JP2002058471A - Mixed bacterium group and means for decomposing organic waste using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To elucidate and isolate a bacterium group capable of being surely effective in an actual treatment environment for decomposing an organic waste, to obtain a mixed bacterium preparation composed of the bacterium group, and to provide a method for treating an organic waste. SOLUTION: This mixed bacterium group comprises Bacillus subtilis, Bacillus licheniformis and/or Bacillus thermodenitrificans having ability of decomposing protein, starch and oils and fats and arbitrarily another bacterium of Bacillus species.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention can be used for the purpose of decomposing and reducing organic waste discarded from homes, restaurants, hospitals, schools, food processing plants, etc. by the action of microorganisms, or for producing compost fertilizer. The present invention relates to a composite microorganism group and a method for using the same.

[0002]

2. Description of the Related Art Organic wastes including so-called garbage discharged from homes and restaurants include oils and fats, proteins, carbohydrates, and other organic substances derived from cooking scraps and leftovers of various foods. I have. In recent years, problems such as environmental pollution caused by dioxin generated from garbage incineration facilities, shortage of landfill sites for incinerated garbage, and outflow of dioxin from landfills have become apparent. Organic garbage, which is classified as combustible garbage, has a large amount of water, so that the amount of energy required for incineration increases, and the combustion temperature is reduced, thereby inducing the generation of dioxin. Therefore, interest in an apparatus for drying garbage and an apparatus for decomposing garbage using microorganisms has increased.

A garbage decomposition treatment apparatus utilizing such microorganisms is provided with a fan or a pump for introducing air into a treatment tank provided with stirring blades and a heating device for maintaining the temperature. After adding chips such as wood and microbial powder, raw garbage is introduced. And the garbage can be decomposed into carbon dioxide, water, and the like by the action of microorganisms.

In order to promote the decomposition of organic waste,
Garbage disposal apparatus in which aerobic bacteria and anaerobic bacteria work alternately (JP-A-9-87074), and garbage disposal method using Bacillus bacteria excellent in decomposing starch, proteins and oils and fats (JP-A-9-234454) A method of degrading garbage by adding a fibrinolytic enzyme, a protease, an oil-degrading enzyme, and a starch-degrading enzyme together with an aerobic bacterium has been devised (JP-A-7-132274).

[0005]

However, the mechanism by which the organic waste is decomposed by microorganisms has not yet been elucidated, and it is unknown whether or not the input of the microorganisms is active in actual treatment. . In addition, even if enzymes other than microorganisms are introduced, decomposition by microorganisms and inactivation due to high temperature occur, so that the effect is small and cost is not desirable. Regarding JP-A-9-234454,
No specific group of bacteria is specified, and bacteria that are excellent in decomposing starch, proteins, and fats and oils do not always work predominantly in the process of decomposing organic waste. Therefore, we have clarified and isolated bacterial groups that can work reliably in the processing environment that actually decomposes organic waste, and developed a complex microbial preparation composed of these bacterial groups and an organic waste treatment method using these bacterial groups. Aimed to provide.

[0006]

First, in order to clarify the bacteria that work in an actual organic waste decomposition treatment environment, bacteria that exist in the organic waste treatment that is undergoing good decomposition are first examined. Was analyzed using the 16S ribosomal RNA gene as an index. V of 16S ribosomal RNA gene
Gene fragments of bacterial groups existing in organic waste treatment were amplified with universal primers targeting the 1, V2 region and having a GC clamp (40-base GC-rich sequence) at the 5 ′ end. The amplified gene of each bacterium was subjected to denaturing gradient gel electrophoresis (Denaturated Gradi
ent Gel Electrophoresis: D
By performing a decomposition analysis by GGE), it is possible to clarify a group of bacteria that effectively work in organic waste treatment.
As a result, it was clarified that the predominant group of bacteria changes according to the decomposition process of organic waste. Analysis of the base sequence of each band obtained by DGGE revealed that Bacillus subtilis represented by SEQ ID NO: 1 (Bacillus subtilis ST10: FERM P-17931) and Bacillus licheniformis represented by SEQ ID NO: 2 (Bacillus subtilis).
Licheniformis SLP8: FERM P-1793
2), the genus Bacillus represented by SEQ ID NO: 3 (Bacillus genus P
R15: FERM P-17930), Bacillus thermodenitrificans shown by SEQ ID NO: 4 (Bacillus thermodenitrificans SL20: FERM P-)
17933) was found to be dominant in organic waste disposal. All of the above microorganisms were deposited on June 30, 2000 by the Institute of Biotechnology and Industrial Technology, National Institute of Advanced Industrial Science and Technology.

[0007] A plurality of bacteria were isolated from the treated sample of organic waste, and a group of bacteria having the nucleotide sequences of SEQ ID NOs: 1 to 4 were selected. These bacteria are fungi that can actually work in organic waste treatment,
The microbial preparations containing at least one enable the decomposition treatment of organic waste.

[0008] As a result of investigating the substrate decomposing ability of each of the selected bacteria, Bacillus subtilis ST1 represented by SEQ ID NO: 1 was obtained.
0 and Bacillus licheniformis SLP8 represented by SEQ ID NO: 2 have the ability to degrade proteins and starch, and Bacillus sp. PR15 represented by SEQ ID NO: 3 has the ability to degrade proteins. -Thermodenitrificans SL20 was found to have a high ability to decompose fats and oils. Complex microbial preparations containing all of these bacterial groups have the ability to degrade the main components of organic waste, proteins, starch, and fats. Therefore, by using the composite microorganism group NS6 including all of these bacterial groups that works effectively in the treatment of the decomposed organic waste, the organic waste is surely decomposed,
It is possible to increase the resolution of organic waste.

Bacillus subtilis ST10 represented by SEQ ID NO: 1 and Bacillus licheniformis SLP18 represented by SEQ ID NO: 2 have the ability to degrade proteins and starch between 25 ° C and 60 ° C. In particular, the optimum temperature range for its decomposition activity is between 45 ° C and 55 ° C. 55 ° C
Even in the above, the activity of the enzyme released by the bacteria is sufficient, but the growth of the bacteria is suppressed, so that the ability to degrade starch and proteins cannot be sufficiently exhibited. Therefore, when proteins and starch are decomposed using these bacteria, 25 ° C.
To 60 ° C, preferably 45 ° C to 55 ° C.
It is desirable to maintain the temperature range between ° C.

The PR of the genus Bacillus represented by SEQ ID NO: 3
15 has the ability to degrade proteins between 40 ° C and 75 ° C. In particular, the optimal temperature range for its decomposition activity is between 60 ° C and 70 ° C. Even at 70 ° C. or higher, the activity of the enzyme released by the bacterium is sufficient, but the growth of the bacterium is suppressed, so that the ability to degrade the protein cannot be sufficiently exhibited. Therefore, when protein is degraded using this bacterium, 40
C. to 75.degree. C., preferably 60.degree.
It is desirable to maintain the temperature range between 0 ° C.

Bacillus thermodenitrificans SL20 represented by SEQ ID NO: 4 has the ability to decompose fats and oils between 40 ° C. and 75 ° C. In particular, the optimal temperature range for its decomposition activity is between 60 ° C and 70 ° C. Even at 70 ° C. or higher, the activity of the enzyme released by the bacterium is sufficient, but the growth of the bacterium is suppressed, so that the ability to decompose fats and oils cannot be sufficiently exhibited. Therefore, when using this bacterium to decompose fats and oils, it is desirable to maintain the temperature in a temperature range between 40 ° C and 75 ° C, preferably between 60 ° C and 70 ° C.

In the actual organic waste decomposition treatment process,
There is a characteristic that the temperature changes with time, for example, the temperature in the processing tank is decreased by the input of the organic waste, and then gradually increased. Due to the slightly different suitable temperature for growth of the bacteria included in the complex microorganisms NS6,
The bacterial group included in the composite microorganism group NS6 can respond to environmental changes in the decomposition temperature of organic waste.

The complex microorganism group NS6 is sporulated by an ordinary method such as a high temperature state or an oligotrophic state and kept in a dry state, whereby a microbial preparation which can be stored at room temperature is obtained. This microbial formulation eliminates distribution problems and simplifies the means of addition to organic waste.

[0014] Furthermore, by adding an appropriate ratio of amino acid powder that promotes germination of spores to the sporulated microbial preparation of the complex microorganism group NS6, regardless of the type, composition and amount of the organic waste to be treated, Organic waste can be quickly and reliably decomposed.

[0015] Among the amino acids to be added to the sporulated microbial preparation, the germination rate of the spores of the complex microbial group is increased by increasing the content of alanine in particular, and the decomposition treatment of the organic waste becomes more reliable. .

The complex microorganism group NS6 can reliably function as a dominant bacterium when decomposing organic waste. The complex microorganism group NS6 is composed of a plurality of Bacillus bacteria, and bacteria that dominate due to changes in substrates such as proteins, starch, and oils can be replaced. As a result, the organic waste can be reliably decomposed regardless of the type of the organic waste. From such characteristics, it is effective to use the complex microorganism group NS6 as a means for decomposing organic waste.

[0017] The microbial preparation of the spore-formed composite microbial preparation NS6 can be stored at room temperature for a long period of time, so that there is no problem concerning distribution. Moreover, it is easy to add uniformly to the organic waste to be treated. From such a feature, as a means to decompose organic waste,
It is effective to use a microorganism preparation of the sporulated composite microorganism group NS6.

Furthermore, by incorporating an amino acid powder that promotes germination of spores in an appropriate ratio into the sporulated microorganism preparation of the complex microorganism group NS6, regardless of the type, composition and amount of the organic waste to be treated, Organic waste can be quickly and reliably decomposed. From such a feature, it is effective to use a microbial preparation of the spore-forming composite microorganism group NS6 containing amino acids as a means for decomposing organic waste.

Among the amino acids to be added to the sporulated microbial preparation, the germination rate of the spores of the complex microbial group is increased by increasing the content of alanine in particular, and the decomposing ability of the organic waste is more assured. . From these characteristics, it is effective to use a microorganism preparation of the sporulated complex microorganism group NS6 to which an amino acid containing a large amount of anilan has been added as a means for decomposing organic waste.

[0020]

DESCRIPTION OF THE PREFERRED EMBODIMENTS Embodiment 1: Working in Organic Waste Treatment
Analysis of bacteria group 500g sawdust and 5kg in 1kg dry weight dog food
0 g of cow dung compost was mixed and water was supplied so that the water content became 60%. The sample was put into an organic waste decomposer and aerated under a condition of 1.2 L / min · DM to decompose the dog food. In the process of decomposing dog food,
The evolution of CO _{2 and} the change over time of the sample temperature as shown in FIG. 1 were shown. In particular, in the generation of CO ₂ , three peaks were observed.

Therefore, sampling was performed at each peak of CO ₂ generation. The bacterial group present in the sample was completely destroyed by a combination of the enzyme treatment with lysozyme and the heat SDS treatment. Subsequently, the genomic DNA present in the bacterial disruption was recovered and purified using a commercially available DNA purification kit.

A mixed solution containing the primers, monomers, thermophilic bacterium DNA polymerase (Taq DNA polymerase) and the like shown in Table 1 and the above sample solution was prepared.

[0023]

[Table 1]

The primer used here has a common sequence to prokaryotic microorganisms existing in the gene encoding 16S ribosomal RNA. The GC8f primer has a GC-rich GC clamp sequence added to its 5 'end. GC8f primer is 5 '
-CGCCCGCCGCGCCCCGCGCCCGTC
CCGCCGCCCCCGCCCCAGAGTTTTGA
TC (A / C) TGGCTCAG-3 ', 339r primer is 5'-ACTGCTGCCTCCCCGTAGG
AG-3 'sequence. In addition, A indicates adenine, G indicates guanine, C indicates cytosine, and T indicates thymine.

Next, a polymerase chain reaction (PCR) was applied to the mixed solution. PCR was performed at 94 ° C for 3 hours.
A cycle consisting of a heat denaturation step of holding at 0 seconds, a primer binding step of holding at 58 ° C. for 30 seconds, and an elongation step of holding at 72 ° C. for 1 minute was repeated 30 times.

After completion of the PCR, 15 μL of each reaction solution was subjected to denaturing gradient gel electrophoresis (DGGE). The gel was subjected to a 40% to 70% denaturant gradient.
5% acrylamide gel was used. An acrylamide gel containing 40% formamide and 7M urea was run on 10
0% denaturant concentration was used. Electrophoresis is 65V at 60 ° C for 15h
I did it. After electrophoresis, SYBR GREEN 1
nucleic acid gel stain (Mo
cyclic Probes, Inc. )
DNA was detected with a UV transilluminator. After the detected DNA fragment was cut out and purified, its nucleotide sequence was examined by the dye terminator method. Based on the nucleotide sequence, bacteria of each DNA band were identified. The result is shown in FIG. In addition, Bacillus subtilis ST1
0 is SEQ ID NO: 1, the DNA fragment of Bacillus licheniformis SLP8 is SEQ ID NO: 2, the DNA fragment of Bacillus sp.
DNA of Bacillus thermodenitrificans SL20
The fragment had the sequence shown in SEQ ID NO: 4.

From the results of the microflora analysis by DGGE shown in FIG. 2, Bacillus subtilis ST10 and Bacillus licheniformis SLP were observed at the first peak of CO ₂ generation.
8 dominant, Bacillus thermodenitrificans SL20 appears at the second peak of CO ₂ generation, and C 2
A change in which another species of Bacillus (species unknown) PR15 appeared at the third peak of O ₂ generation could be confirmed.

Example 2 Isolation of Complex Microorganisms A sample sampled in a dog food decomposition treatment was diluted at an appropriate ratio, and then diluted with an LB agar medium (peptone 10 g / peptone).
L, yeast extract 5 g / L, sodium chloride 5 g / L, agar 15 g / L) and inoculated at 50 ° C. or 65 ° C. for 18 hours.
Culture was performed to obtain colonies. Each colony was picked up with a platinum loop and inoculated and cultured on an LB agar medium to obtain a single bacterium. The V1 and V2 regions of the 16S ribosomal RNA gene of the isolated bacterium were amplified by PCR, and their nucleotide sequences were analyzed by the dye terminator method. Then, three strains of Bacillus subtilis ST10 having the same sequence as SEQ ID NO: 1 (Bacillus subtilis ST10-1, Bacillus subtilis ST10-2, Bacillus subtilis ST10-
3), one strain of Bacillus licheniformis SLP8 having the same sequence as SEQ ID NO: 2, one strain of Bacillus sp. PR15 having the same sequence as SEQ ID NO: 3 and one Bacillus having the same sequence as SEQ ID NO: 4 -One strain of Thermodenitrificans SL20 was selected.

The effects of changes in the culture temperature (between 40 ° C. and 70 ° C.) on the degradation of proteins, starch, and fats were examined for the six selected strains. The evaluation of proteolytic activity, starch-degrading activity, and fat / oil-degrading activity was performed as follows.

(1) Proteolytic activity The selected 6 strains were adjusted with physiological saline to 1 × 10 ⁸ cells / mL, and 1 μL of each was added to a medium containing skim milk (NH ₄ Cl 3. 0 g / L, KH _{2
PO 4 1.0g / L, MgSO 4} · 7H 2 O 0.2
5g / L, KCl 0.25g / L , FeSO 4 · 7H
₂ O 2 mg / L, yeast extract 0.3 g / L, skim milk 10 g / L, agar 15 g / L)
Seven cases each were prepared. Each bacterium was placed at 40 ° C, 45 ° C, 50
24 ° C, 55 ° C, 60 ° C, 65 ° C, and 70 ° C, respectively.
After culturing for h, the proteolytic activity was evaluated using the size of the clear zone formed around the colonies as the skim milk was decomposed. Table 2 shows the results. In the table, "-" indicates that no clear zone was generated, and "+" indicates that the clear zone width was less than 0.5 cm, and the clear zone width was 0.5 cm or more and 1.0 cm or more. Those which were less than "++" are shown, and those whose clear zone width was 1.0 cm or more are shown as "++++". This display method is also used for other decomposition activity items in Table 2.

(2) Starch degrading activity Six selected strains were adjusted with physiological saline to 1 × 10 ⁸ cells / mL, and 1 μL of each was added to a starch-containing medium (NH ₄ Cl 3 .3). 0g / L, KH ₂ PO
_{4 1.0g / L, MgSO 4 ·} 7H 2 O 0.25g
/L,KCl0.25g/L,FeSO ₄ · _7H 2 O
2 mg / L, yeast extract 0.3 g / L, starch 15 g
/ L, agar 15 g / L) were prepared in each case. Each bacterium was placed at 40 ° C, 45 ° C, 50 ° C, 55 ° C,
Cultured at 60 ° C, 65 ° C, and 70 ° C for 24 hours each,
An iodine solution (0.01% I ₂ , 0.1% KI) that specifically stains starch was overlaid on these plates to stain the starch remaining in the medium. The starch degrading activity was evaluated using the size of the clear zone formed around the colonies as the starch was degraded as an index. Table 2 shows the results.

(3) Oil-degrading activity The selected 6 strains were adjusted with physiological saline to 1 × 10 ⁸ cells / mL, and 1 μL of each was added to a medium containing tributyrin (NH ₄ Cl 3. 0 g / L, KH _{2
PO 4 1.0g / L, MgSO 4} · 7H 2 O 0.2
5g / L, KCl 0.25g / L , FeSO 4 · 7H
₂ O 2 mg / L, yeast extract 0.3 g / L, tributyrin 10 g / L, agar 15 g / L)
Seven cases each were prepared. Each bacterium was placed at 40 ° C, 45 ° C, 50
24 ° C, 55 ° C, 60 ° C, 65 ° C, and 70 ° C, respectively.
After culturing for h, the lipolytic activity was evaluated using the size of the clear zone formed around the colony after the decomposition of tributyrin as an index. Table 2 shows the results.

[0033]

[Table 2]

Bacillus subtilis ST10 having the sequence of SEQ ID NO: 1 and Bacillus subtilis having the sequence of SEQ ID NO: 2
Licheniformis SLP8 has high proteolytic and amylolytic activity at 50 ° C., and Bacillus sp. PR15 having the sequence of SEQ ID NO: 3 has high proteolytic activity at 65 ° C. and contains the sequence of Bacillus thermodenitrification containing the sequence of SEQ ID NO: 4. Kansu SL20 was confirmed to have a high fat and oil decomposition activity at 65 ° C.

Example 3 Garbage Degradation Test Six strains of each selected bacteria cultured in 100 mL of LB medium were
Collected by centrifugation. Each bacterium was suspended in 100 mL of sterile water, and 3 kg of standard garbage (1.4 kg of udon, 1.5 kg of cabbage, and sardine dried 260 g)
g, 70 g of pork belly, and 500 g of sawdust. The sample was put into an organic waste decomposer and decomposed by aeration at 1.2 L / min · DM. In the process of decomposing the standard garbage, the generation of CO _{2 and} the change over time of the sample temperature as shown in FIG. 3 were shown.
In the generation of CO _2, 3 peaks were observed.

Therefore, sampling was performed at each peak of CO ₂ generation. The bacterial group present in the sample was completely destroyed by a combination of the enzyme treatment with lysozyme and the heat SDS treatment. Subsequently, the genomic DNA present in the bacterial disruption was recovered and purified using a commercially available DNA purification kit.

After PCR was performed under the same conditions as in Example 1, DGGE was performed under the same conditions as in Example 1. After the electrophoresis, SYBR GREEN 1 nucleic acid
cid gel stain (Molecular P
robes, Inc. ) And DNA was detected with a UV transilluminator. The result is shown in FIG. After the detected DNA fragment was cut out and purified, its nucleotide sequence was examined by the dye terminator method. As a result, the DNA fragment represented by band No. 41 was Bacillus licheniformis SLP8 having the sequence of SEQ ID NO: 2.
And the DNA fragments represented by band numbers 42, 43 and 44 are derived from Bacillus subtilis ST10 having the sequence of SEQ ID NO: 1, and the DNA fragment represented by band number 51 is represented by the Bacillus subtilis having the sequence of SEQ ID NO: 4. The DNA fragment derived from Thermodenitrificans SL20, the DNA fragment represented by Band No. 61 is derived from Bacillus sp. PR15 having the sequence of SEQ ID NO: 3, and the DNA fragment represented by Band No. 62 is represented by SEQ ID NO: 4 was confirmed to be derived from Bacillus thermodenitrificans SL20.

Thus, the added complex microorganism group NS6
Was confirmed to function as a dominant species in the decomposing process of standard garbage and to realize good garbage decomposition.

[0039]

As described above in detail, the complex microorganism group NS6 of the present invention is a group of microorganisms that can be identified by a genetic technique and works in an environment for decomposing organic waste, and is isolated. These fungi thus reliably function as dominant species in the decomposition treatment of organic waste, and realize good organic waste decomposition treatment. In addition, since the appropriate growth temperature of each bacterium included in the complex microorganism group NS6 is different, it is possible to cope with a temperature change generated in the process of decomposing the organic waste. Also,
Since the substrate decomposition characteristics of each of the bacteria included in the composite microorganism group NS6 are different, it is possible to sufficiently cope with a change in the type and composition of the organic waste.

[Sequence list]

[Brief description of the drawings]

FIG. 1 shows the generated CO ₂ in the decomposition process of dog food.
It is a change with time of the concentration and the sample temperature.

FIG. 2 shows a group of bacteria that worked in the decomposition treatment of dog food.
4 is a photograph showing a DGGE electrophoresis result of an S ribosomal RNA gene fragment.

FIG. 3 is a graph showing the change over time in the generated CO ₂ concentration and the sample temperature when the standard garbage is decomposed by adding the complex microorganism group NS6.

FIG. 4 shows 16S ribosomal R of a group of bacteria that worked when standard garbage was decomposed by adding a complex microorganism group NS6.
It is a photograph which shows the DGGE electrophoresis result of NA gene fragment.

[Explanation of symbols]

1 indicates a sampling point 1 in the dog food disassembling process. 2 indicates sampling point 2 in the dog food decomposition process. 3 represents a sampling point 3 in the dog food decomposition process. 11 ... Bacillus licheniformis S containing SEQ ID NO: 2
LP8 16S ribosomal RNA gene fragment 12 ... Bacillus subtilis ST10 containing SEQ ID NO: 1
16S ribosomal RNA gene fragment 13 of Bacillus subtilis ST10 containing SEQ ID NO: 1
16S ribosomal RNA gene fragment 14 ... Bacillus subtilis ST10 containing SEQ ID NO: 1
16S ribosomal RNA gene fragment 21 ... 16S ribosomal RNA gene fragment of Bacillus thermodenitrificans SL20 containing SEQ ID NO: 4 31 ... 16S of Bacillus species PR15 containing SEQ ID NO: 3
Ribosomal RNA gene fragment 32 ... 16S ribosomal RNA gene fragment of Bacillus thermodenitrificans SL20 containing SEQ ID NO: 4 41 ... Bacillus licheniformis S containing SEQ ID NO: 2
LP8 16S ribosomal RNA gene fragment 42 ... Bacillus subtilis ST10 containing SEQ ID NO: 1
16S ribosomal RNA gene fragment 43 ... Bacillus subtilis ST10 containing SEQ ID NO: 1
Bacillus subtilis ST10 containing SEQ ID NO: 1
16S ribosomal RNA gene fragment 51 ... 16S ribosomal RNA gene fragment of Bacillus thermodenitrificans SL20 containing SEQ ID NO: 4 61 ... 16S of Bacillus species PR15 containing SEQ ID NO: 3
Ribosomal RNA gene fragment 62 ... 16S ribosomal RNA gene fragment of Bacillus thermodenitrificans SL20 containing SEQ ID NO: 4

Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat II (reference) // C12Q 1/68 (C12N 1/00 S (C12N 1/00 C12R 1:07) C12R 1:07) (C12N 1 / 00 S (C12N 1/00 C12R 1:10) C12R 1:10) (C12N 1/00 S (C12N 1/00 C12R 1: 125) C12R 1: 125) (C12N 1/20 A (C12N 1/20 C12R 1:07) C12R 1:07) (C12N 1/20 A (C12N 1/20 C12R 1:10) C12R 1:10) (C12N 1/20 A (C12N 1/20 C12R 1: 125) C12R 1: 125) B09B 3/00 ZABD (72) Inventor Akiko Ito 1-1-1, Showa-cho, Kariya-shi, Aichi Prefecture Inside the Denso Corporation (72) Inventor Yasushi Okamoto 1-1-1, Showa-cho, Kariya-shi, Aichi Prefecture Denso Corporation F term (reference) 4B063 QA01 QQ06 QQ42 QQ52 QR32 QR55 QR62 QS34 4B065 AA15X AA19X AC12 CA55 4D004 AA02 AA03 AA04 BA04 CA19 CC07 DA02 DA03 DA06 4H061 AA02 CC42 CC47 CC55 EE66 EE70 GG48

Claims (23)

[Claims] 1. A protein and / or starch and / or
Or a complex microorganism group comprising a group of Bacillus sp. Having the ability to decompose fats and oils and capable of decomposing garbage. 2. The method according to claim 1, wherein Bacillus subtilis ST10 is used.
(FERM P-17931), Bacillus licheniformis ( Bacillus licheniformi)
s ) SLP8 (FERM P-17932), Bacillus sp. PR15 (FERM P-17930) and Bacillus thermodenitrificans ( Bacillus th)
thermodenitificans ) SL20 (FE
RM P-17933)
A composite microorganism group comprising two microorganisms. 3. The method of claim 1, wherein Bacillus subtilis, Bacillus licheniformis, Bacillus species PR1.
5. A composite microorganism group comprising at least one microorganism of Bacillus thermodenitrificans. 4. A complex microorganism group, wherein the Bacillus subtilis according to claim 3 has a protein / starch degrading ability. 5. A complex microorganism group, wherein the Bacillus licheniformis according to claim 3 has a protein / starch degrading ability. 6. The Bacillus sp. PR15 according to claim 3.
Is a complex microorganism group having proteolytic ability. 7. A complex microorganism group, wherein the Bacillus thermodenitrificans according to claim 3 has an ability to decompose fats and oils. 8. The 16SrDN represented by SEQ ID NO: 1 wherein the Bacillus subtilis according to claim 3 or 4 is
A complex microorganism group having the V1-V2 region of A. 9. The Bacillus licheniformis according to claim 3 or 5, wherein the Bacillus licheniformis is represented by SEQ ID NO: 2.
A group of composite microorganisms having the V1-V2 region of rDNA. 10. The Bacillus species according to claim 3 or 6, wherein V1 of 16S rDNA represented by SEQ ID NO: 3
-A complex microorganism group having a V2 region. 11. A complex microorganism group, wherein the Bacillus thermodenitrificans according to claim 3 or 7 has the V1-V2 region of 16S rDNA represented by SEQ ID NO: 4. 12. The method according to claim 2, wherein
The complex microorganism group NS6 according to claim 1, comprising a group of bacteria having the characteristics described in claim 1. 13. A microbial preparation comprising the microorganism group according to any one of claims 1 to 12, wherein the microbial preparation forms spores. 14. The microorganism preparation according to claim 13, comprising an amino acid that promotes germination of spores. 15. The microbial preparation according to claim 14, comprising an amount of alanine which promotes spore germination. 16. The method according to claim 1, wherein:
A method for decomposing garbage using the complex microorganisms described in the above item. 17. A method for decomposing organic waste using the microorganism preparation according to claim 13. Description: 18. The method according to claim 16, wherein the starch is decomposed at a temperature between 25 ° C. and 60 ° C. 19. The method according to claim 16, wherein the starch is decomposed at a temperature between 45 ° C. and 55 ° C. 20. The method for decomposing organic waste according to claim 16 or 17, wherein the protein is decomposed at a temperature between 25 ° C. and 75 ° C. 21. The method for decomposing organic waste according to claim 16 or 17, wherein the protein is decomposed at 45 ° C to 70 ° C. 22. The method according to claim 16, wherein the fats and oils are decomposed between 40 ° C. and 75 ° C. 23. The method for decomposing organic waste according to claim 16 or 17, wherein the fats and oils are decomposed at a temperature between 60 ° C and 70 ° C.