JP2002095488A - Calcitonin receptor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a newly identified polynucleotide, a polypeptide encoded by the same, usages of these polypeptides and a method for producing the polypeptides. SOLUTION: A polynucleotide isolated from human. The isolated polynucleotide is selected from the group consisting of (a) polynucleotides each encoding a G-protein conjugated receptor polypeptide having a specific estimated amino acid sequence, or a fragment, an analog or a derivative of the polypeptide; and (b) polynucleotides each encoding a G-protein conjugated receptor polypeptide having an amino acid sequence encoded by a cDNA contained in ATCC stipulation No.75,824, or a fragment, an analog or a derivative of the polypeptide. The polypeptide is useful for treating, for example, hypercalcemia, a disease of bone remodeling including osteoporosis, osteal deformans and some types of hypercalcemia in malignant tumors.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, and the use of such polynucleotides and polypeptides. Related to the generation of

[0002]

BACKGROUND OF THE INVENTION It is well established that a number of medically important biological processes are mediated by proteins involved in signal transduction pathways, including G proteins and / or second messengers (eg, cAMP). (Lefkowitz, Nature, 35
1: 353-354 (1991)). In this specification,
These proteins are referred to as proteins involved in pathways using G proteins or PPG proteins. Some examples of these proteins include GPC receptors (eg, GPC receptors for adrenergic drugs and dopamine (Kobilka, BK.
Et al., PNAS, 84: 46-50 (1987); Kob.
ilka, B .; K. Et al., Science, 238: 65.
0-656 (1987); R. Et al.
Nature, 336: 783-787 (198).
8))), the G protein itself, effector proteins (eg, phospholipase C, adenyl cyclase, and phosphodiesterase), and actuator proteins (actuator proteins)
n) (eg, protein kinase A and protein kinase C (Simon, MI, et al., Science)
e, 252: 802-8 (1991))).

For example, in one form of signaling,
The effect of hormone binding is the activation of the enzyme adenylate cyclase in the cell. Activation of enzymes by hormones depends on the presence of the nucleotide GTP, and GT
P also affects hormone binding. The G protein links the hormone receptor to adenylate cyclase. G proteins have been shown to convert GTP to bound GDP when activated by hormone receptors. The form with GTP then binds to activated adenylate cyclase. The hydrolysis of GTP to GDP is catalyzed by the G protein itself,
Return the protein to its basal, inactive form. Thus, the G protein plays two roles: as an intermediate that relays the signal from the receptor to the effector, and as a clock that controls the duration of the signal.

[0004] The calcitonin receptor acts by binding to calcitonin, which activates adenylate cyclase via the G protein. Another major pathway for intracellular signaling by calcitonin is cytoplasmic cAMP.
Through the increase.

[0005] Lin et al. ( Science , 254: 10).
22-1024, (1991)) by cloned calcitonin receptors are believed to couple to G _s alpha is guanosine triphosphate (GTP) binding proteins of the heterotrimeric that are sensitive to the cholera toxin. This receptor may also couple to additional signaling pathways via the pertussis toxin-sensitive G protein in isolated osteoclasts.

[0006] Chabre et al. ( Molecular E
ndocrinology , 6: 551-556 (19
92)) recombinant calcitonin receptors described by, presumably by conjugation with G _s, intracellular cA
Functionally conjugated to increase MP. therefore,
It appears to be a family of novel G protein-coupled receptors that activate adenylate cyclase.

[0007] The calcitonin receptor binds to calcitonin. Calcitonin is a 32-amino acid peptide hormone originally identified as a hypocalcemic factor secreted by cells around vesicles of the thyroid in response to elevated serum calcium (Copp et al., Endocrit).
nology, 70: 638-649 (1962) ).
The hypocalcemic effect of calcitonin is mediated primarily by direct inhibition of osteoclast-mediated bone resorption (F
reidman and Raisz, Science , 1
50: 1465-1467, (1965)). Calcitonin also promotes renal calcium excretion (Haa
s et al . Clin. Invest . , 50: 2689
-2701 (1972)). In addition to bone and kidney receptors, high affinity calcitonin binding sites have been demonstrated in many different tissues and sperm, including the central nervous system, testis, placenta, lung. Cells from lung and breast cancer,
And certain lymphoid and myeloid cell lines also express receptors for this hormone. Although this physiological role of calcitonin in many of these tissues is not yet well understood, its effects clearly extend beyond its effects on calcium homeostasis.

[0008]

Therapeutic objectives include, for example, hypercalcemia, diseases of bone remodeling including osteoporosis, osteoarthritis, and some forms of hypercalcemia in malignancies. There is a need for treatment.

[0009]

SUMMARY OF THE INVENTION The present invention relates to an isolated polynucleotide comprising: (a) a G protein-coupled receptor polypeptide having the deduced amino acid sequence of FIG. 1; or a fragment, analog or derivative of this polypeptide. (B) ATC
A G protein-coupled receptor polypeptide having an amino acid sequence encoded by the cDNA contained in C Deposit No. 75824, or a polynucleotide encoding a fragment, analog, or derivative of this polypeptide; An isolated polynucleotide is provided.

[0010] In a preferred embodiment, the polynucleotide is DNA.

[0011] In a preferred embodiment, the polynucleotide is RNA.

[0012] In a preferred embodiment, the polynucleotide is genomic DNA.

In a preferred embodiment, the polynucleotide encodes a G protein-coupled receptor having the deduced amino acid sequence of FIG.

[0014] In a preferred embodiment, the polynucleotide encodes a G protein-coupled receptor polypeptide encoded by the cDNA of ATCC Deposit No. 75824.

In a preferred embodiment, the polynucleotide has the G protein-coupled receptor coding sequence shown in FIG.

In a preferred embodiment, the polynucleotide has a G protein-coupled receptor coding sequence deposited as ATCC Deposit No. 75824.

The present invention also provides a vector containing the above DNA.

[0018] The present invention also provides a host cell genetically engineered using the above vector.

The present invention also provides a process for producing a polypeptide, comprising the step of expressing the polypeptide encoded by the DNA from the host cell.

The present invention also provides a process for producing a cell capable of expressing a polypeptide, comprising the step of genetically engineering a cell using the above vector.

The present invention also provides an isolated DNA capable of hybridizing with the above DNA and encoding a polypeptide having G protein-coupled receptor activity.

The present invention also relates to a polypeptide,
(I) a G protein-coupled receptor polypeptide having the deduced amino acid sequence of FIG. 1 and a fragment thereof;
An analog and a derivative, and (ii) a G protein-coupled receptor polypeptide encoded by the cDNA of ATCC Deposit No. 75824, and a polypeptide selected from the group consisting of fragments, analogs and derivatives of this polypeptide.

In a preferred embodiment, the polypeptide is a G protein-coupled receptor having the deduced amino acid sequence of FIG.

The present invention also provides an antibody against the above polypeptide.

The present invention also provides a compound that activates the above-mentioned G protein-coupled receptor polypeptide.

The present invention also provides a compound that inhibits the activation of the G protein-coupled receptor polypeptide.

The present invention also provides a method of treating a patient in need of activating the G protein-coupled receptor polypeptide, said method comprising administering to said patient a therapeutically effective amount of said compound. provide.

The present invention also provides a method of treating a patient in need of inhibiting the activation of the G protein-coupled receptor, said method comprising administering to said patient a therapeutically effective amount of said compound. provide.

[0029] In a preferred embodiment, the polypeptide is a soluble fragment of the G protein-coupled receptor and has the ability to bind a ligand to the receptor.

The present invention also relates to a process for identifying antagonists and agonists of a G protein-coupled receptor, comprising the step of expressing the G protein-coupled receptor on the surface of a cell, the step of expressing the cell as a receptor ligand and screening. Contacting the compound, determining whether a secondary signal results from the interaction of the ligand and the receptor,
And a process comprising identifying whether the compound to be screened is an agonist or an antagonist.

The present invention also relates to a process for determining whether a ligand not known to have the ability to bind to a G protein-coupled receptor can bind to the same, the method comprising the steps of: To a potential ligand, detecting the presence of the ligand that binds to the receptor, and determining whether the ligand binds to the G protein-coupled receptor.

According to one aspect of the present invention, there is provided a novel polypeptide putatively identified as a calcitonin receptor, and fragments, analogs and derivatives thereof. The polypeptides of the present invention are of human origin.

According to another aspect of the present invention, there is provided a polynucleotide (DNA or RNA) encoding such a polypeptide.

According to a further aspect of the present invention there is provided a process for producing such a polypeptide by recombinant techniques.

According to a still further aspect of the present invention, there are provided antibodies against such polypeptides.

According to another embodiment, a process is provided for using the receptor to screen for receptor antagonists and / or agonists and / or receptor ligands.

According to yet another embodiment of the present invention, for therapeutic purposes, for example, diseases of bone remodeling including hypercalcemia, osteoporosis, osteoarthritis, and some forms of malignancy A process using such an agonist is provided for the treatment of hypercalcemia.

According to another embodiment of the present invention, there is provided a process for using such an antagonist in the treatment of hypocalcemia.

[0039] These and other aspects of the invention include:
It should be apparent to those skilled in the art from the teachings herein.

[0040]

DETAILED DESCRIPTION OF THE INVENTION It should be pointed out that sequence errors are a common problem encountered in polynucleotide sequences. Therefore, the sequences in the figures are based on several sequencing experiments and the sequence accuracy is considered to be at least 97%.

According to one aspect of the present invention, it encodes the mature polypeptide having the deduced amino acid sequence of FIG. 1 or as ATCC Deposit No. 75824, 1994.
Provided is an isolated nucleic acid (polynucleotide) encoding a mature polypeptide encoded by the cDNA of the clone deposited on June 24, 2012.

[0042] Polynucleotides encoding the polypeptides of the present invention can be found in lung, heart, and kidney. The polynucleotide of the present invention comprises c-derived human synovium.
Found in DNA libraries. It is structurally related to the G protein-coupled receptor family. It contains an open reading frame encoding a protein of 472 amino acid residues. The first about 32 amino acid residues of this protein are the putative leader sequence, and therefore the mature protein covers 440 amino acid residues. This protein shows the highest degree of homology to the human calcitonin receptor with 54% identity and 72% similarity over 469 amino acids in length.

The polynucleotide of the present invention may be in the form of RNA or DNA. DNA is cDN
A, including genomic DNA and synthetic DNA. DNA
Can be double-stranded or single-stranded. And in the case of a single strand, it can be a coding strand or a non-coding (antisense) strand. The coding sequence encoding the mature polypeptide may be identical to the coding sequence shown in FIG. 1 or may be identical to the coding sequence of the deposited clone. Or
The coding sequence is a duplicate of the genetic code
y) or, as a result of degeneracy, a different coding sequence encoding the same mature polypeptide as the DNA of FIG. 1 or the deposited cDNA.

The mature polypeptide of FIG. 1 or the deposited c
The polynucleotides encoding the mature polypeptide encoded by the DNA are: the coding sequence of the mature polypeptide only; the coding sequence of the mature polypeptide and additional coding sequences (eg, a leader or secretory or proprotein sequence; It may include coding sequences for the peptide (and additional coding sequences where appropriate) as well as non-coding sequences (eg, non-coding sequences 5 'and / or 3' to the coding sequence of an intron or mature polypeptide).

Thus, the term "polynucleotide encoding a polypeptide" includes polynucleotides comprising only the coding sequence of the polypeptide as well as polynucleotides comprising additional coding and / or non-coding sequences.

The present invention further relates to a polypeptide having the deduced amino acid sequence of FIG.
A fragment of the polypeptide encoded by A,
Variants of the above-described polynucleotides encoding analogs and derivatives. A variant of a polynucleotide can be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

Accordingly, the present invention encompasses polynucleotides encoding the same mature polypeptide as shown in FIG. 1 or the same mature polypeptide encoded by the cDNA of the deposited clone, as well as variants of such polynucleotides. I do. These variants encode fragments, derivatives, or analogs of the polypeptides encoded by the polypeptides of FIG. 1 or the cDNA of the deposited clone. Such nucleotide variants include deletion variants, substitution variants, and addition or insertion variants.

As indicated hereinabove, the polynucleotide may have a coding sequence that is a naturally occurring allelic variant of the coding sequence shown in FIG. 1 or the coding sequence of the deposited clone. As is known in the art, an allelic variant is another form of a polynucleotide sequence that may have one or more nucleotide substitutions, deletions, or additions, which is a function of the encoded polypeptide. Is not substantially changed.

The present invention also includes polynucleotides in which the sequence encoding the mature polypeptide can be fused in the same reading frame to the polynucleotide sequence. The polynucleotide sequence aids in the expression and secretion of the polypeptide from the host cell (eg, a leader sequence that functions as a secretory sequence to control translocation of the polypeptide from the cell). A polypeptide having a leader sequence is a preprotein, and may have the leader sequence cleaved by the host cell to form a mature form of the polypeptide. A polynucleotide may also encode a mature protein and a proprotein that is an additional 5 'amino acid residue. A mature protein having a prosequence is a proprotein, which is an inactive form of the protein. Once the prosequence is cleaved, the active mature protein remains.

Thus, for example, the polynucleotide of the present invention may be a mature protein, a protein having a prosequence, or a prosequence and a presequence (leader sequence).
May be encoded.

The polynucleotide of the present invention may also have the coding sequence fused in frame to a marker sequence that allows for purification of the polypeptide of the present invention. The marker sequence may be a hexahistidine tag provided by the pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host. Or
For example, the marker sequence may be a mammalian host (eg, CO
If S-7 cells are used, hemagglutinin (H
A) It can be a tag. The HA tag corresponds to an epitope from the influenza hemagglutinin protein (W
ilson, I .; Et al., Cell, 37: 767 (198).
4)).

The present invention further provides that at least 50
% And preferably 70% identity, relates to polynucleotides that hybridize to the sequences herein above. The invention particularly relates to polynucleotides that hybridize under stringent conditions to the herein above-described polynucleotides. As used herein, the term "stringent conditions" means that hybridization occurs only when there is at least 95%, and preferably at least 97%, identity between the sequences. In a preferred embodiment, a polynucleotide that hybridizes to a polynucleotide as described herein above has substantially the same biological function or biological activity as the mature polypeptide encoded by the cDNA of FIG. 1 or the deposited cDNA. Encodes the polypeptide to be retained. That is, the polypeptide functions as a G protein-coupled receptor, or retains the ability to bind to a ligand for the receptor, even if the polypeptide does not function as a G protein-coupled receptor (eg, a soluble form of the receptor).

The deposit (s) referred to herein are maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the purposes of patent proceedings.
These deposits are provided for convenience only to one of ordinary skill in the art and are not an admission that a deposit is required under 35 USC 112. The sequence of the polynucleotide contained in the deposit, as well as the amino acid sequence of the polypeptide encoded thereby, is incorporated herein by reference and any conflicts with any description of the sequences herein. You also have control. Manufacturing deposits,
A license may be required to use or sell, and no such license is granted by this specification.

The present invention further relates to G protein-coupled receptor polypeptides having the deduced amino acid sequence of FIG. 1 or having the amino acid sequence encoded by the deposited cDNA, and fragments, analogs, and derivatives of such polypeptides. .

The terms “fragment”, “derivative”, and “analog” when referring to the polypeptide of FIG. 1 or the polypeptide encoded by the deposited cDNA, are substantially the same organisms as such polypeptide. A polypeptide that retains a biological function or biological activity. That is, the polypeptide functions as a G protein-coupled receptor, or retains the ability to bind to a receptor or ligand, even when the polypeptide does not function as a G protein-coupled receptor (eg, a soluble form of the receptor). Analogs include proproteins that can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

[0056] The polypeptide of the present invention can be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide, preferably a recombinant polypeptide.

The polypeptide of FIG. 1 or the deposited cDN
A fragment of the polypeptide encoded by A,
Derivatives or analogs are characterized in that (i) one or more amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue), and such a substituted amino acid residue is Fragments, derivatives, or analogs that may or may not be amino acid residues encoded by the genetic code, or (ii) fragments, derivatives, in which one or more amino acid residue contains a substituent, Or an analog, or (iii) a fragment, derivative, or analog in which the mature polypeptide is fused to another compound, such as a compound that increases the half-life of the polypeptide (eg, polyethylene glycol), or (iv) ) Wherein a leader or secretory sequence or a mature polypeptide or pro In which the additional amino acids, such as a sequence which is employed for purification of the protein sequences are fused to the mature polypeptide, a derivative or analog. Such fragments, derivatives, and analogs are considered to be within the purview of those skilled in the art from the teachings herein.

The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and are preferably purified to homogeneity.

The term "isolated" means that the substance has been removed from its original environment (eg, the natural environment, if it occurs naturally). For example, a naturally occurring polynucleotide or polypeptide present in a living animal has not been isolated, but the same polynucleotide or polypeptide separated from some or all of the coexisting materials in the natural system has been isolated. Have been. Such a polynucleotide can be part of a vector,
And / or such a polynucleotide or polypeptide may be part of a composition, and may still be isolated because such a vector or composition is not part of its natural environment.

The present invention also relates to vectors containing the polynucleotides of the present invention, host cells that are genetically engineered with vectors of the present invention, and the production of polypeptides of the present invention by recombinant techniques.

The host cell is genetically engineered (transduced or transformed or transfected) with a vector of the invention, which can be, for example, a cloning vector or an expression vector. Vectors, for example,
It can be in the form of a plasmid, virus particle, phage, and the like. The engineered host cell activates the promoter,
Transformants can be cultured in conventional nutrient media, suitably modified for selection, or for CRT gene amplification. Culture conditions (eg, temperature, pH, etc.) are those previously used in the host cell selected for expression, and will be apparent to those skilled in the art.

[0062] The polynucleotides of the present invention can be used to produce polypeptides by recombinant techniques. Thus, for example, a polynucleotide can be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, non-chromosomal, and synthetic DNA sequences and include, for example, derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids;
Vectors derived from combination of A, vaccinia, adenovirus, fowlpox virus, and viral DNA such as pseudorabies. However, any other vector can be used as long as it is replicable and viable in the host.

[0063] The appropriate DNA sequence can be inserted into the vector by a variety of procedures. Generally, the DNA sequence is inserted into the appropriate restriction endonuclease site (s) by procedures known in the art. Such and other procedures are considered to be within the purview of those skilled in the art.

The DNA sequence in the expression vector is operably linked to an appropriate expression control sequence (s) (promoter) to direct the synthesis of mRNA. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, E. co
Li lac or trp , the phage lambda P _L promoter, and other promoters known to control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector may also contain a ribosome binding site for translation initiation and a transcription terminator. Vectors may also include appropriate sequences for amplifying expression.

In addition, the expression vector is preferably a phenotypic trait for selection of transformed host cells (eg, dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or tetracycline resistance in E. coli) . (Or ampicillin resistance).

A vector containing a suitable DNA sequence as described herein above and a suitable promoter or control sequence can be used to transform a suitable host to express the protein in the host.

Representative examples of suitable hosts may include: bacterial cells (eg, E. coli , St.
reptomyces, Salmonella typ
Himurium); fungal cells (such as yeast); insect cells (e.g., Drosophila and Sf9); animal cells (e.g., CHO, COS or Bowes melanoma); plant cells, etc.. The selection of a suitable host is considered to be within the scope known to those skilled in the art from the teachings herein.

More particularly, the present invention also encompasses a recombinant construct comprising one or more of the sequences broadly described above. The constructs include a vector (eg, a plasmid vector or a viral vector) into which the sequence of the invention has been inserted in a forward or reverse orientation. According to a preferred aspect of this embodiment, the construct further comprises a regulatory sequence operably linked to the sequence (eg, including a promoter). Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided as examples. Bacterial: pQE70, pQE60, pQE-9
(Qiagen), pbs, pD10, phasesc
Rip, psiX174, pbluescript
SK, pbsks, pNH8A, pNH16a, pNH
18A, pNH46A (Stratagene); pt
rc99a, pKK223-3, pKK233-3, p
DR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pX
T1, pSG (Stratagene), pSVK3,
pBPV, pMSG, pSVL (Pharmaci
a). However, any other plasmid or vector can be used as long as it is replicable and viable in the host.

The promoter region can be selected from any desired gene using a CAT (chloramphenicol transferase) vector or other vector having a selectable marker. Two suitable vectors are p
KK232-8 and PCM7. Particularly well-known bacterial promoters include lacI, lacZ, T3, T3.
7, including gpt, λP _R , P _L , and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell (eg, a mammalian cell) or a lower eukaryotic cell (eg, a yeast cell), or the host cell can be a prokaryotic cell (eg, a bacterial cell). Introduction of the construct into host cells can be achieved by calcium phosphate transfection, DEAE-dextran mediated transfection or electroporation (Davis, L., Dibner, M., Batte).
y, I. , Basic Methods in Mol
ecology Biology, (1986)).

The construct in a host cell can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptide of the present invention comprises
It can be produced synthetically by conventional peptide synthesizers.

[0072] Mature proteins include mammalian cells, yeast,
It can be expressed in bacteria, or other cells, under the control of a suitable promoter. Cell-free translation systems can also be used to produce such proteins, using RNA from the DNA constructs of the present invention. Suitable cloning and expression vectors for use in prokaryotic and eukaryotic hosts are described in Sambrook et al., Molecule.
ar Cloning: A Laboratory
Manual, Second Edition (Cold Spring Ha)
rbor, N .; Y. (1989)), the disclosure of which is incorporated herein by reference.

DNA encoding the polypeptide of the present invention
Is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to about 300 bp, which act on a promoter to increase its transcription. As an example, the replication origin bp100-
Includes the SV40 enhancer on the late side of 270, the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

In general, the recombinant expression vectors contain an origin of replication and selectable markers that allow transformation of the host cell (eg, the ampicillin resistance gene of E. coli and the TRP1 gene of S. cerevisiae ) and the transcription of downstream structural sequences. Contains a promoter derived from a highly expressed gene. Such promoters may be derived from operons encoding glycolytic enzymes (eg, 3-phosphoglycerate kinase (PGK)), α-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably a leader sequence capable of directing secretion of the translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein that includes an N-terminal identification peptide that provides the desired characteristics (eg, stabilization or simplified purification of the expressed recombinant product).

Expression vectors useful for bacterial use are prepared by inserting a structural DNA sequence encoding the desired protein into an operable read phase having a functional promoter, with appropriate translation initiation and termination signals. Be built. The vector may contain one or more phenotypic selectable markers, as well as the maintenance of the vector,
And optionally an origin of replication to provide for amplification in the host. Suitable prokaryotic hosts for transformation are
E. FIG. E. coli , Bacillus subtilis ,
Salmonella typhimurium , and genus Pseudomonas, Streptomyc
Includes various species of the genus es, and Staphylococcus, but other species can also be used as selections.

As a typical, but not limiting example, expression vectors useful for bacterial use include selection markers derived from commercially available plasmids containing the genetic elements of the well-known cloning vector pBR322 (ATCC 37017) and bacterial origins of replication. May be contained. Such commercially available vectors are, for example, pKK223-3 (Phar
macia Fine Chemicals, Upps
ala, Sweden) and GEM1 (Promeg)
a Biotec, Madison, WI, USA). These pBR322 "backbone" portions are combined with an appropriate promoter and the structural sequence to be expressed.

Following transformation of the appropriate host strain and propagation of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (eg, temperature shift or chemical induction) and Is cultured for an additional period.

The cells are typically collected by centrifugation, disrupted by physical or chemical means, and the resulting crude extract is retained for further purification.

The microbial cells used in protein expression can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or the use of cell lysing agents. It is well known to those skilled in the art.

[0082] Various mammalian cell culture systems can also be used to express the recombinant protein. Examples of mammalian expression systems are described in Gluzman, Cell, 23: 1.
75 (1981), and other cell lines capable of expressing compatible vectors (e.g., C127, 3T3, CHO, He).
La, and BHK cell lines). Mammalian expression vectors contain an origin of replication, a suitable promoter and enhancer, and any further necessary ribosome binding, polyadenylation, splice donor and splice acceptor sites, transcription termination sequences, and 5 'flanking non-transcribed sequences. It contains. DNA sequences derived from the SV40 splice and polyadenylation sites can be used to provide the necessary non-transcribed genetic elements.

[0081] G protein-coupled receptor polypeptides can be recovered from recombinant cell culture and purified by the methods described below. These methods include ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography, and lectin chromatography. Included. If desired, a protein refolding step can be used to complete the configuration of the mature protein. Finally,
High performance liquid chromatography (HPLC) can be used for the final purification step.

The polypeptides of the present invention may be natural, purified products, or products of chemical synthesis procedures, or may be prokaryotic or eukaryotic hosts (eg, bacteria, yeast, higher plants, insects in culture). , And by mammalian cells). Depending on the host used in the recombinant production procedure, the polypeptides of the invention can be glycosylated or not glycosylated. The polypeptides of the present invention may also include a starting methionine amino acid residue.

The G protein-coupled receptor of the present invention
It can be used in the process of screening for antagonists and / or agonists of the receptor.

In general, such screening procedures involve providing suitable cells that express the receptor on the cell surface. In particular, the polynucleotide encoding the receptor of the invention is used to transfect cells, thereby expressing a G protein-coupled receptor. Such transfection can be accomplished by a procedure as described herein above.

One such screening procedure is:
Includes the use of melanocytes transfected to express a G protein-coupled receptor of the invention. Such a screening technique is described in PCT WO 92/01810 published February 6, 1992.

Thus, for example, such an assay
Contacting a melanocyte encoding a G protein-coupled receptor with both a receptor ligand and a selected compound can be used to screen for receptor antagonists. Inhibition of the signal produced by the ligand indicates that the compound is a potential antagonist of the receptor, ie, that the compound inhibits activation of the receptor.

This screening method can be used to determine agonists by contacting such cells with the compound to be screened, and to determine whether such compound produces a signal, That is, such compounds can be used to determine whether they activate the receptor.

Other screening techniques include the use of cells that express a G protein-coupled receptor (eg, transfected CHO cells) in a system that measures extracellular pH changes caused by receptor activation. This is, for example, Science24
6, pp. 181-296 (October 1989). For example, a potential agonist or antagonist can be contacted with a cell that expresses a G protein-coupled receptor, and the secondary signaling response (eg, signal transduction or pH change) determines whether the potential agonist or antagonist is effective. Can be measured to determine

Another such screening technique is G
Xen encoding RNA encoding protein-coupled receptor
transfection into opus oocytes and transient expression of the receptor. The receptor oocyte can then be contacted with a receptor ligand and a selected compound in the case of antagonist screening, followed by detection of inhibition of the calcium signal.

Another screening technique involves the expression of a G protein-coupled receptor on a receptor that is linked to phospholipase C or D. Representative examples of such cells can include endothelial cells, smooth muscle cells, fetal kidney cells, and the like. Screening for antagonists or agonists can be accomplished by detection of receptor activation or inhibition of receptor activation by a secondary phospholipase signal, as described herein above.

Another method involves screening for antagonists by determining the inhibition of binding of the labeled ligand to cells having receptors on the cell surface. Such methods involve DNA encoding a G protein-coupled receptor such that the cell expresses the receptor on its surface.
Transfecting a eukaryotic cell with the cell, and contacting the cell with a potential antagonist in the presence of a known ligand in labeled form. The ligand can be labeled, for example, by radioactivity. The amount of the labeled ligand bound to the receptor can be measured, for example, by measuring the radioactivity of the receptor. When a potential antagonist binds to the receptor, as determined by a decrease in labeled ligand binding to the receptor, binding of the labeled ligand to the receptor is inhibited.

The present invention also provides a method for determining whether a ligand, which is not known to be capable of binding to a G protein-coupled receptor, is capable of binding to such a receptor (conditions under which the ligand can bind to a G protein-coupled receptor). Below,
Including contacting the ligand with a mammalian cell that expresses a G protein-coupled receptor), and detecting the presence of the ligand that binds to the receptor, and
Methods for determining whether a ligand binds to a G protein-coupled receptor are provided. The systems described herein above for determining agonists and / or antagonists can also be used to determine ligand binding to the receptor.

In general, G protein-coupled receptor antagonists determined by the screening procedure can be used for a variety of therapeutic purposes. For example, such antagonists may include hypertension, angina, myocardial infarction, ulcer, asthma, allergy, psychosis, depression, migraine, vomiting,
And benign prostate hyperplasia.

Agonists of G protein-coupled receptors are also effective for therapeutic purposes such as asthma, Parkinson's disease, acute heart failure, hypotension, urinary retention, and osteoporosis.

Potential antagonists are antibodies, or, in some cases, oligonucleotides, which bind to the G protein-coupled receptor but do not induce a second transduction response that interferes with the activity of the G protein-coupled receptor. . Potential antagonists also include proteins that are closely related to the ligand of the G protein-coupled receptor, ie, fragments of the ligand, which lose biological function and which respond to binding to the G protein-coupled receptor. Does not induce at all.

[0096] Potential antagonists also include antisense constructs prepared by use of antisense technology. Antisense technology can be used to control gene expression via triple helix formation or antisense DNA or RNA, both of which methods are based on the binding of a polynucleotide to DNA or RNA. For example, the 5 'coding portion of the polynucleotide sequence encoding the mature polypeptide of the present invention may be about 1 in length.
Used to design 0-40 base pair antisense RNA oligonucleotides. DNA oligonucleotides are designed to be complementary to the gene region involved in transcription (triple helix-Lee et al., Nucl. Acids Re.
s. , 6: 3073 (1979); Cooney et al., S.
science, 241: 456 (1988); and D
ervan et al., Science, 251: 1360.
(See (1991)), thereby inhibiting transcription and production of G protein-coupled receptors. Antisense RNA oligonucleotides are used in vivo to mRN
Hybridizes with A and blocks the translation of mRNA molecules into G protein-coupled receptors (antisense-Okano, J. Neurochem., 56:
560 (1991); Oligodeoxynuclecle
oides as Antisense Inhib
itors of Gene Expression,
CRC Press, Boca Raton, FL (1
988)). The above oligonucleotides can also be delivered to cells, where antisense RNA or DNA is expressed in vivo to inhibit the production of G protein-coupled receptors.

Another potential antagonist is a small molecule that binds to the G protein-coupled receptor, rendering the G protein-coupled receptor inaccessible to the ligand and inhibiting normal biological activity. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules.

[0098] Potential antagonists also include soluble forms of G protein-coupled receptors (eg, fragments of the receptor), which bind to ligand and inhibit ligand from interacting with membrane-bound G protein-coupled receptor. I do.

The G protein-coupled receptor of the present invention comprises
It has been putatively identified as a calcitonin receptor. This identification is based on amino acid sequence homology results.

Antagonists can be used to treat hypocalcemia by preventing the interaction of calcitonin, a hypocalcemic factor with the calcitonin receptor. This interference stops the inhibition of osteoclast-mediated bone resorption. Antagonists can be used in the compositions with, for example, a pharmaceutically acceptable carrier as described herein below.

Agonists identified by the above screening methods can be used to treat disorders of bone remodeling, including osteoporosis, osteoarthritis and some forms of malignant hypercalcemia.

The calcitonin receptor polypeptides and antagonists or agonists that are polypeptides can be used in accordance with the present invention by expression of such polypeptides in vivo. This is often called "gene therapy".

Thus, for example, cells from a patient can be engineered ex vivo with a polynucleotide (DNA or RNA) encoding a polypeptide, and the engineered cells can then be treated with the polypeptide to be treated with the polypeptide. Provided to Such methods are well-known in the art. For example, cells can be prepared by using retroviral particles containing RNA encoding a polypeptide of the invention.
It can be operated by procedures known in the art.

Similarly, cells can be engineered in vivo for expression of the polypeptide in vivo, for example, by procedures known in the art. As known in the art,
Producer cells for producing retroviral particles containing RNA encoding a polypeptide of the invention can be administered to a patient for engineering cells in vivo and for expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the invention by such methods will be apparent to those skilled in the art from the teachings of the present invention. For example, an expression vehicle for manipulating cells can be other than a retrovirus (eg, an adenovirus). This can be used to manipulate cells in vivo after being combined with a suitable delivery vehicle.

The calcitonin receptor and antagonists or agonists can be used in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such carriers include:
Saline, buffered saline, dextrose, water,
Glycerol, ethanol, and combinations thereof, but are not limited to. The formulation should suit the mode of administration.

The present invention also relates to one of the pharmaceutical compositions of the present invention.
A pharmaceutical pack or kit comprising one or more containers filled with the above components is provided. For such containers,
A product label may be provided in a form prescribed by a governmental agency that controls the manufacture, use, or sale of a drug or biological product, and this product label may be approved by the agency in manufacturing, using, or marketing for human administration Represents Further, the polypeptides of the present invention can be used in combination with other therapeutic compounds.

The pharmaceutical compositions can be administered in a convenient manner, such as by the topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal route. The pharmaceutical composition is administered in an amount effective to treat and / or prevent the specific condition. Generally, the pharmaceutical compositions will be administered in an amount of at least about 10 μg / kg body weight, and often they will be administered in an amount of about 8
It is administered in an amount not exceeding mg / kg body weight. In many cases, the dosage is about 10 μg / kg to about 1 mg / kg of body weight per day, taking into account the administration route, symptoms, and the like.

Antibodies specific for the calcitonin receptor can be used as a diagnostic tool to find diseased cells that express the calcitonin receptor, using any of the methods available for such purposes available in the art. For example, immunofluorescence or radioactive labeling techniques can be performed as a means of identifying or classifying cells expressing calcitonin receptor in a tissue or in each cell. The antibodies can also be used to screen bacterial expression libraries for the presence of calcitonin receptor or molecules associated with calcitonin receptor.

The sequences of the present invention may also be useful for chromosome identification. This sequence can specifically target a particular location on an individual human chromosome and hybridize at that location. In addition, it is now necessary to identify specific sites on the chromosome. Currently, there are few chromosome labeling reagents based on actual sequence data (repetitive polymorphisms) available for labeling chromosomal locations. The mapping of DNA to chromosomes according to the present invention is an important first step in correlating these sequences with genes associated with disease.

[0110] Briefly, the sequence is derived from cDNA by P
The chromosome can be mapped by preparing a CR primer (preferably 15-25 bp). Computer analysis of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA and thus do not complicate the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

[0111] PCR mapping of somatic cell hybrids is a rapid procedure for assigning specific DNA to specific chromosomes. The present invention can be used with the same oligonucleotide primers to sublocate a panel of fragments from a particular chromosome or a pool of large genomic clones in a similar manner.
ation) can be achieved. Other mapping strategies that can also be used to map to chromosomes include in situ hybridization, pre-screening using labeled flow cytometric chromosomes, and chromosome-specific cDN.
Preselection by hybridization to construct the A library.

Fluorescence in situ hybridization (FISH) of cDNA clones to metaphase chromosomal spreads
Can be used to provide a precise chromosomal location in one step. This technique can be used with cDNAs as short as 500 or 600 bases; however, clones larger than 2,000 bp are more likely to bind to unique chromosomal locations with sufficient signal intensity for convenient detection. FISH
Requires the use of a clone from which the EST is derived, and the longer the clone, the more preferred. For example, 2,000
0 bp is better, 4,000 bp is better, and lengths greater than 4,000 bp are (resonable percentage) in a reasonable percentage of the time.
age of the time It is probably not necessary for good results. For a review of this technology, see Verma et al., Human Chromosom.
es: a Manual of Basic Tec
hniques, Pergamon Press, Ne
See w York (1988).

Once a sequence has been mapped to a precise chromosomal location, the physical location of the sequence on the chromosome can be correlated with genetic map data. Such data, for example,
V. McKusick, Mendelian Inhe
liter in Man (Joh
ns Hopkins University Wel
ch Online available from the Medical Library). Next, the relationship between the disease and the gene mapped to the same chromosomal region is identified by linkage analysis (simultaneous inheritance of physically adjacent genes).

Next, the cD between affected and unaffected individuals
It is necessary to determine NA or genomic sequence differences. If the mutation is observed in some or all affected individuals but not in normal individuals, then the mutation is likely to be a causative agent of the disease.

At the current resolution of physical and genetic mapping techniques, a cDNA correctly located in a chromosomal region associated with a disease may be one of between 50 and 500 potential causative genes. (This is at a mapping resolution of 1 megabase and 1 per 20 kb
Assume gene. The polypeptides, fragments or other derivatives thereof, or analogs thereof, or cells expressing them, can be used as immunogens to generate antibodies against them. These antibodies can be, for example, polyclonal or monoclonal antibodies.
The invention also encompasses chimeric, single chain and humanized antibodies, as well as Fab fragments, or the products of a Fab expression library. Various procedures known in the art can be used for the production of such antibodies and fragments.

Antibodies raised against polypeptides corresponding to the sequences of the present invention can be obtained by direct injection of the polypeptide into an animal or by administration of the polypeptide to an animal. The animal is preferably not a human. The antibody thus obtained then binds to the polypeptide itself. In this way, even sequences encoding only fragments of the polypeptide can be used to generate antibodies that bind to the entire native polypeptide.
Such antibodies can then be used to isolate the polypeptide from a tissue that expresses the polypeptide.

For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technology (Kohler and Milstein, 1975, N.
ature, 256: 495-497), trioma technology, human B cell hybridoma technology (Kozbor).
Et al., 1983, Immunology Today.
4:72), and EBV hybridoma technology for producing human monoclonal antibodies (Cole et al., 198).
5. Monoclonal Antibodies a
nd CancerTherapy, Alan R.C. L
iss, Inc. , 77-96).

The techniques described for generating single chain antibodies (US Pat. No. 4,946,778) can be adapted to generate single chain antibodies to the immunogenic polypeptide products of the invention.

The invention will be further described with reference to the following examples; however, it is to be understood that the invention is not limited to such examples. All parts or amounts are by weight unless otherwise specified.

To facilitate understanding of the following examples,
List particular methods and / or terms that appear frequently.

"Plasmids" are designated by a lower case p preceded and / or followed by capital letters and / or numbers. The starting plasmids herein are either commercially available, publicly available without restriction, or can be constructed from available plasmids according to published procedures. In addition, plasmids equivalent to the described plasmids are known in the art and will be apparent to those skilled in the art.

“Digestion” of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions,
Cofactors and other requirements used were known to those skilled in the art. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction,
Typically, 5-50 μg of DNA is digested with 20-250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. An incubation time of about 1 hour at 37 ° C. is usually used, but can vary according to the supplier's instructions. After digestion, the reaction is electrophoresed directly on a polyacrylamide gel and the desired fragment is isolated.

The size separation of the cleavage fragments was performed according to Goe
ddel, D.E. Et al., Nucleic Acids Re
s. , 8: 8 described by 4057 (1980).
Performed using a% polyacrylamide gel.

“Oligonucleotide” refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide chains, which can be chemically synthesized. Such synthetic oligonucleotides are
It has no 5 'phosphate and therefore will not ligate to another oligonucleotide without the addition of phosphate and ATP in the presence of the kinase. Synthetic oligonucleotides ligate to fragments that have not been dephosphorylated.

“Ligation” refers to the process of forming a phosphodiester bond between two double-stranded nucleic acid fragments (Maniatis, T. et al., Supra, p. 146). Unless otherwise provided, ligation is performed in approximately equimolar amounts of 10 units of T / 0.5 μg of DNA fragment to be ligated.
4 Along with DNA ligase ("ligase"), it can be achieved using known buffers and conditions.

Unless otherwise stated, transformation was performed by Grah.
am, F.S. And Van der Eb, A .; , Viro
logic, 52: 456-457 (1973).

[0127]

EXAMPLES Example 1 Bacterial Expression of CTR and DNA Sequence Encoding Purified CTR (ATCC Deposit No. 7
No. 5824) is first amplified using PCR oligonucleotide primers corresponding to the 5 'end sequence of the processed protein (excluding the signal peptide sequence) and the vector sequence 3' to the CTR gene. CT
Additional nucleotides corresponding to R are 5 ′ and 3 ′
Added to each sequence. The 5 'oligonucleotide primer has the sequence 5' GACTAAAGCTTAATG
Has TTATACAGCATATTT3 ', which is H
It contains an indIII restriction enzyme site followed by a CTR coding sequence of 18 nucleotides starting from the putative terminal amino acid of the processed protein codon. 3 'sequence, 5'
GAACTTCTAGAACCGTCAATTATATA
AATTTTTC 3 'contains a sequence complementary to the XbaI restriction enzyme site, followed by a CTR coding sequence of 18 nucleotides. The restriction enzyme site is located in the bacterial expression vector p.
QE-9 (Qiagen, Inc. 9259 Eton
Avenue, Chatsworth, CA, 913
It corresponds to the restriction enzyme site of 11). pQE-9 is characterized by antibiotic resistance (Amp ^r ), bacterial origin of replication (ori), I
PTG regulatable promoter / operator (P /
O), a ribosome binding site (RBS), a 6-His tag, and a restriction enzyme site. Then, pQE
-9 was digested with HindIII and XbaI. The growth sequence was ligated into pQE-9 and inserted in frame with the sequence encoding the histidine tag and RBS.
The ligation mixture is then used to, E. coli (M15 /
(available from Qiagen under the trademark rep4)
Brook, J. et al. Et al., Molecular Cloni
ng: A Laboratory Manual, C
old Spring Laboratory Pre
Transform by the procedure described in ss, (1989).
M15 / rep4 contains multiple copies of plasmid pREP4, expresses the lacI repressor, and confers kanamycin resistance (Kan ^r ). The transformant is L
Identified by their ability to grow on B plates,
Then, ampicillin / kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by a restriction assay. Clones containing the desired construct are
(100 μg / ml) and Kan (25 μg / ml) in liquid culture in LB medium supplemented overnight (O /
N) Proliferated. 1: 100 using O / N culture
Inoculate a large culture at a ratio of 1: 250. Cells, 6
The cells were grown to an optical density (OD ⁶⁰⁰ ) of between 0.4 and 0.6. IPTG ("isopropyl-BD-thiogalactopyranoside") was then added to a final concentration of 1 mM. IPTG induces P / O clearing to increase gene expression by inactivating the lacI repressor. Cells were grown for an additional 3-4 hours. The cells were then harvested by centrifugation. The cell pellet was solubilized with the chaotropic agent 6M guanidine HCl. After clarification,
The lysate is purified from this solution by chromatography on a nickel chelate column under conditions that bind more tightly to the protein containing the 6-His tag (Hoch
uli, E .; J. et al. Chromatography
411: 177-184 (1984)). CTR, 6
Elute the column with M guanidine HCl pH 5.0 and, for regeneration purposes, 3M guanidine HC
Adjust to 100 mM sodium phosphate, 10 mM glutathione (reduced), and 2 mM glutathione (oxidized). After incubation with this solution for 12 hours, the protein was dialyzed against 10 mM sodium phosphate. Example 2 Expression of recombinant CTR expression plasmid, CTR HA in COS cells, was performed using the vector pcDN.
Induced by AI / Amp (Invitrogen). The vector pcDNAI / Amp contains: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E. coli. col
i) Origin of replication; 4) contains CMV promoter followed by polylinker region, SV40 intron and polyadenylation site. Complete CTR precursor, and its 3 '
The DNA fragment encoding the HA tag fused in frame at the end was cloned into the polylinker region of the vector. Therefore, recombinant protein expression is
Directed under the MV promoter. The HA tag corresponds to an epitope from the influenza hemagglutinin protein as described previously (I. Wilson,
H. Niman, R .; Heighten, A Cher
Enson, M .; Connolly, and R.C. Ler
ner, 1984, Cell 37, 767). The HA tag fusion to our target protein is HA
An antibody that recognizes the epitope allows for easy detection of the recombinant protein.

The plasmid construction strategy is described below: The DNA sequence encoding CTR (ATCC Deposit No. 75824) was constructed by PCR on the cloned original EST using two primers: 5 'Primer 5' GTCCGAAGCTTG
CCACCCATGTTATACAGCATATTT
3 'contains a HindIII site followed by a sequence of 18 nucleotides of the CTR coding sequence starting from the start codon; 3' sequence 5 'CTAGCTCGAGTCAAGCG
TAGTCTGGGACCTCGTATGGGGTAGC
AATTATAATAAATTTTCTGG 3 'is X
It contains a sequence complementary to the hoI site, a translation stop codon, an HA tag, and a sequence complementary to the last 18 nucleotides (excluding the stop codon) of the CTR coding sequence. Therefore, the PCR product contains a HindIII site, a CTR coding sequence followed by an in-frame fusion HA tag, a translation termination stop codon next to the HA tag, and an XhoI site. PCR amplified DNA fragments and vectors (p
cDNAI / Amp) was converted to HindIII and Xho.
Digested with I restriction enzyme and ligated. The ligation mixture is coli SURE strain (Stratagene)
CloningSystems, 11099 Nor
the Torrey Pines Road, La J
Olla, CA 92037), the transformed cultures were plated on ampicillin medium plates, and resistant colonies were selected. Plasmid DNA
Was isolated from the transformants and tested for the presence of the correct fragment by restriction analysis. For expression of recombinant CTR, COS cells were transfected with an expression vector by the DEAE-DEXTRAN method (J. Sambro).
ok, E. Fritsch, T .; Maniatis, M
olecular Cloning: A Labor
attory Manual, Cold Spring
Laboratory Press, (1989)).
CTR HA protein expression was detected by radiolabeling and immunoprecipitation. (E. Harlow, D. La
ne, Antibodies: A Laborato
ry Manual, Cold Spring Har
Bor Laboratory Press, (198
8)). Cells were transferred to ³⁵ S two days after transfection.
-Labeled with cysteine for 8 hours. The culture medium is then harvested and the cells are washed with detergent (RIPA buffer (150
mM NaCl, 1% NP-40, 0.1% SD
S, 1% NP-40, 0.5% DOC, 50 mM
Tris (pH 7.5). (Wilso
n, I. 37: 767 (1984)). Both cell lysate and culture medium were precipitated with an HA-specific monoclonal antibody. 15 precipitated proteins
% Analyzed on SDS-PAGE gel. Example 3 Cloning of CTR Using Baculovirus Expression System
And a DNA sequence encoding the full-length CTR protein (AT
CC Deposit No. 75824) was amplified using PCR oligonucleotide primers corresponding to the 5 ′ and 3 ′ sequences of the gene.

The 5 'primer has the sequence 5' GTCCg
gatcc GCCACC ATG TTATACAGCAT
Six nucleotides (J. Mol. Bio) having an ATTT 3 'and a BamHI restriction enzyme site (lower case) followed by a signal efficient for initiation of translation in eukaryotic cells.
l. 1987, 196 , 947-950, Kozak,
M. ) And located immediately after the first 18 nucleotides of the CTR gene (translation initiation codon "AT
G "is underlined).

The 3 'primer has the sequence 5' GTCCG
GATCCGCCACCATGTTATACAGCAT
With ATTT 3 ', restriction endonuclease Bam
Includes 18 nucleotides complementary to the HI cleavage site and the 3 'untranslated sequence of the CTR gene. The amplified sequence was prepared using a commercially available kit ("Geneclean" BIO 101In).
c. , La Jolla, Ca. ) Was used to isolate from a 1% agarose gel. The fragment was then digested with the endonuclease BamHI and then purified on a 1% agarose gel. This fragment is called F2.

The vector pRG1 (a variant of the pVL941 vector, described below) is used for the expression of CTR proteins using the baculovirus expression system (for a review, see Summers, MD and Smith, G .;
E. FIG. 1987, A manual of method
s for baculovirus vectors
and insert cell culture p
rosedures, Texas Agricultu
ral Expertial Station
Bulletin No. 1555). This expression vector is Autographa calif.
Ornica nuclear polyhedrosis virus (AcMNPV) contains the strong polyhedrin promoter, followed by a recognition site for the restriction endonuclease BamHI. The simian virus (SV) 40 polyadenylation site is used for efficient polyadenylation. To facilitate the selection of recombinant viruses, E. coli The β-galactosidase gene from E. coli was inserted in the same direction as the polyhedrin promoter followed by the polyhedrin gene polyadenylation signal. The polyhedrin sequence is flanked on both ends by viral sequences for cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors can be used in place of pRG1. For example, pAc373, pVL941 and pAcIM1 (Luckow, VA and Summers,
M. D. , Virology, 170: 31-39).

The plasmid was digested with the restriction enzyme BamHI and then dephosphorylated with calf intestinal phosphatase by procedures known in the art. Then, this DNA
Was isolated and purified from a 1% agarose gel as described above. This vector DNA is called V2.

Fragment F2 and the dephosphorylated plasmid V2 were ligated using T4 DNA ligase. Then, E. E. coli HB101 cells were transformed and bacteria containing the plasmid with the CTR gene (pBacCTR) were identified using the enzyme BamHI. The sequence of the cloned fragment was confirmed by DNA sequencing.

5 μg of the plasmid pBacCTR was ligated using the lipofection method (Felgner et al., Proc.
tl. Acad. Sci. USA, 84: 7413-7.
417 (1987)) using 1.0 μg of a commercially available linearized baculovirus (“BaculoGold ^™ b”).
aculovirus DNA ", Pharminge
n, San Diego, CA. ) And co-transfected.

1 g of BaculoGold ^™ virus D
NA and 5 μg of plasmid pBacCTR
μl of serum-free Grace's medium (Life Technology)
offices Inc. , Gaithersburg, M
Mixed in sterile wells of microtiter plate containing D). Thereafter, 10 μl Lipofectin and 90 l Grace's medium were added, mixed and mixed at room temperature for 15 minutes.
Incubated for minutes. The transfection mixture was then diluted with 3 ml serum-free Grace's medium.
It was dropped onto Sf9 insect cells (ATCC CRL 1711) seeded in a 5 mm tissue culture plate. The plate was shaken back and forth to mix the newly added solution. The plate was then incubated at 27 ° C. for 5 hours.
After 5 hours, the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added. The plate was returned to the incubator and the culture continued at 27 ° C. for 4 days.

After 4 days, the supernatant was collected and the Summe
Plaque assays were performed as described by rs and Smith (supra). As an improvement, the "Blue Ga", which allows easy isolation of blue-stained plaques
l ”(Life Technologies In
c. Agarose gel with Gaithersburg) was used. (A detailed description of the “plaque assay” is also available from Life Technologies Incorporated.
c. User's Guide to Insect Cell Culture Methods and Baculovirology, distributed to Gaithersburg (9-
10) can also be found).

Four days later, serial dilutions of the virus were added to the cells and blue-stained plaques were picked up with the tip of an Eppendorf pipette. The agar containing the recombinant virus was then resuspended in an Eppendorf tube containing 200 μl Grace's medium. The agar was removed by simple centrifugation and the supernatant containing the recombinant baculovirus was added to
Sf9 cells seeded in 5 mm dishes were infected. Four days later, the supernatants of these culture dishes were collected and then stored at 4 ° C.

Sf9 cells were cultured in Grace's medium supplemented with 10% heat-inactivated FBS. Cells were infected with the recombinant baculovirus V-CTR at a multiplicity of infection (MOI) of 2. After 6 hours, the medium was removed and SF900 II medium (Life Technologies Inc., G.) depleted of methionine and cysteine.
aithe. -Rsburg). After 42 hours, 5 μCi of ³⁵ S-methionine and 5 μCi of ³⁵ S
Cysteine (Amersham) was added. Cells
After an additional 16 hours of incubation, cells were harvested by centrifugation and the labeled proteins visualized by SDS-PAGE and autoradiography.

Many modifications and variations of the present invention are possible in light of the above teachings, and, unless otherwise indicated, the invention may be practiced within the scope of the appended claims.

[0140]

EFFECTS OF THE INVENTION For therapeutic purposes, for example, for the treatment of some forms of hypercalcemia in diseases of bone remodeling, including hypercalcemia, osteoporosis, osteoarthritis, and malignancies. , Using an agonist.

[0141]

[Sequence list]

[0142]

[Table 1]

[0143]

[Table 2]

[0144]

[Table 3]

[0145]

[Table 4]

[Brief description of the drawings]

FIG. 1 shows the cDNA sequence of the G protein-coupled receptor of the invention and the corresponding deduced amino acid sequence. The first 32 amino acids (highlighted) indicate the putative leader sequence. Standard one-letter abbreviations for amino acids are used.

FIG. 1 shows the cDNA sequence of the G protein-coupled receptor of the invention and the corresponding deduced amino acid sequence. The first 32 amino acids (highlighted) indicate the putative leader sequence. Standard one-letter abbreviations for amino acids are used.

FIG. 1 shows the cDNA sequence of the G protein-coupled receptor of the invention and the corresponding deduced amino acid sequence. The first 32 amino acids (highlighted) indicate the putative leader sequence. Standard one-letter abbreviations for amino acids are used.

FIG. 1 shows the cDNA sequence of the G protein-coupled receptor of the invention and the corresponding deduced amino acid sequence. The first 32 amino acids (highlighted) indicate the putative leader sequence. Standard one-letter abbreviations for amino acids are used.

FIG. 1 shows the cDNA sequence of the G protein-coupled receptor of the invention and the corresponding deduced amino acid sequence. The first 32 amino acids (highlighted) indicate the putative leader sequence. Standard one-letter abbreviations for amino acids are used.

FIG. 1 shows the cDNA sequence of the G protein-coupled receptor of the invention and the corresponding deduced amino acid sequence. The first 32 amino acids (highlighted) indicate the putative leader sequence. Standard one-letter abbreviations for amino acids are used.

FIG. 2 shows G protein-coupled receptor 2
4 is an illustration of the next structural characteristic. The first seven illustrations show amino acid sequence regions that are α-helix, β-sheet, turn region, or coil region. The region surrounded by a square is a region corresponding to the indicated region. The second set of figures is
The region of the amino acid sequence that is exposed to the intracellular or cytoplasmic region or that penetrates the membrane is shown. The hydrophilic part is
The lipid bilayer of the membrane is shown, indicating regions of the protein sequence that are hydrophobic and regions outside the lipid bilayer that are hydrophilic. The antigenicity index corresponds to the hydrophilicity plot since the antigenic region is the region outside the lipid bilayer and has the ability to bind antigen. Further, the surface probability plot corresponds to the antigenic index and the hydrophilicity plot. The amphipathic plot shows regions of the protein sequence that are polar and non-polar. The mobile region corresponds to the second set of illustrations in the sense that the mobile region is a region outside the membrane and the non-mobile region is a transmembrane region.

FIG. 2 shows G protein-coupled receptor 2
4 is an illustration of the next structural characteristic. The first seven illustrations show amino acid sequence regions that are α-helix, β-sheet, turn region, or coil region. The region surrounded by a square is a region corresponding to the indicated region. The second set of figures is
The region of the amino acid sequence that is exposed to the intracellular or cytoplasmic region or that penetrates the membrane is shown. The hydrophilic part is
The lipid bilayer of the membrane is shown, indicating regions of the protein sequence that are hydrophobic and regions outside the lipid bilayer that are hydrophilic. The antigenicity index corresponds to the hydrophilicity plot since the antigenic region is the region outside the lipid bilayer and has the ability to bind antigen. Further, the surface probability plot corresponds to the antigenic index and the hydrophilicity plot. The amphipathic plot shows regions of the protein sequence that are polar and non-polar. The mobile region corresponds to the second set of illustrations in the sense that the mobile region is a region outside the membrane and the non-mobile region is a transmembrane region.

FIG. 3 shows an amino acid sequence alignment of the G protein-coupled receptor of the present invention with calcitonin receptors from various animal species. The colored regions are regions that are compatible with other amino acid sequences in the figure.

FIG. 3 shows an amino acid sequence alignment of the G protein-coupled receptor of the present invention with calcitonin receptors from various animal species. The colored regions are regions that are compatible with other amino acid sequences in the figure.

FIG. 3 shows an amino acid sequence alignment of the G protein-coupled receptor of the present invention with calcitonin receptors from various animal species. The colored regions are regions that are compatible with other amino acid sequences in the figure.

FIG. 3 shows an amino acid sequence alignment of the G protein-coupled receptor of the present invention with calcitonin receptors from various animal species. The colored regions are regions that are compatible with other amino acid sequences in the figure.

FIG. 3 shows an amino acid sequence alignment of the G protein-coupled receptor of the present invention with calcitonin receptors from various animal species. The colored regions are regions that are compatible with other amino acid sequences in the figure.

 ──────────────────────────────────────────────────続 き Continued on the front page (71) Applicant 597018381 9410 Key West Avenue, Rockville, Maryland 20850, United States of America (72) Inventor Lee United States of America 20878, Geysersburg, Howard Landing 125 (72) Inventor Norman H. Lee United States Maryland 21163, Woodstock, Weatherburn Road 10344 F-term (Reference) 4B024 AA01 AA11 BA63 CA04 4H045 AA10 BA10 CA40 DA50 EA20 EA50

Claims (1)

[Claims] 1. An isolated polynucleotide comprising: (a) the following deduced amino acid sequence: A polynucleotide encoding a G protein-coupled receptor polypeptide or a fragment, analog or derivative of said polypeptide; (b) cDN contained in ATCC Deposit No. 75824
An isolated polynucleotide selected from the group consisting of a G protein-coupled receptor polypeptide having an amino acid sequence encoded by A, or a polynucleotide encoding a fragment, analog, or derivative of the polypeptide.