JP2002071693A - Method of manufacturing nucleic acid bonded fiber - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide an efficient manufacturing method for fixing nucleic acid to fiber. SOLUTION: The nucleic acid is made to react on fiber having a carboxyl group, or fiber into which the carboxyl group is introduced.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a method for producing a nucleic acid-immobilized fiber having a nucleic acid immobilized on the fiber. The fiber produced in the present invention can be used for detecting gene expression, mutation and the like.

[0002]

2. Description of the Related Art In recent years, microarrays and microelectrophoresis devices have been developed as devices for utilizing genomic or genetic information, and have been used for high-throughput analysis of gene expression and mutation. Some of the present inventors have previously developed and applied for a novel method for producing a microarray (Japanese Patent Application No. 11-59361). That is, a thin section is obtained by preparing an array of nucleic acid binding fibers and cutting the nucleic acid binding fiber in a direction intersecting the fiber axis of the array. This slice can be used as a nucleic acid binding array, ie, a microarray.

As a method for immobilizing a nucleic acid on a fiber, a method in which a positive charge is generated on a nylon surface is used.
A method for adsorbing a nucleic acid and a method for directly covalently binding a nucleic acid to a fiber are known (see JP-A-11-108928).

[0004]

However, no effective technique has been known for a method of efficiently binding a nucleic acid to a fiber.

[0005]

Means for Solving the Problems As a result of intensive studies on a method for producing a nucleic acid binding fiber, the present inventors have found that a nucleic acid and a fiber having a carboxyl group can be reacted to produce a nucleic acid binding fiber. The present inventors have found that the obtained nucleic acid binding fiber can be used for nucleic acid detection of a complementary sequence, and completed the present invention.

That is, the present invention provides (1) a method for producing a nucleic acid binding fiber, which comprises reacting a fiber having a carboxyl group with a nucleic acid. (2) The method for producing a nucleic acid binding fiber according to (1), wherein the fiber having a carboxyl group is obtained by reacting a fiber having a hydroxyl group and / or an amino group with an acid anhydride. (3) The method for producing a nucleic acid binding fiber according to (1), wherein the fiber having a carboxyl group is obtained by hydrolyzing a fiber having a nitrile group. (4) The method for producing a nucleic acid binding fiber according to (1), wherein the fiber having a carboxyl group is obtained by copolymerization with acrylic acid and / or methacrylic acid. (5) The method for producing a nucleic acid binding fiber according to (2), wherein the acid anhydride is succinic anhydride. (6) the method for producing a nucleic acid binding fiber according to any one of (1) to (5), wherein the nucleic acid has a terminal amino group or a terminal thiol group;
It is.

[0007]

DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention will be described below in detail. The fiber having a carboxyl group that can be used in the present invention may be any fiber regardless of synthetic fiber or natural fiber. A fiber having no carboxyl group can be led to a fiber having a carboxyl group, for example, by the following method. Fibers containing a large number of hydroxyl groups, such as acetate fibers and cellulose fibers, can be converted into fibers having a carboxyl group by reaction with an acid anhydride. Fibers containing amino groups, such as nylon 6 and nylon 66, can be induced into fibers having carboxyl groups by reaction with an acid anhydride. Fibers having a nitrile, such as acrylic fibers, can be converted into fibers having a carboxyl group by alkali treatment or the like. Polyolefin fibers can be derived into fibers having a carboxyl group by copolymerization with succinic anhydride and alkali treatment. Further, polymethacrylate can be derived into a fiber having a carboxyl group by copolymerization with acrylic acid, methacrylic acid, or the like.

[0008] In the present invention, the nucleic acid to be bound to the fiber includes deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). When bonding with fiber,
In order to achieve end-selective binding, it is preferable that the terminal portion of the nucleic acid is aminated or thiolated. The modified product can be synthesized by reacting an aminating reagent or a thiolating reagent in the final step of automatic synthesis. If necessary, a PCR reaction can be carried out to obtain a terminal-modified long-chain nucleic acid.

In the present invention, the amide or thioester forming reaction between the carboxyl group contained in the fiber and the terminal amino group or terminal thiol group of the nucleic acid may be performed by any method. For example, the method can be carried out by a method via activation with an acid halide, a method via activation with hydroxysuccinimide, or the formation of a bond with a condensing agent.

[0010]

The present invention will be described more specifically with reference to the following examples. However, the present invention is not limited to only these examples.

Example 1 Acetate fiber (1) Pretreatment of fiber 1 g of acetate fiber (cellulose diacetate fiber, manufactured by Mitsubishi Rayon; 55 dtex / 30 fil.) Was added to 20 ml of DMF.
Then, 0.2 ml of triethylamine and 0.5 g of succinic anhydride were added and reacted at 40 ° C. for 2 hours. After the reaction, the fiber was separated by filtration, immersed in distilled water, and neutralized by dropping 1 ml of 1N sulfuric acid. Thus, an acetate fiber having succinic acid bonded to a part of the hydroxyl groups was obtained. The treated fiber dried product was immersed in 10 ml of methylene chloride, and thionyl chloride 0.2% was added.
ml and 0.3 g of hydroxysuccinimide were added and reacted at room temperature for 2 hours, followed by filtration and vacuum drying.

(2) Binding of Nucleic Acid Oligonucleotides are synthesized using an automatic DNA / RNA synthesizer (model 394) manufactured by PE Biosystems. In the final step of DNA synthesis, aminolink II (trade name) (Applied NH ₂ (CH ₂ ) at the 5 ′ end of each oligonucleotide using
_An aminated probe was prepared by introducing _6- . These were used after deprotection and purification by a general method. Terminally aminated oligonucleotide A: (SEQ ID NO: 1)
Solution 50 diluted to 10 μg / ml with distilled water
μl and 0.1 g of the treated fiber immersed in 2 ml of distilled water were mixed and reacted at room temperature for 2 hours.

After the reaction, filtration is carried out, and the filtrate is filtered at 260 nm.
By measuring the UV absorption and quantifying the nucleic acid from a separately prepared calibration curve, the binding ratio of the nucleic acid was determined. As a result, the untreated acetate fiber had a binding rate of 13%,
The treated acetate fiber had a binding ratio of 90%.

(3) Hybridization using nucleic acid binding fiber The nucleic acid binding fiber prepared in (2) is cut at a length of 5 cm,
It was stuck on a plastic film with an adhesive for easy handling. At this time, an untreated fiber was attached as a control. Oligonucleotide B (SEQ ID NO: 2) complementary to the probe was purchased with DIG (digoxigenin) labeling at the 5 ′ end (manufactured by VEX Co., Ltd.).

The film to which the fibers were attached was put into a hybridization bag, a hybridization solution having the following composition was poured, and prehybridization was performed at 45 ° C. for 30 minutes. Next, DIG-labeled oligonucleotide B was added, and hybridization was performed at 45 ° C. for 15 hours.

Hybridization solution composition: 5 × SSC (0.75 M sodium chloride, 0.075 M sodium citrate, pH 7.0) 5% blocking reagent (Roche Diagnostics Co., Ltd.) 0.1% N-lauroyl sarcosine sodium 0.02% SDS (Sodium lauryl sulfate) 50% formamide

After the hybridization, the film to which the fiber was stuck was heated to 50 m in advance.
transfer to a 0.1 x SSC, 0.1% SDS solution and shake for 20 minutes.
Washing for 3 minutes at 45 ° C. was performed. DIG buffer 1 was added, and SDS was removed while shaking at room temperature. After repeating this again, DIG buffer 2 was added and shaken for 1 hour.
After removing the buffer, 1 / 10,000 anti-DI was added to DIG buffer 2.
An antigen-antibody reaction was carried out by adding 10 ml of a solution to which a G alkaline phosphatase-labeled antibody solution was added and shaking slowly for 30 minutes. Next, the plate was washed by shaking twice with DIG buffer 1 containing 0.2% Tween 20 for 15 minutes, and then immersed in DIG buffer 3 for 3 minutes. After removing DIG buffer 3, 3 ml of DIG buffer containing CSPD was added and equilibrated for 10 minutes.

After draining the water, the mixture was transferred to a new hybridization bag and kept at 37 ° C. for 1 hour, and then sandwiched together with the X-ray film in a binder for X-ray film to expose the film. As a result, no signal was detected in the untreated fiber, but a signal indicating that the oligonucleotide was bound was confirmed in the nucleic acid-bound fiber.

[Example 2] Cellulose fiber (1) Treatment of fiber Cellulose fiber (85 dtex / 36 filament (fil.)) Was treated in the same manner as in Example 1,
Cellulose fibers having succinic acid bonded to a part of hydroxyl groups were obtained.

(2) Binding of nucleic acid 50 μl of a solution obtained by diluting the terminal aminated oligonucleotide A (SEQ ID NO: 1) with distilled water to a concentration of 10 μg / ml.
l and 0.1 g of EDC (1-ethyl-3- (3-dimethylaminopropyl) carbodiimide) were added to 0.1 g of the treated fiber immersed in 2 ml of distilled water, and reacted at room temperature for 2 hours. After the reaction, filtration was carried out, and 2
The nucleic acid binding ratio was determined by measuring the UV absorption at 60 nm and quantifying the nucleic acid from a separately prepared calibration curve. result,
The untreated cellulose fiber had a binding rate of 20%, whereas the treated cellulose fiber had a binding rate of 95%.
Met.

(3) Hybridization Using Nucleic Acid-Binding Fiber The nucleic acid-binding fiber was also attached to a plastic film in the same manner as in Example 1, and oligonucleotide B (SEQ ID NO: 2)
Was used to perform the same hybridization operation.
As a result, a hybridization signal was detected.

Example 3 Nylon fiber (1) Treatment of fiber 1 g of nylon fiber (0.165 mm diameter, monofilament made of nylon 6) was immersed in 20 ml of DMF, and 0.2 ml of triethylamine and 0.5 g of succinic anhydride were added thereto. ° C
For 2 hours. After the reaction, the fiber was separated by filtration, immersed in distilled water, and neutralized by dropping 1 ml of 1N sulfuric acid. Thus, a nylon fiber having succinic acid bonded to a part of the amino group was obtained. The treated fiber was immersed in 10 ml of methylene chloride, 0.2 ml of thionyl chloride and 0.3 g of hydroxysuccinimide were added thereto, and reacted at room temperature for 2 hours, followed by filtration and vacuum drying.

(2) Preparation of template (chromosome) Rhodococcus rhodochrous J1 strain was transformed into a nutrient medium (glucose 15 g, yeast extract 1 g, sodium glutamate 10).
_{g, KH 2 PO 4 0.5g,} K 2 HPO 4 0.5g, MgSO 4 · 7H 2 O 0.5g / L, p
H7.2) The cells were cultured in 100 ml at 30 ° C for 3 days and collected. A chromosome was prepared from the cells and used as a template for PCR. The Rhodococcus rhodochrous J1 strain has been deposited as FERM BP-1478 with the Research Institute of Biotechnology and Industrial Technology (1-3-1-3 Higashi, Tsukuba-shi, Ibaraki Prefecture).

(3) PCR Reaction The terminal aminated oligonucleotide C (SEQ ID NO: 3) was diluted to 50 μM with sterile water, and PCR was performed using the prepared template and oligonucleotide D (SEQ ID NO: 4). Oligonucleotides were submitted to Amersham Pharmacia for synthesis. PC
R is Asymm in which one primer is present in excess in the other.
etric PCR was performed, and the primer concentration was adjusted to 5 ′ aminated modified oligonucleotide C: oligonucleotide D = 100: 1. Other conditions were performed according to the specifications of Ex-Taq (Takara Shuzo) using TaKaRa PCR Thermal Cycler PERSONAL. The reaction was performed in 100 μl, and temperature conditions were 93 ° C for 30 seconds and 55 ° C.
30 cycles were performed at 72 ° C. for 1 minute for 30 seconds. By this reaction, the 5'-terminal aminated nucleic acid of 623 (SEQ ID NO: 5) was amplified.

(4) Binding of nucleic acid 50 μl of a solution obtained by diluting terminally aminated nucleic acid amplified by performing a PCR reaction with distilled water to 10 μg / ml and 0.1 g of the treated fiber are immersed in 2 ml of distilled water. Were mixed and reacted at room temperature for 2 hours. After the reaction, filtration was performed, the UV absorption of the filtrate at 260 nm was measured, and the nucleic acid binding rate was determined by quantifying the nucleic acid from a separately prepared calibration curve. As a result, the untreated nylon fiber had a bonding rate of 30.
%, Whereas the treated cellulose fiber had a binding rate of 93%.

(5) Hybridization Using Nucleic Acid-Binding Fiber The nucleic acid-immobilized fiber is also attached to a plastic film as in Example 1, and the same hybridization operation is performed using oligonucleotide B (SEQ ID NO: 2). Was. As a result, a hybridization signal was detected.

Example 4 Acrylic fiber (1) Fiber treatment Acrylic fiber (manufactured by Mitsubishi Rayon; 165 dtex / 60fi)
l.) 1 g of 1 mol / L sodium hydroxide aqueous solution 50 m
and alkali treatment at 100 ° C. for 5 minutes. Immediately after the treatment, 5N sulfuric acid was dropped into the immersion liquid for neutralization. Thus, an acrylic fiber in which a part of the nitrile group became a carboxyl group was obtained.

(2) Binding of nucleic acid EDC (1-ethyl-3- (3-dimethylamino) was dissolved in 50 μl of a solution obtained by diluting the terminally aminated nucleic acid amplified by PCR in Example 3 with distilled water to a concentration of 10 μg / ml. Propyl) carbodiimide) 0.1 g with the treated fiber 0.1
g at room temperature.
Reacted for hours. After the reaction, filtration was performed.
Was measured and the nucleic acid binding rate was determined by quantifying the nucleic acid from a separately prepared calibration curve. As a result, the untreated acrylic fiber had a binding rate of 5%, whereas the treated acrylic fiber had a binding rate of 85%.

(3) Hybridization Using Nucleic Acid-Binding Fiber The nucleic acid-immobilized fiber was also attached to a plastic film in the same manner as in Example 1, and the same hybridization operation was performed using oligonucleotide B (SEQ ID NO: 2). Was. As a result, a hybridization signal was detected.

Example 5 Polymethacrylate Fiber (1) Treatment of Fiber Carboxyl-containing polymethacrylate fiber (165 dt)
ex / 30 fil. 99 parts by weight of methyl methacrylate and 1 part by weight of methacrylic acid were copolymerized, and the obtained polymer was melt-spun (1 g), immersed in 20 ml of DMF, and 0.2 ml of triethylamine and 0.5 g of succinic anhydride were added. The reaction was carried out at 2 ° C. for 2 hours. After the reaction, the fiber was separated by filtration, immersed in distilled water, and neutralized by dropping 1 ml of 1N sulfuric acid. Thus, an acetate fiber having succinic acid bonded to a part of the hydroxyl groups was obtained. The treated fiber was immersed in 10 ml of methylene chloride, 0.2 ml of thionyl chloride and 0.3 g of hydroxysuccinimide were added thereto, and reacted at room temperature for 2 hours, followed by filtration and vacuum drying.

(2) Binding of nucleic acid 50 μl of a solution obtained by diluting the terminal thiolated oligonucleotide (SEQ ID NO: 1) with distilled water to a concentration of 10 μg / ml.
l and 0.1 g of the treated fiber immersed in 2 ml of distilled water were mixed and reacted at room temperature for 2 hours. After the reaction, filtration was performed, the UV absorption of the filtrate at 260 nm was measured, and the nucleic acid binding rate was determined by quantifying the nucleic acid from a separately prepared calibration curve. As a result, the untreated carboxyl group-containing polymethacrylate fiber had a binding rate of 3%, whereas the treated carboxyl group-containing polymethacrylate fiber had 90%.

(3) Hybridization Using Nucleic Acid-Binding Fiber The nucleic acid-immobilized fiber was also attached to a plastic film in the same manner as in Example 1, and the same hybridization operation was performed using oligonucleotide B (SEQ ID NO: 2). Was. As a result, a hybridization signal was detected.

[0033]

According to the present invention, it is possible to efficiently produce a nucleic acid binding fiber.

[0034]

[Sequence List] SEQUENCE LISTING <110> Mitsubishi Rayon Co., Ltd. <120> The process for production of nucleic acid binding fiber <130> P120466000 <160> 5 <210> 1 <211> 33 <212> DNA <213 > Artificial Sequence <220> <223> Synthetic DNA bound with O-aminohexyl at 5 'terminus <400> 1 gcgataggtg gaggtcaggg tttgggacag cag 33 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> < 223> Synthetic DNA bound with Digoxigenin at 5 'terminus <400> 2 ctgctgtccc aaaccctgac ctccacctat 30 <210> 3 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Synthetic DNA bound with amino group at 5 'terminus <400> 3 gcgataggtg gaggtcaggg tttgggacag cag 33 <210> 4 <211> 33 <212> DNA <213> Artificial Sequence <220> 31 <223> Synthetic DNA <400> 4 gcgtaagctt ccgcgagatc agtatccacc g 31 <210> 5 <211> 623 <212> DNA <213> Rhodococcus rhodochrous <400> 5 gcgataggtg gaggtcaggg tttgggacag cagctccgaa atccgctaca tcgtcatccc 60 ggaacggccg gccggcaccg acggttggtc cgaggaggag ctgacgcgggtggtgggtggtgggtggtggg gtaatgcgct cacaccgcag gaagtgatcg tatgagtgaa 180 gacacactca ctgatcggct cccggcgact gggaccgccg caccgccccg cgacaatggc 240 gagcttgtat tcaccgagcc ttgggaagca acggcattcg gggtcgccat cgcgctttcg 300 gatcagaagt cgtacgaatg ggagttcttc cgacagcgtc tcattcactc catcgctgag 360 gccaacggtt gcgaggcata ctacgagagc tggacaaagg cgctcgaggc cagcgtggtc 420 gactcggggc tgatcagcga agatgagatc cgcgagcgca tggaatcgat ggccatcatc 480 gactgacatc ccctgtgtct ccatctagca gcagtgcggg cgtaccccga cggtgctgag 540 ccgacggggt acgcccgcac ttcatcaatg acggtggttc ctaatttggc tcggtggata 600 ctgatctcgc ggaaggtaac gcg 623

[0035]

[Free text of Sequence Listing]

 SEQ ID NO: 1: Synthetic DNA SEQ ID NO: 2: Synthetic DNA SEQ ID NO: 3: Synthetic DNA SEQ ID NO: 4: Synthetic DNA

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) // C12Q 1/68 C12N 15/00 ZNAF F-term (Reference) 4B024 AA11 CA09 HA14 4B063 QA01 QA18 QQ42 QR32 QR55 QR82 QS25 QS34 QS39 4L033 AB01 AC15 CA02

Claims (6)

[Claims] 1. A method for producing a nucleic acid binding fiber, comprising reacting a fiber having a carboxyl group with a nucleic acid. 2. The method according to claim 1, wherein the fiber having a carboxyl group is obtained by reacting a fiber having a hydroxyl group and / or an amino group with an acid anhydride. 3. The method for producing a nucleic acid binding fiber according to claim 1, wherein the fiber having a carboxyl group is obtained by hydrolyzing a fiber having a nitrile group. 4. The method according to claim 1, wherein the fiber having a carboxyl group is obtained by copolymerization with acrylic acid and / or methacrylic acid. 5. The method according to claim 2, wherein the acid anhydride is succinic anhydride.
A method for producing the nucleic acid binding fiber according to the above. 6. The method for producing a nucleic acid binding fiber according to claim 1, wherein the nucleic acid has a terminal amino group or a terminal thiol group introduced.