JP2002065274A - Method for detecting object component in specimen and substrate for detection to be used therefor - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a new detection method that permits, by using an oligonucleotide having a known base sequence as a probe for detection, reducing the consumption amount of a specimen necessary for each estimation to a lower level upon evaluating the presence or absence of an association property to the above oligonucleotide, the presence or absence of the formation of a complex to examine the strength or weakness of the association ability, and the efficiency of the formation with respect to a limited amount of specimen. SOLUTION: This method comprises the steps of, with utilizing a substrate for detection prepared by binding each probe for detection to each section arranged like a matrix, placing, on each section like an array, an objective component, e.g. small amounts of specimen solutions containing a nucleic acid molecule using a substrate for detection, carrying out hybridization reaction in the micro-droplet, and detecting the resultant complex utilizing an appropriate label with selecting a spot position with a microscopy detection system or the like.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a method for detecting the presence or absence of a complex formed by intermolecular bonding between an oligonucleotide having a known base sequence as a detection probe and the oligonucleotide for the detection probe. A method for detecting whether or not a component having the ability to bind to the detection probe is contained in the sample sample, and an oligonucleotide for the detection probe, which is exclusively used in this detection method, To a detection substrate fixed to the substrate. More specifically, for a plurality of sample samples, for example,
A method for detecting a nucleic acid molecule using a probe hybridization method, and a method for detecting the nucleic acid molecule, which are used for the purpose of simultaneously testing whether or not a nucleic acid molecule having a specific base sequence is contained therein The present invention relates to a DNA probe matrix in which a plurality of types of DNA probes are used in a matrix form and fixed on a substrate.

[0002]

2. Description of the Related Art Identification of a partial sequence contained in a nucleotide sequence of a nucleic acid molecule, detection of a target nucleic acid contained in a sample derived from a living body, and genera / species of various bacteria based on the characteristics of their genetic DNA. In the identification of, a plurality of types of probe DNAs having a known base sequence can be used, and means for specifically detecting each probe DNA, that is, detecting whether or not the nucleic acid molecule hybridizes with each probe DNA can be used. . As an effective technique for quickly and accurately performing the assay for a plurality of types of probe DNAs by a hybridization method, a probe array in which a plurality of types of probe DNAs are regularly arranged on a solid phase is used. Means for simultaneously detecting whether or not a nucleic acid molecule specifically binds to DNA has been proposed.

A general method for manufacturing such a probe array is described in, for example, EP 37320.
As described in Japanese Patent Publication No. 3373 (EP 0373203 B1), a method of synthesizing predetermined nucleic acid probes on a solid phase in an array, or a method in which a plurality of nucleic acid probes synthesized in advance are arrayed on a solid phase. There is known a method of supplying in a form.

As a prior art document which discloses the former method, for example, US Pat. No. 5,405,783 (US Pat.
P 5,405,783). As an example of the latter method, for example, US Pat. No. 5,601,980 (US Pat.
P 5,601,980) and "Science", 270
Vol., Page 467, (1995) discloses a method of arranging cDNAs in an array on a solid phase using micropipetting.

[0005] The probe array prepared by these methods has a nucleic acid probe on a solid phase of 100 per inch square.
An array having a high density of 00 or more can be obtained. By immersing this high-density probe array in a sample solution, hybridization reactions with many kinds of probes are simultaneously performed at the same time, and based on the nucleotide sequence of the nucleic acid probe that has undergone hybridization,
The nucleotide sequence of the gene is analyzed. This method has an advantage that by arranging probes at a high density on a substrate having a small area, it is possible to perform a simultaneous multi-item inspection with a small amount of sample and to reduce a burden associated with sampling a sample from a subject.

[0006]

As a method for producing a high-density probe array for the above-mentioned application on a substrate by a DNA synthesis method, a method utilizing photolithography is disclosed in the above-mentioned US Pat. No. 5,405,783. However, implementing this method requires sophisticated equipment and is not easily accessible to everyone.

When the number of specimens is large but the number of required test items is not so large, the degree of integration of DNA probes on the probe array corresponding to the number of test items does not need to be so high. Rather, it may be necessary to produce a large number of probe arrays in which a small number of desired DNA probes are immobilized using a simpler method.

[0008] In fact, even in the field of clinical examination, 100
In many cases, it is not always necessary to inspect items exceeding 00. For example, in the case of mass screening, it may be more important to examine a large number of specimens with a limited number of items. When testing a large number of samples in this way, a system that can quickly test for the presence or absence of a disease or the like by comparing each sample with a standard sample is required.

In addition, the amount of DNA in a specimen is generally smaller than that of a synthetic oligonucleotide used as a probe. In order to use the usual form in which the probe array substrate is immersed in the sample solution during the hybridization reaction, a sufficient amount of the sample DNA is required to sufficiently immerse the substrate. Therefore,
Depending on the amount of the sample DNA, the size of the DNA probe / array substrate is limited, and it is necessary to increase the density of the array.
Alternatively, according to the size of the probe array substrate,
As a result of performing dilution to secure the volume of the sample solution, the DNA concentration in the sample solution is lowered. To compensate for this, a method of increasing the reaction time is also employed.

[0010] Further, since the specimen is an extract from a tissue, the amount of the sample is originally limited, and furthermore,
Pretreatment with the sample solution used for the hybridization reaction, specifically, extraction of nucleic acid, its single-strand, and further, labeling, etc., require a small amount of sample to be finally obtained. It is. To make up for it, PCR
After amplification treatment of the amount of DNA such as amplification treatment by reaction, it is used for inspection and research. However, when performing a PCR reaction, a separately prepared primer is required,
The disadvantage remains that the primer sequence is known and that it can be applied only to specific genes. others,
There are sequences that are easily amplified and sequences that are hardly amplified in the course of the PCR reaction, and the reaction efficiency (amplification rate) is not uniform. For example, a specific m
When examining the RNA content and judging a disease or the like based on the content, it is necessary to always prepare a reference standard sample and correct the amplification rate.

[0011] As the size of the substrate is reduced, the amount of the sample solution required for the hybridization reaction is reduced, but there is naturally a limit in reducing the size of the substrate in handling operation. Specifically, it is possible in principle to reduce the size of the substrate by increasing the array density or reducing the number of probes placed on the array, but using an extremely small substrate In a process such as hybridization reaction and subsequent detection, a dedicated handling device is required, which is not practical.

Also, cDNA for mRNA transcribed reflecting the developmental process of a certain organism, cDNA for mRNA transcribed reflecting each phase during the culturing process of a certain cell, transcribed by interaction with a drug mRNA
When examining cDNA or the like for DNA, a DNA array in which various types of specimen samples are arranged is used. As an example of arraying this sample sample, for example, the above-mentioned “Science (S
270), p. 467, (199)
5). In this case, a hybridization reaction is carried out by immersing the arrayed sample sample on a substrate using a labeled DNA of a known sequence derived from a gene having a specific function as a probe solution.

If a plurality of items are to be checked at the same time using this method, it is necessary to prepare DNA probes labeled with different types of fluorescent reagents (fluorescent dyes) by the number of items. At the time of detection, these different types of fluorescent reagents (fluorescent dyes) must be detected separately from each other, and therefore, needless to say, their wavelengths and the like must be different. Of course, the detector also requires a filter for detection corresponding to each fluorescent reagent (fluorescent dye).

The need for such a multi-item / multi-sample simultaneous test is not limited to a hybridization reaction between genes (DNA).

For example, the interaction between a gene and a protein (D
It is important to conduct a multi-item study with a small sample of the interaction between the gene and other substances, such as screening for chemical substances that bind to the gene (NA binding protein) and the gene. The former detection of a DNA-binding protein is used for elucidation of the regulation mechanism of gene expression by a protein such as a transcription promoting factor. However, at present, a DNA fragment is bound to a protein, and then the complex is subjected to gel electrophoresis. The analysis method is adopted. In this method, the number of samples that can be analyzed at one time is limited due to the use of gel electrophoresis.
Also, considerable analysis time is required.

In the field of drug discovery, investigating the interaction between a gene and an administered drug is sometimes an important item in the progress of research, but a chemically synthesized product used for the drug to be studied It may be quite troublesome to obtain the drug itself, and it is considered that reducing the amount of drug used for screening significantly improves the research efficiency.

As introduced above, hybridization between DNA, formation of a complex between DNA and protein,
When examining the presence or absence of an interaction that forms a complex using the interaction between the two, such as the interaction of a drug compound with gene DNA, the amount of one sample is limited. Therefore, it may be necessary to perform a series of evaluations on the presence or absence of complex formation for a large number of target species using the limited sample amount. In other words, it is desired to develop an inspection method capable of reducing the amount of consumption of a sample required for each evaluation to a smaller amount, and more efficiently performing inspections of many types within a limited sample amount. I have.

The present invention has been made to solve the above-mentioned problems, and an object of the present invention is to use an oligonucleotide whose nucleotide sequence is known and which is relatively easily available as a probe for detection, so that it is limited. For a sample amount of the sample, the presence or absence of the binding of the detection probe to the oligonucleotide, or the strength of the binding ability, the presence or absence of the formation of a complex between the two, or, when evaluating the efficiency, the detection probe It is an object of the present invention to provide a novel detection method capable of reducing the consumption of a sample required for the evaluation for each kind of oligonucleotide. In addition, another object of the present invention is to provide a detection substrate used exclusively for such a detection method, in which the oligonucleotide of the detection probe is immobilized on a predetermined region on the surface, and a method for preparing the same.

More specifically, the detection substrate is fixed to each section of the matrix using a DNA probe matrix in which the plurality of types of oligonucleotides of the detection probe are arranged in a matrix. A DNA probe having a known base sequence is detected for hybridization or not, and a test is performed for a large number of sample samples to determine whether a nucleic acid molecule having a specific base sequence is contained therein. When performed at the same time, even when reducing the amount of specimen required for each DNA probe,
It is an object of the present invention to provide a novel detection method that can be suitably used as a form of a nucleic acid molecule detection method capable of achieving a sufficiently high detection sensitivity.

[0020]

Means for Solving the Problems In order to solve the above-mentioned problems, the present inventors have conducted intensive studies and examinations, and used an oligonucleotide whose base sequence is known as a detection probe. Conventionally, when detecting a target component having a binding ability, for example, a nucleic acid molecule, a detection substrate on which an oligonucleotide serving as a detection probe is immobilized on a surface is immersed in a solution containing the target component, for example, a nucleic acid molecule. A method of performing a hybridization reaction to form a complex between the oligonucleotide of the probe and the target component, for example, a nucleic acid molecule, and detecting the complex using an appropriate label is used. component,
For example, instead of immersion in a solution containing nucleic acid molecules, a probe oligonucleotide is fixed in a predetermined section, and a target solution, for example, a solution containing nucleic acid molecules is spotted on this section in a fixed volume. If a method is adopted in which a hybridization reaction is carried out in such a microdroplet and the resulting complex is detected using a microscopic detection system while selecting a spot position, the detection accuracy and sensitivity can be improved. I have found it to be sufficiently high. In addition, using this method, the sample solution to act on the probe oligonucleotide only requires the amount of liquid used for the microdroplets of the spot per oligonucleotide of each probe, and a plurality of types of probe oligonucleotides are required. Even so, it has been found that the total liquid volume can be much smaller than the liquid volume required to immerse the entire detection substrate. In addition, in order to place each sample sample in a fixed liquid volume spot shape, by selecting the spot diameter and the spot interval between adjacent spots so that the droplets do not mix with each other, once For a plurality of analyte samples, under essentially the same conditions, a target component showing the binding ability to the oligonucleotide of each probe, for example,
It was confirmed that the presence or absence of a nucleic acid molecule could be detected and evaluated with the same sensitivity and accuracy. Therefore, on the detection substrate, the oligonucleotide of each probe is uniformly fixed in a predetermined compartment,
In order to prevent mixing and contamination between the oligonucleotides of the probe between the compartments, the plurality of the compartments are arranged in an orderly matrix, and for the plurality of specimen samples spotted in each compartment, the spot is formed. If you do this in an orderly array matrix,
The present inventors have found that it is also possible to carry out the detection operation on a large number of sample samples at once with respect to various types of detection probes, and have completed the present invention.

That is, according to the method for detecting a target component in a specimen sample of the present invention, an oligonucleotide having a known nucleotide sequence is used as a detection probe, and the target component having a binding ability to the oligonucleotide is contained in a liquid specimen sample. Is included, or, in order to evaluate the strength of its binding ability, a method for detecting a complex formed between the oligonucleotide and the target component, used as a detection probe, The oligonucleotide whose base sequence is known is at least one or more, and the sample sample to be evaluated is at least two or more, and the one or more detection probe oligonucleotides are on a predetermined solid-phase substrate. Using a detection substrate which is pre-bound to a predetermined compartment, and wherein the detection probe oligonucleotide is pre-bound. A step of spotting a plurality of predetermined sample liquid volumes for each spot such that the spot positions form a prescribed array shape for each of the two or more types of sample samples, A step of detecting the presence or absence of a complex formed between the oligonucleotide and the target component for each of the plurality of spots, and containing a target component having a binding ability to the oligonucleotide based on the detection result. And a step of determining whether the binding ability is high or low or not, and a step of determining the strength of the binding ability. At that time, when the length of the known base sequence of the oligonucleotide bound to the predetermined section on the detection substrate is 2 to 100 bases, the method of the present invention is more suitable for the detection method. Become.

In the detection method of the present invention, the liquid sample to be evaluated is a solution containing at least one nucleic acid whose base sequence is unknown. By detecting the presence or absence of complex formation in the nucleic acid of unknown base sequence contained in the specimen sample, as a target component having a binding ability to each oligonucleotide, for the known base sequence of each of the oligonucleotides It is preferable to determine whether or not a nucleic acid molecule having a complementary base sequence is included as a detection method for the purpose of the evaluation. Specifically, when the nucleic acid contained in each of the liquid sample samples to be evaluated contains a set of mRNAs extracted from a biological tissue,
It is a suitable detection method. Similarly, a cDN prepared based on a set of mRNAs extracted from a biological tissue is included in the nucleic acid contained in each of the liquid sample samples to be evaluated.
It is a suitable detection method even when the A library is contained. At this time, it is preferable that the nucleic acids contained in the liquid sample samples to be evaluated are nucleic acids having a length of 100 to 5000 bases.

In addition, in addition to the nucleic acid molecule as a component to be detected, for example, when the liquid sample to be evaluated is a solution containing at least one protein different from each other, The detection method can be suitably used. Further, the liquid sample to be evaluated is,
The detection method of the present invention can be suitably used even when the solutions contain at least one different chemical substance. The detection method of the present invention is particularly effective when the liquid sample to be evaluated is an extract from a different species, tissue, or cell. You.

In the detection method of the present invention, when detecting a plurality of target components, a plurality of oligonucleotides each having a known base sequence different from each other are used as the oligonucleotides used for the detection probe, and each of the oligonucleotides is bound to each other. An embodiment is characterized in that a detection substrate in which a plurality of sections are arranged in a matrix on the substrate is used.

When the detection method of the present invention is used in this embodiment, the matrix composed of the sections to which the plural kinds of oligonucleotides having different known base sequences are bonded is composed of the respective sections constituting the matrix. It is desirable to have the same area and the arrangement density of the sections of the matrix to be 400 / cm ² or less. In addition, for each of the sections to which the plurality of oligonucleotides having different known base sequences are bonded to each other, the spots are arrayed in an array shape so that the spot positions of the two or more types of sample samples are the same. It is desirable to do.

In the detection method of the present invention, it is preferable that the solid substrate used for the detection substrate is glass.

It is more preferable that the oligonucleotide is immobilized on the detection substrate by a covalent bond. For example, the immobilization of the oligonucleotide on the detection substrate is formed by a chemical reaction between a maleimide group introduced on the surface of the glass substrate used for the solid-phase substrate and a thiol group contained in the oligonucleotide. It is preferable to use a detection substrate formed by a covalent bond. In this case, it is preferable that the maleimide group introduced on the surface of the glass substrate is first introduced by introducing an amino group on the glass surface and reacting the amino group with succiimidyl-4- (maleimidophenyl) butyrate. . Alternatively, the oligonucleotide is immobilized on the detection substrate by a chemical reaction between an epoxy group introduced on the surface of the glass substrate used for the solid-phase substrate and an amino group contained in the oligonucleotide. It is preferable to use a detection substrate formed by a covalent bond.

Usually, in the detection method of the present invention, the substrate surface is partitioned in a matrix in advance, and known oligonucleotides having a plurality of different base sequences are respectively placed in the matrix formed in advance. It is preferable to use a detection substrate that has been bonded in advance. For example, in the matrix-shaped section previously formed on the substrate surface, each section is divided by a hydrophobic wall (wall surface) portion, and a bottom surface portion of each section uses a hydrophilic solid phase substrate. be able to. In this case, the thickness of the wall (wall surface) for partitioning each section is 1 to 20 μm.
It is desirable that

In the detection method of the present invention,
The oligonucleotide for the detection probe is previously bound.
In each of the combined compartments,
And the diameter of each spot to be formed is 200 μm or less.
It is preferably below. In addition, the detection probe
In each compartment to which the oligonucleotide for use is previously bound
Next, spots formed by the two or more types of sample samples are formed.
Area density of 400 / cm ^TwoMore preferred
New

In the detection method of the present invention, for example, the supply of the sample liquid to each spot formed on each of the two or more kinds of sample samples can be performed by supplying a predetermined amount of liquid by an ink-jet method. It is preferable to use means.

In this case, it is preferable to use this means if the two or more kinds of sample samples supplied by the ink-jet method at the time of spotting are each a solution containing a nucleic acid having a length of 100 to 5,000 bases. Can be. In addition, it is more preferable that the two or more kinds of sample samples respectively supplied by the ink-jet method have a total concentration of the nucleic acid contained of 0.05 μM to 500 μM. Specifically, it is preferable to employ a bubble jet method as the ink jet method used for spots.

In the detection method of the present invention, in addition to the above, spot formation of a sample sample is performed by bringing a pin for collecting a sample solution into contact with a liquid surface of a sample solution storage site for holding each sample sample solution. By attaching a sample solution to the tip and dispensing a predetermined amount of liquid, then physically bringing the pin tip into contact with the substrate surface and transferring the dispensed predetermined amount of liquid to the substrate surface. Can be supplied.

Further, the spot formation of the sample sample is performed by inhaling the sample solution from a sample supply unit for supplying each sample sample solution using a capillary tube, and bringing the tip end of the capillary tube into which the sample solution has been sucked into physical contact with the substrate surface. Thus, a predetermined amount of liquid can be supplied by transferring it to the substrate surface.

On the other hand, the present invention also provides a detection substrate exclusively used for performing the above-described detection method of the present invention. That is, the detection substrate of the present invention, on a solid substrate,
A detection substrate on which a plurality of types of oligonucleotides having different known base sequences are fixed to each other, wherein each of the plurality of types of oligonucleotides is provided in a predetermined section so that one type of oligonucleotide exists in each section. The detection substrate is characterized in that the plurality of sections to which the oligonucleotides are fixed and bound are arranged in a matrix on the surface of the solid phase substrate. At this time, it is preferable that the plurality of types of the oligonucleotides to be bound in a predetermined section have a known base sequence of 2 to 60 bases in length.

It is preferable that the plurality of sections arranged in a matrix on the surface of the solid-phase substrate have a matrix density of 400 / cm ² or less.

In the detection substrate of the present invention, the solid substrate is preferably a glass substrate. On the other hand, the immobilization of the oligonucleotide on the substrate surface can be performed by covalent bonding.

For example, the oligonucleotide is immobilized on the detection substrate by a chemical reaction between a maleimide group introduced on the surface of the glass substrate used for the solid phase substrate and a thiol group contained in the molecule of the oligonucleotide. It can be formed by a covalent bond formed. In this case, the maleimide group introduced on the surface of the glass substrate can be introduced, for example, by first introducing an amino group on the glass surface, and reacting the amino group with succiimidyl-4- (maleimidophenyl) butyrate. .

Alternatively, the oligonucleotide is immobilized on the detection substrate by a chemical reaction between an epoxy group introduced on the surface of the glass substrate used as the solid phase substrate and an amino group contained in the molecule of the oligonucleotide. It can be formed by a covalent bond formed.

In addition, in the detection substrate of the present invention,
It is arranged such that one kind of oligonucleotide is present in each section of the matrix, the immobilization of each of a plurality of kinds of oligonucleotides in a predetermined section, on the solid-phase substrate surface, each of the plurality of kinds of oligonucleotides, It is preferable to use a detection substrate that is supplied into a predetermined section by printing by an inkjet method.

In particular, on the surface of a solid-phase substrate on which a plurality of sections preliminarily divided into a matrix are formed, a plurality of types of oligonucleotides, each of which is bound to the preliminarily formed matrix section, are used for detection. Preferably, it is a substrate. At this time, it is preferable that the matrix-shaped sections formed in advance on the substrate surface are separated from each other by a hydrophobic wall (wall surface), and that the bottom surface of each section is hydrophilic. Further, the thickness of the wall (wall surface) for partitioning each section is 1 to 20 μm.
Is more preferable.

Further, the plurality of types of oligonucleotides may be fixed to the matrix-shaped section formed in advance by, for example, supplying each of the plurality of types of oligonucleotides only to the bottom portion of the section by an ink-jet method. Can be done.

The method for preparing the detection substrate of the present invention is a method suitable for producing the above-described detection substrate of the present invention. Specifically, the method has different known base sequences on a solid phase substrate. A method for preparing a detection substrate on which a plurality of types of oligonucleotides are immobilized, wherein the solid-phase substrate is formed on a surface of which a plurality of sections preliminarily partitioned into a matrix are formed, and the plurality of types of oligonucleotides are used. Respectively
As one kind of oligonucleotide is present in each section, a predetermined amount is supplied into a predetermined section by a printing method by an inkjet method, and within the predetermined section,
This is a method for preparing a detection substrate, comprising fixing the supplied oligonucleotide.

[0043]

BEST MODE FOR CARRYING OUT THE INVENTION According to the detection method of the present invention, a liquid analyte sample has a binding ability to an oligonucleotide having a known nucleotide sequence used as a detection probe and forms a complex with the oligonucleotide. Or not, and when such a component is present, regarding the strength of its binding ability,
This is a method for detecting a complex formed between an oligonucleotide for a detection probe and a target component, which is used for the purpose of evaluation and inspection. When detecting this complex, the oligonucleotide for the detection probe is fixed on the surface of the solid-phase substrate in advance, so that the fixed oligonucleotide and the target component contained in the specimen sample are bound. Then, the complex to be formed is also separated while being fixed on the solid-phase substrate, and based on the method of detecting the complex using appropriate detection means, the amount of the sample sample required in that case is extremely small. In addition, the detection accuracy and the sensitivity itself are kept sufficiently high.

That is, in this method on which the present invention is based, since the areal density of the oligonucleotide for the detection probe fixed on the surface of the solid phase substrate can be set to a predetermined value in advance, the complex formed The amount is proportional to the binding ability of the target component, and is also proportional to the concentration of the target component contained in the specimen sample that has been brought into contact with the surface of the solid-phase substrate and acted on the oligonucleotide. Utilizing this feature, only the surface on which the oligonucleotide for the detection probe is currently immobilized is brought into contact with the specimen sample, and is used by limiting the contact area. It is also assumed that the liquid volume of the sample is limited. Specifically, a predetermined minute liquid amount is formed into droplets, and spotting means is employed to control the contact area and the amount of liquid placed thereon with good reproducibility. By automatically detecting the amount of the complex to be immobilized on the surface of the solid-phase substrate with the formation of the limited contact area, the oligonucleotide for the detection probe is immobilized on the surface by automatically detecting the amount of the complex. Essentially the same detection accuracy and sensitivity are achieved as when the entire phase substrate is immersed in a liquid specimen sample.

The detection of the complex itself utilizes a method of labeling the complex itself and detecting the label attached to the surface according to the complex, thereby detecting the presence of the accompanying complex. However, by using a fluorescent dye label or the like as the label, if a certain interval is provided between individual spots, it is possible to perform detection independently for each spot. Therefore, if the distance between adjacent spots is equal to or greater than a certain distance, even if spots for different sample samples are present around them, detection is performed while selecting only spots for the target sample sample without being affected by them. It is possible to do work. In order to reliably achieve the requirement that the interval between adjacent spots is equal to or longer than a certain interval, in the detection method of the present invention, the interval between spots is set to a predetermined interval. In addition, since the spot area (contact area), in general, the spot (contact surface) shape is circular, a predetermined sample liquid amount is spotted for each spot so that the spot diameter is constant and reproducible. I am trying to do it. Needless to say, in order to eliminate the influence of the adjacent spot, the area to be measured (diameter of the measurement range) of the detection system appropriately selected according to the spot diameter.
In consideration of the above, an interval between spots is selected so that an optical signal (such as fluorescence) derived from an adjacent spot does not enter the detection system. In addition, as a matter of course, in the detection method of the present invention, when there are a plurality of types of sample samples, when the samples are simultaneously subjected to detection, the advantage is truly exhibited.

On the other hand, it is necessary that one kind of detection probe oligonucleotide is immobilized at a uniform areal density on the surface on which a plurality of spots in such an array are formed. The area and shape of the section where the oligonucleotide for detection probe is immobilized are appropriately selected according to the above-mentioned array interval and the total number of spots to be included in a series of arrays. On the detection substrate to be used, sections in which different oligonucleotides are fixed are provided in mutually different regions, and a plurality of sections in which a plurality of types of oligonucleotides are respectively fixed can be arranged on one detection substrate. . That is, the detection method of the present invention uses a plurality of types of oligonucleotides as detection probes, and for a plurality of target components corresponding to each, for a plurality of sample samples, at the same time, when performing a series of evaluations. , It is a more suitable method.

Generally, in this type of evaluation, the type of the oligonucleotide for the detection probe is determined in advance, while the number of sample samples to be evaluated is often only an approximate number. In such a case, as a detection substrate on which oligonucleotides for detection probes are fixed in advance, sections where each oligonucleotide is fixed are arranged in a matrix on the substrate surface, and a plurality of types of detection probes are used. It is preferable to use an orderly placed detection substrate. In the detection substrate in which the fixed sections are arranged in a matrix, the unit of the total number of spots spotted in an array form in each section is fixed, but it depends on the number of sample samples to be actually evaluated. The evaluation can be performed using a plurality of spot number units, which is more convenient than practical. Note that each section arranged in a matrix may be provided with a pattern formed of a hydrophobic compound at its boundary to form a mutual area.

In the detection method of the present invention, a nucleic acid molecule is selected as a target component, and is subjected to a hybridization reaction with an oligonucleotide for a detection probe.
It can be applied to the evaluation of whether or not a double strand is formed to form a hybrid. In this case, a nucleic acid molecule containing a nucleotide sequence having complementarity with the known nucleotide sequence of the oligonucleotide for the detection probe is used to determine whether or not the nucleic acid molecule is contained in the sample sample, even for a large number of sample samples at once. It is an effective way to evaluate. Alternatively, when a plurality of types of oligonucleotides for the detection probe are used, and each specimen sample contains one type of nucleic acid molecule, a known nucleic acid molecule whose base sequence is not known is possessed by each oligonucleotide. It is possible to evaluate whether or not it contains a nucleotide sequence having complementarity with the above nucleotide sequence. For example, it is effective as a means for searching for a group of genes having homology.

The detection substrate of the present invention is a DNA probe substrate in which oligonucleotides used as probes are respectively bound to sections arranged in a matrix in advance, and in particular, the substrate itself is a frame formed of a hydrophobic compound in advance. The binding of oligonucleotides is made easier by making the bottom of each section of the structural matrix pattern separated by wells (walls) a hydrophilic surface. Further, by providing this hydrophobic wall (wall), D
It is possible to more reliably prevent the NA probes from mixing with each other.

Further, by using these DNA probe substrates, sample samples are spotted in an array on an oligonucleotide matrix and a hybridization reaction is carried out, whereby complementary to each sample sample for a specific oligonucleotide probe is obtained. This is a means for quickly checking whether or not a nucleic acid molecule having a property is contained.

In this method, since the amount of the specimen used for the hybridization reaction is determined only by the number of spots, there is no limitation on the size of the detection substrate, and by using a large-area substrate, The section for fixing each probe can be widened, and the necessity for high density is eliminated. Therefore, since the section for immobilizing each probe can be widened, the means for binding the probe oligonucleotide on the substrate includes a liquid containing the probe in a defined region on the substrate,
It is possible to use a wide range of methods such as coating, printing as a “solid pattern” by an inkjet method, or chemical synthesis on a substrate.

Considering that the probe oligonucleotide is cheaper and easier to obtain than the specimen sample, there is no problem even if the area of the oligonucleotide binding region is somewhat large. It is not always necessary to spot various sample samples at high density. When spotting the sample sample little by little, the hybridization reaction can be promoted by increasing the concentration of the target component contained in the sample sample, and highly sensitive detection can be performed in a short time. In addition, when the detection method of the present invention is applied, a sufficient amount of sample cannot be obtained so far, and a region that could not be examined, for example, directly examines mRNA obtained from a tissue, opens up a new test region. It is.

Further, information on the reactivity of the obtained hybridization reaction is compared with nucleic acid molecules contained in a specific specimen sample by using various oligonucleotides,
By performing analysis / evaluation from the viewpoint of the presence or absence of complementation with the probe, detection having the same function as a conventional DNA array (hybridization reaction of one sample with various kinds of probes) can be performed.

Further, the detection method of the present invention is a means for evaluating the interaction between a chemical substance, particularly a drug and an oligonucleotide, the binding property between a protein and an oligonucleotide, and the like, as a target component. It can also be used as a means for simultaneously evaluating multiple items of the target component contained therein. further,
On the same substrate, it is also a means by which target components having different properties such as chemical substances, proteins, and nucleic acids can be simultaneously examined under the same reaction conditions.

Hereinafter, the detection method of the present invention and the detection substrate exclusively used therefor will be described in more detail.

FIG. 1 shows an example in which the detection method of the present invention is applied to an embodiment in which a hybrid is formed by performing a hybridization reaction with a known base sequence oligonucleotide used as a detection probe using cDNA as a target component. . In the detection substrate shown in FIG. 1, a plurality of rectangular sections which are preliminarily arranged in a matrix are provided on the surface of a rectangular solid phase substrate. Each rectangular section is
It is spatially separated by a matrix section that forms a surrounding wall. DNA probes used as hybridization probes are uniformly bonded on the bottom surface of the rectangular section.

In the compartment where the DNA probe is fixed, a plurality of sample samples containing cDNA as a target component, for example, based on m-RNA collected respectively,
An enlarged view schematically showing a state where spots are formed in a two-dimensional array like a square matrix with respect to a plurality of prepared cDNA solutions is attached. The detection substrate, detection probe, component to be detected, and the like used in the detection method of the present invention will be described in more detail.

(Types of Oligonucleotide Used for Detection Probe) In the detection method of the present invention, deoxyribonucleic acid can be used as the oligonucleotide used for the detection probe. In addition, ribonucleic acid,
It is also possible to use a peptide nucleic acid or the like. Any type may be used as long as it has a desired base sequence and can be bonded to another molecule at that portion, and at the same time, can be immobilized on a solid phase substrate. In addition, the portion excluding the nucleic acid chain may be modified with a non-nucleic acid atomic group or may have an additional structure if the above requirements are satisfied.

It is necessary to artificially prepare or collect a desired amount of the oligonucleotide used for the detection probe, and the base sequence itself needs to be known. However, the nucleic acid portion has at least two or more bases. In principle, there is no upper limit on the base length, but if it exceeds 100 bases, when immobilizing on a solid phase substrate, as the base length increases, the difficulty increases, so that the base length can be limited to 100 bases or less. preferable.

For example, when the oligonucleotide is subjected to a hybridization reaction with, for example, a nucleic acid molecule having more than 100 bases, it is preferable that the oligonucleotide be at least 10 mer in order to obtain sufficient binding properties. on the other hand,
If it exceeds 50 mer, it is difficult to set conditions for controlling the detection of mismatch, and it is difficult to select and detect only perfectly matched ones. Therefore, it is preferable that the length be 50 mer or less.

The range of 10 mer to 50 mer is a preferable range for preparing an oligonucleotide having a target base sequence, for example, DNA, by chemical synthesis.

(Shape of Section for Arranging Oligonucleotides to be Arranged in a Matrix) The shape of the section to which the oligonucleotide used for the detection probe is bound and immobilized is not particularly limited. However, on this parcel,
Considering spotting sample samples in an array,
It is generally desirable to select a simpler shape than a complex outer shape. In addition, when binding and immobilizing oligonucleotides, it is generally preferable to select a simpler shape in order to make the areal density uniform in such a compartment from the viewpoint of work efficiency and convenience. . Specifically, it is preferable to adopt a rectangular shape, for example, a linear (linear), square, or rectangular shape. Of course,
In principle, there is no problem even if the outer periphery is formed by a curve, such as a circle or an ellipse.

On the other hand, in the detection substrate of the present invention, when a plurality of types of oligonucleotides used for the detection probe are mounted on one substrate, from the viewpoint of work efficiency and convenience, a compartment for fixing the oligonucleotide is used. Are preferably arranged in a matrix. It is also preferable to unify the shape of each section and unify the area occupied by each section.

(Density of Sections Arranged in a Matrix)
The density of the sections arranged in a matrix is appropriately selected depending on the number of types of oligonucleotides simultaneously placed on the detection substrate, but is preferably selected to be 400 or less per 1 cm ² . If the density is 400 / cm
^If it is set to ² and the shape of each section is a square, the size of each section is 500 μm square. When the sample is spotted with a diameter of 100 μm and densely arranged in an array in this section, there are 5 spots in each of the vertical and horizontal directions, that is, a total of 25 spots. When the spot diameter is 20 μm, the number of spots that can be arranged on one side is 25, for a total of 625 spots. The detection method of the present invention, when there are a large number of sample samples, when evaluating them at the same time, because it has a greater advantage, at least the upper limit of the number of sample samples that can be spotted, so that the above value is about In addition, selecting the density of the compartments to be arranged is more consistent with the final object of the invention.

For example, when the detection method of the present invention is applied to a sample containing cDNA, the number of sample samples to be evaluated at one time, specifically, the total number of types of cDNA can reach about 3600. Often. In this case, when the spot diameter is 100 μm, the size of one section is about 6 mm square when the length and width are each set to 60 spots. Even when the spot diameter is set to 20 μm, the size of one section needs to be 1.2 mm square. As described above, in the detection substrate used in the detection method of the present invention, it is not rare that the density of the sections arranged in a matrix is preferably selected to be 400 or less per 1 cm ² .

In the detection method of the present invention, the specimen is spotted in the form of a droplet.
In the case of μm, the liquid amount required for a droplet per spot is about 2
5 picoliters. Even if the number of probes used for evaluation is selected to be 400 at this spot size (for example, the number of sections of the matrix provided on the substrate is 400), the total spot is required for each specimen sample. The total amount of the liquid can be limited to 10 nanoliters, and the target evaluation item can be implemented with a very small amount.

In the conventional method of immersing the detection substrate in the sample sample solution, the required amount of the solution depends on the size of the substrate. It has been necessary to reduce the size of the substrate to meet the requirements, and it has been essential to highly integrate probes fixed on the substrate. On the other hand, in the detection method of the present invention, the size of the substrate itself can be arbitrarily selected without considering the liquid amount of the specimen sample. In addition, when immobilizing the oligonucleotide used for the detection probe, it is, of course, necessary to make the surface density uniform, but it is not necessary to highly integrate and immobilize a plurality of probes. Will be easier.

(Immobilization of oligonucleotide on substrate)
As a means for immobilizing the oligonucleotide used for the detection probe on the substrate surface, a separately prepared oligonucleotide is applied, or, by printing, supplied into a predetermined compartment and bound, or Each oligonucleotide, specifically, DN on the substrate
A method can be used in which solid-phase synthesis of the A probe or the like is performed to prepare an originally bound DNA. The oligonucleotide is other than DNA, for example, ribonucleic acid,
In the case of peptide nucleic acids as well, it is possible to combine them by synthesizing them on a substrate, as described later.

On the other hand, oligonucleotides synthesized or collected separately in advance, specifically, DN
When using A or ribonucleic acid, peptide nucleic acid, etc. as a probe, a method of immobilizing to the substrate surface by a covalent bond, or a method of fixing by using an electrostatic bond is used. It is possible.

(Synthesis of Oligonucleotide on Substrate)
For DNA synthesis on a substrate, for example, US Pat.
As in the method disclosed in Japanese Patent Application Laid-Open No. 4 (1999) -176, synthesis on a silicon substrate using photolithography is mentioned. U.S. Pat. No. 5,445,934 discloses a method for producing a high-density DNA probe array by dividing the surface of a silicon substrate into extremely small areas and synthesizing DNA for probes. On the other hand, in the detection substrate used in the detection method of the present invention, for example, the section size to which each probe is fixed can be 0.5 mm square or more, and does not necessarily require high density. However, a photodegradable protecting group, a protecting group that is decomposed by a chemical substance, and the like are previously bound to the nucleic acid, and the masking, exposure, and reaction steps are repeated to bind the four nucleic acid bases one by one. To extend a DNA strand having a desired base sequence,
Utilizing the method described in S54445934,
Also in the detection substrate of the present invention, a DNA chain can be synthesized on each section.

(Immobilization of Oligonucleotides Synthesized or Collected in Advance) As a means of immobilization using electrostatic bonding, polylysine, polyethyleneimine A technique of blocking polyalkylamine aons is generally used.

However, in the case of an oligonucleotide having a base length of 50 or less and not long enough, the charge of the phosphate group is small, and the binding to the substrate by the above-mentioned method is not necessarily strong. For oligonucleotides whose base length is not sufficiently long, an oligonucleotide having a functional group for covalent bonding introduced at the end of the nucleic acid is synthesized in advance, and the substrate is subjected to surface treatment according to the functional group. It is more preferable to use a method of performing covalent bonding using the functional group, since a stronger bond can be achieved.

Also, when the oligonucleotide is RNA, the method used for DNA can be applied. Alternatively, in the case of a peptide nucleic acid, the technique used for the DNA can be applied using the nucleic acid portion.

(Type of Functional Group Used for Covalent Bonding of Oligonucleotide to Solid-Phase Substrate) When the oligonucleotide is fixed to the surface of the solid-phase substrate by covalent bonding, the oligonucleotide is previously fixed to the oligonucleotide. On the phase board surface,
It is general to introduce a functional group and perform a reaction between them. Regarding the combination of the functional groups, a preferable example is a combination in which a maleimide group is introduced into the substrate surface and a thiol group (—SH) is introduced into the oligonucleotide. Specifically, a thiol group (-SH) is bound to the end of the oligonucleotide,
The surface of the solid phase is subjected to a treatment for forming a coating having a maleimide group, and when an oligonucleotide is supplied to the surface of the solid phase, a thiol group (-SH) acts on the maleimide group;
The reaction causes immobilization by the formation of covalent bonds.

Various methods can be used to introduce a maleimide group on the surface of the solid phase. For example, an aminosilane coupling agent is reacted on a glass substrate, and then the following formula (II):

[0076]

Embedded image

N- (6-maleimidocaproyloxy) succinimide (N- (6-maleimidocaproylox)
y) succinimide) (EMCS reagent: Doji
(manufactured by N Co., Ltd.) and reacting it with the amino group of the silane coupling, it is possible to form a coating layer having a maleimide group.

In addition, for example, when a DNA is synthesized using an automatic DNA synthesizer, a 5′-Thiol-Modif
It can be synthesized by using ierC6 (manufactured by Glen Research). After the synthesis, after the ordinary deprotection reaction, purification treatment by high performance liquid chromatography is performed.

Examples of combinations of functional groups that can be used for immobilization by covalent bonding include, in addition to the combination of the thiol group and maleimide group, for example, an epoxy group (on the solid surface) and an amino group (of the oligonucleotide). Terminal). The introduction of the epoxy group to the solid phase surface, for example, by applying to a solid phase surface made of polyglycidyl methacrylate resin having an epoxy group, or by applying a silane coupling agent having an epoxy group to a glass solid surface. A method of reacting with glass is exemplified.

(Supply of Oligonucleotide Solution by Inkjet Method) A means for supplying a solution containing oligonucleotide immobilized thereon to a predetermined section on the surface of a solid-phase substrate supplies a uniform amount of liquid per unit area. There is no particular limitation as far as it is. For example, when using printing by an ink-jet method or the like, a “solid pattern” is prepared, and an ink-jet printer head used for an ink-jet printer is used. Instead, a technique of filling the oligonucleotide solution and printing a defined area is used. When the amount of liquid to be supplied is small, a large-capacity liquid such as an ink cartridge is not used. Instead, a sample supply unit such as a tube is connected to the head, and the oligonucleotide solution is supplied to the head. A structure may be used.

As the oligonucleotide solution for ejection used in this method, a solution which can be ejected like an ink jet and has a viscosity suitable for the minute droplet ejected from the head to land on a desired position is used. . further,
The solvent to be used is selected from a mixed state of the target oligonucleotide and a solvent which does not damage the target oligonucleotide at the time of ejection, in addition to satisfying the above requirements.

More specifically, from the viewpoint of dischargeability from an ink jet head, particularly a bubble jet head, the characteristics of a solution include, for example, a viscosity of 1 to 15 c.
It is preferable that ps and the surface tension be 30 dyn / cm or more. Above all, viscosity is 1-5 cps, surface tension is 3
When selecting from the range of 0 to 50 dyn / cm, the landing position on the solid phase substrate becomes extremely accurate, and the supply method using a bubble jet head can be particularly suitably used.

In addition, in consideration of the stability of the oligonucleotide at the time of ejection, for example, 2 to 100 mer, particularly 2 to 60 m
er oligonucleotide, 0.05-500 μM,
When using a solution to be contained in a concentration range of preferably 2 to 50 μM, a supply means of an ink jet system is more preferable.

In applying the ink jet type ejection method, as described above, the liquid composition of the oligonucleotide solution is substantially the same as the target oligonucleotide mixed with the target oligonucleotide, and even when the target oligonucleotide is discharged. Of course, the composition is not particularly limited as long as the composition can be normally ejected onto the surface of the solid-state substrate using an ink jet. In addition, in addition to the target oligonucleotide, for example, glycerin, urea, thiodiglycol or ethylene glycol, isopropyl alcohol, or the following formula (I):

[0085]

Embedded image

(Wherein R ₁ , R ₂ , R ₃ , and R ₄ represent an alkyl group, for example, a linear or branched alkyl group having 1 to 4 carbon atoms, and m and n each represent 0 or a positive An integer, 1
≦ m + n ≦ 30) is preferable. More specifically, urea is 5 to 10 wt%, and glycerin is 5 to 10 w
% of thiodiglycol, and 0.02 to 5% of acetylene alcohol represented by the formula (I).
When the composition of the solution contains 0.1% by weight, more preferably 0.5% to 1% by weight, the ink jet method is suitably used.

(Matrix Structure Consisting of Hydrophobic Wall and Hydrophilic Well) The matrix-shaped section provided on the surface of the solid phase may be, for example, a hydrophobic wall (hollow well) surrounding a hydrophilic well (dent bottom). (A barrier section) and a matrix-like section is formed to prevent connection between adjacent sections. The oligonucleotide solution is supplied to the hydrophilic well (the bottom of the hollow) surrounded by the hydrophobic wall (the barrier), and the oligonucleotide is fixed only to the bottom of the hydrophilic well (the bottom of the hollow). Configurations are also available.

(Material of Wall / Well) As a section arranged in a matrix, a solution of oligonucleotide is supplied to the bottom of a well (bottom of a depression) divided by a wall (barrier) pattern to perform a binding reaction. When doing the well
The bottom surface of the (dent bottom) is wetted with the solution densely, but the wall (barrier portion) desirably has poor wettability with the solution. For example, the solid phase material constituting the surface of the bottom part of the well (the bottom of the well) is rich in hydrophilicity, and the wall surface of the wall (barrier part) and the part corresponding to the adjacent partition are poorly hydrophilic. Is preferred. As a result, the aqueous solution of the oligonucleotide supplied to the bottom of the well (the bottom of the depression) spreads over the entire bottom, but is prevented from entering the adjacent section beyond the wall (barrier). Also,
If the liquid droplet is erroneously supplied to the position where it hangs on the wall (barrier portion), it quickly moves to the target well (well bottom) with good wettability, so that a predetermined amount of the oligonucleotide solution is wetted.
ll (recess bottom) ensures reliable supply.

FIG. 5 shows an example of sections arranged in a matrix provided on the detection substrate of the present invention. The square matrix section has a structure in which a convex portion (wall) having a frame structure is provided on the surface of the solid-phase substrate, and the arranged rectangular concave portion (well) is partitioned. Specifically, the concave portions (wells) separated from each other by the convex portions (walls) having the frame structure are formed by covering the entire surface of the solid phase substrate with the material forming the convex portions (walls), and then forming a rectangular shape. A through hole (opening) having a shape is provided, and a recess (well) is opened. Therefore, on the bottom of the recess (well),
In this state, the surface of the solid substrate is exposed. The exposed portion of the surface of the solid-phase substrate is treated so that the surface can be bound to the oligonucleotide. As a result, this recess (well)
The oligonucleotide is immobilized only on the bottom surface of.

Examples of the material for forming the projections (walls) having the frame structure include metals (chromium, aluminum, gold, etc.) and resins. Acrylic, as resin
Resins such as polycarbonate, polystyrene, polyimide, acrylic acid monomer, urethane acrylate, and the like, and photosensitive resins such as photoresists containing a black dye or a black pigment may be used. In addition, as a specific example of the photosensitive resin, for example, UV resist, DEEP-
A UV resist, an ultraviolet curable resin, or the like can be used. Examples of the UV resist include a negative resist such as a cyclized polyisoprene-aromatic bisazide-based resist and a phenol resin-aromatic azide compound-based resist, and a bodied resist such as a novolak resin-diazonaphthoquinone-based resist.

As the DEEP-UV resist, as a positive resist, for example, polymethyl methacrylate,
Polymethylene sulfone, polyhexafluorobutyl methacrylate, polymethyl isopropenyl ketone, and
Radiation-dispersible polymer resists such as poly 1-trimethylsilylpropyne bromide, and dissolution inhibitor-based resists such as o-nitrobenzyl cholic acid;
As a negative resist, borovinylphenol-3,
3'-diazidodiphenyl sulfone, polyglycidyl methacrylate, and the like can be given.

The UV-curable resin contains about 2 to 10% by weight of one or more photopolymerization initiators selected from benzophenone and substituted derivatives thereof, and oxime compounds such as benzyl. And polyester acrylate, epoxy acrylate, and urethane diacrylate.

At the time of detection using a fluorescent label, in order to suppress light reflection due to the material forming the projections (walls) having the frame structure, it is effective to use a light-shielding material. is there. In order to impart light-shielding properties, it is effective to add a black pigment to the above-mentioned resin. At this time, examples of usable black pigments include carbon black and black organic pigments.

Note that a projection (wall) having a frame structure is provided.
Is formed of the above-mentioned resin material having hydrophobicity, the surface of the projection (wall) becomes hydrophobic. The configuration in which the convex portions (walls) having the frame structure formed of the material exhibiting hydrophobicity are provided when the aqueous solution is used as the solution containing the oligonucleotide to be supplied to the substrate surface of the concave portion (well). Is more preferable. what if,
Even if the aqueous solution is supplied to a position that hangs on the surface of the convex portion (wall), the solution does not directly adhere to the surface of the convex portion (wall), and gradually fills the bottom of the concave portion (well) at a lower position. Will be migrated. In addition, different types of oligonucleotide solutions are supplied to adjacent recesses (wells), but are separated by hydrophobic projections (walls). Mixing (cross contamination)
Has been prevented.

Note that a projection (wall) having a frame structure is provided.
Thickness (height from the solid phase substrate surface) is concave (well)
The volume of the concave portion (well) is selected in consideration of the amount of the oligonucleotide solution to be supplied to the container, and the volume is appropriately determined so as to satisfy the volume. Although it depends on the method of forming the projections (walls), it is preferable to select the projections in the range of 1 to 20 μm so as to satisfy the above requirements. The thickness of the protrusions (walls) selected in this manner is determined when the oligonucleotide solution is supplied to each well by the inkjet method.
This is a thickness region that effectively prevents cross contamination between adjacent wells.

(Type of Sample) As a target component contained in a sample to which the detection method of the present invention is applicable, mRN is used.
A, cDNA, proteins, cell extracts, and chemicals including drugs.

When cDNA is used as a target component,
Although it is possible to use the double strand as it is, it is preferable to use a single-stranded strand that has been labeled in advance, in order to efficiently form a hybrid and detect it easily.

On the other hand, mRNA is originally single-stranded, and it is possible to efficiently form a hybrid and detect it by labeling by some method to obtain a labeled mRNA. In addition, mRNA in a specimen sample is generally a small amount, and is a target component in which the advantage of being able to reduce the amount of a sample solution required for detection, which is a feature of the detection method of the present invention, is more remarkable. However, during handling, RNase is liable to be contaminated, so that a predetermined amount of a substance that suppresses the degradation of mRNA, such as an RNase inhibitor such as diethyl pyrocarbonate, may be added to the sample sample solution. desirable. In addition to mRNA, RN
The genome of the A virus is also a target component. In addition, tRNA and ribosomal RNA are also target components.

On the other hand, when a protein is used as the target component, the formed complex can be detected by utilizing the fluorescence emitted from the protein itself.

In some cases, some chemical substances emit their own fluorescence, and the complex formed can be detected by utilizing the fluorescence. For a chemical substance that does not emit fluorescence, it can be labeled by a method using a functional group of the compound. Examples of those to which the detection method of the present invention can be applied include chemical substances capable of binding to single-stranded DNA. In addition, examples of chemical substances capable of binding to single-stranded RNA can be given.

(Means for Spotting Sample Samples in Array) In the detection method of the present invention, sample samples are spotted in an array at predetermined positions on a detection substrate. In order to make the required liquid volume small, the spot diameter is several tens μm.
It is selected in the range of about m to 100 μm, but it is necessary to perform spotting with such spot diameter, high uniformity of spot quantity, and high positional accuracy. As spot means satisfying these requirements, there are a pin type, an inkjet type, and a capillary type spot device.

The pin method is a method in which a sample sample is attached to the tip of a pin and the tip is mechanically brought into contact with the surface of a solid phase to copy a predetermined amount of the sample. The capillary method using a capillary method is a method of copying a fixed amount of a sample sample by bringing the solution of the sample sample once sucked into the capillary into mechanical contact with the tip of the capillary to the solid phase surface, similar to the pin method. It is. Various spot devices employing these two methods are commercially available, and commercially available devices can be used.

The pin-type or capillary-type spot apparatus is capable of spotting regardless of the type of specimen sample, and is considered to be the most preferable method for unknown specimen samples. However, for example, DNA contained in the specimen sample
The viscosity of the sample solution varies depending on the length and the concentration of the sample, so that the amount of the spotted liquid varies. Therefore, there is a problem from the viewpoint of quantitativeness.
Regarding proteins, the viscosity of the sample solution varies depending on the size and concentration of the molecules, and there remains a problem in terms of quantitativeness. However, there is a great advantage that a physical stimulus such as a cutting force is not applied to the specimen sample when the droplet is ejected as in the ink jet method described later, and the molecular weight of the specimen itself is not limited.

(Arrayed Spots of Specimen Samples by Inkjet Method) Examples of the specimens that can be ejected by the inkjet method include nucleic acids, proteins, and chemicals.

In the ink-jet method, the length of the nucleic acid that can be ejected and the size of the protein are limited due to the decisive force. However, its quantitative property is superior to other pin methods and capillary methods, and it is more preferably used for discharging a chemical substance than other methods. The nucleic acid that can be ejected has a base pair length of 1 kbp or less, and the protein preferably has a base length of 100 K daltons or less. Regarding chemical substances, the molecular weight is generally sufficiently small as compared with nucleic acids and proteins, and therefore, anything can be discharged except for polymers having extremely large molecular weights.

FIG. 6 is a diagram schematically illustrating a method of discharging a sample solution by an ink jet method, particularly a bubble jet method, which is one of means used for spotting a sample sample solution in the method of the present invention. It is. In FIG. 6, reference numeral 101 denotes a liquid supply system (nozzle) that holds a solution containing a sample as a discharge liquid so as to be able to discharge, 103 denotes a solid phase to which a nucleic acid probe to which the sample reacts is bound, and 105 denotes a solid phase. This is a bubble jet head having a function of applying thermal energy to a discharge liquid and discharging the liquid, which is a type of ink jet head. Reference numeral 104 denotes a liquid (droplet) containing a specimen ejected from the bubble jet head. FIG. 7 is a sectional view of the bubble jet head 105 described in FIG. In FIG. 7, reference numeral 107 denotes a liquid containing a sample solution to be ejected from the bubble jet head 105, and 117 denotes a substrate portion having a heat generating portion for applying ejection energy to the liquid. Substrate part 11
7, a protective film 109 made of silicon oxide or the like;
Electrodes 111-1, 11 made of aluminum or the like
1-2, heating resistance strip layer 11 formed of nichrome or the like
3, a heat storage layer 115 and a support band 116 made of alumina or the like having good heat dissipation. The liquid 107 containing the specimen is formed up to the discharge orifice (discharge port) 119 and forms a meniscus 121 by a predetermined pressure. In this state, when an electric signal is applied to the electrodes 111-1 and 111-2, an area 123 (foamed area) generates heat rapidly, and the liquid 107 in contact therewith is discharged.
It flies toward the surface of the solid phase 103. The amount of liquid that can be ejected using a bubble jet head having such a structure varies depending on the size of the nozzle and the like, but can be controlled to, for example, about 4 to 50 picoliters, This is extremely effective as means for arranging probes in a matrix at high density.

[0107] From the viewpoint of the ejection property from an ink jet, particularly from a bubble jet head, the characteristics of the liquid to be ejected include, for example, a viscosity of 1 to 15 cp.
s, the surface tension is preferably 30 dyn / cm or more. The viscosity is 1 to 5 cps and the surface tension is 30 to 50 dyn.
In the case of / cm, the droplet landing position (spot position) on the solid phase becomes extremely accurate, and is particularly preferably used.

In addition, considering the stability of the nucleic acid at the time of ejection, the solution contains, for example, 100 to 10,000 mer,
Particularly, a single-stranded nucleic acid of 100 to 5000 mer or a double-stranded nucleic acid is preferable. For example, the c-DNA fragment is preferably contained at a concentration of 10 μM or less, particularly preferably 1 μM or less.

The composition of the ejection liquid is such that it does not substantially affect the nucleic acid probe when mixed with the nucleic acid probe as described above and when ejected from the ink jet, and uses the ink jet. The liquid composition is not particularly limited as long as it satisfies the conditions that enable normal ejection to the solid phase, for example, glycerin,
Urea, thiodiglycol or ethylene glycol, isopropyl alcohol and the following formula (I):

[0110]

Embedded image

(Wherein R ₁ , R ₂ , R ₃ , and R ₄ represent an alkyl group, for example, a linear or branched alkyl group having 1 to 4 carbon atoms, and m and n each represent 0 or a positive An integer, 1
≦ m + n ≦ 30) is preferable.

More specifically, urea is 5 to 10% by weight,
5 to 10 wt% of glycerin and 5 to thiodiglycol
10% by weight, and 0.02 to 5% by weight, more preferably 0.5% by weight of the acetylene alcohol represented by the above formula (I).
A liquid containing 〜1 wt% is suitably used.

[0113]

The present invention will be described more specifically below with reference to examples. The examples shown here are examples of the best mode of the present invention, but the present invention is not limited to these examples.

Example 1 An example of a procedure for preparing an oligonucleotide-bound substrate will be described. In this example, a detection substrate in which an oligonucleotide was bound to a 2 mm square region on a glass substrate was prepared by the following procedure.

1. Substrate cleaning A 1-inch square glass substrate was put in a rack and immersed in an ultrasonic cleaning detergent overnight. Thereafter, ultrasonic cleaning was performed in the detergent for 20 minutes, and then the detergent was removed by water washing. Furthermore, after rinsing with distilled water, sonication was further performed for 20 minutes in a container filled with distilled water.

Next, this glass plate was immersed for 10 minutes in a 1N sodium hydroxide solution which had been heated in advance. After being taken out, the 1N sodium hydroxide solution on the surface was washed with water, and then washed with distilled water.

[0117] 2. Surface treatment The cleaned glass substrate is immersed in a 1% silane coupling agent aqueous solution (manufactured by Shin-Etsu Chemical Co., Ltd., trade name: KBM603) at room temperature for 20 minutes, and then nitrogen gas is sprayed on both surfaces to remove moisture and dry. I let it. The glass substrate was baked for 1 hour in an oven heated to 120 ° C. to complete the silane coupling agent treatment on the surface of the glass substrate.

On the other hand, EMCS (N- (6-Maleimidocap
royloxy) succinimide (manufactured by Dojin) 2.7 mg, DM
Dissolved in a 1: 1 solution of SO / ethanol (final concentration 0.3 mg / m
l). The glass substrate that had been treated with the silane coupling agent was immersed in this EMCS solution for 2 hours to cause the amino groups of the silane coupling agent coating the substrate surface to react with the carboxyl groups of the EMCS solution. Along with this reaction, coating with EMCS is performed via a silane coupling agent. A maleimide group derived from EMCS exists on the surface of the obtained glass. After the reaction with the EMCS solution, the glass substrate taken out is washed with distilled water and dried with nitrogen gas. The glass substrate which has been subjected to a surface treatment for introducing a maleimide group is used for a binding reaction with DNA described later.

3. Synthesis of DNA for fixing glass substrate In order to fix the DNA on a glass substrate, an oligonucleotide having the following base sequence 1 was chemically synthesized. In the amino acid sequence of the gene product (peptide chain) encoded by the p53 gene known as a tumor suppressor gene, this sequence 1 has, as a central part, a nucleotide sequence having a nucleotide length of 6 encoding the 248th and 249th amino acids. 18me including
r array. In addition, an SH group is introduced at the 5 'end for fixation on a glass substrate.

Sequence 1 Introduction of the ^{5 '} HS-GATGGGCCTCCGGTTCAT ^3' SH group is carried out by using a commercially available synthesis reagent Thiol-Modifier (manufactured by GlenResearch) on an automatic DNA synthesizer. Subsequently, the DNA was recovered by ordinary deprotection, purified by high performance liquid chromatography, and used in the following steps.

4. D using BJ printer head
Discharge NA and bind to substrate The above synthetic oligonucleotide (DNA) is dissolved in water, and SG clear (glycerin 7.5%, urea 7.5%,
(An aqueous solution containing 7.5% thiodiglycol and 1% acetylenol EH) to obtain a final concentration of 8 µM.

100 μl of this oligonucleotide solution was filled in a nozzle of a BJ printer head BC62 (manufactured by Canon Inc.) in which the nozzle was modified so as to be suitable for a small amount of sample (discharge amount). The modified printer head was set on a drawing machine, and a 2 mm square “solid coating” surface was printed on the glass substrate surface with an oligonucleotide solution. The modified printer head used was
Used for bubble jet type ink jet printing, 36
Printing is possible at a resolution of 0 × 720 dpi.

Thereafter, the glass substrate with the oligonucleotide solution was left in a humidified chamber for 30 minutes to react a maleimide group on the substrate surface with a thiol group (HS-) of the oligonucleotide. Thereafter, the unreacted oligonucleotide was removed. The prepared detection substrate is a substrate in which the synthetic DNA (oligonucleotide) of Sequence 1 is covalently bonded to a predetermined 2 mm square section on a glass substrate.

(Example 2) Supply of a cDNA solution to the surface of an oligonucleotide-bound substrate and hybridization reaction From various cDNA libraries obtained from cancer tissues,
The p53 gene fragment was amplified by PCR, and then only one side chain was re-amplified using a pre-labeled primer to prepare a labeled single-stranded cDNA as a sample. The labeled single-stranded DNA derived from the p53 gene and the DNA bound on the detection substrate prepared in Example 1.
A hybridization reaction with the probe was performed.

[0125] 1. Preparation of Specimen Sample A p53 gene fragment was obtained by PCR from 64 cDNA libraries obtained from cancer tissues.

More specifically, first, a total RNA sample was separated and collected from each tissue collected by biopsy using Catrimox-14 (Biotechnology). This total RNA
First-Strand cDNA Synthesis K based on sample solution
A cDNA library was prepared using it (manufactured by Life Sciences). This cDNA library contains p53
A primer for gene amplification was added, and the P53 gene fragment was
CR amplified. Next, a PCR reaction (a DNA synthesis reaction) in which only one strand is amplified using the PCR amplification product as a template and a labeled 5′-side primer.
Was done. By this reamplification, a single-stranded DNA derived from the labeled p53 gene can be prepared.

(1) Amplification of p53 Gene Fragment Having T3 Binding Site at the End by PCR Method In order to use a primer for an autosequencer using the T3 promoter (Takara Shuzo) as the labeled primer, Has a T3 site in
A primer to which a base sequence capable of amplifying the p53 gene portion was ligated downstream thereof was synthesized. Using these primers, a PCR reaction was performed, and
A PCR amplification product to which the T3 promoter site was linked was obtained.

In this example, a base sequence primer (T3-P5) having a T3 promoter site linked to the 5 ′ side of the 5 ′ end primer for amplifying the p53 gene was used.
3) was produced. The base sequence is shown below. 5 ' AATTAACCCTCACTAAAGGGGAAC
CTGAGGTTTGGCTCTGACTGTACCAC
In the CATCC 3 'sequence, the underlined portion at the 5' end is the T3 polymerase binding site. On the other hand, the 3′-end primer for amplification includes
A commercially available amplification kit, “Human p53Amplimer” from CLONTECH
The 3 'terminal primer attached in the "Set" was used. P
"One shot LA PCR Mix" (Takara Shuzo) was used as the CR reaction solution.

The composition of the solution in the PCR reaction was as follows: one shot LA PCR Mix 25 µl T3-P53primer (20 µM) 1 µl 3'primer (20 µM) 1 µl cDNA library solution 1 µl DW 22 µl / 50 µ1 After heat denaturation for 5 minutes at 95 ° C,
The cycle of 0 second, 55 ° C. for 30 seconds, and 72 ° C. for 60 seconds was performed 29 times, and finally, the reaction product was cooled and temporarily stored at 4 ° C. after cooling at 72 ° C. for 5 minutes.

After the reaction, gel electrophoresis was carried out and 300 me
It was confirmed that a PCR product was present in a molecular weight range of about r. Transfer this PCR product to Micro Spin Column S200 (Pharmacia)
To obtain a p53 gene fragment (T3-1inked p53 DNA) to which the T3 primer can bind.

(2) Synthesis of labeled single-stranded DNA using labeled T3 primer (Rho-T3) Using the p53 gene fragment obtained in (1) as a template, Rho-T3
Single-stranded labeled DNA was obtained by PCR using primers (Takara Shuzo). The composition of the reaction solution was one shot LA PCR Mix 25 µl Rho-T3primer (10 µM) 1 µl T3-linked p53 DNA 1 µl DW 23 µl / 50 µl, and the reaction cycle was 96 ° C for 30 seconds and 50 ° C for 15 seconds.
The reaction was cooled and temporarily stored at 4 ° C. under the conditions of repeating the process at 60 ° C. for 4 seconds for 24 times. Micro Spin Column S2
After purification in step 00, it was confirmed by gel electrophoresis that the target rhodamine-labeled single-stranded DNA was synthesized by PCR.

[0132] 2. Supply of Sample Sample Solution Salt was added to the sample sample obtained in the above step, that is, a solution of rhodamine-labeled single-stranded DNA derived from the p53 gene to a final concentration of 1M. Each cDNA library 6
A solution of rhodamine-labeled single-stranded DNA derived from the p53 gene prepared from the four types was injected into each well of a 96-well microtiter plate. These rhodamine-labeled single-stranded DNA solutions were applied to a glass substrate for detection having the DNA probe of sequence 1 obtained in Example 1 bound to a 2 mm square by using a microarray production apparatus (pin method) manufactured by Cartesian Technologies. The spots were spotted as 8 × 8 rows. The diameter of each spot is 100 μm.

3. Hybridization reaction Sample sample, rhodamine-labeled single-stranded DNA solution total 64
The substrate on which the seeds were spotted was left in a humidified chamber set at 40 ° C., and a hybridization reaction was performed for 3 hours. Thereafter, the detection substrate is set to 100 mM N
The sample was washed with a 10 mM phosphate buffer containing aCl to remove a sample sample that did not participate in the formation of a hybrid.

After the hybridization reaction, the specimen samples spotted in an 8 × 8 two-dimensional array were observed using an inverted fluorescence microscope equipped with a filter set for excitation light and fluorescence, which was suitable for fluorescently labeled rhodamine. . In most of the spots, red fluorescence derived from the fluorescently labeled rhodamine was observed with the formation of the hybrid. However, the fluorescence intensity was weak at six spots, and no fluorescence was observed at one spot.

This means that the p53 gene products (p53 gene products)
Since there is a mutation in the base sequence corresponding to the 248th and 249th amino acid sequences of the protein), the amount of hybrid formation is small due to the mismatch, and the fluorescence intensity from the fluorescent label is weakened to reflect this. Conceivable. In the sample sample in which no fluorescence was observed, since no hybrid was formed, p
In the 53 cDNA fragment, the amino acid sequences 248 and 2
It is considered that the deletion occurred in the nucleotide sequence encoding the 49th position, resulting in the inability to form a hybrid.

(Example 3) Preparation of array-like spots of specimen samples on a probe / matrix detection substrate on which various kinds of oligonucleotides were fixed 1. Preparation of 64 kinds of probe matrices The same treatment as in Example 1 was performed. A glass substrate having a maleimide group was prepared. Further, using the same bubble jet printer head as in Example 1, 64 types of DNAs whose base sequences are shown in Table 1 were printed (coated) on an area of 2 mm square, and 64 types of DNAs were printed. Probe DNA
A substrate for detection was prepared in which the sections where are fixed were arranged in a matrix.

Table 1 shows 64 types of DNAs whose base sequences are shown.
Is the gene product of the p53 gene, a tumor suppressor gene (p
Attention was paid to the amino acid sequences 248 and 249 of (53 protein), and based on the base sequence encoding these two amino acids, a sequence was selected so that various base mutations were added. Specifically, in the base sequence CGGAG which is a base, the mutation frequency is high because the CG encoding the 248th amino acid is high.
The first C of G is T, the second A is G, and 24
The third G of AGG encoding the eighth amino acid is T
It is known that each of them is mutated. Therefore, 64 types of probes were designed so that these three bases had sequences that could bind to variously mutated base sequences.

In practice, the probe had a total length of 18 mer, 6 bases containing this mutation were located at the center, and a common base sequence of each base length 6 was placed before and after that. More specifically, from the 5 'end, the common base sequence of ATGAAC, and the base sequence NN
GAGN, further having a common base sequence of CCCATC on the 3 ′ end side, 5′ATGAACNGNGAG
The nucleotide sequence was complementary to NCCCATC3 '. That is, the sequence 5′GATGGGNCCTCNNGT
The probe was designated as TCAT3 '. In addition, DNA
In order to use it as a probe, the site denoted by N in the above nucleotide sequence means any of the four DNA nucleobases A, G, C and T.

[0139]

[Table 1]

Next, each of these 64 types of DNA was
Glycerin, urea, and thiodiglycol were each prepared as an 8 μM solution containing 7.5% final concentration and acetylenol EH at 1% final concentration. In the same manner as in the second embodiment, using a BJ printer head BC62 (manufactured by Canon Inc.),
Each of the six nozzles was filled with 100 μl of a different DNA probe solution, and using such a plurality of heads, a total of 64 types of DNA probes were placed at 2 mm each.
Apply “solid paint” to the corner sections, fix, and apply the matrix (8
× 8). In FIG. 2, the 64 pixels arranged in a matrix (8 × 8) on the detection substrate are shown.
The arrangement | sequence drawing of a seed DNA probe is shown.

[0141] 2. Preparation of array-shaped spots of specimen samples As in Example 2, 64 types of labeled cDNAs were collected at 2 m each.
An 8 × 8 two-dimensional array was spotted on the m-angle probe fixing region. Specifically, as shown schematically in FIG. 3, spots in an 8 × 8 two-dimensional array are formed using a pin-type array manufacturing apparatus, and each DNA arranged in a matrix (8 × 8) It was formed on the compartment where the probe was fixed.

3. Hybridization reaction The hybridization reaction was performed under the same conditions and procedures as in Example 2. FIG. 4 shows the result. FIG.
In the arrangement shown in (2), as for the spot on the probe corresponding to the base sequence of the No. 42 normal gene, the fluorescence intensity was weak at six spots as in Example 2. In one spot, no fluorescence was observed. In addition, three places in the tenth probe region,
It was observed that each of the spots emitted fluorescence at two locations in the first probe area and one spot in the 46th probe area.

In the probe region having the mutated base sequence, the spot position where the fluorescence associated with the formation of the hybrid was observed was the same as the spot position where the fluorescence intensity was weak in the 42nd probe region having the original base sequence. Was compatible. Therefore, comparing the base sequence of the probe between them, the base sequence of the 10th probe is ACTCCG, the base sequence of the 41st probe is CCTCCA, The base sequence of the probe is
CCTCTG. Its complementary sequence is the 42nd CGG
At the 10th, CGGAG and G are T
It can be seen that TGGAGGG and C are mutated to T at the 41st, and CAGAGG and G are mutated to A at the 46th. That is, these 10th, 41st,
In the specimen sample that forms a hybrid with the 46th probe, the cDN derived from the p53 gene contained therein
It was confirmed that the A fragment had a one-base mismatch with the 42nd probe due to the above mutation.

According to this method, the presence or absence of the mutation and the type of the mutation can be simultaneously detected in all of the 64 types of sample samples.

Example 4 Production of Probe Matrix Substrates Separated by Patterns A glass substrate having a black matrix for probe matrices having an epoxy group introduced on the surface was prepared by the following procedure.

1. Introduction of epoxy group to substrate surface Glass substrate made of synthetic quartz (50 mm x 50 mm)
Was first ultrasonically cleaned using a 2% aqueous sodium hydroxide solution, and then subjected to UV ozone treatment to clean the surface. A 50% aqueous methanol solution containing 1% of a silane coupling agent (trade name: KBM403; manufactured by Shin-Etsu Chemical Co., Ltd.) containing a silane compound (γ-glycidoxypropyltrimethoxysilane) having an epoxy group bonded thereto at room temperature. The mixture was stirred for 3 hours and subjected to a pretreatment for hydrolyzing the methoxy group in the silane compound. This hydrolyzed solution was applied to the clean substrate surface by a spin coater, heated at 100 ° C. for 5 minutes, and dried to form a silane coupling agent binding film on the substrate surface. By this film formation, the epoxy group contained in the silane compound was introduced to the substrate surface.

[0147] 2. Formation of Black Matrix Next, on a substrate, DEEP containing carbon black
-Apply a UV resist (a negative resist for black matrix) (trade name: BK-739P; manufactured by Nippon Steel Chemical Co., Ltd.) using a spin coater so that the film thickness after curing becomes 5 μm, and place on a hot plate. The composition was cured by heating at 80 ° C. for 5 minutes. By proximity exposure using a DEEP-UV exposure apparatus, an exposure mask of 10 mm × 1
In the area of 0 mm, the distance (X) between adjacent wells is 100 μm.
m, the pattern was exposed using a negative mask patterned so that the outer shape of the well was a square of 1 mm × 1 mm. Next, development was performed with a developer of an aqueous inorganic alkali solution using a spin drier, and further, washing with pure water was performed to completely remove the developer. Next, it is easily dried using a spin drier, and then 180 ° C. in a clean oven.
For 30 minutes to fully cure the resist. As a whole substrate, 400 wells were arranged in a predetermined arrangement, and a substrate in which adjacent wells were separated by a black matrix (resist wall) was obtained. The inner volume of each well is calculated to be 5 μl when the thickness of the liquid is 5 μm. On the surface of the prepared black matrix, the contact angle with water is 93 degrees, and the wettability with water is extremely low. On the other hand, the contact angle with water is 35 degrees at the bottom of the well, and the wettability with water is low. It was excellent.

[0148] 3. Immobilization of Probe DNA As a DNA probe, 64 types of 18-mer oligonucleotides in which a hydroxyl group at the 5 'end was linked to an amino group via a phosphate group and hexamethylene were synthesized. The base sequences of these 64 types of probes are the same as those prepared in Example 3, except that an amino group is introduced at the 5 'end in place of a thiol group.

5 μl of each of these DNA probe solutions was injected into each well under a microscope, left overnight in a humidified chamber, and allowed to react on the 5′-terminal amino group with the epoxy group on the substrate. Combined.

(Embodiment 5) Probes divided by the pattern prepared in Embodiment 4
P5 prepared from mRNA using matrix substrate
Analysis of cDNAs Derived from Three Genes As in Example 2, 64 types of labeled cDNAs were spotted on a probe area of 2 mm square as shown in FIG.

A hybridization reaction was performed in the same manner as in Example 2.

The results obtained were the same as in Example 3.

[0153]

According to the method for detecting a target component in a specimen sample of the present invention, an oligonucleotide having a known base sequence is used as a detection probe, and a target component having a binding ability to the oligonucleotide, for example, a nucleic acid, is used. When detecting a molecule, an oligonucleotide serving as a detection probe is fixed to a predetermined section on the surface, and a detection substrate in which the sections to which the detection probe is fixed is arranged in a matrix is used,
For the target component, for example, a plurality of types of solution of the sample containing the nucleic acid molecule, the sample is placed in a fixed volume spot on each section, and the spot positions are arranged in an orderly manner in an array. A hybridization reaction is performed in the microdroplet to form a complex of the probe oligonucleotide and a target component, for example, a nucleic acid molecule.
Finally, it is necessary to evaluate the hybridization ability to a large number of detection probes by employing a method of detecting the complex by selecting a spot position using a microscopic detection system or the like using an appropriate label. This has the advantage that the liquid volume of the sample can be reduced.

In addition, even if the required liquid volume is small, the effect of sufficiently increasing the detection accuracy and the sensitivity itself can be obtained. Furthermore, for a large number of sample samples, a plurality of types of detection probes arranged in a matrix on a detection substrate can be used at the same time under the same conditions to perform a hybridization reaction. When the type of probe used is limited and the detection method of the present invention is applied using a large-area detection substrate, the amount of each sample solution itself is at least the evaluation of a larger number of sample samples. While maintaining accuracy, in a short time,
In addition, it can be easily implemented.

The detection substrate of the present invention, which is exclusively used for the detection method of the present invention having the above-described structure, is characterized in that the hybridization reaction itself is carried out in a fine droplet spotted on the substrate. Regarding the liquid volume of the sample sample itself,
There is an advantage that the substrate size can be arbitrarily selected without any consideration.

[Brief description of the drawings]

FIG. 1 shows an example of a detection substrate used in the method for detecting a target component in a specimen sample according to the present invention, in which sections for fixing oligonucleotides serving as detection probes are arranged in a matrix, and FIG. 3 is a diagram schematically illustrating a state where a plurality of cDNAs are spotted in a two-dimensional array as a specimen sample.

FIG. 2 shows each probe on a detection substrate described in Example 3 in which 64 types of DNA probes are respectively bound to sections arranged in an 8 × 8 matrix according to the detection method of the present invention. It is a figure which illustrates typically arrangement | positioning.

FIG. 3 shows a detection substrate on which sections to which probes are fixed are arranged in an 8 × 8 matrix, and 6 sections on each section.
It is a figure which shows typically the pattern of the spot array of a total of 64x64 which spotted 4 types of sample samples in the form of a 2x8 two-dimensional array.

FIG. 4 shows 64 types of sample specimens fixed on 8 × 8 matrix arranged in an 8 × 8 matrix described in Example 3 and 64 types of specimen samples on each section. It is a figure which shows typically the result of having carried out the hybridization reaction which spotted on the dimension array.

FIG. 5 is a diagram showing an example of the configuration of a section divided by a hydrophobic wall (wall surface) of a frame structure provided on a detection substrate of the present invention and arranged in an 8 × 8 matrix.

FIG. 6 is a diagram schematically illustrating a method of discharging a sample solution by an inkjet method, particularly a bubble jet method, which is an example of a unit used for spotting a sample sample solution in the detection method of the present invention.

FIG. 7 is a diagram schematically illustrating a configuration example of a bubble jet head used for spots of a specimen sample solution.

[Explanation of symbols]

 DESCRIPTION OF SYMBOLS 101 Liquid supply system (nozzle) 103 Solid phase (substrate) 105 Bubble jet head 104 Discharged liquid (suitable for liquid) 107 Discharged liquid 109 Protective film 111-1, 111-2 Electrode 113 Heat generation resistance band layer 115 Heat storage layer 116 Support belt 117 Substrate part of bubble jet head 119 Discharge orifice (discharge port) 121 Meniscus

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI theme coat ゛ (Reference) G01N 33/53 G01N 33/566 33/566 35/02 F 35/02 37/00 102 35/10 C12N 15 / 00 ZNAA 37/00 102 G01N 35/06 A (72) Inventor Tomohiro Suzuki 3-30-2 Shimomaruko, Ota-ku, Tokyo Inside Canon Inc. (72) Inventor Ei Shimizu 3-30 Shimomaruko, Ota-ku, Tokyo No.2 Canon Inc. F-term (reference) 2G042 AA01 BD19 2G058 CC02 CC08 CF12 EA11 EB00 EB19 ED02 ED17 GA02 4B024 AA11 AA19 AA20 CA01 CA04 CA09 CA12 HA12 4B029 AA07 AA23 BB20 FA15 4B06QR QR2 QS34 QX02

Claims (42)

[Claims] 1. An oligonucleotide having a known base sequence is used as a detection probe, and whether or not a target component having a binding ability to the oligonucleotide is contained in a liquid specimen sample, A method for detecting a complex formed between the oligonucleotide and a target component for evaluating the strength, wherein the oligonucleotide whose base sequence is known is at least one or more used as a detection probe. Further, at least two or more types of specimen samples to be evaluated, and a detection substrate comprising the one or more detection probe oligonucleotides previously bound to predetermined sections on a predetermined solid-phase substrate, respectively. In each compartment to which the oligonucleotide for the detection probe is previously bound, the two or more sample samples A step of spotting a plurality of predetermined sample liquid volumes for each spot so that the spot positions form a prescribed array shape; and for each of the plurality of spots for each specimen sample, the oligonucleotide and the target component. Detecting the presence or absence of the complex formed between the target component and the target component having the binding ability to the oligonucleotide based on the detection result, or determining the strength of the binding ability A method of detecting a target component in a sample sample. 2. The oligonucleotide according to claim 1, wherein the known nucleotide sequence of the oligonucleotide bound to a predetermined section on the detection substrate has a length of 2 to 100 bases.
The detection method described in 1. 3. The liquid sample sample to be evaluated is a solution containing at least one nucleic acid of unknown base sequence, and the presence or absence of complex formation between each of the sample samples and each of the oligonucleotides is determined. By detecting, in the nucleic acid of unknown base sequence contained in the specimen sample, as a target component having a binding ability to each oligonucleotide, a base sequence having complementarity to a known base sequence of each of the oligonucleotides The method according to claim 1, wherein the purpose of the evaluation is to determine whether a nucleic acid molecule having the following is included. 4. The mR extracted from a biological tissue in the nucleic acid contained in each of the liquid sample samples to be evaluated.
The detection method according to claim 3, wherein a set of NAs is contained. 5. The mR extracted from a biological tissue in the nucleic acid contained in each of the liquid sample samples to be evaluated.
4. The detection method according to claim 3, wherein the method comprises a cDNA library prepared based on a set of NAs. 6. The detection method according to claim 3, wherein the nucleic acid contained in each of the liquid sample samples to be evaluated is a nucleic acid having a length of 100 to 5,000 bases. 7. The detection method according to claim 1, wherein the liquid sample to be evaluated is a solution containing at least one protein different from each other. 8. The detection method according to claim 1, wherein the liquid sample to be evaluated is a solution containing at least one different chemical substance. 9. The detection method according to claim 1, wherein the liquid sample samples to be evaluated are extracts from different biological species, tissues, and cells. 10. A detection probe comprising a plurality of oligonucleotides each having a different known base sequence, each of which is arranged in a matrix on a substrate, as the oligonucleotide used for the detection probe. The detection method according to claim 1, wherein a substrate is used. 11. A matrix constituted by sections to which a plurality of types of oligonucleotides having mutually different known base sequences are bound, wherein the sections constituting the matrix have the same area, and the arrangement density of the sections of the matrix is reduced. The detection method according to claim 10, wherein the pressure is 400 / cm ² or less. 12. An array shape such that spots of the two or more kinds of sample samples are arranged in the same manner with respect to each section to which the plurality of kinds of oligonucleotides having different known base sequences are bonded to each other. The detection method according to claim 10, wherein the spot is spotted. 13. The detection method according to claim 1, wherein the solid phase substrate used for the detection substrate is glass. 14. The detection method according to claim 1, wherein the oligonucleotide is immobilized on a detection substrate by a covalent bond. 15. The method according to claim 15, wherein the oligonucleotide is immobilized on a detection substrate by a maleimide group introduced on the surface of a glass substrate used for the solid-phase substrate, and a thiol group (—SH) contained in the molecule of the oligonucleotide. 15. The detection method according to claim 14, wherein the detection is performed by a covalent bond formed by the chemical reaction of the above. 16. The maleimide group introduced on the surface of the glass substrate is obtained by first introducing an amino group on the glass surface and reacting the amino group with succiimidyl-4- (maleimidophenyl) butyrate. The detection method according to claim 15, wherein 17. The immobilization of the oligonucleotide on the detection substrate is performed by a chemical reaction between an epoxy group introduced on the surface of the glass substrate used for the solid-phase substrate and an amino group contained in the molecule of the oligonucleotide. The detection method according to claim 14, wherein the detection is performed by a covalent bond formed. 18. A detection substrate in which the substrate surface is previously partitioned in a matrix, and known oligonucleotides having a plurality of different base sequences are respectively preliminarily bound to the previously formed matrix-shaped partition. The detection method according to claim 1, wherein the detection method is used. 19. The matrix-shaped sections pre-formed on the substrate surface are characterized in that each section is separated by a hydrophobic wall (wall surface), and the bottom surface of each section is hydrophilic. The detection method according to claim 18, wherein: 20. The wall for partitioning each section from each other.
The detection method according to claim 19, wherein the thickness of the (wall) portion is 1 to 20 m. 21. The method according to claim 21, wherein the spots formed in each of the compartments to which the oligonucleotide for the detection probe is previously bound are 200 μm or less for each of the two or more types of specimen samples. Item 4. The detection method according to Item 1. 22. The oligonucleotide for the detection probe
In each of the compartments to which the tides are pre-bound, the spots that form
Area density 400 / cm ^TwoIt is a special feature that
The detection method according to claim 1. 23. The detection method according to claim 1, wherein the supply of the sample liquid to each spot formed with respect to each of the two or more kinds of sample samples is performed by supplying a predetermined liquid amount by an inkjet method. 24. At the time of spotting, the two or more kinds of sample samples respectively supplied by an ink-jet method are:
The detection method according to claim 23, wherein each of the solutions is a solution containing a nucleic acid having a length of 100 to 5000 bases. 25. The method according to claim 24, wherein each of the two or more kinds of sample samples supplied by an ink-jet method has a total nucleic acid concentration of 0.05 μM to 500 μM. 26. The detection method according to claim 24, wherein the ink jet method used for spots is a bubble jet (registered trademark) method. 27. Forming a spot of a sample sample on a liquid surface of a sample solution storage site holding each sample sample solution;
A sample solution sampling pin is brought into contact, a sample solution is attached to the tip of the pin, a predetermined amount of liquid is collected, and then the pin tip is brought into physical contact with the substrate surface, and the sample is collected. The detection method according to claim 1, wherein the supplied predetermined liquid amount is supplied by transferring the liquid amount to a substrate surface. 28. The spot formation of a sample sample is performed by inhaling from a sample supply unit that supplies each sample sample solution using a capillary, and bringing the tip of the capillary into which the sample solution has been sucked into physical contact with the substrate surface. 2. The detection method according to claim 1, wherein a predetermined amount of the liquid is supplied by transferring the liquid to the surface of the substrate. 29. A detection substrate in which a plurality of oligonucleotides having different known base sequences are immobilized on a solid-phase substrate, wherein each of the plurality of oligonucleotides has one kind of oligonucleotide in each compartment. The plurality of the compartments in which oligonucleotides are immobilized are fixed and bound in a predetermined compartment so that
A detection substrate, which is arranged in a matrix on the surface of the solid-phase substrate. 30. The plurality of types of oligonucleotides to be bound in a predetermined compartment, each of which has a known base sequence of 2 to 60 bases in length.
4. The detection substrate according to 1. 31. The method according to claim 29, wherein the plurality of sections arranged in a matrix on the surface of the solid substrate have an arrangement density of the sections of the matrix of 400 / cm ² or less. Detection board. 32. The detection substrate according to claim 29, wherein the solid phase substrate is a glass substrate. 33. The detection substrate according to claim 29, wherein the oligonucleotide is immobilized on the substrate surface by a covalent bond. 34. The immobilization of the oligonucleotide on the detection substrate is performed by a chemical reaction between a maleimide group introduced on the surface of the glass substrate used as the solid-phase substrate and a thiol group contained in the molecule of the oligonucleotide. The detection substrate according to claim 33, wherein the detection substrate is formed by a covalent bond formed. 35. The maleimide group introduced on the surface of the glass substrate, first, an amino group is introduced on the glass surface, and succiimidyl-4- (maleimidophenyl) butyrate is reacted with the amino group. 35. The detection substrate according to claim 34, wherein: 36. The fixing of the oligonucleotide on the detection substrate is performed by a chemical reaction between an epoxy group introduced on the surface of the glass substrate used for the solid-phase substrate and an amino group contained in the molecule of the oligonucleotide. The detection substrate according to claim 33, wherein the detection substrate is formed by a covalent bond formed. 37. A method according to claim 37, wherein one kind of the oligonucleotide is present in each section of the matrix, and the plurality of kinds of oligonucleotides are fixed in a predetermined section. 30. The detection substrate according to claim 29, wherein each of the plurality of types is supplied into a predetermined section by printing by an inkjet method. 38. A plurality of types of oligonucleotides are respectively bound to the previously formed matrix-shaped section on the surface of the solid-phase substrate on which a plurality of sections previously partitioned in a matrix are formed. 30. The detection substrate according to claim 29, wherein: 39. The matrix-shaped section formed in advance on the substrate surface, wherein each section is separated by a hydrophobic wall (wall surface), and the bottom face of each section is hydrophilic. The detection substrate according to claim 38, wherein: 40. The wall for partitioning each section from each other.
The detection substrate according to claim 39, wherein the thickness of the (wall surface) portion is 1 to 20 m. 41. The plural kinds of oligonucleotides are fixed to the matrix-shaped section which is formed in advance by supplying each of the plural kinds of oligonucleotides only to the bottom surface of the section by an ink-jet method. 40. The detection substrate according to claim 39, wherein: 42. A method for preparing a detection substrate in which a plurality of types of oligonucleotides having different known base sequences are immobilized on a solid phase substrate, comprising: Using a substrate on which a plurality of partitioned sections are formed, each of the plurality of oligonucleotides is a predetermined amount in a predetermined section by a printing method using an inkjet method so that one kind of oligonucleotide is present in each section. A method for preparing a detection substrate, comprising supplying and fixing the supplied oligonucleotide in a predetermined compartment.