydrate-based carbon source such as glucose.

The amount of the separation source sample to be added to the medium is not particularly limited.
It is preferable to mix at a ratio of mL. The concentration of cyclohexanol as an activator in the medium is about 0.1% (V / V), and the concentration of trichlorethylene is preferably about 10 ppm. The above medium mixture is placed in a sealed culture vessel, and shaken at, for example, 30 ° C. for 1 week to 10 days, and the consumption of trichlorethylene is measured. For the measurement of trichlorethylene, for example, the concentration of trichlorethylene in the gas in the incubator may be measured by, for example, gas chromatography.

Next, a medium (ie, an incubator) in which trichlorethylene is reduced during the incubation by shaking is selected. As a second step, the microorganisms in the medium selected in the first step are added to a medium containing cyclohexanone as an activator and trichloroethylene which is a halogen-substituted hydrocarbon, and the same as in the incubation in the first step Perform culture. In this case, the medium composition, the concentration of the activator, the concentration of trichlorethylene,
The conditions for culturing may be the same as those in the first step. Also, the selection of a microorganism that has decomposed trichloroethylene using cyclohexanone as an activator may be performed by measuring the concentration of trichlorethylene in the gas in the incubator by gas chromatography in the same manner as in Step 1 above.

The transition from the first step to the second step may be carried out by adding a part of the medium obtained in the first step to the medium in the second step, but preferably the medium obtained in the first step is used. After isolating the microorganism from the culture medium and then selecting and confirming the trichloroethylene decomposability of this microorganism,
Preferably, the selected microorganism is inoculated into a second stage medium. Isolation of the above microorganisms can be performed, for example, by adding cyclohexanol 0.1% (V / V) to a medium having a composition similar to that of the basal medium used in step 1 and obtaining the solid culture medium solidified in agar in step 1. The culture medium may be appropriately diluted, applied, and incubated at 30 ° C. for 3 to 5 days to collect colonies.

The ability of the microorganism isolated by the above colony separation to degrade trichloroethylene can be assayed in the same manner as in the method in the first step. Further, when the second step is performed by inoculating a part of the medium selected in the first step directly into the medium of the second step, it is necessary to isolate the microorganism from the medium selected in the second step. ,
In this case also, the above-mentioned colony isolation source could be used. In place of the above method, the above-mentioned cycloalkyl is used in any or all of the medium in the first stage, the agar medium for isolation of the microorganism after the first stage, and the medium for assaying the isolated microorganism for trichloroethylene degradation. Cyclohexanone can be used instead of hexanol.

According to the present invention, a microorganism belonging to the genus Ralstonia and having the ability to degrade a halogen-substituted hydrocarbon can be obtained by the above selection method. As a representative example of this microorganism, FEZ4 deposited on January 31, 2001 as FERM P18190 with the National Institute of Bioscience and Human Technology
B strain can be mentioned. The specific isolation method and mycological properties of this strain are specifically described in Examples.
This microorganism, unlike known halogen-substituted hydrocarbon-degrading bacteria, can grow rapidly with cyclohexanone as the sole carbon source and can degrade high concentrations of trichloroethylene at high speed.

The activation of the halogen-substituted hydrocarbon-decomposing bacterium by the activator of the present invention can be carried out in the environment by adding the activator and the microorganism together to the environment such as soil, or Activated cells can be obtained by culturing the microorganism in the presence of an activator, and this can be added to the environment. In the present invention, cyclohexanol or cyclohexanone or a combination of both can be used as the activator. Preferably, cyclohexanone is used alone or in a combination of cyclohexanols, and particularly preferably, cyclohexanone is used alone.

In the mass cultivation of the microorganism of the present invention, a medium having a composition similar to that of the above-mentioned basal medium for selection, to which cyclohexanol and / or cyclohexanone is added as a sole carbon source may be used. . Culture is performed under aerobic conditions by aeration and / or agitation. It is preferable to increase the culture volume stepwise by performing preculture before main culture. The culture temperature is 25 ° C to 35
° C, preferably about 30 ° C. The culturing time is suitably 2 to 3 days.

In the treatment of the contaminated soil, the cells or culture cultured as described above are added together with or without an activator. For example, the soil to be treated may be unraveled and the cells or the cells and the activator may be uniformly mixed. When treating wastewater,
The culture or cultured cells may be added alone or together with the activator to the waste water to be treated, and mixed by aeration and / or stirring.

[0020]

Next, the present invention will be described more specifically with reference to examples. Embodiment 1 FIG . Cyclohexanol assimilating trichloroethylene
As a separate soil of down-degrading bacteria, FEZ (wetlands surface humus), FORE3 (forest soil), GOT (paddy surface soil), KR (Kanto loam), KSM (wetlands surface topsoil), MZH (field surface soil) , NRT (sandy soil), NS
(Sandy soil), OJH (field surface soil), OJK (ogawa mud), RSD
(Field deep soil), RSS (field surface soil), SDD (mountain deep soil), S
Using DS (mountain surface soil), SL (silt soil), WZD (mountain deep clay), WZS (mountain surface soil), and YMH (field surface soil), 10 g of soil wet weight, inorganic salt M medium ( Composition: 1
Per liter, NH ₄ NO ₃ : 3.0g, Na ₂ HPO ₄ : 2.2g, KH ₂ P
_{O 4: 0.8g, FeSO 4 ·} 7H 2 O: 10.0mg, CaSO 4 · 2H 2 O: 10.0
_{mg, MgSO 4 · 7H 2 O} : 10.0mg, Yeast Extract: 50mg) and 2
0 ml, shake well, and add 4 ml of the suspension to 20 ml
Dispensed into vials of capacity.

To this vial, 0.1% (V / V) of a test sample and 10 ppm of trichloroethylene were added, and the vial was sealed.
Shaking culture was performed at 30 ° C. for 1 week. After the culture, the residual trichlorethylene in the gas phase was measured by gas chromatography. The activity was measured in triplicate using a soil suspension prepared similarly. The soil suspension in which trichlorethylene decomposition activity was confirmed was appropriately diluted with M medium, and applied to an M medium agar plate containing 0.1% (V / V) cyclohexanol.
After culturing at 30 ° C. for 3 to 5 days, the grown colonies were picked and applied to the same medium. The resolution was evaluated using the grown cells.

The resolution test was performed as follows. Take one loopful of cells grown on the above medium, inoculate 4 ml of M medium into a 20 ml vial as described above, add cyclohexanol 0.1% (V / V) and 10 ppm of trichloroethylene. Then, the cells were sealed and cultured with shaking at 30 ° C. for 1 week. After the culture, the residual trichlorethylene in the gas phase was measured by gas chromatography. Activity measurement must be at least 3
It was done in ream. As a result, the strains showing the activity were applied to an agar plate of a nutrient medium (Difco, LB broth), subjected to pure separation, confirmed again for degradative activity, and stored on the plate until used for the experiment. As a result, the separation source RD
Strain RSD5 was isolated from S, strain YMH6A and YMH6C from YMH, and strain FEZ4B from FEZ.

Embodiment 2 FIG. Liquid in the presence of cyclohexanone
Decomposition of trichlorethylene in the body 20 ml of M medium and 0.1% (v / v) of cyclohexanol were added to a tube having a volume of 50 ml. Shake for 3 days to perform preculture. The grown pre-culture solution is centrifuged to collect the cells, and an equal amount of phosphate buffer (10 mM
Wash with KH ₂ PO ₄ -NaOH pH7.0) and add OD to phosphate buffer
_{Resuspended to 600} = 0.1.

3 ml of the suspension, 0.1% of cyclohexanone (V / V), and a final trichloroethylene concentration of 10 ppm were added to a 20-ml vial, followed by shaking culture at 30 ° C. for one week. After the culture, the residual trichlorethylene in the gas phase was measured by gas chromatography. The measurement of the activity was performed in triplicate using the cell suspension similarly prepared.
As a result, all strains showed good growth, but FE
Only the Z4B strain showed significant trichlorethylene degradation activity using cyclohexanone as an activator (FIG. 1).

Embodiment 3 FIG. Cyclohexanol assimilating TC
The morphological, physiological and biochemical properties of the FEZ4B strain selected in Example 2 were examined.
The result as shown in FIG.

[0026]

[Table 1]

The 16S rRNA gene sequence of the microorganism of the present invention was determined. 16S rRNA of this microorganism determined
FIG. 2 shows the nucleotide sequence of the gene. The obtained nucleotide sequence was compared with the sequence of a known microorganism (FIGS. 3 and 4), and a phylogenetic tree was created by the NJ (proximity junction) method. 98% homology between Ralstoniabasilensis and Ralstonia
eutropha and 96%.

References of the reference strain of Ralstonia eutropha
(JG Holt, NR Krieg, PHASenath, JT Staley
and ST Williams, "Bergey's Manual of Determinat
iveBacteriology "Ninth edition (1994) Williams and
Comparing the physiological and biochemical properties of Wilkins) described, since it is part showing a clearly different nature (Table 2), it is determined not to be the same type, the microorganism is classified as Ralstonia genus, Ralstonia Sp.FEZ4B The strain was identified. Also,
This microorganism did not match any known pathogenic microorganism, and was confirmed to be a safe microorganism.

[0029]

[Table 2]

Embodiment 4 FIG. Cyclohexanol or cyclo
Trichlorethylene content in liquids in the presence of hexanone.
LB medium was added 20ml in the tube of the solution 50ml volume, colonies were picked loopful of strains grown in M medium plate containing cyclohexanol as the sole carbon source, 30 ° C.
For 1 day to perform preculture. The grown preculture was collected by centrifugation to collect the cells, washed with an equal amount of the M medium and resuspended in the M medium to a concentration of 10 ⁸ cfu / ml.

In a 20 ml vial, 3 ml of the suspension, cyclohexanol 0.1% (V / V) or cyclohexanone 0.
1% (V / V) and final trichlorethylene concentration 10pp each
m, 30 ppm, or 50 ppm.
C., shaking culture for 1 or 3 days. After the culture, the residual trichlorethylene in the gas phase was measured by gas chromatography. The measurement of the activity was performed in triplicate using the cell suspension similarly prepared. As a result, when cyclohexanol was added, 10 ⁸ cfu / ml was added, and after 3 days of reaction, 10 ppm TCE
Was decomposed by 40% (FIG. 5). In the case of adding cyclohexanone, 10 ⁸ cfu / ml was added, and after 3 days, 10 ppm TCE
%, 30 ppm TCE was degraded by 50% (FIG. 6).

Embodiment 5 FIG. Cultured in cyclohexanol
Decomposition of Trichlorethylene in Liquid Using Microorganisms 20 ml of M medium and 0.1% (V / V) of cyclohexanol were added to a 50-ml tube, and FEZ4B strain grown on an M medium plate containing cyclohexanol as the sole carbon source One platinum loop of colony 1 was picked, shaken at 30 ° C. for 1 day, and precultured. In a 500 ml Erlenmeyer flask, add 170 ml of M medium
, 0.1% (V / V) of cyclohexanol, 1% of the grown preculture was inoculated, and shaking culture was performed at 30 ° C. Samples were taken over time, diluted appropriately, and the bacterial cell concentration was measured as an absorbance (OD ₆₀₀ ) at an absorption wavelength of 600 nm using a spectrophotometer.

The activity was measured as follows. The cells were sampled over time, and the cells were collected from the cell suspension by centrifugation. The phosphate buffer (10 mM KH ₂
Wash with PO ₄ -NaOH pH7.0) and add OD ₆₀₀ =
Resuspended to 0.1. 3 ml suspension and 20 pp final trichlorethylene concentration in a 20 ml vial
m, and cultured with shaking at 30 ° C. for 24 hours.
After the culture, the residual trichlorethylene in the gas phase was measured by gas chromatography. The measurement of the activity was performed in triplicate using the cell suspension similarly prepared. As a result, the stationary phase was reached in 30 hours. Degradation activity of about 30% was observed in the late logarithmic phase after 24 hours of culture.

Embodiment 6 FIG. Bacteria cultured in cyclohexanone
Decomposition of Trichlorethylene in Liquid Using Liquid Body 20 ml of M medium and 0.1% (V / V) of cyclohexanone were added to a 50-ml tube, and a colony of platinum 1 of FEZ4B strain grown on an M medium plate containing cyclohexanone as a sole carbon source Ears were picked, shaken at 30 ° C. for 1 day, and precultured. In a 500 ml Erlenmeyer flask, 170 ml of M medium,
0.1% (V / V) of cyclohexanone was added, and 1% of the grown preculture was inoculated and shake-cultured at 30 ° C. Samples were taken over time, diluted appropriately, and the bacterial cell concentration was measured as an absorbance (OD ₆₀₀ ) at an absorption wavelength of 600 nm using a spectrophotometer.

The activity was measured as follows. Sampling was performed over time, the cells were collected from the cell suspension by centrifugation, and a phosphate buffer (10 mM KH ₂
Wash with PO ₄ -NaOH pH 7.0) and add OD ₆₀₀ =
Resuspended to 0.1. 3 ml of the suspension and a final trichlorethylene concentration of 30 pp in a 20 ml vial
m, and cultured with shaking at 30 ° C. for 24 hours.
After the culture, the residual trichlorethylene in the gas phase was measured by gas chromatography. The activity was measured in triplicate using the cell suspension similarly prepared. As a result, the stationary phase was reached in 24 hours. At this time, the cell turbidity was OD ₆₀₀ = 4.5
And showed very good growth. 25 hours after culture for 26 hours
% Decomposition activity was observed.

[0036]

[Sequence List] <110> Toyota Jidosha Kabushiki Kaisha <120> Microganism which decomposes halogenated hydrocanbons and environmental cleaning method using the same <130> 994363 <160> 3 <210> 1 <211> 305 <212> DNA <213> Ralstonia sp. <223> Nucleotide sequence of 16SrRHA gene of Ralstonia sp. <400> 1 gaccgtaagg cctcgcgcga taggagcggc cgatgtctga ttagctagtt ggtggggtaa 60 aggcccacca aggcgacgat cagtagctgg tctgagagga cgatcagcca cactgggact 120 gagacacggc ccagactcnt acgggaggca gcagtgggga attttggaca atgggggcaa 180 ccctgatcca gcaatgccgc gtgtgtgaag aaggccttcg ggttgtaaag cacttttgtc 240 cggaaagaaa tcccctgctc taatacagcg gggggatgac ggtaccggaa gaataagcac 300 cggct 305

<210> 2 <211> 298 <212> DNA <213> Ralstonia basilensis <223> Nucleotide sequence of S16rRHA gene of Ralstonia basilensis <400> ccagactcct acgggaggca gcagtgggga attttggaca atgggggcaa 180 ccctgatcca gcaatgccgc ttgtgtgaag aaggccttcg ggttgtaaag cacttttgtc 240 cggaaagaaa tcccttgccc taatacggcg gggggatgacggtag 298

<210> 3 <211> 305 <212> DNA <213> Ralstonia eutropha <223> Nucleotide sequence of 16SrRNA of Ralstonia eutropha <400> 3 gaccgtaagg cctcgcgcaa taggagcggccgatgtctga ttagcgg gaggggcccag taggtgcgag cagat caggcgcccatc gagggccacact 120 acgggaggca gcagtgggga attttggaca atgggggcaa 180 ccctgatcca gcaatgccgc gtgtgtgaag aaggccttcg ggttgtaaag cacttttgtc 240 cggaaagaaa tggctctggc taatacctgg ggtcgatgac ggtaccggaa gaataagcac 300

[Brief description of the drawings]

FIG. 1 is a graph showing the resolution of trichloroethane by various strains activated by cyclohexanone. The M07 strain is a known strain, and the others are isolated in the present invention.

FIG. 2 is a diagram showing the nucleotide sequence of the 16SrRHA gene of the FEZ4B strain of the present invention.

FIG. 3 shows the nucleotide sequence of the 16SrRHA gene of the FEZ4B strain of the present invention and the relative bacterium Ralstonia basilensis (Rals).
FIG. 3 is a diagram comparing the nucleotide sequences of 16S rRNA genes of C. tonia basilensis) . Identities = 293/298 (98%); Positives = 2
93/298 (98%).

FIG. 4 shows the nucleotide sequence of the 16SrRHA gene of the FEZ4B strain of the present invention and the relative fungus Ralstonia eutropa.
1 is a diagram comparing the nucleotide sequences of the 16SrRHA gene of S. nia eutropha) . Identities = 294/306 (96%); Positives = 294/306
(96%); Gaps = 2/306 (0%).

FIG. 5 is a graph showing the degradation rate when the FEZ4B strain of the present invention was cultured in the presence of cyclohexanol to degrade trichlorethylene.

FIG. 6 is a graph showing the degradation rate when the FEZ4B strain of the present invention was cultured in the presence of cyclohexanone to decompose trichlorethylene.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI theme coat ゛ (Reference) C02F 3/34 C12N 1/02 C12N 1/20 (C12N 1/20 // (C12N 1/20 C12R 1: 01) C12R 1:01) (C12N 1/02 (C12N 1/02 C12R 1:01) C12R 1:01) B09B 3/00 ZABE F term (reference) 2E191 BA15 BB01 BD20 4B065 AA01X AC12 AC20 BA23 BB01 BB03 BB06 BC03 BC26 CA56 4D004 AA41 AB06 CA18 CC07 4D040 DD01 DD11

Claims (10)

[Claims] 1. A strain FEZ4B (FERM P-1 ) belonging to the genus Ralstonia and having the ability to degrade halogen-substituted hydrocarbons.
8190). 2. A method comprising adding cyclohexanol or cyclohexanone or both thereof and a microorganism belonging to the genus Ralstonia and having the ability to degrade a halogen-substituted hydrocarbon to an environment contaminated with the halogen-substituted hydrocarbon, Environmental purification method. 3. Ralstonia (Ra) grown in an environment contaminated with halogen-substituted hydrocarbons in the presence of cyclohexanol and / or cyclohexanone.
lstonia), which comprises adding a microorganism having the ability to degrade a halogen-substituted hydrocarbon. 4. The method according to claim 2, wherein the halogen-substituted hydrocarbon is trichloroethylene. 5. An activator for halogen-substituted hydrocarbon-decomposing bacteria comprising cyclohexanone as an active ingredient. 6. The activator according to claim 5, wherein the halogen-substituted hydrocarbon-degrading bacterium is a microorganism belonging to the genus Ralstonia. 7. The activator according to claim 5, wherein the halogen-substituted hydrocarbon is trichloroethylene. 8. A method for isolating or selecting a halogen-substituted hydrocarbon-degrading bacterium that can be activated by cyclohexanone, comprising the steps of: (1) incubating a medium containing a microorganism separation source sample, a halogen-substituted hydrocarbon, and cyclohexanol; Selecting a medium in which the halogen-substituted hydrocarbon is reduced, and (2) culturing the microorganisms present in the medium selected in the step 1 in a medium containing the halogen-substituted hydrocarbon and cyclohexanone; A step of selecting a microorganism having a halogen-substituted hydrocarbon resolution,
A method comprising: 9. A method for isolating or selecting a halogen-substituted hydrocarbon-degrading bacterium which can be activated by cyclohexanone, comprising: (1) incubating a sample expected to contain the microorganism, a medium containing a halogen-substituted hydrocarbon and cyclohexanone; Selecting a medium in which the added halogen-substituted hydrocarbon has been reduced, and (2) isolating a halogen-substituted hydrocarbon-degrading bacterium that can be activated by cyclohexanone from the medium selected in step (1). Comprising a method. 10. The method according to claim 8, wherein the halogen-substituted hydrocarbon is trichloroethylene.