JP2002000272A - Expression vector for phage display method, and its utilization - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a means that permits saving a large amount of time and labor for the gene cloning in the phage display method by efficiently obtaining a gene to be cloned and preventing the loss of a desired gene through deletion at an unpredictable frequency by the specificity of each gene. SOLUTION: This vector is a vector containing (a) a promoter, (b) a selection marker gene, (c) a secretion signal sequence, (d) a cloning site for inserting a gene encoding a protein to express, and (e) an expression unit containing a gene encoding an envelope protein of a phage, wherein the selection marker gene, the secretion signal sequence, the cloning site, and the gene encoding the phage envelope protein are near one another, and the expression of the secretion signal sequence, the gene inserted into the cloning site, and the gene encoding the phage envelope protein are controlled by the promoter.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to an expression vector for use in a phage display method and its use. More specifically, the present invention provides an expression vector capable of reducing the time and labor required for gene cloning in a phage display method by arranging a selectable marker gene near a gene encoding a protein to be expressed. And its use.

[0002]

2. Description of the Related Art Methods for cloning a gene by the phage display method include cloning of a gene encoding an antibody binding site of an antigen, cloning of a gene of an epitope region of an antigen, cloning of a gene encoding a substrate peptide of an enzyme and the like. This method is widely used for cloning various genes and for screening reaction substrates.

[0003] However, a major disadvantage of this method is that
When a phagemid having a phagemid having a gene to be cloned is propagated using a helper phage, the phagemid lacking the cloned gene is incorporated into the phageparticle. The mechanism by which this phenomenon occurs is currently unknown. It is also known that the appearance frequency of the deleted phagemid varies greatly depending on the gene to be cloned. Therefore, there have been many difficulties in obtaining a desired gene by the phage display method.

[0004]

SUMMARY OF THE INVENTION It is an object of the present invention to provide a means for solving the above-mentioned problems that occur when cloning a gene using the phage display method. That is, the problem to be solved by the present invention is to efficiently obtain a gene to be cloned,
In addition, by preventing the desired gene from being lost at an unexpected frequency due to the specificity of each gene and hindering gene cloning, it is possible to provide a means for greatly reducing the time and labor required for gene cloning in the phage display method. is there.

[0005]

Means for Solving the Problems As a result of intensive studies to solve the above-mentioned problems, the present inventors have introduced a selectable marker gene near a cloning site into which a gene to be cloned is introduced, and selected the desired gene by the selection pressure. The inventors have found that the desired gene can be efficiently obtained by eliminating the phagemid lacking the gene and selectively leaving only the phagemid into which the desired gene has been introduced, thereby completing the present invention. That is, according to the present invention, the following inventions are provided.

(1) (a) a promoter, (b) a selectable marker gene, (c) a secretory signal sequence, (d) a cloning site for inserting a gene encoding a protein to be expressed, and (e) a phage In an expression vector containing an expression unit containing a gene encoding an envelope protein, a selectable marker gene, a secretory signal sequence,
The cloning site, and the gene encoding the phage envelope protein are in close proximity, a secretory signal sequence,
An expression vector, wherein expression of a gene inserted into a cloning site and a gene encoding a phage envelope protein are under the control of the above promoter.

(2) It has (a) a promoter, (b) a selectable marker gene, (c) a secretory signal sequence, (d) a gene encoding a protein to be expressed, and (e) a gene encoding a phage envelope protein. An expression vector comprising an expression unit, wherein expression of a secretory signal sequence, a gene encoding a protein to be expressed, and a gene encoding a phage envelope protein are under the control of the above promoter.

(3) The gene according to (2), wherein the gene encoding the protein to be expressed is an antibody gene, an enzyme gene, a receptor or a ligand-binding gene, a bioactive protein or a ligand-binding gene. Expression vector. (4) Downstream of the promoter, a selectable marker gene,
Any one of (1) to (3), wherein a secretory signal sequence, a gene encoding a protein to be expressed or a cloning site for inserting the same, and a gene encoding a phage envelope protein are arranged in this order. An expression vector according to item 1.

(5) The expression vector according to any one of (1) to (4), wherein the selectable marker gene is a drug resistance gene. (6) The drug resistance gene according to (5), wherein the drug resistance gene is a zeocin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, a puromycin resistance gene, an ampicillin resistance gene, a hygromycin resistance gene, or a blasticidin resistance gene. The expression vector according to any one of the preceding claims. (7) The expression vector according to any one of (1) to (4), wherein the selectable marker gene is an auxotrophic marker gene. (8) The expression vector according to any one of (1) to (7), which is an expression vector derived from an Escherichia coli plasmid.

(9) A gene library comprising a plurality of expression vectors according to any one of (1) to (8), wherein a gene encoding a protein to be expressed is introduced into a cloning site. (10) A transformant having the expression vector according to any one of (1) to (8). (11) A gene obtained by phage display using the expression vector according to any one of (1) to (8) or the gene library according to (9), wherein a gene encoding a protein to be expressed is introduced into the cloning site. Cloning method. (12) A gene cloned by the gene cloning method according to (11).

[0011]

DESCRIPTION OF THE PREFERRED EMBODIMENTS (1) Expression Vector of the Present Invention The expression vector of the present invention comprises (a) a promoter, (b)
Selectable marker gene, (c) secretion signal sequence, (d)
It contains a cloning site for inserting a gene encoding a protein to be expressed, and (e) an expression unit containing a gene encoding a phage envelope protein, and includes the above-described selection marker gene, secretory signal sequence, and cloning site. And the gene encoding the phage envelope protein are in close proximity, and the expression of the secretion signal sequence, the gene inserted into the cloning site, and the gene encoding the phage envelope protein are under the control of the above promoter.

The expression unit referred to herein is a D constructed so as to express a gene contained in the expression unit.
It means a unit of NA sequence, and usually, an expression control sequence such as a promoter is arranged upstream of a gene.

In the expression vector of the present invention, (b) a selectable marker gene, (c) a secretory signal sequence, (d) a cloning site for inserting a gene encoding a protein to be expressed, and (e) a phage envelope. The gene encoding the protein is operably linked to a suitable promoter.

The promoter used in the present invention can be appropriately selected by those skilled in the art according to the host into which the expression vector is introduced. As a promoter, phage λPL
Promoter, T7 promoter, E. coli lac, t
rp, lpp and tac promoters, Bacillus spol promoter, penP promoter, yeast PHO5 promoter, PGK promoter, GAP
Promoter, ADH1 promoter, SUC2 promoter, GAL4 promoter, Mfα promoter,
Insect cell polyhedron promoter, P10 promoter,
SV40 early and late promoters for animal cells, LTR promoter of retrovirus, CMV promoter, HSV-TK promoter, metallothionein promoter, 35S promoter for plant cells, rice actin gene promoter and the like. In the present invention, it is preferable to use Escherichia coli as a host. Therefore, it is preferable to use an Escherichia coli promoter.

In the expression vector of the present invention, the expression of the secretory signal sequence, the gene inserted into the cloning site, and the gene encoding the phage envelope protein are under the control of a common promoter. More specifically, downstream of the promoter, a selectable marker gene, a secretory signal sequence, a cloning site for inserting a gene encoding a protein to be expressed, and a gene encoding a phage envelope protein are arranged in close proximity. I have.

[0016] The term "adjacently arranged" as used herein specifically means that the genes are arranged so closely that the expression of the gene can be regulated by an upstream promoter. The distance between each gene is not particularly limited as long as the above conditions are satisfied, but is preferably 500 bp.
Or less, more preferably 300 bp or less, still more preferably 100 bp or less. By arranging the genes in close proximity, phagemids lacking the desired gene due to the selection pressure of the selection marker gene can be efficiently eliminated.

A selectable marker gene, a secretory signal sequence,
The cloning site for inserting the gene encoding the protein to be expressed, and the sequence order of the gene encoding the phage envelope protein are not particularly limited. From the viewpoint of displaying the expressed target protein on a phage, generally, a secretory signal sequence, a cloning site for inserting a gene encoding a protein to be expressed, and a gene encoding a phage envelope protein are It is preferable to arrange in this order from the 5 'direction to the 3' direction.

The cloning site for inserting the gene encoding the protein to be expressed (ie, the target protein) in the expression vector of the present invention usually contains a restriction enzyme site for inserting the desired gene. The position of the cloning site is not particularly limited, but is preferably, as described above, downstream of the secretory signal sequence and upstream of the gene encoding the phage envelope protein.

The position of the selectable marker gene is not particularly limited as long as the expression of the secretory signal sequence, the gene inserted into the cloning site and the gene encoding the phage envelope protein are under the control of a common promoter.
Upstream of the promoter, between the promoter and the secretory signal sequence, between the cloning site for inserting the gene encoding the protein to be expressed and the gene encoding the phage envelope protein, or downstream of the gene encoding the phage envelope protein Any of The expression of the selectable marker gene does not necessarily need to be controlled by a common promoter. For example, expression may be controlled by another promoter in the host gene.

The selectable marker gene used in the present invention is:
It refers to a gene that produces an indicator that can distinguish between a host that has expressed the gene and a host that has not. Examples of the selectable marker gene include a drug resistance gene and an auxotrophic marker gene.

The kind of the drug resistance gene is not particularly limited, and examples thereof include a zeocin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, a puromycin resistance gene, an ampicillin resistance gene, a hygromycin resistance gene, and blasticidin. Resistance gene and the like. Transformants having these drug resistance genes can be selected by culturing the transformants in a medium containing these drugs.

The type of the auxotrophic marker gene is not particularly limited, and examples thereof include an amino acid auxotrophic marker gene, specifically, each amino acid synthase gene, a 4-amine synthase gene and the like. Transformants having these auxotrophic marker genes can be selected by using these auxotrophs and by culturing the transformants in a medium free of these nutrients.

The secretory signal sequence is a leader peptide domain of a protein that makes the target protein target the periplasmic membrane of a host (eg, a gram-negative bacterium such as Escherichia coli). Such leader sequences for Gram-negative bacteria (such as E. coli) are well known in the art (eg, Oliver et al., Ne.
idhard, FC (eds.), Escherichia coli and Salmonella typhimurium (Es
cherichia coli and Salmonella typhimurium), Ameri
can Society for Microbiology, Washington, DC, 1:
56-69, 1987).

The gene encoding the phage envelope protein is preferably a gene that encodes a protein that has the ability to associate with the substrate of the filamentous phage particle and thereby incorporate the fusion polypeptide onto the phage surface. Genes encoding such phage envelope proteins can be obtained from filamentous phages M13, f1, fd and related filamentous phages.

A preferred envelope protein is gene II
Found in coat proteins encoded by I and gene VIII. The membrane anchor domain of the filamentous phage coat protein is part of the carboxy-terminal region of the coat protein, and is usually found in the region of hydrophobic amino acid residues for cross-linking the lipid bilayer at both ends and in the cytoplasmic surface of the membrane. And contains charged amino acid residues extending from the membrane. Phage
At f1, the membrane cross-linking region of gene VIII coat protein
Carboxy-terminal 11 residues from position 52 to position 52 (Oh
kawa et al. Biol. Chem., 256: 9951-9958, 1981). The membrane anchor will usually contain residues 25-40 relative to cpVIII. Therefore, the preferred amino acid residue sequence of the membrane anchor domain is derived from the VIII-encoding protein of the M13 filamentous phage gene (cpVIII or
CP 8). The coat protein of gene VIII is present on most phage particles of mature filamentous phage, and typically there is about 2500-3000 copies of the coat protein.

Another preferred amino acid residue sequence of the membrane anchor domain is derived from the coat protein of M13 filamentous phage gene III (also called cpIII). Gene I
The coat protein of II is present at one end of the phage particles of mature filamentous phage, and typically contains about 4 coat proteins.
There are ~ 6 copies. A detailed description of the structure of filamentous phage particles, their coat proteins, and particle populations can be found in Rached et al. (Microbiol. Rev., 50:40.
1-427, 1986) and Model et al. (Bacteriophage: Volume 2), R. Calende.
r, Plenum Publishing Co., pp. 375-456, 1988).

[0027] Preferably, the gene encoding the envelope protein of the filamentous phage is such that the gene encoding the envelope protein can be easily excised and removed from the vector without destroying the rest of the expression units of the vector. Thus, it is inserted downstream of the cloning site for inserting the gene encoding the protein to be expressed.

The type of the protein (target protein) to be expressed in the present invention is not particularly limited, but is preferably an antibody gene, an enzyme gene, a receptor or a ligand binding thereto, a bioactive protein or a ligand binding thereto. Is the gene. Hereinafter, a general method for preparing an antibody gene and an antibody gene library using the same will be described. The antibody gene can be obtained, for example, by preparing cDNA encoding the antibody from lymphocyte mRNA. According to methods well known in the art (eg, Sambrook)
MOLECULAR CLONING, A LABO
RATORY MANUAL, 2nd Ed; Cold
Spring Harbor LaboratoryPr
ess, Cold Spring Harbor, New
See York (1989)), reverse transcriptase is used to produce cDNA from the isolated RNA, and the polymerase chain reaction (PCR) is used to amplify the cDNA encoding the heavy or light chain of the antibody. CD encoding a heavy or light chain
The 3 'primer used to amplify NA can be synthesized based on a known nucleotide sequence common to heavy or light chain antibodies of a particular antibody subclass. For example, to amplify the IgG1 subclass heavy chain, one set of primers based on the constant region of the gene encoding the IgG1 heavy chain can be used, while to amplify the IgG1 subclass light chain. Alternatively, another set of primers based on the constant portion of the gene encoding the light chain of IgG1 can be used. The 5 'primer is a consensus sequence obtained based on a study of a number of variable regions. In this way, DNA encoding all antibodies of a particular antibody class or subclass can be amplified regardless of the antigen specificity of the antibody encoded by the amplified DNA. It is also possible to amplify the entire gene encoding the heavy or light chain. Alternatively, only a portion of the gene encoding the heavy or light chain, as long as the PCR amplification product encodes a heavy or light chain gene product that functions in antigen binding in association with its corresponding heavy or light chain. May be amplified. Preferably, the phage display product is a Fab or Fv antibody fragment.

Encodes an antibody selected for amplification
cDNA can encode any isotype,
Preferably, it encodes a subclass of IgG. Mouse IgG subclasses include IgG1, IgG2a, IgG2b, and IgG3. The choice of cDNA encoding a particular antibody subclass for amplification will depend on various factors, including, for example, the response of the animal's serum antibody to the antigen.

Preferably, by amplifying the heavy chain and the light chain from the cDNA derived from the plasma cell, (1) a cDNA containing the amplification product of the heavy chain cDNA, wherein the heavy chain is of a specific antibody subclass A pool, and (2) a cDNA pool containing the light chain cDNA amplification products, the light chain of which is of a particular antibody subclass.
A DNA pool can be created.

Subsequently, each of the cDNA encoding the heavy chain and the cDNA encoding the light chain is inserted into a cloning site in an expression unit (also referred to as an expression cassette) of the expression vector of the present invention. The expression vector constructed in this manner is converted into the following (3) phage display gene (for example,
By performing the treatment by the method described in (Preparation of Antibody Gene) Library, a gene library consisting of the antibody genes to be expressed can be constructed.

The expression vector of the present invention generally further comprises an origin of replication for maintenance and replication in prokaryotic cells, preferably Gram-negative cells such as E. coli.

The expression vector of the present invention may contain a polylinker that enables each DNA fragment to be ligated in a certain direction. The polylinker is operably linked to upstream and downstream translatable DNA sequences for replication and transport, providing a site or means for the directional ligation of DNA sequences into a vector. One region of the expression vector. Usually, a polylinker is a nucleotide sequence corresponding to two or more restriction enzyme recognition sequences.
Cleavage with restriction enzymes creates cohesive ends from which the translatable DNA sequence from these two sites can be ligated into a DNA expression vector. Preferably, the two cohesive ends are non-complementary so that cD into the expression unit
Directional insertion of NA becomes possible. The polylinker provides one or more directional cloning sites and may or may not be translated during the expression of the inserted cDNA.

[0034] Preferably, the expression vector of the present invention allows operation in the form of filamentous phage particles. Such a DNA expression vector has a filamentous form such that when an appropriate helper phage is displayed, the vector is replicated as a single-stranded replication form of filamentous phage and packaged in filamentous phage particles. The phage further includes a single nucleotide sequence with a defined origin of replication.

(2) Transformant having the expression vector of the present invention By introducing the expression vector of the present invention into an appropriate host, a transformant having the expression vector can be prepared. Such transformants are also within the scope of the present invention.
The type of host cell is not particularly limited, and generally, animal cells (particularly, mammalian cells such as COS-7 cells, mouse AtT-20 cells, rat GH3 cells, rat MtT
Cells, mouse MIN6 cells, Vero cells, C127 cells, CHO cells, dhfr gene-deficient CHO cells, He
La cells, L cells, BHK cells, BALB3T3 cells,
293 cells, Bow's melanoma cells, etc.), plant cells, insect cells, yeast cells (eg, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, etc.), eukaryotic cells such as Aspergillus, and bacterial cells. Prokaryotic cells (eg, Escherichia coli, Bacillus subtilis, Salmonella, Pseudomonas, Streptomyces, Staphylococcus, etc.). The host cell used in the present invention is preferably a prokaryotic cell such as a bacterial cell, particularly preferably Escherichia coli.

The method for introducing the expression vector of the present invention into a host is not particularly limited, and any method known to those skilled in the art can be used. For example, a transformant can be prepared by introducing the expression vector of the present invention into a host by a calcium chloride method, a calcium phosphate transfection method, an electroporation method, a lipofection method, a method using a gene gun, or other methods. .

(3) Phage display gene (for example,
Preparation of a library) For example, after cloning a gene encoding a target protein such as heavy chain and light chain cDNA into an expression vector, packaging of the entire library is performed using an appropriate filamentous phage. Do. The phage is then used to infect phage-sensitive bacterial cultures (such as E. coli strains),
After allowing the phage to replicate, the phage is isolated from the culture supernatant. The phage includes filamentous phage that express heavy and light chains isolated and cloned from the immunized animal on the surface.

Generally, the heavy and light chains are present on the phage surface as Fab antibody fragments, and the Fab is anchored to the phage surface via a filamentous phage envelope protein of the fusion polypeptide. The light chain associates with the heavy chain to form an antigen binding site. A method for producing a chimeric antibody was described in 1989.
No. 4,816,567, issued to Cabilly et al.

(4) Live phage display gene
Selection of target gene from rally target protein (for example, Fa that specifically binds to one antigen)
b or antibodies) can be isolated, for example, using any of a variety of procedures for the identification and isolation of monoclonal and / or polyclonal antibodies. Such methods include immunoaffinity purification (eg, binding of phage to a column to which the antibody is bound) and antibody panning (eg,
Phage binding by repeated runs to antigen bound to a solid support to select phage with high binding affinity for the antigen. Preferably, the phage is selected by a panning method using techniques well known in the art.

After identification and isolation of a phage that expresses the protein of interest, the phage can be used to infect a bacterial culture, where a single phage isolate is identified. Each separate phage isolate can be further screened using the methods described above. To further confirm the affinity of the phage for the antigen and / or measure the relative affinity of the phage for the antigen, the DNA encoding the antibody or Fab is isolated from the phage and the DNA contained in the vector is isolated from the phage. The nucleotide sequences of the nucleotides of the chain and light chain can be determined by methods known in the art (eg, Sambrook et al., MOLECULA).
R CLONING, A LABORATORY MAN
UAL, 2nd Ed; Cold Spring Har
Bor Laboratory Press, Cold S
spring Harbor, New York (198
9)).

(5) Phage display gene live
Target protein from phage selected from the rally (eg,
For example, an isolated soluble antibody or Fab, such as a soluble Fab, can be produced by excision of the DNA encoding the filamentous phage anchor membrane in an expression unit containing the gene encoding the heavy chain of the antibody. Preferably, the DNA encoding the anchor membrane
Is adjacent to a convenient restriction site that allows excision of the anchor membrane sequence without disruption of the rest of the heavy chain expression cassette or any other portion of the expression vector. Subsequently, after infecting bacterial cells with the modified vector having no anchor membrane sequence, a soluble light chain is produced simultaneously with a soluble heavy chain.

Alternatively, if the vector contains an appropriate mammalian expression sequence, the modified vector may be used to produce Fabs using eukaryotic cells (eg, mammalian or yeast cells, preferably mammalian). (Eg, Chinese hamster ovary (CHO) cells) If the modified vector does not result in expression in a eukaryotic cell, preferably the expression vector of the present invention is a suitable alternative vector. A number of vectors are commercially available and / or well known in the art for expression of proteins in eukaryotic and / or prokaryotic cells (eg, MOLECULAR CLO, such as Sambrook
NING, A LABORATORY MANUAL, 2
nd Ed; Cold Spring Harbor La
boratoryPress, Cold Spring
Harbor, New York (1989)). The present invention will be described more specifically with reference to the following examples, but the present invention is not limited to the examples.

[0043]

EXAMPLES Example 1: Phage Display Vector
Construct 1 μg of pCANTAB 5E (purchased from Pharmacia) DNA using 10 units of HindIII and NotI in 50 μl of System M (10 mM
Tris-HCl, 50 mM NaCl, 2 mM MgCl ₂ ) were reacted at 37 ° C. for 2 hours to cut. Separately, pelB signal linker DNA and g3 signal linker DNA are prepared by synthesis. The sequence of the gene prepared by synthesis has a pelB signal linker:
5'AGCTTCACACAGGAAACAGGATCCATGAAATACCTATTGCCTACGG
CAGCCGCTGGATTGCTATTACTCGCTGCCCAACCAGCGATGGCTAGCTAA
TGATAGAGG 3 '(SEQ ID NO: 1) and 5' CGCGCCTCTATCATTAGC
TAGCCATCGCTGGTTGGGCAGCGAGTAATAGCAATCCAGCGGCTGCCGTA
GGCAATAGGTATTTCATGGATCCTGTTACCTGTGTGA 3 ′ (SEQ ID NO: 2), g3 signal linker: 5′CGCGCCGTAATGT
GGAGCCTTTTTTTTGGAGATTTTCAACGTGAAAAAATTATTATTCGCAAT
TCCTTTAGTTGTTCCTTTCTATGCGGCCCAACCGGCCGGCCCGC 3 '
(SEQ ID NO: 3) and 5′GGCCGCGGGCCGGCCGGTTGGGCCGCATAG
AAAGGAACAACTAAAGGAATTGCGAATAATAATTTTTTCACGTTGAAAAT
CTCCAAAAAAAAGGCTCCACATTACG 3 ′ (SEQ ID NO: 4), prepared using Applied Biosystems Model 394, and prepared by a standard method. Cut plasmid and synthetic DNA fragment 0.25pmo
Each l was ligated using a ligase kit (purchased from Takara Shuzo, the reaction was performed according to the instructions) and transformed into Escherichia coli JM109 strain (purchased from Takara Shuzo, the reaction was performed according to the instructions) to obtain the desired plasmid pFab. (FIG. 1).

Example 2: Stable phage display
Construction of the vector (1) In the case of Fab display phagemid 1 μg of plasmid pFab DNA was digested with 1 unit of AscI in a 50 μl system M at 37 ° C. for 2 hours for cleavage. The Zeocin resistance gene was amplified by PCR using pcDNA3.1 / Zeo (+) (purchased from invitrogen). Primers used for amplification were 5'CCCCACGCGTGAGCACGTGTTGACAATT
AATCATCGGC 3 '(SEQ ID NO: 5) and 5' CCCCGGCGCGCCCTGA
GTCAGTCCTGCTCCTCGGCCACG 3 ′ (SEQ ID NO: 6). P
The CR reaction was performed using a Perkin Elmer Cetus DNA Thermal Cycler and KOD (purchased from Toyobo Co., Ltd., reaction conditions according to the instructions) as the polymerase. Thereafter, the desired DNA fragment of about 550 bp was purified using Molecular Cloning section 6.46-6.48, Cold Spr using 5% acrylamide electrophoresis.
Purified by the method described in ing Harvor. About 1 μg of the purified DNA fragment was digested with 1 unit of AscI and MluI in 50 μl of system M at 37 ° C. for 2 hours to cut.

The cleaved DNA fragment and the cleaved plasmid were ligated using a ligase kit (purchased from Takara Shuzo, the reaction was performed according to the instructions) and transformed into Escherichia coli JM109 strain (purchased from Takara Shuzo, the reaction was performed according to the instructions). Then, the desired plasmid pFab-Zeo was obtained (FIG. 2).

(2) In the case of a single-chain antibody display phage 1 μg of pCANTAB5E was added to 5 phages using 1 unit of HindIII.
Cleavage was performed by reaction at 37 ° C. for 2 hours with 0 μl of system M. pc
The Zeocin resistance gene was amplified by PCR using DNA3.1 / Zeo (+). The primer used for amplification was 5'CCCCAAGCTT
GAGCACGTGTTGACAATTAATCATCGGC 3 ′ (SEQ ID NO: 7) and
5′CCCCAAGCTTTGAGTCAGTCCTGCTCCTCGGCCACG 3 ′ (SEQ ID NO: 8). PCR reaction was performed with Perkin Elmer Cetus DNA
Using a Thermal Cycler, KOD was used as the polymerase (purchased from Toyobo Co., Ltd., reaction conditions were according to the instructions). Thereafter, the desired DNA fragment of about 550 bp was purified using 5% acrylamide electrophoresis according to the method described in Molecular Cloning section 6.46-6.48, Cold Spring Harvor. About 1 μg of the purified DNA fragment was added to 1 unit of HindIII.
The reaction was performed with 50 μl of the system M at 37 ° C. for 2 hours for cleavage.

The cleaved DNA fragment and the cleaved plasmid were ligated using a ligase kit (purchased from Takara Shuzo, the reaction was performed according to the instructions), and transformed into Escherichia coli JM109 strain (purchased from Takara Shuzo, the reaction was performed according to the instructions). After transformation, the desired plasmid pCANTAB 5E Zeo was obtained (FIG. 3).

Example 3 Cloning of Antibody Gene (Preparation of Antibody Library)
For Fab display phage, Human monoclonal an
ti-HCMV neutralizing antibody from phage display l
ibraries (Journalof virological Methods 1998, 74,
89-98, and in the case of single-chain antibody display phage, By-Passing Immunization Human An
tibodies from V-gene Libraries Displayed on Phage
(Journal of Molecular Biology 1991222 582-597).

1 μg of mRNA purified from human lymphocytes
From RT-PCR kit ver2.1 (TAKA
CDNA was synthesized using random primers according to the attached materials. Next, the cDNA was used as a template and the heavy chain and light chain (lambda chain, kappa chain) of the antibody were amplified by PCR according to the attached materials of this kit.
Primers and linkers for antibody gene cloning used were those prepared as described in the above-mentioned paper. PC
The R product was electrophoresed on a 1% agarose gel, and the antibody heavy and light chain bands were cut out. From the cut agarose gel, QIAEX II Gel extract
DNA was extracted using ion kit (QIAGEN). In the case of Fab display, the extracted heavy chain DNA is 50 μl using restriction enzyme SfiI and NotI1 unit.
The reaction was carried out at 37 ° C. for 2 hours and 50 ° C. for 2 hours with 1 l of system H, followed by cleavage. 1 μl of pFab and pFab ZeoDNA was digested with 50 μl of system H at 37 ° C. using SfiI and NotI1 restriction units.
The reaction was allowed to proceed for 2 hours at 50 ° C. for 2 hours and cut. Severed heavy chain
Ligase kit (purchased from Takara Shuzo, the reaction was performed according to the instructions) using the DNA fragment and the cleaved pFab and pFab ZeoDNA
E. coli JM109 strain (purchased from Takara Shuzo,
The reaction was performed according to the instructions) to obtain a plasmid into which the desired heavy chain was introduced. This plasmid DNA1
μg using the restriction enzyme NheI and AscI1 units,
C. for 2 hours at 37.degree. Separately, the light chain DNA prepared above was cleaved with a restriction enzyme NheI and AscI1 unit at 37 ° C. for 2 hours with 50 μl system M for 2 hours. Introduced pFab and pFab Ze with cleaved heavy chain DNA breaks
The oDNA and the cut light chain DNA fragment were ligated using a ligase kit (purchased from Takara Shuzo, the reaction was performed according to the instructions), and transformed into Escherichia coli JM109 strain (purchased from Takara Shuzo, the reaction was performed according to the instructions). , The desired heavy and light chain DN
The plasmid into which A was introduced was obtained.

In the case of single-chain antibody display, the extracted heavy chain, light chain and linker sequence DNA were mixed in the same mole, and PCR was carried out using ligation primers. PCR is a 50 μl system and uses Taq polymer.
ase (PerkinElmer) 1 unit, 9
After heating at 4 ° C for 5 minutes, 94 ° C for 30 seconds, 55 ° C
30 seconds at 72 ° C. for 30 seconds, followed by heating at 72 ° C. for 5 minutes to complete. The PCR product was subjected to electrophoresis on a 1% agarose gel, and a band in which the heavy chain, light chain, and linker were ligated together was cut out. From the cut agarose gel, QIAEX II Gel extraction ki
DNA was extracted using t (QIAGEN). Next, the prepared DNA fragment was treated with 50 μl of system H at 37 ° C. for 2 hours at 50 ° C. using restriction enzymes SfiI and NotI1 unit.
The mixture was reacted for 2 hours and cut. Separately pCANTAB5E and pCANTAB5E
1 μg of ZeoDNA was treated with 50 μl of system H at 37 ° C. for 2 hours at 50 ° C. for 2 hours using SfiI and NotI1 units.
The reaction was allowed to proceed for a period of time to cut. This DNA fragment was ligated with a plasmid digested with a restriction enzyme using a ligase kit (purchased from Takara Shuzo, the reaction was performed according to instructions), and E. coli JM109 strain (purchased from Takara Shuzo, reaction was performed according to instructions). Transformation was performed to obtain a plasmid into which the desired single-chain antibody had been introduced. As described above, Fab and single-chain antibody display phage libraries were prepared.

(Preparation of phage) Escherichia coli growing on the plate was recovered in 2 ml of 2 × TY liquid medium, and 20 μl thereof was collected in 20 ml of 2 × TY liquid medium (pFab and pCb).
For ANTAB 5E: For pFab Zeo and pCANTAB 5E Zeo containing 100 mg / l ampicillin and 2% glucose:
100 mg / l ampicillin and 50 mg / l zeocin and 2% glucose). While shaking at 37 ° C. and 200 rpm, the absorbance at 600 nm was 1.0.
The culture was continued until To this culture solution, 1 × 10 ¹¹ pfu of helper phage M13KO7 was added and left at 37 ° C. for 30 minutes. Subsequently, the mixture was shaken at 37 ° C. at 200 rpm. After 30 minutes, the solution was centrifuged at 3000 rpm for 10 minutes to recover E. coli. Discard the supernatant and add 20 ml of 2
× TY liquid medium (for pFab and pCANTAB 5E: 100 m
g / l ampicillin, 40 mg / l kanamycin and 2%
In the case of pFab Zeo and pCANTAB 5E Zeo containing glucose: suspended in 100 mg / l ampicillin and 50 mg / l zeocin, 40 mg / l kanamycin and 2% glucose) and shaken at 37 ° C with 200 rpm. Cultured overnight. The next day, the culture was centrifuged at 15,000 rpm to precipitate E. coli, and the supernatant was collected. This supernatant was used as a phage solution.

Example 4: Escherichia coli JM by phagemid
Using the phage solution displaying the transformed Fab of 109 and the single-chain antibody, 10 ml of Escherichia coli JM109 cultured until the absorbance at 600 nm reached 0.6 was added, and the mixture was placed at 37 ° C for 30 minutes. Subsequently, the mixture was shaken at 37 ° C. at 200 rpm. After 30 minutes, the solution was centrifuged at 3000 rpm for 10 minutes to recover E. coli. This E. coli was cultured in 2 × TY plate medium (for pFab and pCANTAB 5E: pFab Zeo and pCAN containing 100 mg / l ampicillin and 2% glucose).
For TAB 5E Zeo: 100 mg / l ampicillin and 50
mg / l zeocin and 2% glucose)
Placed at 37 ° C. overnight.

Example 5: Plasmid from transformant
Preparation and size of plasmid by agarose electrophoresis
Confirmed transformants were placed in 2 × TY plate medium (pFab and pCANTAB).
For 5E: 100 mg / l ampicillin and 2% glucose, pFab Zeo and pCANTAB For 5E Zeo: 100
mg / l ampicillin and 50 mg / l zeocin and 2%
(Incl. Glucose) at 37 ° C overnight.
Plasmids were prepared using AGEN spin prep kit (purchased from QIAGEN), and the size was confirmed by 0.8% agarose electrophoresis (FIGS. 4 and 5). Electrophoresis, Molecula
r Cloning Performed according to the method described in Section 6.46-6.48, Cold Spring Harvor. Table 1 below shows the percentage (%) of plasmids in which the target gene portion was not deleted calculated from the results of FIGS. 4 and 5.

[0054]

[Table 1]

[0055]

EFFECTS OF THE INVENTION The expression vector of the present invention efficiently obtains a gene to be cloned and prevents the desired gene from being lost at an unpredictable frequency due to the specificity of each gene, thereby preventing the cloning of the gene. Thus, the time and labor required for gene cloning in the phage display method can be greatly reduced.

[0056]

[Sequence List] SEQUENCE LISTING <110> Mitsubishi-Tokyo Pharmaceutical, Inc. <120> An expression vector for the use in a phage-display method and its use <130> A01210MA <160> 8

<210> 1 <211> 105 <212> DNA <213> Artificial Sequence <220> <223> Linker <400> 1 agcttcacac aggaaacagg atccatgaaa tacctattgc ctacggcagc cgctggattg 60 ctattactcg ctgcccaacc agcgatggct agctaatg

<210> 2 <211> 105 <212> DNA <213> Artificial Sequence <220> <223> Linker <400> 2 cgcgcctcta tcattagcta gccatcgctg gttgggcagc gagtaatagc aatccagcgg 60 ctgccgtagg caataggtat ttcatgg gtggacc

<210> 3 <211> 107 <212> DNA <213> Artificial Sequence <220> <223> Linker <400> 3 cgcgccgtaa tgtggagcct tttttttgga gattttcaca gtgaaaaaat tattattcgc 60 aattccttta gttgttcctt tctatgcggc ccaaccgcc ccc

<210> 4 <211> 106 <212> DNA <213> Artificial Sequence <220> <223> Linker <400> 4 ggccgcgggc cggccggttg ggccgcatag aaaggaacaa ctaaaggaat tgcgaataat 60 aattttttca cgttgaaaat ctccaaaaaa aagggcc atcat

<210> 5 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 5 ccccacgcgt gagcacgtgt tgacaattaa tcatcggc 38

<210> 6 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 6 ccccggcgcg ccctgagtca gtcctgctcc tcggccacg 39

<210> 7 <211> 38 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 7 ccccaagctt gagcacgtgt tgacaattaa tcatcggc 38

<210> 8 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 8 ccccaagctt tgagtcagtc ctgctcctcg gccacg 36

[Brief description of the drawings]

FIG. 1 shows a schematic diagram of the construction of plasmid pFab.

FIG. 2 shows a schematic diagram of the construction of plasmid pFab-Zeo.

FIG. 3 shows a schematic diagram of the construction of plasmid pCANTAB 5E Zeo.

FIG. 4 shows the results of confirming the size of the plasmid insert carried by the transformant by 0.8% agarose electrophoresis.

FIG. 5 shows the results of confirming the size of the plasmid insert retained by the transformant by 0.8% agarose electrophoresis.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12P 21/02 C12R 1:19) // (C12N 1/21 (C12P 21/02 C C12R 1:19) (C12R 1:19) (C12P 21/02 C12N 15/00 ZNAA C12R 1:19) 5/00 A (72) Inventor Kiyoma Itami 1000 Kamoshidacho, Aoba-ku, Aoba-ku, Yokohama-shi, Kanagawa Pref. F term (reference) 4B024 AA20 BA07 BA31 BA41 BA63 BA80 CA04 DA06 EA03 EA04 FA02 FA10 FA18 GA11 HA01 4B064 AG01 CA02 CA19 CC24 4B065 AA26X AA99X AB01 AC10 BA02 CA24 CA46

Claims (12)

[Claims] 1. A promoter, (b) a selectable marker gene, (c) a secretory signal sequence, (d) a cloning site for inserting a gene encoding a protein to be expressed, and (e) a phage envelope. In an expression vector containing an expression unit containing a gene encoding a protein, a selection marker gene, a secretory signal sequence, a cloning site, and a gene encoding a phage envelope protein are in close proximity and inserted into the secretory signal sequence and the cloning site. An expression vector, wherein the expression of the gene and the gene encoding the phage envelope protein is under the control of the promoter. 2. Expression comprising (a) a promoter, (b) a selectable marker gene, (c) a secretory signal sequence, (d) a gene encoding a protein to be expressed, and (e) a gene encoding a phage envelope protein. An expression vector comprising a unit, wherein expression of a secretory signal sequence, a gene encoding a protein to be expressed, and a gene encoding a phage envelope protein are under the control of the above promoter. 3. The gene according to claim 2, wherein the gene encoding the protein to be expressed is an antibody gene, an enzyme gene, a receptor or a ligand binding thereto, a bioactive protein or a ligand binding thereto. Expression vector. 4. A downstream of the promoter, a selectable marker gene, a secretory signal sequence, a gene encoding a protein to be expressed, or a cloning site for inserting the gene.
The expression vector according to any one of claims 1 to 3, wherein the genes encoding the envelope protein of the phage are arranged in this order. 5. The expression vector according to claim 1, wherein the selectable marker gene is a drug resistance gene. 6. The drug resistance gene is a zeocin resistance gene, a kanamycin resistance gene, a chloramphenicol resistance gene, a puromycin resistance gene, an ampicillin resistance gene, a hygromycin resistance gene, or a blasticidin resistance gene. 6. The expression vector according to 5. 7. The expression vector according to claim 1, wherein the selectable marker gene is an auxotrophic marker gene. 8. The expression vector according to claim 1, which is an expression vector derived from an Escherichia coli plasmid. 9. The method according to claim 1, wherein a gene encoding a protein to be expressed is introduced into the cloning site.
A gene library comprising a plurality of the expression vectors described in the section. 10. A transformant having the expression vector according to any one of claims 1 to 8. 11. A phage display method using the expression vector according to any one of claims 1 to 8 or the gene library according to claim 9, wherein a gene encoding a protein to be expressed is introduced into a cloning site. Gene cloning method by 12. A gene cloned by the gene cloning method according to claim 11.