JP2002233377A - New protein and its dna - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new protein having an organic anion transport activity and a DNA capable of encoding the protein, to provide a method for screening a compound capable of promoting or inhibiting the activity of the protein and to provide the compound obtained by the screening method. SOLUTION: This protein has the same or substantially same amino acid sequence as a specific amino acid sequence derived from a human. The protein is useful as a diagnostic marker, etc., for renal disease or liver disease and the compound capable of promoting or inhibiting the activity of the protein available by the method for screening using the protein can be used as a prophylactic or a therapeutic agent for diseases, e.g. the renal disease or liver disease.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a novel organic anion transporter (OAT) protein, a DNA encoding the protein, a method for screening a compound that promotes or inhibits the activity of the protein, and a compound obtained by the screening method. And so on.

[0002]

2. Description of the Related Art Organic anions are contained in many drugs and xenobiotics, and many of them are harmful to living organisms. Most of the lipophilic compounds inside and outside the living body are conjugated with sulfuric acid or glucuronic acid to become organic anions. These harmful organic anion compounds are processed in the kidney and liver and excreted from the living body. The organic anion transporter (OAT) plays a central role in transporting this organic anion. To date, four isoforms of OAT1, OAT2, OAT3, and OAT4 have been identified.

[0003]

The organic anion transporter is expressed not only in the kidney, liver and placenta but also in the blood-brain barrier, and is thought to play an important role in the elimination and selective transport of harmful substances. However, the detailed mechanism is not well understood. Drug efflux transporters also work at the blood-brain barrier, but elucidating the role of these transporters will lead to the development of therapeutics for various diseases.

[0004]

Means for Solving the Problems The present inventors have conducted intensive studies to solve the above-mentioned problems, and as a result, have found an organic anion transporter protein (human OAT homolog). The human OAT homolog is OA
It exhibits 41% homology with T4 in part and can function as an organic anion transporter. As a method for suppressing the OAT homolog, for example, it is conceivable to inhibit the transport of an organic anion or to suppress the transcription of the OAT homolog to reduce the expression level. As a method of activating the OAT homolog, for example, it is considered that the expression level is enhanced by promoting the transport of organic anions, activating the promoter of the OAT homolog, or stabilizing mRNA. The present inventors have further studied based on these findings, and as a result, have completed the present invention.

That is, the present invention relates to (1) SEQ ID NO: 1.
A protein or a salt thereof containing the same or substantially the same amino acid sequence as the amino acid sequence represented by
(2) a partial peptide of the protein of (1) or a salt thereof; (3) a DNA encoding the protein of (1) or the partial peptide of (2)
(4) a DNA according to the above (3) having a base sequence represented by SEQ ID NO: 2, (5) a recombinant vector containing the DNA according to the above (4),
(6) A transformant transformed with the recombinant vector according to the above (5), (7) A transformant described in the above (6) is cultured, and the protein according to the above (1) or the above ( (2) a method for producing the protein according to the above (1), the partial peptide according to the above (2) or a salt thereof, wherein the partial peptide according to the above (2) is produced, accumulated, and collected. A pharmaceutical comprising the protein according to the above (1) or the partial peptide according to the above (2) or a salt thereof; (9) a pharmaceutical comprising the DNA according to the above (3); (1) An antibody against the protein described in (1) or the partial peptide described in (2) or a salt thereof, (11) Use of the protein described in (1) or the partial peptide described in (2) or a salt thereof To A method for screening a compound or a salt thereof that promotes or inhibits the activity of the protein according to the above (1) or the partial peptide or the salt thereof according to the above (2), and (12) the method according to the above (1). A compound that promotes or inhibits the activity of the protein of (1) or the partial peptide of (2) or a salt thereof, comprising the protein or the partial peptide of (2) or a salt thereof; (13) The protein according to (1) or (2) above, which is obtained using the screening kit for a salt thereof, (13) the screening method according to (11) or the screening kit according to (12). A compound or a salt thereof, which promotes or inhibits the activity of the partial peptide or a salt thereof according to the above (14); Or a compound that promotes or inhibits the activity of the protein of (1) or the partial peptide of (2) or a salt thereof obtained by using the screening method of (1) or the screening kit of (12). (15) The medicament comprising a salt, (15) the medicament according to the above (8) or (9), which is a prophylactic / therapeutic agent for kidney disease and liver disease, (1)
6) The above (1) which is a prophylactic / therapeutic agent for kidney disease and liver disease
4) The drug described in the item is provided.

[0006]

BEST MODE FOR CARRYING OUT THE INVENTION SEQ ID NO: 1 used in the present invention
A protein containing the same or substantially the same amino acid sequence as the amino acid sequence represented by (hereinafter, sometimes referred to as the protein of the present invention or the protein used in the present invention) is a human or a warm-blooded animal (for example, Cells of guinea pigs, rats, mice, chickens, rabbits, pigs, sheep, cows, monkeys, etc. (eg, hepatocytes, spleen cells, nerve cells, glial cells, pancreatic β cells, bone marrow cells, mesangial cells, Langerhans cells, epidermis) Cell, epithelial cell, goblet cell, endothelial cell, smooth muscle cell, fibroblast, fiber cell, muscle cell, adipocyte, immune cell (eg, macrophage, T cell, B cell, natural killer cell, mast cell, neutrophil Spheres, basophils, eosinophils, monocytes), megakaryocytes, synovial cells, chondrocytes, osteocytes, osteoblasts, osteoclasts, breast cells, hepatocytes or stroma Vesicles, or precursor cells of these cells, stem cells or cancer cells) or any tissue in which these cells are present, such as the brain, various parts of the brain (eg, olfactory bulb, amygdala, basal sphere, hippocampus, thalamus, thalamus) Lower, cerebral cortex, medulla, cerebellum), spinal cord, pituitary, stomach, pancreas, kidney, liver, gonads, thyroid, gall bladder, bone marrow, adrenal gland, skin, muscle, lung, digestive tract (eg, large intestine, small intestine), blood vessels Or a protein derived from the heart, thymus, spleen, submandibular gland, peripheral blood, prostate, testis, ovary, placenta, uterus, bone, joint, skeletal muscle, or the like, or may be a synthetic protein.

[0007] The amino acid sequence substantially identical to the amino acid sequence represented by SEQ ID NO: 1 is about 50% or more, preferably about 6%, of the amino acid sequence represented by SEQ ID NO: 1.
Amino acid sequences having 0% or more, more preferably about 70% or more, particularly preferably about 80% or more, and most preferably about 90% or more homology are exemplified. SEQ ID NO: 1
As a protein containing an amino acid sequence substantially identical to the amino acid sequence represented by, for example, a protein containing an amino acid sequence substantially identical to the amino acid sequence represented by the aforementioned SEQ ID NO: 1; A protein having substantially the same activity as the protein having the amino acid sequence represented by 1 is preferred. As substantially the same activity,
For example, organic anion transport activity and the like can be mentioned. Substantially homogenous indicates that the properties are homogenous (eg, physiologically or pharmacologically). Therefore, the transport activity of organic anions is equivalent (eg, about 0.0
(1 to 100-fold, preferably about 0.1 to 10-fold, more preferably 0.5 to 2-fold). However, the quantitative factors such as the degree of activity and the molecular weight of the protein are different. Is also good. The activities such as transport activity of the organic anion, can be carried out according to known methods, e.g., J Biol Chem 275:.. . 4507-4512, measured according to the method or methods analogous thereto described in 2000 be able to.

The protein used in the present invention includes, for example, one or more (preferably about 1 to 30) amino acids in the amino acid sequence represented by SEQ ID NO: 1.
Preferably about 1 to 10, more preferably a number (1 to
5) amino acids, the amino acid sequence represented by SEQ ID NO: 1 or 1 or more (preferably about 1 to 30, preferably about 1 to 10, more preferably An amino acid sequence to which a number (1 to 5) of amino acids are added, 1 or 2 or more (preferably about 1 to 30, preferably about 1 to 10) to the amino acid sequence represented by SEQ ID NO: 1, More preferably, an amino acid sequence in which several (1 to 5) amino acids have been inserted,
1 or 2 in the amino acid sequence represented by SEQ ID NO: 1
Or more (preferably about 1 to 30, preferably 1 to 30)
A so-called mutein such as a protein containing an amino acid sequence in which about 10 amino acids are substituted, and more preferably about 1 to 5 amino acids, or an amino acid sequence obtained by combining them is also included. When the amino acid sequence is inserted, deleted or substituted as described above,
The position of the insertion, deletion or substitution is not particularly limited.

The protein in the present specification is a peptide
The left end is the N-terminus (amino terminus) and the right end is according to the convention
Is the C-terminus (carboxyl terminus). SEQ ID NO: 1
Including proteins containing the amino acid sequence represented
The protein used in the present invention has a C-terminal
Ordinary carboxyl group (-COOH) or carboxyl
G (-COO^-), But the C-terminal is an amide (—CONH
_Two) Or an ester (—COOR). This
Here, R in the ester includes, for example, methyl,
Butyl, n-propyl, isopropyl, n-butyl, etc.
C_1-6Alkyl groups such as cyclopentyl, cyclohexyl
C such as kishiru_3-8Cycloalkyl groups such as phenyl
And C such as α-naphthyl_6-12Aryl groups, e.g.
Phenyl-C such as benzyl and phenethyl_1-2Alkyl group
Or α-naphthyl-C such as α-naphthylmethyl
_1-2C such as an alkyl group_7-14Aralkyl group, pivaloyl
An oxymethyl group is used. Used in the present invention
If the protein has a carboxyl group (or
Carboxyl group).
Those that are imidized or esterified are also used in the present invention.
Included in the protein to be obtained. In this case, the ester
For example, the above-mentioned C-terminal ester or the like is used
You. Further, the proteins used in the present invention include N-terminal.
The amino group at the terminal amino acid residue (eg, methionine residue)
Protecting groups (for example, C such as formyl group and acetyl group) _1-6
C such as alkanoyl_1-6Protected by an acyl group, etc.)
N-terminal gluta produced by cleavage in vivo
Pyroglutamine oxidized min residue, amino acid in the molecule
Substituents on the side chain of the acid (e.g., -OH, -SH, amino
Group, imidazole group, indole group, guanidino group
Are suitable protecting groups (eg, formyl group, acetyl group)
Such as C_1-6C such as alkanoyl group_1-6Acyl group, etc.)
Protected with sugar chains or sugar chains
Complex proteins such as glycoproteins.
Specific examples of the protein used in the present invention include, for example,
For example, a human containing the amino acid sequence represented by SEQ ID NO: 1
And liver-derived proteins.

[0010] The partial peptide of the protein used in the present invention is a partial peptide of the protein used in the present invention described above, and preferably has the same properties as the protein used in the present invention described above. Any one may be used. For example, at least 20 of the constituent amino acid sequences of the protein used in the present invention.
Or more, preferably 50 or more, more preferably 70
Peptides having an amino acid sequence of at least 100, more preferably at least 100, most preferably at least 200 are used. Further, the partial peptide used in the present invention is:
1 or 2 or more (preferably,
About 1 to 10, more preferably number (1 to 5) amino acids are deleted, or 1 or 2 or more (preferably about 1 to 20, more preferably 1 to 2) About 10, more preferably number (1 to 5)
Amino acids) or 1 or 2 or more (preferably about 1 to 20, more preferably about 1 to 10, more preferably about 1 to 2 amino acids) in the amino acid sequence.
5) amino acids, or one or more (preferably about 1 to 10, more preferably several, and still more preferably about 1 to 5) amino acids in the amino acid sequence. It may be substituted with another amino acid. The partial peptide of the present invention is preferably, for example, the amino acid sequence at positions 176 to 201 and 471 to 491 in the amino acid sequence represented by SEQ ID NO: 1.

The partial peptide used in the present invention usually has a carboxyl group (—COOH) or a carboxylate (—COO ⁻ ) at the C-terminus. (-
CONH ₂ ) or an ester (—COOR). Further, the partial peptide used in the present invention includes
Similar to the protein used in the present invention described above, those having a carboxyl group (or carboxylate) other than the C-terminus, and the amino group of the N-terminal amino acid residue (eg, methionine residue) is a protecting group. Protected, N
Glutamine residue generated by cleavage at the end in vivo is pyroglutamine-oxidized, substituent on the side chain of amino acid in the molecule is protected by an appropriate protecting group, or so-called sugar to which sugar chain is bonded Complex peptides such as peptides are also included. The partial peptide used in the present invention can also be used as an antigen for producing an antibody. For example, to prepare the antibody of the present invention described below, for example, the amino acid sequence represented by SEQ ID NO:
Peptides having the amino acid sequence at positions 417-500 and 500-649.

The salt of the protein or partial peptide used in the present invention may be a physiologically acceptable acid (eg,
Salts with inorganic acids, organic acids) and bases (eg, alkali metal salts) are used, and physiologically acceptable acid addition salts are particularly preferable. Examples of such salts include salts with inorganic acids (eg, hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid),
Alternatively, organic acids (eg, acetic acid, formic acid, propionic acid,
Fumaric acid, maleic acid, succinic acid, tartaric acid, citric acid,
For example, salts with malic acid, oxalic acid, benzoic acid, methanesulfonic acid, and benzenesulfonic acid) are used. The protein or its partial peptide or a salt thereof used in the present invention can be produced from the above-mentioned method for purifying a protein from human or warm-blooded animal cells or tissues. It can also be produced by culturing the transformant.
Further, it can be produced according to the peptide synthesis method described later. When producing from human or mammalian tissues or cells, the homogenized human or mammalian tissues or cells are extracted with an acid or the like, and the extract is subjected to chromatography such as reverse phase chromatography or ion exchange chromatography. Can be purified and isolated.

For the synthesis of the protein or partial peptide or a salt thereof or an amide thereof used in the present invention, a commercially available resin for protein synthesis can be usually used. Such resins include, for example, chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin,
PAM resin, 4-hydroxymethylmethylphenylacetamidomethyl resin, polyacrylamide resin, 4-
(2 ′, 4′-dimethoxyphenyl-hydroxymethyl) phenoxy resin, 4- (2 ′, 4′-dimethoxyphenyl-Fmocaminoethyl) phenoxy resin, and the like. Using such a resin, an amino acid having an α-amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the target protein according to various known condensation methods. At the end of the reaction, the protein or partial peptide is cleaved from the resin, and at the same time, various protecting groups are removed.In addition, an intramolecular disulfide bond formation reaction is performed in a highly diluted solution to obtain the target protein or partial peptide or an amide thereof. I do. For the condensation of the above protected amino acids, various activating reagents that can be used for protein synthesis can be used, and carbodiimides are particularly preferable. As the carbodiimides, DCC, N, N′-diisopropylcarbodiimide, N-ethyl-N ′-(3-dimethylaminoprolyl) carbodiimide and the like are used. Activation by these includes racemization inhibiting additives (eg, HOBt,
HOOBt) or directly add protected amino acids to the resin or symmetrical anhydrides or HOBt esters or HOOBt
The ester can be added to the resin after activation of the protected amino acid in advance as an ester.

The solvent used for activating the protected amino acid or condensing with the resin can be appropriately selected from solvents known to be usable for the protein condensation reaction. For example, acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol,
Sulfoxides such as dimethyl sulfoxide, ethers such as pyridine, dioxane, and tetrahydrofuran; nitriles such as acetonitrile and propionitrile; esters such as methyl acetate and ethyl acetate; and an appropriate mixture thereof are used. The reaction temperature is appropriately selected from a range known to be usable for a protein bond formation reaction, and is usually appropriately selected from a range of about -20 ° C to 50 ° C. The activated amino acid derivative is usually used in a 1.5 to 4-fold excess. As a result of the test using the ninhydrin reaction, when the condensation is insufficient, sufficient condensation can be carried out by repeating the condensation reaction without removing the protecting group. When a sufficient condensation cannot be obtained by repeating the reaction, the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole so as not to affect the subsequent reaction.

Examples of the protecting group for the amino group of the starting material include Z, Boc, t-pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, Trifluoroacetyl, phthaloyl, formyl, 2
-Nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc and the like are used. The carboxyl group is
For example, alkyl esterification (eg, methyl, ethyl, propyl, butyl, t-butyl, cyclopentyl,
Cyclohexyl, cycloheptyl, cyclooctyl, 2
Linear, branched or cyclic alkyl esterification such as adamantyl), aralkyl esterification (eg, benzyl ester, 4-nitrobenzyl ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester, benzhydryl esterification) , Phenacyl esterification, benzyloxycarbonyl hydrazide, t-butoxycarbonyl hydrazide, trityl hydrazide and the like. The hydroxyl group of serine is
For example, it can be protected by esterification or etherification. Examples of groups suitable for the esterification include lower (C _1-6 ) alkanoyl groups such as acetyl group, aroyl groups such as benzoyl group, and groups derived from carbonic acid such as benzyloxycarbonyl group and ethoxycarbonyl group. Used. Examples of the group suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a t-butyl group. Examples of the protecting group for the phenolic hydroxyl group of tyrosine include, for example, Bzl, Cl ₂ -Bzl,
Nitrobenzyl, Br-Z, t-butyl and the like are used.
As a protecting group for imidazole of histidine, for example,
Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc
Are used.

Examples of the activated carboxyl group of the raw material include, for example, a corresponding acid anhydride, azide, active ester [alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4- Dinitrophenol, cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, and esters with HOBt). As the activated amino group of the raw material, for example, a corresponding phosphoric amide is used. As a method for removing (eliminating) the protecting group, for example, catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon,
Also, acid treatment with anhydrous hydrogen fluoride, methanesulfonic acid, trifluoromethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., and reduction with sodium in liquid ammonia Also used. The elimination reaction by the acid treatment is generally performed at a temperature of about -20 ° C to 40 ° C.
In the acid treatment, for example, anisole, phenol,
It is effective to add a cation scavenger such as thioanisole, metacresol, paracresol, dimethylsulfide, 1,4-butanedithiol, 1,2-ethanedithiol and the like. In addition, the 2,4-dinitrophenyl group used as the imidazole protecting group of histidine is removed by thiophenol treatment, and the formyl group used as the indole protecting group of tryptophan is 1,2-ethanedithiol, 1,4-butane described above. In addition to deprotection by acid treatment in the presence of dithiol or the like, it is also removed by alkali treatment with dilute sodium hydroxide solution, dilute ammonia or the like.

The protection of the functional group which should not be involved in the reaction of the raw materials, the protecting group, the elimination of the protective group, the activation of the functional group involved in the reaction, and the like can be appropriately selected from known groups or known means. . As another method for obtaining an amide form of a protein or partial peptide, for example, first, after amidating and protecting the α-carboxyl group of the carboxy terminal amino acid, a peptide (protein) chain is added to the amino group side to a desired chain length. After the elongation, a protein or partial peptide from which only the protecting group for the N-terminal α-amino group of the peptide chain has been removed, and a protein or partial peptide from which only the protecting group for the C-terminal carboxyl group has been removed, are produced. The protein or peptide is condensed in a mixed solvent as described above. Details of the condensation reaction are the same as described above. After purifying the protected protein or peptide obtained by the condensation, all the protecting groups are removed by the above-mentioned method to obtain a desired crude protein or peptide. This crude protein or peptide is purified by various known purification means, and the main fraction is lyophilized to obtain an amide of the desired protein or peptide. To obtain an ester of a protein or peptide, for example, α-
After condensing the carboxyl group with a desired alcohol to form an amino acid ester, the desired protein or peptide ester can be obtained in the same manner as the protein or peptide amide.

The partial peptide used in the present invention or a salt thereof can be produced according to a known peptide synthesis method or by cleaving the protein used in the present invention with an appropriate peptidase. As a method for synthesizing a peptide, for example, any of a solid phase synthesis method and a liquid phase synthesis method may be used. That is, the target peptide can be produced by condensing a partial peptide or amino acid capable of constituting the partial peptide used in the present invention with the remaining portion, and removing the protecting group when the product has a protecting group. it can. Known methods for condensation and elimination of protecting groups include, for example, the methods described in (1) to (4) below. M. Bodanszky and MA Ondetti, Peptide Synthesis, Interscience Publisher
s, New York (1966) Schroeder and Luebke, The Peptid
e), Academic Press, NewYork (1965) Nobuo Izumiya et al., Fundamentals and experiments of peptide synthesis, Maruzen Co., Ltd.
(1975) Haruaki Yajima and Shunpei Sakakibara, Laboratory of Biochemistry 1, Protein Chemistry IV, 205, (1977) Supervised by Haruaki Yajima, Development of Continuing Pharmaceuticals, Vol. 14, Peptide Synthesis, Hirokawa Shoten Thereafter, the partial peptide used in the present invention can be purified and isolated by a combination of ordinary purification methods such as solvent extraction, distillation, column chromatography, liquid chromatography, and recrystallization. When the partial peptide obtained by the above method is a free form, it can be converted to an appropriate salt by a known method or a method analogous thereto, and conversely, when the partial peptide is obtained as a salt, a known method or analogous method It can be converted into a free form or another salt by a method.

The DNA encoding the protein used in the present invention may be any DNA containing the above-described nucleotide sequence encoding the protein used in the present invention. In addition, genomic DNA, genomic DNA library, cDN derived from the above-described cells and tissues
A, a cDNA library derived from the cells and tissues described above,
Any of synthetic DNAs may be used. The vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like. In addition, reverse transcriptase Po is directly used by preparing a total RNA or mRNA fraction from the cells and tissues described above.
Amplification can also be carried out by a lymerase chain reaction (hereinafter abbreviated as RT-PCR method). Examples of the DNA encoding the protein used in the present invention include, for example,
A DNA containing the nucleotide sequence represented by SEQ ID NO: 2, or a nucleotide sequence that hybridizes under high stringent conditions to the nucleotide sequence represented by SEQ ID NO: 2,
Any DNA may be used as long as it encodes a protein having substantially the same properties as the protein used in the present invention.

DNA capable of hybridizing with the base sequence represented by SEQ ID NO: 2 under high stringent conditions
Is, for example, about 50% or more, preferably about 60% or more, more preferably about 70% or more, more preferably about 80% or more, particularly preferably about 90% or more with the nucleotide sequence represented by SEQ ID NO: 2. As described above, DNA containing a nucleotide sequence having a homology of about 95% or more is most preferably used. Hybridization can be performed by a known method or a method analogous thereto, for example, molecular cloning (Molecular Cloning) 2nd (J. Sambrook et al.,
Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. More preferably, it can be performed under high stringency conditions. High stringency conditions include, for example, a sodium concentration of about 19 to 40 mM, preferably about 19 to 20 mM.
At a temperature of about 50-70 ° C, preferably about 60-65 ° C
Are shown. Particularly, the case where the sodium concentration is about 19 mM and the temperature is about 65 ° C. is most preferable. More specifically,
As the DNA encoding the protein containing the amino acid sequence represented by SEQ ID NO: 1, a DNA containing the base sequence represented by SEQ ID NO: 2 or the like is used.

The DNA encoding the partial peptide used in the present invention may be any DNA containing the above-described nucleotide sequence encoding the partial peptide used in the present invention. In addition, genomic DNA, genomic DNA library, c
It may be any of DNA, cDNA library derived from the above-mentioned cells and tissues, and synthetic DNA. Examples of the DNA encoding the partial peptide used in the present invention include a DNA having a part of the DNA having the nucleotide sequence represented by SEQ ID NO: 2, or a DNA having the nucleotide sequence represented by SEQ ID NO: 2 and high stringency For example, DNAs containing a part of DNA encoding a protein having a base sequence that hybridizes under a simple condition and having substantially the same activity as the protein of the present invention can be used. The DNA hybridizable to the base sequence represented by SEQ ID NO: 2 has the same significance as described above. The same hybridization method and high stringency conditions as described above are used.

The protein and partial peptide used in the present invention (hereinafter, in the description of the cloning and expression of DNAs encoding them, these may be simply abbreviated as the protein of the present invention) are completely encoded by D
As a means for cloning NA, the DNA may be amplified by a PCR method using a synthetic DNA primer having a part of the nucleotide sequence encoding the protein of the present invention, or the DNA incorporated into an appropriate vector may be a part of the protein of the present invention. Alternatively, selection can be carried out by hybridization with a DNA fragment encoding the entire region or labeled with a synthetic DNA. Hybridization methods are described, for example, in Molecular Cloning 2nd (J. Sambrook et al.,
Cold Spring Harbor Lab. Press, 1989). When a commercially available library is used, it can be performed according to the method described in the attached instruction manual. Conversion of the base sequence of DNA can be performed by PCR or a known kit, for example, Mutan ^™ -superExp.
ress Km (Takara Shuzo Co., Ltd.), Mutan ^TM -K (Takara Shuzo Co., Ltd.)
The method can be performed according to a known method such as the ODA-LAPCR method, the gapped duplex method, the Kunkel method, or a method analogous thereto. The DNA encoding the cloned protein can be used as it is depending on the purpose, or it can be used after digesting with a restriction enzyme or adding a linker, if desired. The DNA may have ATG as a translation initiation codon at the 5 'end and TAA, TGA or TAG as a translation stop codon at the 3' end. These translation initiation codon and translation termination codon can also be added using a suitable synthetic DNA adapter. The expression vector of the protein of the present invention is
For example, (a) DNA encoding the protein of the present invention
From (b) the DNA
It can be produced by ligating the fragment downstream of the promoter in an appropriate expression vector.

As a vector, a plasmid derived from Escherichia coli (eg, pBR322, pBR325, pUC12,
UC13), a plasmid derived from Bacillus subtilis (eg, pUB11)
0, pTP5, pC194), yeast-derived plasmids (eg, pSH19, pSH15), bacteriophages such as phage λ, animal viruses such as retrovirus, vaccinia virus, baculovirus, etc.
A1-11, pXT1, pRc / CMV, pRc / RS
V, pcDNAI / Neo, etc. are used. The promoter used in the present invention may be any promoter as long as it is appropriate for the host used for gene expression. For example, when animal cells are used as hosts, SRα promoter, SV40 promoter, L
TR promoter, CMV promoter, HSV-TK
Promoters and the like. Of these, CMV
(Cytomegalovirus) promoter, SRα promoter and the like are preferably used. When the host is Escherichia, trp promoter, lac promoter, recA promoter, .lambda.P _L promoter,
When the host is a bacterium of the genus Bacillus, the SPO1 promoter, the S7 promoter,
When the host is yeast, such as a PO2 promoter and a penP promoter, a PHO5 promoter, a PGK promoter, a GAP promoter, an ADH promoter, and the like are preferable. When the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable.

[0024] In addition to the above, an expression vector optionally containing an enhancer, a splicing signal, a poly-A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori) and the like may be used. Can be used. As a selection marker, for example, dihydrofolate reductase (hereinafter, dhfr)
Gene (sometimes abbreviated as “methotrexate (M
TX) resistance], an ampicillin resistance gene (hereinafter referred to as Amp
^r ), a neomycin resistance gene (hereinafter sometimes referred to as Neo ^r , G418 resistance) and the like. In particular, when the dhfr gene is used as a selection marker using dhfr gene-deficient Chinese hamster cells, the target gene can be selected using a thymidine-free medium. If necessary, a signal sequence suitable for the host is added to the N-terminal side of the protein of the present invention. When the host is a genus Escherichia, a PhoA signal sequence, an OmpA signal sequence, and the like. In some cases, the MFα signal sequence,
When the host is an animal cell, such as an SUC2 signal sequence, an insulin signal sequence, an α-interferon signal sequence, an antibody molecule / signal sequence, etc. can be used. A transformant can be produced using the vector containing the DNA encoding the protein of the present invention thus constructed.

As the host, for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used. Specific examples of Escherichia bacteria include
For example, Escherichia coli K1
2. DH1 [Procedures of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 60]
Vol. 160 (1968)], JM103 [Nukuirek
Acids Research, (Nucleic Acids Research), 9
309 (1981)], JA 221 [Journal of Molecule Biology (Journal of Molecul)
ar Biology)], 120, 517 (1978)], HB
101 [Journal of Molecular Biology, Vol. 41, 459 (1969)], C600 [Genetics, Vol. 39, 440 (1954)] and the like are used. Examples of Bacillus spp. Include, for example, Bacillus subtilis MI114
[Gene, 24, 255 (1983)], 207-21
[Journal of Biochemistry
Biochemistry), 95, 87 (1984)]. As yeast, for example, Saccharomyces
Saccharomyces cerevisiae AH22, A
^{H22R -, NA87-11A, DKD-5D} , 20B
-12, Schizosacchamyces pombe
romyces pombe) NCYC1913, NCYC203
6. Pichia pastoris KM71
Are used.

As insect cells, for example, virus is A
In the case of cNPV, a cell line derived from night larvae of moth (Spodop
tera frugiperda cell (Sf cell), Trichoplusia ni
MG1 cells from the midgut, H from the eggs of Trichoplusia ni
igh Five ^TM cells, cells derived from Mamestra brassicae or
Estigmena acrea-derived cells and the like are used. When the virus is BmNPV, a silkworm-derived cell line (Bombyx mor
iN cells; BmN cells) and the like. As the Sf cells, for example, Sf9 cells (ATCC CRL1711), Sf9
21 cells (Vaughn, JL et al., In Vivo
ivo), 13, 213-217, (1977)). As insects, for example, silkworm larvae are used [Maeda et al., Nature, 315, 592 (198).
5)]. As animal cells, for example, monkey cells COS-
7, Vero, Chinese hamster cell CHO (hereinafter abbreviated as CHO cell), dhfr gene-deficient Chinese hamster cell CHO (hereinafter, CHO (dhf)
r ⁻ ) cells), mouse L cells, mouse AtT-2
0, mouse myeloma cells, rat GH3, human FL cells, and the like. In order to transform Escherichia, for example, Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 69
Vol. 2110 (1972) and Gene, Vol. 17, 1
07 (1982).

For transformation of Bacillus sp., For example, Molecular & General Genetics, Vol.
111 (1979). To transform yeast, for example, Methods in Enzymolog
y), 194, 182-187 (1991), Processings of the National Academy of Sciences of the USA (Proc. Na)
Acad. Sci. USA), 75, 1929 (197).
8) and the like. In order to transform insect cells or insects, for example, Bio / Technology, 6, 47-55 (1988))
And the like. To transform animal cells, for example, see Cell Engineering Separate Volume 8, New Cell Engineering Experiment Protocol. 263-267 (1995)
(Published by Shujunsha), Virology, Volume 52,
456 (1973). Thus, the DNA encoding the protein
A transformant transformed with an expression vector containing When culturing a transformant whose host is a genus Escherichia or Bacillus, a liquid medium is suitable as a medium used for the culturing, and a carbon source necessary for growth of the transformant is used therein. Nitrogen sources, inorganic substances, etc. are contained. As a carbon source, for example, glucose, dextrin, soluble starch, sucrose, etc.As a nitrogen source, for example, ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract and the like Examples of the inorganic or organic substance and the inorganic substance include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride. In addition, yeast extract, vitamins, growth promoting factors and the like may be added. The pH of the medium is preferably about 5 to 8.

As a medium for culturing the genus Escherichia, for example, M9 medium containing glucose and casamino acid [Miller, Journal of Experiments in Molecular Genetics (Journa)
l of Experiments in Molecular Genetics), 431-
433, Cold Spring Harbor Laboratory, New York 1
972] is preferred. If necessary, an agent such as 3β-indolylacrylic acid can be added in order to make the promoter work efficiently. When the host is a bacterium belonging to the genus Escherichia, the cultivation is usually carried out at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration and stirring can be added. When the host is a bacterium belonging to the genus Bacillus, the cultivation is usually performed at about 30 to 40 ° C. for about 6 to 24 hours, and if necessary, aeration and stirring can be added. When culturing a transformant in which the host is yeast, for example, Burkholder's minimum medium [Bostian, KL
Processings of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 77, 450
5 (1980)] and an SD medium containing 0.5% casamino acid [Bitter, GA et al., Processings of the.
National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. US
A), 81, 5330 (1984)].
Preferably, the pH of the medium is adjusted to about 5-8. The cultivation is usually performed at about 20 ° C. to 35 ° C. for about 24 to 72 hours, and if necessary, aeration and stirring are added. When culturing a transformant whose host is an insect cell or an insect, the medium used is Grac.
e's Insect Medium (Grace, TCC, Nature (Natur
e), 195, 788 (1962)) to which an additive such as immobilized 10% bovine serum is appropriately added. Medium pH
Is preferably adjusted to about 6.2 to 6.4. The cultivation is usually performed at about 27 ° C. for about 3 to 5 days, and if necessary, aeration and / or stirring are added. When culturing a transformant in which the host is an animal cell, the medium may be, for example, a MEM medium containing about 5 to 20% fetal bovine serum [Science, 12
2, 501 (1952)], DMEM medium [Virology, 8, 396 (1959)], RPMI
1640 medium [Journal of the American
Medical Association (The Journal of the A
American Medical Association) 199, 519 (19
67)], 199 medium [Proceeding of the Society for the Biological Medicine]
cine), 73, 1 (1950)]. p
H is preferably about 6-8. Culture is usually about 30 ° C
Perform at １５40 ° C. for about 15-60 hours, adding aeration and stirring as needed. As described above, the protein of the present invention can be produced in the cell, in the cell membrane, or outside the cell of the transformant.

The protein of the present invention can be separated and purified from the above culture by, for example, the following method. When the protein of the present invention is extracted from cultured cells or cells, after culturing, the cells or cells are collected by a known method, suspended in an appropriate buffer, and subjected to sonication, lysozyme, and / or freeze-thawing. After the cells or cells are destroyed by the method, a method of obtaining a crude extract of the protein by centrifugation or filtration is used as appropriate. The buffer may contain a protein denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 ^™ . When the protein is secreted into the culture solution, after the culture is completed, the supernatant is separated from the cells or cells by a known method, and the supernatant is collected. The protein contained in the thus obtained culture supernatant or extract can be purified by appropriately combining known separation and purification methods. These known separation and purification methods include methods using solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis, mainly molecular weight. Method using difference in charge, method using charge difference such as ion exchange chromatography, method using specific affinity such as affinity chromatography, and use of difference in hydrophobicity such as reverse phase high performance liquid chromatography A method utilizing a difference between isoelectric points, such as an isoelectric focusing method, is used.

When the protein thus obtained is obtained in a free form, it can be converted into a salt by a known method or a method analogous thereto, and conversely, when the protein is obtained as a salt, a known method or analogous method Depending on the method, it can be converted into a free form or other salts. The protein produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein modifying enzyme before or after purification. As the protein modifying enzyme, for example, trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like are used. The presence of the protein of the present invention thus produced can be measured by an enzyme immunoassay using a specific antibody, Western blotting, or the like.

The antibody against the protein or partial peptide or a salt thereof used in the present invention may be a polyclonal antibody or a monoclonal antibody as long as it can recognize the protein or partial peptide or a salt thereof used in the present invention. Is also good. Antibodies against the protein or partial peptide used in the present invention or a salt thereof (hereinafter, these may be simply abbreviated to the protein of the present invention in the description of the antibody) can be obtained by using the protein of the present invention as an antigen and a known antibody. It can be produced according to a method for producing an antibody or antiserum. [Preparation of Monoclonal Antibody] (a) Preparation of Monoclonal Antibody-Producing Cell The protein of the present invention is administered to a warm-blooded animal by itself or together with a carrier or a diluent at a site where the antibody can be produced by administration. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. The administration is usually performed once every 2 to 6 weeks, about 2 to 10 times in total. Examples of the warm-blooded animal to be used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, goats and chickens, and mice and rats are preferably used. When preparing monoclonal antibody-producing cells, a warm-blooded animal immunized with an antigen, for example, an individual having an antibody titer is selected from a mouse, and the spleen or lymph node is collected 2 to 5 days after the final immunization and contained in the spleen or lymph node. By fusing the antibody-producing cells thus obtained with myeloma cells of the same or different species, a monoclonal antibody-producing hybridoma can be prepared. The antibody titer in the antiserum can be measured, for example, by reacting a labeled protein described below with the antiserum, and then measuring the activity of a labeling agent bound to the antibody. The fusion operation is performed by known methods, for example, the method of Kohler and Milstein [Nature, 256, 495 (1
975)]. Examples of the fusion promoter include polyethylene glycol (PEG) and Sendai virus, but PEG is preferably used.

Examples of myeloma cells include NS-1,
Examples include warm-blooded animal myeloma cells such as P3U1, SP2 / 0, and AP-1, but P3U1 is preferably used. The preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1,
PEG (preferably PEG1000-PEG6000)
Is added at a concentration of about 10 to 80%,
Preferably, cell fusion can be carried out efficiently by incubating at 30 to 37 ° C for 1 to 10 minutes. Various methods can be used to screen for monoclonal antibody-producing hybridomas. For example, a hybridoma culture supernatant is added to a solid phase (eg, a microplate) on which a protein antigen is adsorbed directly or together with a carrier, and then radioactive substances or An anti-immunoglobulin antibody labeled with an enzyme or the like (if the cell used for cell fusion is a mouse, an anti-mouse immunoglobulin antibody is used) or protein A
A method for detecting a monoclonal antibody bound to a solid phase, adding a hybridoma culture supernatant to a solid phase to which an anti-immunoglobulin antibody or protein A is adsorbed, adding a protein labeled with a radioactive substance or an enzyme, and A method for detecting a monoclonal antibody bound to a phase is exemplified. Selection of the monoclonal antibody can be performed according to a known method or a method analogous thereto. Normal HAT
(Hypoxanthine, aminopterin, thymidine) in an animal cell culture medium. As a selection and breeding medium, any medium can be used as long as a hybridoma can grow. For example, 1-2
RP containing 0%, preferably 10-20% fetal calf serum
MI 1640 medium, G containing 1-10% fetal calf serum
An IT medium (Wako Pure Chemical Industries, Ltd.) or a serum-free medium for hybridoma culture (SFM-101, Nissui Pharmaceutical Co., Ltd.) can be used. The culturing temperature is usually 20 to 40 ° C, preferably about 37 ° C. The culturing time is usually 5 days to 3 weeks, preferably 1 week to 2 weeks. The culture can be usually performed under 5% carbon dioxide. The antibody titer of the hybridoma culture supernatant can be measured in the same manner as the measurement of the antibody titer in the antiserum described above.

(B) Purification of Monoclonal Antibody Separation and purification of monoclonal antibodies can be performed by known methods, for example, immunoglobulin separation and purification methods (eg, salting out method, alcohol precipitation method, isoelectric point precipitation method, electrophoresis method). , Ion-exchanger (eg, DEAE) adsorption / desorption method, ultracentrifugation method, gel filtration method, antigen-bound solid phase or active adsorbent such as protein A or protein G to collect only antibody and dissociate the antibody Specific purification method for obtaining

[Preparation of Polyclonal Antibody] The polyclonal antibody of the present invention can be produced according to known methods or modifications thereof. For example, an immunizing antigen (protein antigen) itself or a complex thereof with a carrier protein is formed, and immunization is performed on a warm-blooded animal in the same manner as in the above-described method for producing a monoclonal antibody. It can be produced by collecting a substance and separating and purifying the antibody. With respect to the complex of the immunizing antigen and the carrier protein used for immunizing a warm-blooded animal, the type of the carrier protein and the mixing ratio of the carrier and the hapten are such that the antibody is efficiently cross-linked to the hapten immunized by crosslinking the carrier. If possible, any material may be cross-linked at any ratio. For example, bovine serum albumin, bovine thyroglobulin, hemocyanin, etc. may be used in a weight ratio of about 0.1 to 20, preferably about 1 to 20, relative to hapten 1. A method of coupling at a rate of ５5 is used. Further, for coupling of the hapten and the carrier, various condensing agents can be used,
Glutaraldehyde, carbodiimide, maleimide active ester, an active ester reagent containing a thiol group or a dithioviridyl group, and the like are used. The condensation product is administered to a warm-blooded animal itself or together with a carrier or diluent at a site where antibody production is possible. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance the antibody-producing ability upon administration. Administration is
Usually, once every 2 to 6 weeks, about 3 to 10 times in total. The polyclonal antibody can be collected from the blood, ascites, etc., preferably from the blood of a warm-blooded animal immunized by the above method. The measurement of the polyclonal antibody titer in the antiserum can be performed in the same manner as the measurement of the antibody titer in the antiserum described above. The polyclonal antibody can be separated and purified according to the same method for separating and purifying immunoglobulins as in the above-described method for separating and purifying a monoclonal antibody.

A DNA that is complementary to the base sequence of DNA encoding the protein or partial peptide used in the present invention (hereinafter, these DNAs may be abbreviated to the DNA of the present invention in the description of antisense nucleotides).
Alternatively, the antisense nucleotide having a substantially complementary nucleotide sequence includes a nucleotide sequence complementary to or substantially complementary to the nucleotide sequence of the DNA of the present invention.
Any antisense nucleotide may be used as long as it has an effect of suppressing the expression of NA, but antisense DNA is preferable. The base sequence substantially complementary to the DNA of the present invention is, for example, a base sequence complementary to the DNA of the present invention (that is, a complementary strand of the DNA of the present invention).
About 70% or more, preferably about 80% or more, more preferably about 90% or more,
Most preferably, a nucleotide sequence having about 95% or more homology is exemplified. In particular, of the entire base sequence of the complementary strand of the DNA of the present invention, the base sequence of the portion encoding the N-terminal portion of the protein of the present invention (for example, a base sequence near the start codon, etc.) is at least about 70% or more of the complementary strand. Preferably about 80
%, More preferably about 90% or more, and most preferably about 95% or more antisense nucleotides are preferred. Specifically, a base sequence complementary to or substantially complementary to the base sequence of DNA having the base sequence represented by SEQ ID NO: 2, or an antisense nucleotide having a part thereof, preferably, for example, SEQ ID NO: : 2, a base sequence complementary to the base sequence of the DNA having the base sequence represented by 2, or an antisense nucleotide having a part thereof. The antisense nucleotide is usually about 10 to 40, preferably 1 to 40.
It is composed of about 5 to 30 bases. In order to prevent degradation by a hydrolase such as nuclease, the phosphate residue (phosphate) of each nucleotide constituting the antisense DNA is replaced with a chemically modified phosphate residue such as phosphorothioate, methylphosphonate or phosphorodithionate. It may be substituted. These antisense nucleotides can be produced using a known DNA synthesizer or the like.

Hereinafter, the protein or partial peptide of the present invention or a salt thereof (hereinafter sometimes abbreviated as the protein of the present invention), the DNA encoding the protein or partial peptide of the present invention (hereinafter referred to as the DNA of the present invention) Abbreviated), antibodies against the protein or partial peptide of the present invention or a salt thereof (hereinafter sometimes abbreviated as the antibody of the present invention), and antisense nucleotides of the DNA of the present invention (hereinafter referred to as the antisense nucleotide of the present invention). (May be abbreviated as sense nucleotide).

Since a drug containing a compound or a salt thereof that inhibits the activity of the protein of the present invention can suppress the transport of organic anions, it can be used as an agent for treating or preventing a kidney disease, a liver disease and the like. Can be.
On the other hand, a drug containing a compound or a salt thereof that promotes the activity of the protein of the present invention can promote the transport of organic anions, leading to an improvement in biological defense ability,
For example, it can be used as a therapeutic / prophylactic agent for kidney disease, liver disease and the like.

[1] Agent for treating / preventing various diseases related to the protein of the present invention The protein of the present invention contributes to the transport of organic anions and is involved in the excretion of harmful organic anions in the kidney and liver. Therefore, when the DNA encoding the protein of the present invention is abnormal or defective, or when the expression level of the protein of the present invention is reduced, various diseases such as kidney disease and liver disease can be used. Develops. Therefore, the protein of the present invention and the DNA of the present invention can be used as medicaments, such as agents for treating or preventing diseases such as kidney disease and liver disease. For example, because the protein of the present invention is reduced or deficient in the living body, the transport of organic anions is insufficient, or when there is a patient who does not normally exert,
(A) administering the DNA of the present invention to the patient and expressing the protein of the present invention in vivo, (b) inserting the DNA of the present invention into cells and expressing the protein of the present invention, The role of the protein of the present invention in the patient can be sufficiently or normally exerted by transplanting the cells into the patient, or (c) administering the protein of the present invention to the patient.
When the DNA of the present invention is used as the above-mentioned therapeutic / prophylactic agent, the DNA is inserted alone or into a suitable vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector, and the like. It can be administered to humans or warm-blooded animals. The DNA of the present invention can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an auxiliary agent for promoting uptake, using a gene gun or a catheter such as a hydrogel catheter. When the protein of the present invention is used as the above-mentioned therapeutic or prophylactic agent, it is preferable to use a protein which has been purified to at least 90%, preferably 95% or more, more preferably 98% or more, and still more preferably 99% or more. preferable.

The protein and the like of the present invention include, for example, tablets, capsules, elixirs,
It can be used orally as microcapsules or the like, or parenterally in the form of injections such as sterile solutions or suspensions with water or other pharmaceutically acceptable liquids. For example, the protein or the like of the present invention is mixed with physiologically acceptable carriers, flavors, excipients, vehicles, preservatives, stabilizers, binders, and the like in the unit dosage form generally required for the practice of the formulation. Can be manufactured. The amount of the active ingredient in these preparations is such that a proper dosage in the specified range can be obtained. Examples of additives that can be mixed with tablets, capsules, and the like include binders such as gelatin, corn starch, tragacanth, and acacia, excipients such as crystalline cellulose, corn starch, gelatin, and alginic acid. Useful bulking agents, lubricants such as magnesium stearate, sweeteners such as sucrose, lactose or saccharin, flavoring agents such as peppermint, reddish oil or cherry and the like are used. When the preparation unit form is a capsule, a liquid carrier such as oil and fat can be further contained in the above-mentioned type of material. Sterile compositions for injection can be formulated according to normal pharmaceutical practice such as dissolving or suspending the active substance in vehicles such as water for injection, and naturally occurring vegetable oils such as sesame oil, coconut oil and the like. Aqueous liquids for injection include, for example, physiological saline, isotonic solutions containing glucose and other adjuvants (eg, D-sorbitol, D-mannitol, sodium chloride, etc.), and suitable solubilizing agents. For example, it may be used in combination with an alcohol (eg, ethanol or the like), a polyalcohol (eg, propylene glycol, polyethylene glycol, or the like), a nonionic surfactant (eg, polysorbate 80 ^™ , HCO-50, or the like). Examples of the oily liquid include sesame oil and soybean oil, and may be used in combination with a solubilizing agent such as benzyl benzoate or benzyl alcohol. In addition, buffers (eg, phosphate buffer, sodium acetate buffer, etc.), soothing agents (eg, benzalkonium chloride, procaine hydrochloride, etc.), stabilizers (eg, human serum albumin, polyethylene glycol, etc.), Preservatives (for example,
Benzyl alcohol, phenol, etc.), antioxidants and the like. The prepared injection is usually filled in a suitable ampoule. The vector into which the DNA of the present invention has been inserted is also formulated in the same manner as described above, and is usually used parenterally.

Since the preparation thus obtained is safe and has low toxicity, for example, warm-blooded animals (eg, human, rat, mouse, guinea pig, rabbit, bird, sheep, pig, cow, horse, cat, Dogs, monkeys, chimpanzees, etc.). The dose of the protein or the like of the present invention may vary depending on the target disease, the subject of administration, the administration route, and the like. )), The protein or the like is used in an amount of about 0.1 mg to 100 mg, preferably about 1.0 mg per day.
５０50 mg, more preferably about 1.0-20 mg. When administered parenterally, the single dose of the protein or the like varies depending on the administration subject, target disease, and the like.
For example, when the protein or the like of the present invention is administered to an adult (with a body weight of 60 kg) in the form of an injection for the purpose of treating kidney disease, about 0.01 to 30 mg of the protein or the like per day is administered.
It is convenient to administer the drug by injecting into the affected part, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg. For other animals, 60
An amount converted per kg can be administered.

[2] Screening of Candidate Drug Compounds for Disease The protein of the present invention is useful as a reagent for screening a compound or a salt thereof that promotes or inhibits the activity of the protein of the present invention. That is, the present invention
(1) A compound or a salt thereof that promotes or inhibits the activity of the protein of the present invention (for example, transport of an organic anion) characterized by using the protein of the present invention or a salt thereof (hereinafter, abbreviated as a promoter and an inhibitor, respectively) In some cases), more specifically, for example, (2) (i) the organic anion transport activity of cells having the ability to produce the protein of the present invention and (ii) the protein of the present invention. The present invention provides a method for screening for an accelerator or an inhibitor, which comprises comparing the transport activity of an organic anion of a mixture of a cell having the ability to produce E. coli and a test compound. Specifically, in the above screening method, for example, in the cases of (i) and (ii), the transport activity of the organic anion is measured by incorporation of the organic anion labeled with a radioisotope, and the transport activity of the organic anion is measured. The feature is that comparison is made as an index.

As the test compound, for example, peptide,
Examples include proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, and the like.These compounds may be novel compounds or known compounds. Is also good. To carry out the above screening method, cells having the ability to produce the protein of the present invention are prepared by suspending them in a buffer suitable for screening. The buffer has a pH of about 4 to 10
Any buffer, such as a phosphate buffer (preferably about 6 to 8) or a borate buffer, which does not inhibit the organic anion transport activity of the protein of the present invention may be used. As a cell having the ability to produce the protein of the present invention, for example, a host (transformant) transformed with a vector containing the DNA encoding the protein of the present invention described above is used. As a host, for example, animal cells such as CHO cells are preferably used.
For the screening, for example, a transformant in which the protein of the present invention is expressed on a cell membrane by culturing by the method described above is preferably used.

The transport activity of the protein of the present invention for organic anions can be determined by a known method, for example, J. Biol. Chem. 275 : 45.
It can be measured according to the method described in 07-4512, 2000 or a method analogous thereto. For example, the transport activity of the organic anion in the case (ii) is about 20% or more, preferably 30% or more, as compared with the case (i).
More preferably, a test compound that promotes about 50% or more can be selected as a compound or a salt thereof that promotes the activity of the protein of the present invention. Further, for example, the above (ii)
The transport activity of the organic anion in the case of
Selecting a test compound that inhibits (or suppresses) about 20% or more, preferably 30% or more, more preferably about 50% or more of that in the case of the above, as a compound that inhibits the activity of the protein of the present invention or a salt thereof. Can be. Also,
A gene such as secretory alkaline phosphatase or luciferase is inserted downstream of the promoter of the protein OAT homolog gene of the present invention, and expressed in the above-described various cells.
The expression of the protein of the present invention (OAT homolog) is promoted or suppressed by searching for a compound or a salt thereof that activates or inhibits the enzymatic activity when the test compound is brought into contact with the cells (that is, the protein of the present invention). Compound that promotes or inhibits the activity of) or a salt thereof.

The screening kit of the present invention contains the protein or partial peptide used in the present invention or a salt thereof, or a cell capable of producing the protein or partial peptide used in the present invention.

The compound obtained by using the screening method or the screening kit of the present invention or a salt thereof may be a test compound such as a peptide, protein, non-peptide compound, synthetic compound, fermentation product, cell extract, A compound or a salt thereof selected from a plant extract, an animal tissue extract, plasma, and the like, and a compound or a salt thereof that promotes or inhibits the activity (eg, organic anion transport activity) of the protein of the present invention. As the salt of the compound, those similar to the aforementioned salts of the protein of the present invention are used. The compound or its salt that promotes the activity of the protein of the present invention is useful, for example, as a medicament such as a therapeutic / prophylactic agent for kidney disease and liver disease. Further, the compound or a salt thereof that inhibits the activity of the protein of the present invention can be used, for example, for the treatment and treatment of kidney disease and liver disease.
It is useful as a medicament such as a prophylactic agent.

When a compound or a salt thereof obtained by using the screening method or the screening kit of the present invention is used as the above-mentioned therapeutic or prophylactic agent, it can be formulated into a preparation according to a conventional method. For example, tablets, capsules, elixirs, microcapsules, sterile solutions, suspensions and the like can be used. The preparations obtained in this way are safe and low toxic, for example, human or warm-blooded animals (eg, mouse, rat, rabbit, sheep, pig, cow, horse, bird, cat, dog, monkey, chimpanzee, etc.) ) Can be administered orally or parenterally. The dose of the compound or a salt thereof varies depending on its action, target disease, subject of administration, administration route and the like. When administered orally, generally, in an adult (with a body weight of 60 kg), about 0.1 to 100 mg, preferably about 1.0 to 50 mg of the compound or a salt thereof per day is used.
More preferably, about 1.0 to 20 mg is administered. When administered parenterally, the single dose of the compound or a salt thereof varies depending on the administration subject, target disease, and the like. When the salt is usually administered to an adult (with a body weight of 60 kg) in the form of an injection, the compound or a salt thereof is about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 20 mg per day. About 0.
It is convenient to administer about 1 to 10 mg by intravenous injection. In the case of other animals, the dose can be administered in terms of weight per 60 kg.

[3] Quantification of the protein of the present invention, its partial peptide or its salt An antibody against the protein of the present invention (hereinafter sometimes abbreviated as the antibody of the present invention) specifically recognizes the protein of the present invention. Therefore, it can be used for quantification of the protein of the present invention in a test solution, particularly for quantification by sandwich immunoassay. That is, the present invention
(I) reacting the antibody of the present invention with a test solution and a labeled protein of the present invention competitively, and measuring the ratio of the labeled protein of the present invention bound to the antibody. And (ii) simultaneously or sequentially reacting the test solution with the antibody of the present invention insolubilized on a carrier and another antibody of the present invention labeled on a carrier. The present invention provides a method for quantifying the protein of the present invention in a test solution, which comprises measuring the activity of a labeling agent on an insolubilized carrier after the reaction. In the quantitative method (ii), it is desirable that one antibody is an antibody that recognizes the N-terminal of the protein of the present invention and the other antibody is an antibody that reacts with the C-terminal of the protein of the present invention.

The protein of the present invention can be quantified using a monoclonal antibody against the protein of the present invention (hereinafter sometimes referred to as the monoclonal antibody of the present invention), and can also be detected by tissue staining or the like. . For these purposes, the antibody molecule itself may be used, or F (ab ') ₂ , Fab', or Fab fraction of the antibody molecule may be used. The method for quantifying the protein of the present invention using the antibody of the present invention is not particularly limited. Any measurement method may be used as long as the amount is detected by chemical or physical means and the amount is calculated from a standard curve prepared using a standard solution containing a known amount of antigen. For example, nephelometry, competition method, immunometric method and sandwich method are preferably used, but in terms of sensitivity and specificity, it is particularly preferable to use the sandwich method described later. As a labeling agent used in a measurement method using a labeling substance, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like are used. Examples of the radioisotope include [ ¹²⁵ I], [ ¹³¹ I], [ ³ H], and [ ¹⁴ H].
C] is used. As the above enzyme, a stable enzyme having a large specific activity is preferable. For example, β-galactosidase, β-glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used. As the fluorescent substance, for example, fluorescamine, fluorescein isothiocyanate and the like are used. As the luminescent substance, for example, luminol, a luminol derivative, luciferin, lucigenin and the like are used. Further, a biotin-avidin system can be used for binding the antibody or antigen to the labeling agent.

For insolubilization of the antigen or antibody, physical adsorption may be used, or a method using a chemical bond usually used for insolubilizing and immobilizing proteins or enzymes may be used. Examples of the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose; synthetic resins such as polystyrene, polyacrylamide, and silicon; and glass. In the sandwich method, the test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further reacted with another labeled monoclonal antibody of the present invention (secondary reaction). By measuring the activity of the labeling agent, the amount of the protein of the present invention in the test solution can be determined. The primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at staggered times. The labeling agent and the method of insolubilization can be in accordance with those described above. In addition, in the immunoassay by the sandwich method,
The antibody used for the solid phase antibody or the labeling antibody is not necessarily one kind, and a mixture of two or more kinds of antibodies may be used for the purpose of improving measurement sensitivity and the like. In the method for measuring the protein of the present invention by the sandwich method of the present invention, as the monoclonal antibody of the present invention used in the primary reaction and the secondary reaction, an antibody having a different site to which the protein of the present invention binds is preferably used. That is, the antibody used in the primary reaction and the secondary reaction is preferably, for example, when the antibody used in the secondary reaction recognizes the C-terminal of the protein of the present invention, the antibody used in the primary reaction is preferably For example, an antibody that recognizes an N-terminal other than the C-terminal is used.

The monoclonal antibody of the present invention can be used in a measurement system other than the sandwich method, for example, a competition method, an immunometric method, or a nephrometry. In the competition method, an antigen in a test solution and a labeled antigen are allowed to react competitively with an antibody, and then the unreacted labeled antigen is reacted.
(F) and the labeled antigen (B) bound to the antibody are separated (B
/ F separation), the labeling amount of either B or F is measured, and the amount of antigen in the test solution is quantified. In this reaction method, a soluble antibody was used as an antibody, B / F separation was performed using polyethylene glycol,
A liquid phase method using a second antibody or the like to the antibody, and using an immobilized antibody as the first antibody, or
A solid-phase method using a soluble first antibody and a solid-phased antibody as the second antibody is used. In the immunometric method, an antigen in a test solution and a solid-phased antigen are subjected to a competitive reaction with a fixed amount of a labeled antibody, and then the solid phase and the liquid phase are separated. And an excess amount of the labeled antibody, and then immobilized antigen is added to bind unreacted labeled antibody to the solid phase, and then the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to determine the amount of antigen in the test solution. In nephelometry, the amount of insoluble precipitates generated as a result of an antigen-antibody reaction in a gel or in a solution is measured. Even when the amount of antigen in the test solution is small and only a small amount of sediment is obtained, laser nephrometry utilizing laser scattering is preferably used.

In applying these individual immunoassays to the quantification method of the present invention, there is no need to set special conditions, operations, and the like. What is necessary is just to construct the protein measurement system of the present invention by adding ordinary technical considerations of those skilled in the art to ordinary conditions and operation methods in each method. For details of these general technical means, reference can be made to reviews, books, and the like. For example, Hiroe Irie, "Radio Immunoassay" (Kodansha, published in 1974), Hiroshi Irie, "Sequence Radioimmunoassay" (Kodansha, published in 1974), Eiji Ishikawa et al., "Enzyme Immunoassay" (Medical Shoin, Showa Ed. Ishikawa et al., “Enzyme Immunoassay” (Second Edition) (Issue Shoin, 1982) Published in 1962, "Methods in ENZYMOLOGY" Vol. 70 (Immunochem
ical Techniques (Part A)), ibid.Vol. 73 (Immunochem
ical Techniques (Part B)), ibid.Vol. 74 (Immunochem
ical Techniques (Part C)), ibid.Vol. 84 (Immunochem
ical Techniques (Part D: Selected Immunoassays)),
Ibid.Vol. 92 (Immunochemical Techniques (Part E: Mono
clonal Antibodies and General Immunoassay Method
s)), ibid.Vol. 121 (Immunochemical Techniques (Part
I: Hybridoma Technology and Monoclonal Antibodie
s)) (above, published by Academic Press). As described above, the protein of the present invention can be quantified with high sensitivity by using the antibody of the present invention. Furthermore, by quantifying the concentration of the protein of the present invention using the antibody of the present invention, (1)
When a decrease in the concentration of the protein of the present invention is detected, for example, it can be diagnosed that the possibility of kidney disease, liver disease, and the like is high. (2) Conversely, for example, when an increase in the concentration of the protein of the present invention is detected, it can be diagnosed that the possibility of kidney disease and liver disease is high. Further, the antibody of the present invention can be used for detecting the protein of the present invention present in a subject such as a body fluid or a tissue. Further, for preparation of an antibody column used for purifying the protein of the present invention, detection of the protein of the present invention in each fraction at the time of purification, analysis of the behavior of the protein of the present invention in test cells, etc. Can be used.

[4] Gene Diagnostic Agent The DNA of the present invention can be used, for example, as a probe to produce a human or warm-blooded animal (eg, rat, mouse, guinea pig, rabbit, bird, sheep, pig, cow,
DNA or mRNA abnormalities (genetic abnormalities) encoding the protein of the present invention or its partial peptide in horses, cats, dogs, monkeys, chimpanzees, etc.) can be detected.
It is useful as an agent for genetic diagnosis such as damage, mutation or decreased expression of DNA, and increase or excessive expression of the DNA or mRNA. The above-described genetic diagnosis using the DNA of the present invention can be performed, for example, by the known Northern hybridization or PCR-SSCP method (Genomics,
5, 874-879 (1989), Proceedings of the National Academy of Sciences of USA
heNational Academy of Sciences of the United State
s of America), Vol. 86, pp. 2766-2770 (1
989)). For example, when an increase in expression is detected by Northern hybridization, it can be diagnosed that the possibility of kidney disease or liver disease is high. Conversely, when a decrease in the expression is detected or when a DNA mutation is detected by the PCR-SSCP method, for example, it is possible to diagnose that there is a high possibility of a kidney disease or a liver disease.

[5] Pharmaceuticals Containing Antisense Nucleotides The antisense nucleotides of the present invention, which can complementarily bind to the DNA of the present invention and suppress the expression of the DNA, have low toxicity, and Since the function of the protein of the present invention or the DNA of the present invention (eg, organic anion transport activity) can be suppressed, for example, kidney disease,
It can be used as a therapeutic / prophylactic agent for liver diseases and the like. When the antisense nucleotide is used as the therapeutic or prophylactic agent, it is formulated according to a known method,
Can be administered. For example, when the antisense nucleotide is used, the antisense nucleotide is inserted alone or into a suitable vector such as a retrovirus vector, an adenovirus vector, an adenovirus associated virus vector or the like, and then inserted into a human or mammal ( For example, rats, rabbits, sheep, pigs, cows, cats, dogs, monkeys, etc.) can be administered orally or parenterally. The antisense nucleotide can be administered as it is or in the form of a formulation together with a physiologically acceptable carrier such as an adjuvant for promoting uptake, and administered with a gene gun or a catheter such as a hydrogel catheter. The dose of the antisense nucleotide varies depending on the target disease, the administration subject, the administration route, and the like. In adults (weight 60 kg),
About 0.1 to 1 of the antisense nucleotide per day
Administer 00 mg. Furthermore, the antisense nucleotide can also be used as a diagnostic oligonucleotide probe for examining the presence of the DNA of the present invention in tissues or cells and the state of its expression.

In the present specification and drawings, when bases, amino acids and the like are represented by abbreviations, IUPAC-IUB
It is based on the abbreviation by the Commission on Biochemical Nomenclature or the abbreviation commonly used in the relevant field, examples of which are described below. When an amino acid can have an optical isomer, the L-form is indicated unless otherwise specified. DNA: deoxyribonucleic acid cDNA: complementary deoxyribonucleic acid A: adenine T: thymine G: guanine C: cytosine RNA: ribonucleic acid mRNA: messenger ribonucleic acid dATP: deoxyadenosine triphosphate dTTP: deoxythymidine triphosphate dGTP: deoxyguanosine triphosphate Phosphate dCTP: Deoxycytidine triphosphate ATP: Adenosine triphosphate EDTA: Ethylenediaminetetraacetic acid SDS: Sodium dodecyl sulfate Gly: Glycine Ala: Alanine Val: Valine Leu: Leucine Ile: Isoleucine Ser: Serine Thr: thyronine : Methionine Glu: Glutamic acid Asp: Aspartic acid Lys: Lysine Arg: Arginine His: Histidine Phe Phenylalanine Tyr: tyrosine Trp: tryptophan Pro: proline Asn: asparagine Gln: glutamine pGlu: pyroglutamic acid

The substituents, protecting groups and reagents frequently used in the present specification are represented by the following symbols. Me: methyl group Et: ethyl group Bu: butyl group Ph: phenyl group TC: thiazolidine -4 (R) - carboxamide group Tos: p-toluenesulfonyl CHO: formyl Bzl: benzyl Cl ₂ -Bzl: 2,6-dichlorobenzyl Bom: benzyloxymethyl Z: benzyloxycarbonyl Cl-Z: 2-chlorobenzyloxycarbonyl Br-Z: 2-bromobenzyloxycarbonyl Boc: t-butoxycarbonyl DNP: dinitrophenyl Trt: trityl Bum: t-butoxymethyl Fmoc : N-9-fluorenylmethoxycarbonyl HOBt: 1-hydroxybenztriazole HOOBT: 3,4-dihydro-3-hydroxy-4-oxo- 1,2,3-benzotriazine HONB: 1-hydroxy-5-no Bornene-2,3-dicarboximide DCC: N, N'-dicyclohexylcarbodiimide

The sequence numbers in the sequence listing in the present specification indicate the following sequences. [SEQ ID NO: 1] This shows the amino acid sequence of human TCH121 protein. [SEQ ID NO: 2] This shows the base sequence of DNA encoding TCH121 protein having the amino acid sequence represented by SEQ ID NO: 1.

[0057]

The protein having the same or substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1 is useful as a diagnostic marker for kidney disease and liver disease and the like. The resulting compound that promotes or inhibits the activity of the protein can be used, for example, as an agent for preventing or treating diseases such as kidney disease and liver disease.

[0058]

[Sequence List] SEQUENCE LISTING <110> Takeda Chemical Industries, Ltd. <120> Novel Protein and its DNA <130> P2001-030 <140> <141> <160> 2 <170> PatentIn Ver. 2.1 <210> 1 <211> 1289 <212> PRT <213> Human <400> 1 Met Glu Glu Ile Thr Ala Thr Val Gln Lys Leu Val Glu Val Asn Ile 1 5 10 15 Ile Trp Pro Ala Glu Phe Phe Gln Ser Tyr Val Thr Glu Phe Arg Gln 20 25 30 Gly Trp Ser Gly Cys Ser Gly Arg Leu Ser Gln Ala Leu Pro Ser Lys 35 40 45 Glu Trp Gly Ser Leu Thr Ala Ser Pro His Tyr Gly Asp Thr Ser Trp 50 55 60 Ala Ser Ala Glu Val Thr Val Val Ala Ala Ala Gly Gln Ala Tyr Leu 65 70 75 80 Ser Leu Asp Ser Arg Ala Leu His Ala Gly Ser Gly Val Ser Ser Tyr 85 90 95 Gly Leu Val Asp Ser Trp Ala Ser Arg Gln Leu Ala Gln Leu Pro Val 100 105 110 Val Ala Thr Met Gly Tyr Ala Ser Gly Gln Trp Asp Leu Val Cys Asp 115 120 125 Tyr Gln Ser Leu Lys Ser Val Val Gln Phe Leu Leu Leu Thr Gly Met 130 135 140 Leu Val Gly Gly Ile Ile Gly Gly His Val Ser Asp Ser Trp Val Asn 145 150 155 160 Phe Arg Gln Leu Ser Phe Gly Leu Arg T hr Cys Ala Asp Tyr Glu Ile 165 170 175 Leu Leu Trp Phe Gly Arg Arg Phe Ile Leu Arg Trp Cys Leu Leu Gln 180 185 190 Leu Ala Ile Thr Asp Thr Cys Ala Ala Phe Ala Pro Thr Phe Pro Val 195 200 205 Tyr Cys Val Leu Arg Phe Leu Ala Gly Phe Ser Ser Met Ile Ile Ile 210 215 220 Ser Asn Asn Ser Leu Pro Ile Thr Glu Trp Ile Arg Pro Asn Ser Lys 225 230 235 240 Ala Leu Val Val Ile Leu Ser Ser Gly Ala Leu Ser Ile Gly Gln Ile 245 250 255 Ile Leu Gly Gly Leu Ala Tyr Val Phe Arg Asp Trp Gln Thr Leu His 260 265 270 Val Val Ala Ser Val Pro Phe Phe Val Phe Phe Leu Leu Ser Arg Trp 275 280 285 Leu Val Glu Ser Ala Arg Trp Leu Ile Ile Thr Asn Lys Leu Asp Glu 290 295 300 Gly Leu Lys Ala Leu Arg Lys Val Ala Arg Thr Asn Gly Ile Lys Asn 305 310 315 320 Ala Glu Glu Thr Leu Asn Ile Glu Val Val Arg Ser Thr Met Gln Glu 325 330 335 Glu Leu Asp Ala Ala Gln Thr Lys Thr Thr Val Cys Asp Leu Phe Arg 340 345 350 Asn Pro Ser Met Arg Lys Arg Ile Cys Ile Leu Val Phe Leu Arg Phe 355 360 365 Ala Asn Thr Ile Pro Phe Tyr Gly Thr MetVal Asn Leu Gln His Val 370 375 380 Gly Ser Asn Ile Phe Leu Leu Gln Val Leu Tyr Gly Ala Val Ala Leu 385 390 395 400 Ile Val Arg Cys Leu Ala Leu Leu Thr Leu Asn His Met Gly Arg Arg 405 410 415 Ile Ser Gln Ile Leu Phe Met Phe Leu Val Gly Leu Ser Ile Leu Ala 420 425 430 Asn Thr Phe Val Pro Lys Glu Met Gln Thr Leu Arg Val Ala Leu Ala 435 440 445 Cys Leu Gly Ile Gly Cys Ser Ala Ala Thr Phe Ser Ser Val Ala Val 450 455 460 His Phe Ile Glu Leu Ile Pro Thr Val Leu Arg Ala Arg Ala Ser Gly 465 470 475 480 Ile Asp Leu Thr Ala Ser Arg Ile Gly Ala Ala Leu Ala Pro Leu Leu 485 490 495 495 Met Thr Leu Thr Val Phe Phe Thr Thr Leu Pro Trp Ile Ile Tyr Gly 500 505 510 Ile Phe Pro Ile Ile Gly Gly Leu Ile Val Phe Leu Leu Leu Glu Thr 515 520 525 Lys Asn Leu Pro Leu Pro Asp Thr Ile Lys Asp Val Glu Asn Gln Ala 530 535 540 Val Gly Val Gly Val Val Ala Gln Ser Thr Val Gln Val Leu Pro Ile 545 550 555 560 Gly Thr Gln Ser Cys Thr Tyr Trp Gln Ser Ser Gly Arg Gly Gly Ser 565 570 575 Ser Val Leu Glu Ser Pro Thr Gly Ala SerCys Pro Val Lys Val Tyr 580 585 590 Cys Met Glu Ser His Leu His Ile Asp Pro Val Met Ala Gln Glu Asp 595 600 605 Val Asn Leu Tyr Phe Gln Asp Leu Leu Gly His Ala Gly Asp Leu Trp 610 615 620 620 Arg Phe Gln Ile Leu Gln Thr Val Phe Leu Ser Ile Phe Ala Val Ala 625 630 635 640 Thr Tyr Leu His Phe Met Leu Glu Asn Phe Thr Ala Phe Ile Pro Gly 645 650 655 His Arg Cys Trp Val His Ile Leu Asp Asn Asp Thr Val Ser Asp Asn 660 665 670 Asp Thr Gly Ala Leu Ser Gln Asp Ala Leu Leu Arg Ile Ser Ile Pro 675 680 685 Leu Asp Ser Asn Met Arg Pro Glu Lys Cys Arg Arg Phe Val His Pro 690 695 700 Gln Trp Gln Leu Leu His Leu Asn Gly Thr Phe Pro Asn Thr Ser Asp 705 710 710 715 720 Ala Asp Met Glu Pro Cys Val Asp Gly Trp Val Tyr Asp Arg Ile Ser 725 730 735 Phe Ser Ser Thr Ile Val Thr Glu Trp Asp Leu Val Cys Asp Ser Gln 740 745 750 Ser Leu Thr Ser Val Ala Lys Phe Val Phe Met Ala Gly Met Met Val 755 760 765 Gly Gly Ile Leu Gly Gly His Leu Ser Asp Ser Trp Leu Leu Glu Ser 770 775 780 Ala Arg Trp Leu Ile Ile Asn Asn Lys Pro Glu Glu Gly Leu Lys Glu 785 790 795 800 Leu Arg Lys Ala Ala His Arg Ser Gly Met Lys Asn Ala Arg Asp Thr 805 810 815 Leu Thr Leu Glu Val Ser Trp Met Gly Ala Arg Tyr Gly Ile Cys Phe 820 825 830 Ser Ser Val Pro Arg Glu Asn Thr Leu Ala Tyr Asp Arg Ser Leu Ile 835 840 845 Glu Lys Glu Gly Val Glu Gln Tyr Thr Ser Gly Pro Phe Asp Thr Leu 850 855 860 Cys Glu Glu Leu Val Phe Val Ser Pro His Ser Glu His Leu Trp Asn 865 870 875 880 Leu His Ile Trp Met Phe Gly Ser Leu Asn Arg Arg Phe Ala Asn Phe 885 890 895 Met Ala Tyr Phe Gly Leu Asn Leu His Val Gln His Leu Gly Asn Asn 900 905 910 Val Phe Leu Leu Gln Thr Leu Phe Gly Ala Val Ile Leu Leu Ala Asn 915 920 925 Cys Val Ala Pro Trp Ala Leu Lys Tyr Met Asn Arg Arg Ala Ser Gln 930 935 940 Met Leu Leu Met Phe Leu Leu Ala Ile Cys Leu Leu Ala Ile Ile Phe 945 955 960 Val Pro Gln Glu Met Gln Thr Leu Arg Glu Val Leu Ala Thr Leu Gly 965 970 975 Leu Gly Ala Ser Ala Leu Ala Asn Thr Leu Ala Phe Ala His Gly Asn 980 985 990 Glu Val Ile Pro Thr Ile Ile Arg Ala Arg Ala Met Gly Ile Asn Ala 995 1000 1005 Thr Phe Ala Asn Ile Ala Gly Ala Leu Ala Pro Leu Met Met Ile Leu 1010 1015 1020 Ser Val Tyr Ser Pro Pro Leu Pro Trp Ile Ile Tyr Gly Val Phe Pro 1025 1030 1035 1040 Phe Ile Ser Gly Phe Ala Phe Leu Leu Leu Pro Glu Thr Arg Asn Lys 1045 1050 1055 Pro Leu Phe Asp Thr Ile Gln Asp Glu Lys Asn Asp Val Ile Cys Thr 1060 1065 1070 Leu Leu Lys Val Phe Tyr Lys Tyr Ala Glu Ile Gln Thr Pro Asp Phe 1075 1080 1085 His Pro Trp Gly Thr Leu Lys Gln Val Gly Thr Ser Thr Asn Phe Leu 1090 1095 1100 Gly Thr Thr Asn His Thr Ser Pro Phe Ile Pro Gln Glu Gln Arg Ile 1105 1110 1115 1120 Thr Lys Leu Glu Asp Asn Lys Arg Gly Val Cys Asp Asn Asn Leu Lys 1125 1130 1135 Leu Gly Thr Arg Glu Gln Leu Leu Ser Thr Pro Gly Val Thr Gln Gly 1140 1145 1150 Ser Leu Leu Ala Phe Pro Leu Pro Pro Leu Pro Cys Cys Pro Tyr Gly 1155 1160 1165 Ser Ala Ser Ser Val Gly Leu Arg Gly Lys Gly Ser His Ser Thr Thr 1170 1175 1180 Ala Thr Glu Ala Leu Ile Leu Gln Thr Gly Asp Pro Arg Ala Arg Glu 1185 1190 1195 1200 A rg Asn Ser Leu Gly Gln Ser His Thr Val Asn Ser Cys Pro Asn Leu 1205 1210 1215 Ala Leu Gly Phe Leu Gly Leu Met Thr Pro Arg Pro Lys Leu Leu Gln 1220 1225 1230 Arg Thr Ser Cys Asn Ala Leu Ser Pro Trp Gly Leu His Val Gln Ile 1235 1240 1245 Leu Thr Gly Arg Glu Val Ser His Thr Arg Ala His Gln Ala Pro Asp 1250 1255 1260 Thr Arg Glu Lys Pro His Lys Asn Gly Val Gln Ala Gly Glu Asp Ala 1265 1270 1275 1280 Glu Gln Arg Gly Gly Arg Cys Arg Lys 1285 <210> 2 <211> 3867 <212> DNA <213> Human <400> 2 ATGGAAGAGA TTACAGCCAC GGTACAGAAG CTTGTTGAAG TTAATATTAT ATGGCCAGCT 60 GAGTTCTTTC AGTCTTATGT GACAGAATTC AGACAAGGAT GGAGTGGCTG TAGTGGAAGA 120 CTGAGTCAAG CCTTGCCTAG CAAGGAGTGG GGTAGCCTGA CTGCTTCTCC ACACTATGGG 180 GACACCAGTT GGGCCAGTGC TGAGGTCACA GTTGTGGCAG CTGCAGGCCA AGCATACCTG 240 TCCTTGGACT CCAGGGCATT GCATGCTGGC AGTGGTGTTA GCAGTTATGG GCTAGTTGAT 300 TCTTGGGCCT CCAGGCAACT TGCTCAGTTG CCAGTAGTAG CAACAATGGG TTATGCTAGT 360 GGACAGTGGG ACCTGGTATG TGATTATTGAGTCGATCGATGACT TGATTATTGTAG TAGATTATTGAG TAG AGGCATCATA GGTGGCCATG TCTCAGACAG TTGGGTAAAT 480 TTTCGGCAGC TCTCTTTTGG ACTCAGGACT TGTGCGGACT ATGAAATTCT CCTATGGTTT 540 GGGCGAAGAT TTATTCTCAG ATGGTGTTTG CTCCAGCTTG CCATCACTGA CACCTGCGCT 600 GCCTTCGCTC CCACCTTCCC TGTTTACTGT GTACTACGCT TCTTGGCAGG TTTTTCTTCC 660 ATGATCATTA TATCAAATAA TTCTTTGCCC ATTACTGAGT GGATAAGGCC CAACTCTAAA 720 GCCCTGGTAG TAATATTGTC ATCTGGTGCC CTTAGTATTG GACAGATAAT CCTGGGAGGC 780 TTGGCTTATG TCTTCCGAGA CTGGCAAACC CTGCACGTGG TGGCGTCTGT ACCTTTCTTT 840 GTCTTCTTTC TTCTTTCAAG GTGGCTGGTG GAATCTGCTC GGTGGTTGAT AATCACCAAT 900 AAACTAGATG AGGGCTTAAA GGCACTTAGA AAAGTTGCAC GCACAAATGG AATAAAGAAT 960 GCTGAAGAAA CCCTGAACAT AGAGGTTGTA AGATCCACCA TGCAGGAGGA GCTGGATGCA 1020 GCACAGACCA AAACTACTGT GTGTGACTTG TTCCGCAACC CCAGTATGCG TAAAAGGATC 1080 TGTATCCTGG TATTTTTGAG ATTTGCAAAC ACAATACCTT TTTATGGTAC CATGGTCAAT 1140 CTTCAGCATG TGGGGAGCAA CATTTTCCTG TTGCAGGTAC TTTATGGAGC TGTCGCTCTC 1200 ATAGTTCGAT GTCTTGCTCT TTTGACACTA AATCATATGG GCCGTCGAAT AAGCCAGATA 1260 TTGTTCATGT TCCTGGTGGG CCTTTCCATT TTGG CCAACA CGTTTGTGCC CAAAGAAATG 1320 CAGACCCTGC GTGTGGCTTT GGCATGTCTG GGAATCGGCT GTTCTGCTGC TACTTTTTCC 1380 AGTGTTGCTG TTCACTTCAT TGAACTCATC CCCACTGTTC TCAGGGCAAG AGCTTCAGGA 1440 ATAGATTTAA CGGCTAGTAG GATTGGAGCA GCACTGGCTC CCCTCTTGAT GACCTTAACG 1500 GTATTTTTTA CCACTTTGCC ATGGATCATT TATGGAATCT TCCCCATCAT TGGTGGCCTT 1560 ATTGTCTTCC TCCTACTAGA AACCAAGAAT CTGCCTTTGC CTGACACCAT CAAGGATGTG 1620 GAAAATCAAG CAGTGGGAGT GGGTGTAGTT GCCCAATCCA CTGTCCAGGT GCTTCCCATA 1680 GGAACACAGA GCTGCACCTA CTGGCAGAGT TCAGGCAGAG GTGGGTCCTC TGTGTTGGAA 1740 TCCCCAACTG GTGCATCCTG CCCAGTGAAG GTATACTGCA TGGAAAGTCA TCTTCATATT 1800 GACCCAGTAA TGGCACAAGA GGATGTAAAT TTATATTTCC AGGACCTCCT GGGTCACGCT 1860 GGTGACCTGT GGAGATTCCA GATCCTTCAG ACTGTTTTTC TCTCAATCTT TGCTGTTGCT 1920 ACATACCTTC ATTTTATGCT GGAGAACTTC ACTGCATTCA TACCTGGCCA TCGCTGCTGG 1980 GTCCACATCC TGGACAATGA CACTGTCTCT GACAATGACA CTGGGGCCCT CAGCCAAGAT 2040 GCACTCTTGA GAATCTCCAT CCCACTGGAC TCAAACATGA GGCCAGAGAA GTGTCGTCGC 2100 TTTGTTCATC CTCAGTGGCA GCTCCTTCAC CTGAATGGG A CCTTCCCCAA CACAAGTGAC 2160 GCAGACATGG AGCCCTGTGT GGATGGCTGG GTGTATGACA GAATCTCCTT CTCATCCACC 2220 ATCGTGACTG AGTGGGATCT GGTATGTGAC TCTCAATCAC TGACTTCAGT GGCTAAATTT 2280 GTATTCATGG CTGGAATGAT GGTGGGAGGC ATCCTAGGCG GTCATTTATC AGACAGTTGG 2340 CTGCTAGAGT CTGCTCGGTG GCTCATTATC AACAATAAAC CAGAGGAAGG CTTAAAGGAA 2400 CTTAGAAAAG CTGCACACAG GAGTGGAATG AAGAATGCCA GAGACACCCT AACCCTGGAG 2460 GTGAGCTGGA TGGGAGCTAG ATATGGGATT TGTTTCAGCT CAGTGCCAAG AGAGAACACC 2520 CTGGCCTATG ACCGCTCCCT CATAGAAAAG GAAGGAGTGG AGCAATACAC ATCTGGGCCT 2580 TTTGACACAC TGTGTGAGGA ACTGGTATTT GTCTCACCTC ACTCAGAGCA CTTATGGAAC 2640 TTGCATATTT GGATGTTTGG GTCACTGAAT AGAAGATTTG CAAACTTTAT GGCCTATTTT 2700 GGCCTTAATC TCCATGTCCA GCATCTGGGG AACAATGTTT TCCTGTTGCA GACTCTCTTT 2760 GGTGCAGTCA TCCTCCTGGC CAACTGTGTT GCACCTTGGG CACTGAAATA CATGAACCGT 2820 CGAGCAAGCC AGATGCTTCT CATGTTCCTA CTGGCAATCT GCCTTCTGGC CATCATATTT 2880 GTGCCACAAG AAATGCAGAC GCTGCGTGAG GTTTTGGCAA CACTGGGCTT AGGAGCGTCT 2940 GCTCTTGCCA ATACCCTTGC TTTTGCCCAT GGAAATGAAG TAAT TCCCAC CATAATCAGG 3000 GCAAGAGCTA TGGGGATCAA TGCAACCTTT GCTAATATAG CAGGAGCCCT GGCTCCCCTC 3060 ATGATGATCC TAAGTGTGTA TTCTCCACCC CTGCCCTGGA TCATCTATGG AGTCTTCCCC 3120 TTCATCTCTG GCTTTGCTTT CCTCCTCCTT CCTGAAACCA GGAACAAGCC TCTGTTTGAC 3180 ACCATCCAGG ATGAGAAAAA TGATGTGATA TGCACACTGT TGAAGGTATT TTACAAATAT 3240 GCAGAGATCC AAACACCAGA TTTTCATCCC TGGGGAACCC TCAAACAAGT GGGTACCTCT 3300 ACAAACTTTT TGGGTACCAC AAACCATACT TCTCCTTTTA TTCCCCAAGA ACAGCGAATA 3360 ACAAAGCTTG AAGATAACAA AAGGGGAGTA TGTGACAATA ACTTAAAACT GGGAACTAGA 3420 GAGCAGCTTC TTTCTACTCC TGGTGTCACC CAAGGGTCCC TTCTGGCTTT TCCCCTGCCG 3480 CCTCTGCCCT GCTGCCCCTA TGGGTCTGCT TCCAGTGTGG GGCTCAGAGG CAAAGGATCT 3540 CACAGCACCA CAGCCACTGA GGCCCTCATT CTACAAACAG GGGATCCAAG AGCCAGGGAG 3600 CGGAACTCAC TTGGACAGAG CCATACAGTG AATTCATGTC CAAACTTAGC TCTTGGGTTC 3660 TTGGGCCTCA TGACTCCTAG GCCCAAGCTT CTTCAGAGGA CTTCTTGTAA TGCCCTCAGT 3720 CCTTGGGGTC TTCATGTGCA AATTCTCACG GGACGGGAGG TTTCTCACAC CAGGGCCCAC 3780 CAAGCCCCGG ACACTAGAGA AAAGCCTCAC AAGAATGGAG TGCAGGCTGG AGAGGATGCA 3840 GAGCAGAGAG GAGGAAGGTG CAGAAAG 3867

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 43/00 111 C07K 14/47 4H045 C07K 14/47 16/18 16/18 C12N 1/15 C12N 1 / 15 1/19 1/19 1/21 1/21 C12P 21/02 C 5/10 G01N 33/15 Z C12P 21/02 33/50 Z G01N 33/15 C12P 21/08 33/50 C12N 15/00 ZNAA // C12P 21/08 5/00 A F term (reference) 2G045 AA40 DA12 DA13 DA36 FB02 FB03 FB05 FB06 FB07 4B024 AA01 AA11 BA43 CA03 GA03 GA11 HA04 HA12 HA15 HA17 4B064 AG27 CA10 CA19 CC24 DA01 DA13 4B065 AA9025 AB01 BA01 4C084 AA13 AA17 NA14 ZA752 ZA812 ZC022 4H045 AA10 AA11 AA20 AA30 BA10 CA40 DA50 DA76 EA20 EA50

Claims (16)

[Claims] 1. A protein comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, or a salt thereof. 2. A partial peptide of the protein according to claim 1, or a salt thereof. 3. A D-containing DNA encoding the protein according to claim 1 or the partial peptide according to claim 2.
NA. 4. The DNA according to claim 3, which has the base sequence represented by SEQ ID NO: 2. 5. A recombinant vector containing the DNA according to claim 4. 6. A transformant transformed with the recombinant vector according to claim 5. 7. The method according to claim 1, wherein the transformant according to claim 6 is cultured to produce and accumulate the protein according to claim 1 or the partial peptide according to claim 2, and collect the protein. 3. A method for producing a protein according to claim 2, or a partial peptide according to claim 2, or a salt thereof. 8. A pharmaceutical comprising the protein according to claim 1, the partial peptide according to claim 2, or a salt thereof. 9. A pharmaceutical comprising the DNA according to claim 3. 10. An antibody against the protein according to claim 1, the partial peptide according to claim 2, or a salt thereof. 11. The activity of the protein according to claim 1, the partial peptide according to claim 2, or a salt thereof, wherein the protein according to claim 1 or the partial peptide according to claim 2 or a salt thereof is used. A method of screening for a compound that promotes or inhibits or a salt thereof. 12. The activity of the protein according to claim 1, the partial peptide according to claim 2, or a salt thereof, comprising the protein according to claim 1 or the partial peptide according to claim 2, or a salt thereof. A kit for screening a compound to be inhibited or a salt thereof. (13) promoting or inhibiting the activity of the protein of (1), the partial peptide of (2), or a salt thereof obtained by using the screening method of (11) or the screening kit of (12); Or a salt thereof. 14. The protein according to claim 1, which is obtained by using the screening method according to claim 11 or the screening kit according to claim 12.
A medicament comprising a compound or a salt thereof that promotes or inhibits the activity of the partial peptide or a salt thereof described above. 15. The medicament according to claim 8 or 9, which is an agent for preventing or treating kidney disease and liver disease. 16. The medicament according to claim 14, which is an agent for preventing or treating kidney disease and liver disease.