JP2001517421A - G-protein coupled glycoprotein hormone receptor AOMF05 - Google Patents

Abstract

  (57) [Summary] The present invention relates to a novel G protein-coupled glycoprotein hormone receptor, AOMF05, mutated and polymorphic forms of the receptor, nucleic acids encoding them, expression vectors containing the nucleic acids, host cells transformed with the nucleic acids, Provided are transgenic knockout animals in which the body has been deleted, and transgenic animals expressing a non-innate receptor gene, antibodies to the receptor and its polypeptide, and assays for modulators, agonists and antagonists of the receptor. The receptor proteins and polypeptides, nucleic acids, cells, animals and assays of the present invention are useful for drug screening and development, diagnostic and therapeutic uses.

Description

DETAILED DESCRIPTION OF THE INVENTION

FIELD OF THE INVENTION The present invention relates to novel G protein-coupled glycoprotein hormone receptors in substantially purified and mutated or polymorphic forms, recombinant nucleic acids encoding said receptors, Recombinant host cells transformed with the nucleic acid, transgenic knockout animals deficient in the receptor, transgenic animals expressing non-native receptor genes, receptors and antibodies to the polypeptides thereof And the use of receptors, recombinant nucleic acids, recombinant host cells and transgenic animals in drug screening and development and diagnostic and therapeutic applications.

BACKGROUND OF THE INVENTION [0002] The G protein-coupled receptors of the present invention belong to the glycoprotein hormone receptor family. Only three G protein-coupled glycoprotein hormone receptors have been reported so far: follicle stimulating hormone (FSH) receptor (Mineg).
ish et al., 1991, Biomed. Biochem. Res. Comm. 17
5: 1125-1130; Sprengel et al., 1990, Mol. Endoc
rinol. 4: 525-530); thyroid stimulating hormone (TSH) receptor (F
Razier et al., 1990, Mol. Endocrinol. 4: 1264-1
276; Parmentier et al., 1990, Science 246: 162.
0-1622) and luteinizing hormone / placental chorionic gonadotropin (LH / h)
CG) Receptor (Loosfeld et al., 1990, Science 245: 52).
5-528).

[0003] The structure and function of known glycoprotein hormone receptors have been reviewed in the literature (Pearce et al., 1995, QJ Med. 88: 3-8; Reicher).
t et al., 1991, Trends in Pharmacol. Sci. 12: 2
19-203). This group of glycoprotein hormone receptors represents the structure of the G protein-coupled receptor of the rhodopsin family. This class of receptors contains seven transmembrane domains with three extracellular and three intracellular loops.

[0004] Large ligands, such as glycoprotein hormones, bind to the N-terminal domain, and smaller peptides, amines and other ligands can bind to pockets formed by extracellular loops. It is believed that the binding of the active ligand results in a conformational change that activates the associated G protein. It is believed that during this activation, the cytoplasmic loop of the receptor, particularly the third loop and the C-terminal domain, interact with the G protein.

[0005] Receptor-associated G proteins can be involved in multiple cellular signaling pathways. The most well-known pathways are the adenylate cyclase / cAMP pathway, the phospholipase Cb / phosphoinositol pathway and increased intracellular Ca ²⁺ . These second messenger pathways mediate the action of receptor ligands inside cells. They can also be used advantageously in assays to assess receptor activity.

[0006] Receptor activity can be regulated at the cellular level. Extensive activation of the receptor by agonists phosphorylates the C-terminus and cytoplasmic loop and rapidly desensitizes the receptor. Further, the receptor may be regulated by a transcriptional activity modulator on the receptor gene.
The presence of a cAMP responsive element within the promoter region of some G protein-coupled receptor genes has been demonstrated. These aspects of cell biochemistry can also be used to advantage in assays that monitor and evaluate receptor activity, for example, receptor phosphorylation may be monitored as an indicator of the presence of a receptor agonist, or transcriptional activity may be monitored. May be monitored as an indicator of the presence of a modulator of receptor gene expression.

[0007] Mutations in known G protein-coupled glycoprotein receptors can lead to or be indicative of a disease state (Pearce et al., 1995).
Because of the importance of glycoprotein hormone receptors in the endocrine system, AOMF0
5 is expected to play an important role in skeletal muscle, spinal cord and placenta development and function, and to a lesser extent, cerebral development and function.

SUMMARY OF THE INVENTION A preferred object of the present invention is to provide a G protein-coupled glycoprotein hormone receptor protein AO disclosed in FIGS. 1A-1C and FIGS. 4A-4C and in sequences 1 and 3.
It is a human cDNA encoding MF05 variants a and b.

[0009] The present invention is an isolated nucleic acid fragment of the G-protein coupled glycoprotein hormone receptor AOMF05 (SEQ ID NO: 1) encoding a novel biologically active human receptor. Each such nucleic acid fragment encodes a protein or protein fragment containing at least one domain that associates with an intracellular G protein and / or contains an extracellular ligand binding domain, wherein these domains are AOMF05 variant a and b is conserved across the G protein-coupled glycoprotein hormone receptor family present in the amino acid sequence (sequences 2 and 4). All such polynucleotides include, but are not necessarily limited to, nucleotide substitutions, deletions, additions, amino-terminal deletions and carboxyl-terminal deletions, so that these mutations are useful for diagnostic, therapeutic or prophylactic purposes. Encoding mRNA that expresses a protein or protein fragment that can be used in, or would be useful to screen for expression modulators, agonists and / or antagonists of AOMF05 function.

[0010] In certain embodiments, the isolated nucleic acid molecules of the present invention are single-stranded (coding or non-coding) or double-stranded deoxyribonucleic acids, such as genomic DNA and complementary DNA (cDNA). It may be a molecule (DNA) or a synthetic DNA such as a synthesized single-stranded polynucleotide. An isolated nucleic acid molecule of the present invention may also be a ribonucleic acid molecule (RNA). In certain embodiments, the nucleic acid is either the entire sequence of SEQ ID NO: 1 or SEQ ID NO: 3, the sequence encoding the open reading frame of SEQ ID NO: 1 or SEQ ID NO: 3, or a shorter sequence useful for expression of a peptide or polypeptide of the AOMF05 protein. Good. In certain embodiments, the nucleic acid is natural,
It may have non-natural or modified nucleotides or internucleotide linkages or mixtures thereof.

[0011] Aspects of the invention are described in FIGS. 1A-1C, FIGS. 3A-3F, FIGS. 4A-4C, and FIGS.
F and nucleotide probes and primers derived from the nucleotide sequences disclosed herein as Sequence 1 and Sequence 3. In certain embodiments of the invention, probes and primers can be used to identify or isolate a polynucleotide or a mutated or polymorphic form of an AOMF05 receptor protein or gene that encodes AOMF05. Probe and primer are AOMF
05 can be highly specific to a nucleotide sequence.

One aspect of the present invention is a variant a of the novel G protein-coupled glycoprotein hormone receptor protein AOMF05 in substantially purified form. This variant is disclosed in FIG.

One aspect of the present invention is a variant b of the novel G protein-coupled glycoprotein hormone receptor protein AOMF05 in substantially purified form. This variant is disclosed in FIG.

[0014] Aspects of the invention include biologically active fragments and / or mutants of the AOMF05 protein. Non-limiting examples of mutations include amino acid substitutions, deletions, additions, amino-terminal deletions and carboxy-terminal deletions, which provide proteins or protein fragments that can be used for diagnostic, therapeutic or prophylactic purposes. However, it would be useful to screen for modulators, agonists and / or antagonists of AOMF05 function. In a preferred embodiment, the fragment is a soluble N-terminal fragment that can compete with the receptor for the receptor ligand.

[0015] Aspects of the invention include recombinant vectors and recombinant hosts comprising the nucleic acid molecules disclosed herein. In certain embodiments, the vectors and hosts can be prokaryotic or eukaryotic. In certain embodiments, the host is an AOMF05 peptide,
Express a polypeptide, protein or fusion protein. In another embodiment, a host cell is used as a source of the expression product.

[0016] Aspects of the invention are polyclonal and monoclonal antibodies that are raised against the complete form of human AOMF05 disclosed herein or a fragment thereof or a single epitope thereof. In a preferred embodiment, the antibody is AOMFO
5 NH ₂ - is formed for terminal domain inside the epitope. In another preferred embodiment, the antibodies are raised against an epitope specific to the AOMF05 receptor.

One aspect of the invention is the use of the DNA molecules, RNA molecules, recombinant proteins and antibodies of the invention to screen and measure levels of human AOMF05. Recombinant proteins, DNA molecules, RNA molecules and antibodies are human AOMFO
5 can be used to produce a kit suitable for detection and typing.

[0018] Aspects of the invention are assays for detecting AOMF05 receptor agonists and antagonists and AOMF05 expression modulators. In certain embodiments for this purpose, screening assays such as melanophore, yeast expressing mammalian adenylate silase, yeast pheromone protein surrogates, phospholipase second signal screening and yeast two-hybrid systems include AOMF05. Use cells. All of these assays are known to those of skill in the art and can be readily adapted by those skilled in the art.

One aspect of the present invention is tissue typing using the probes or antibodies of the present invention. In certain embodiments, polynucleotide probes are used to identify tissues that express AOMF05 RNA. In another embodiment, probes or antibodies can be used to identify a tissue type based on AOMF05 expression or AOMF05 receptor presentation on the surface of one or more cells.

One aspect of the invention is an isolated nucleic acid molecule comprising a fusion construct that expresses a fusion protein useful in assays that identify compounds that act as modulators, agonists or antagonists of wild-type human AOMF05 activity. Preferred embodiments of the invention include, but are not limited to, glutathione S-transferase GST-A
Includes OMF05 fusion construct. Non-limiting examples of these fusion constructs include GST
There are all or part of the ligand binding domain of AOMF05, such as an in-frame fusion at the carboxy terminus of the gene. The fusion protein is useful for isolating or identifying a ligand for the AOMF05 receptor. The average skilled artisan can construct any such nucleic acid molecule that encodes a fusion protein of a GST-G protein-coupled glycoprotein hormone receptor based on the disclosure of Sequences 1-4. Soluble recombinant GS
The fusion protein of the TG protein-coupled glycoprotein hormone receptor can be obtained by using a baculovirus expression vector (for example, Bac-NB provided by Invitrogen).
lu DNA or pAcG2T provided by Pharmingen).
odoptera frugiperda (Sf21) insect cells (Invitr
ogen) can be expressed in various expression systems.

One aspect of the present invention is directed to an AOMF05 protein, a fragment thereof, an AOM.
A pharmaceutical composition comprising an agonist, antagonist or modulator of a F05 or AOMF05 polypeptide.

One aspect of the invention is a method of gene therapy, eg, treating an individual with a polynucleotide of the invention for the purpose of preventing or treating (fully or partially) a disease state associated with a mutation in the AOMF05 gene. Is to use it. This will reduce one or more symptoms of the disease. Nucleic acids are introduced in vivo using gene therapy vectors and methods.

One aspect of the invention is a non-human transgenic animal useful for studying the tissue and time-specific expression or activity of AOMF05 receptor in the body of the animal. Animals are useful for studying the ability of various compounds to act as modulators of AOMF05 receptor activity or expression in vivo, or by providing cells for in vitro culture or assays. In one embodiment of this invention, the animal is used in a method for producing another animal in which the functional endogenous AOMF05 gene has been deleted. In another embodiment, the animal is used in a method of producing an animal that expresses a non-innate AOMF05 gene in the absence of expression of an endogenous gene. In certain embodiments, the non-human animal is a mouse. In another embodiment, the non-innate AOMF05 gene is a wild type human gene or a mutated human AOMF0 gene.
5 genes.

DETAILED DESCRIPTION The present invention provides human G-linked glycoprotein hormone receptor polynucleotides and polypeptides referred to herein as AOMF05. The polynucleotides and polypeptides may further comprise an expression vector, a host cell containing the vector, a non-human animal transgenic to the polynucleotide, a knockout animal, probes and primers, an antibody to the receptor and its polypeptide, the presence or expression of AOMF05. It is used in assays to detect and identify modulators, agonists and antagonists of the AOMF05 receptor.

The AOMF05 gene, receptor and agonists, antagonists and modulators thereof are effective for treating pancreatic disease. Other indications include obesity and diabetes. Another use is in promoting the growth or regeneration of skeletal muscle cells.

The contents of all documents cited in the present specification are included in the present invention by reference.

As used herein, the term “compound” or “molecule” refers to a collection of atoms of any size, organic or inorganic, and includes peptides, polypeptides, whole proteins and polynucleotides. Includes macromolecules. The two terms are used interchangeably herein.

The term “candidate” as used herein refers to a molecule or compound that is predicted to be a modulator, agonist or antagonist of the AOMF05 receptor.

The term “agonist,” as used herein, refers to a compound or molecule that interacts with or activates an AOMF05 receptor polypeptide. Activated AOMF05 receptor polypeptides can stimulate the cleavage of GTP by G proteins to activate the adenylate cyclase pathway or the phospholipase b pathway.

The term “antagonist” as used herein refers to a compound or molecule that interacts with a polypeptide of the AOMF05 receptor and inhibits or blocks activation of the receptor.

The term “modulator”, as used herein, refers to one of the cell biochemistry methods of cell biochemistry to increase or decrease the amount of AOMF05 receptor polypeptide present on the surface of cells or in the surrounding serum or medium. A compound or molecule that interacts with an aspect. Changes in the amount of the receptor polypeptide can be mediated by the action of a modulator on receptor expression, such as receptor transcription, translation, post-translational processing, translocation or folding, or directly or indirectly on receptor expression. Is the action of the component (s) of cell biochemistry involved in Alternatively, the effect of the modulator may be to accelerate or decelerate receptor tanover by direct interaction with the receptor, or to separate one or more of the cell biochemistry (s) involved in the change, directly or indirectly. May interact with the components of

Polynucleotides One preferred object of the present invention is a human cDNA encoding the G-protein coupled glycoprotein hormone receptor AOMF05 as disclosed in FIGS. 1A-1C and SEQ ID NO: 1.

[0033]

Embedded image

[0034]

Embedded image

[0035]

Embedded image

A polynucleotide having a DNA or RNA sequence corresponding to the above sequence
Called variant a ″ polynucleotide.

One highly preferred embodiment of the present invention is a human cDNA encoding a G protein-coupled glycoprotein hormone receptor AOMF05 as disclosed in FIGS. 4A-4C and SEQ ID NO: 3.

[0038]

Embedded image

[0039]

Embedded image

[0040]

Embedded image

A polynucleotide having a DNA or RNA sequence corresponding to the above sequence
Mutant b "is referred to as the polynucleotide.

The isolated nucleic acid molecules of the present invention include genomic DNA and complementary DNA (cD
NA), such as single-stranded (coding or non-coding) or double-stranded deoxyribonucleic acid molecules (DNA) as well as synthetic DNA, such as synthesized single-stranded polynucleotides. An isolated nucleic acid molecule of the invention also includes a ribonucleic acid molecule (RNA).

The present invention also relates to recombinant vectors containing the substantially purified nucleic acid molecules disclosed herein and to prokaryotic and eukaryotic recombinant hosts.

As used herein, the term “polynucleotide” refers to a nucleic acid composed of two or more nucleotides. One polynucleotide can be composed of multiple polynucleotide units called units. For example, one polynucleotide may have one or more polynucleotide (s) with the coding sequence (s) at both ends and one or more regulatory regions (s). And / or other polynucleotide units commonly used in the art.

An “expression vector” is a polynucleotide having a regulatory region operably linked to a coding region such that the vector introduced into the host cell can direct the expression of the coding sequence. The use of expression vectors is known in the art. The expression vector can be used for various host cells, and therefore, a preferable regulatory region according to each host cell is appropriately selected.

A “regulatory region” is a polynucleotide that can promote or enhance the initiation or termination of transcription or translation of a coding sequence. Regulatory regions include sequences recognized by host cell RNA polymerases, ribosomes, or related factors that initiate or terminate transcription or translation. A regulatory region that directs the initiation of transcription or translation can direct the constitutive or inducible expression of the coding sequence.

The polynucleotide of the present invention comprises the entire sequence or a partial sequence of the mammalian AOMF05 receptor gene. The polynucleotide of the present invention may be single-stranded or double-stranded. If single stranded, the polynucleotide may be the coding "sense" strand or the complementary "antisense" strand. The antisense strand is the RNA encoding the receptor
Is effective as a receptor modulator by interacting with. The antisense strand is preferably shorter than full length, has unique sequences or is highly specific for the RNA encoding the receptor.

[0048] The polynucleotide may comprise deoxyribonucleotides, ribonucleotides, or a mixture of both. A polynucleotide may be produced by a cell, or may be produced by a cell-free biochemical reaction or chemical synthesis. Unnatural or modified nucleotides such as inosine, methyl-cytosine, deaza-guanosine and the like may be present. Natural phosphodiester internucleotide linkages are also suitable. However, it is also possible for a polynucleotide to have non-natural bonds between nucleotides. Non-natural linkages are known in the art, and non-limiting examples include methylphosphonate linkages, phosphorothioate linkages, phosphorodithionate linkages, phosphoramidite linkages, and phosphate ester linkages. Dephospho bonds are also known as bridges between nucleotides. Examples of these are siloxane bridges, carbonate bridges, carboxymethyl ester bridges, acetamidodate bridges, carbamate bridges and thioether bridges. For example,
"Plastic DNA" having internucleotide linkages of N-vinyl, methacryloxyethyl, methacrylamide or ethyleneimine may be used. "Peptide nucleic acids" (PNA) are also useful and are resistant to degradation by nucleases. These bonds can be mixed in one polynucleotide.

As used herein, the terms “purified” and “isolated” refer to polynucleotides, proteins and polypeptides or their respective fragments that are i
used interchangeably to represent state retrieved from the n vivo environment,
These can be manipulated by the skilled artisan without limitation by sequencing, restriction digestion, site-directed mutagenesis, etc., allowing the nucleic acid fragments to be subcloned into expression vectors, and for the production of polyclonal and monoclonal antibodies, amino acid sequencing. Thus, a sufficient amount of protein or protein fragment can be produced to provide an opportunity for peptide digestion and the like. Thus, the nucleic acids as claimed in the present invention may be present in whole cells, in a cell lysate, or in a partially purified form. May be present in a substantially purified form. A polynucleotide is considered to have been purified when it has been separated and purified from surrounding contaminants. Thus, a polynucleotide purified and isolated from a cell is considered substantially purified when purified from cellular components by standard methods, and a chemically synthesized nucleic acid sequence is purified from its chemical precursor. Is considered substantially purified when

Polypeptides The present invention also relates to a novel G protein-coupled glycoprotein hormone receptor protein AOMF05 in substantially purified and isolated form. A preferred embodiment is the protein of the following sequence, disclosed in single letter code as sequence 2 in FIG.

[0051]

Embedded image

[0052] Proteins and polypeptides having sequences corresponding to those set forth above are referred to as "variant a" proteins or polypeptides.

A more preferred embodiment is a protein of the following sequence, disclosed in one letter code as sequence 4 in FIG.

[0054]

Embedded image

Proteins and polypeptides having sequences corresponding to the sequences set forth above are referred to as “variant b” proteins or polypeptides.

The present invention also relates to biologically active fragments and mutated or polymorphic forms of AOMF05 as set forth in SEQ ID NO: 2 and SEQ ID NO: 4. These mutant forms include, but are not limited to, amino acid substitutions, deletions, additions, amino-terminal deletions and carboxyl-terminal deletions, so that these mutations are used for diagnostic, therapeutic or prophylactic purposes. The present invention may be useful for providing proteins or protein fragments or for screening for modulators, agonists and / or antagonists of AOMF05 function.

In a preferred embodiment, the bioactive AOMF05 fragment is a soluble N-terminal fragment capable of competing with the full receptor AOMF05 for a ligand for the receptor. Such soluble forms of the receptor are known in the art and can be derived from the polypeptides disclosed herein. Preferably, the signal sequence is deleted in the soluble N-terminal fragment. This corresponds to a deletion of about the first 20 amino acids of sequence 2 or sequence 4. The term "about" means that the fragment is not exactly 20 deleted amino acids, but deletion or removal of fewer or more amino acids is allowed. The important point is that the N-terminal fragment, not the amount of deletion, retains ligand binding activity. Competition of any AOMF05 fragment with the AOMF05 receptor can be easily tested using the antagonist assays described herein. The fragments can also have various lengths. Array 2
Or a soluble N-terminal fragment having a sequence up to less than 7 hydrophobic domains of sequence 4 is preferred. For example, it is preferred that the soluble N-terminal fragment range up to about 539 amino acids of sequence 2 or sequence 4. Again, this need not be the exact endpoint. Other suitable endpoints can be determined, for example, by a simple test of binding activity relative to wild type.

Using the polynucleotide and polypeptide sequences disclosed herein to isolate a polynucleotide encoding AOMF05 in its naturally occurring form,
One of skill in the art can determine whether such naturally occurring forms are mutated or polymorphic forms of AOMF05 by sequence comparison. Further, in order to determine whether the encoded protein or a fragment of any AOMF05 protein is biologically active, the in vivo activity of the AOMF05 receptor can be determined in vivo.
The protein of the fragment may be tested by routine procedures in a tro or in vivo assay. For example, the ability to express N-terminal or C-terminal deletions or internal additions or deletions in host cells and stimulate GTP cleavage by G proteins, activation of adenylate cyclase pathway or activation of phospholipase b pathway, etc. Can be tested.

It is known that the various codons encoding a particular amino acid have considerable redundancy. Thus, a DNA sequence encoding an RNA containing an alternative codon that finally encodes the translation of the same amino acid as shown below is also an embodiment of the invention: A = Ala = alanine: codons GCA, GCC, GCG , GCU C = Cys = Cysteine: Codon UGC, UGU D = Asp = Aspartic acid: Codon GAC, GAU E = Glu = Glutamic acid: Codon GAA, GAG F = Phe = Phenylalanine: Codon UUC, UUUG = Gly = Glycine: GGA , GGC, GGG, GGU H = His: histidine: codon CAC, CAU I = Ile = isoleucine: codons AUA, AUC, AUUK = Lys = lysine: codon AAA, AAG L = Leu = leucine: codon UUA, UUG, CUA , CUC, CUG, CU
UM = Met = methionine: codon AUG N = Asp = asparagine: codon AAC, AAU P = Pro = proline: codon CCA, CCC, CCG, CCU Q = Gln = glutamine: codon GAA, CAGR = Arg = arginine: codon AGA, AGG, CGA, CGC, CGG, C
GU S = Ser = serine: codons AGC, AGU, UCA, UCC, UCG, UCU T = Thr = threonine: codons ACA, ACC, ACG, ACU V = Val = valine: codons GUA, GUC, GUG, GGU W = Trp = Tryptophan: codon UGG Y = Tyr = tyrosine: codons UAC, UAU

Thus, the present invention discloses codon duplication that can result in different DNA molecules expressing the same protein. For the purposes of this specification, sequences containing one or more substituted codons are defined as degenerate mutations. Mutations that do not substantially alter the final physical properties of the expressed protein, whether in the DNA sequence or in the translated protein, are included within the scope of the invention. For example, substitution of valine for leucine, arginine for lysine, or asparagine for glutamine, etc., does not result in a change in the function of the polypeptide.

It is also known that the DNA sequence encoding a peptide can be modified to encode a peptide having properties that are different from those of the naturally occurring peptide. A non-limiting example of a method for altering a DNA sequence is site-directed mutagenesis. A non-limiting example of an altered property is a change in the affinity of the receptor for an enzyme or ligand for a substrate.

As used herein, a “bioactive equivalent” or “functional derivative” of wild-type human AOMF05 has a biological activity substantially similar to that of wild-type human AOMF05. The term “functional derivative” refers to a “fragment”, “mutant”, “variant”, “degenerate variant”, “analog” and “homolog” or “chemical” of the wild-type human AOMF05 protein. Derivatives ". The term "fragment" refers to any polypeptide subset of wild-type human AOMF05.
The term "mutant" refers to a molecule that is substantially similar to the wild-type form, but has distinct biological characteristics. Non-limiting examples of such altered features include altered substrate binding, altered substrate affinity and human AOMF05
Alternatively, there is an altered sensitivity to chemical compounds that affect the biological activity of the human AOMF05 functional derivative. The term "variant" refers to a molecule having a structure and function substantially similar to the wild-type complete protein or a fragment thereof. When a molecule is said to be "substantially similar" to a wild-type human AOMF05-like protein, both molecules have substantially similar structures or both molecules have similar biological activities. Thus, if two molecules have substantially similar activities, they may be associated with each other, even if the structure of one molecule is not found in the other molecule, or the two amino acid sequences Are considered to be mutants even if they are not identical. The term "analog" refers to a molecule that has substantially the same function as the full length human AOMF05 protein or a biologically active fragment thereof.

As used herein with respect to the human AOMF05 gene or encoded protein, “polymorphic” AOMF05 is AOMF05 that is naturally found as an allele in an unspecified population. A polymorphic form of AOMF05 may have a nucleotide sequence that differs from the particular human AOMF05 allele disclosed herein. However, due to the silent mutation, the polymorphic AOMF05 gene may encode the same amino acid sequence as the amino acid sequences disclosed herein or a different amino acid sequence. In addition, some polymorphic forms of AOMF05 will exhibit biological characteristics that distinguish this form from wild-type receptor activity. In this case, the polymorphic form is simultaneously a mutant.

At least about 5% of the concentration at which the protein or fragment thereof is found in nature
It is considered purified or isolated when obtained at a 1- to 10-fold concentration. A protein or fragment thereof is considered substantially pure when obtained at a concentration of at least about 100 times that found in nature. A protein or fragment thereof is considered to be essentially pure when it is obtained at a concentration of at least about 1000 times the concentration found in nature.

Probes and Primers The AOMF05 receptor disclosed herein exhibits a tissue-specific expression pattern. Therefore, the polynucleotide of the present invention can be used as a probe for tissue typing. A polynucleotide probe consisting of the full length sequence or a partial sequence of SEQ ID NO: 1 or SEQ ID NO: 3 can be used to determine a tissue expressing AOMF05 RNA. Time and tissue specific expression of AOMF05 RNA in one whole animal can also be studied using polynucleotide probes. The effect of modulators on the transcription of the AOMF05 receptor gene can be studied through the use of these probes. Preferred probes are single-stranded antisense probes having at least the full length of the coding sequence of AOMF05. It also has at least 14 contiguous nucleotides, preferably at least 15 or 16 and more preferably at least 20 contiguous nucleotides shorter than the full-length sequence, and this nucleotide sequence is highly expressed in AOMF05 DNA or RNA. It is preferred to use a probe that is specific.

One skilled in the art can use standard techniques to determine hybridization and washing conditions, using this technique from Southern blots of total human genomic DNA (digested with restriction enzymes to an average size of about 4000 nucleotides). If the coding DNA of AOMF05 can be detected, but no visually detectable non-specific background hybridization occurs, the nucleotide probe is AOMF05.
5 "Highly specific" for DNA or RNA. Despite the presence of visually detectable non-specific background hybridization, AOMFO
5 Probe is specific if detection of DNA is possible. The identification of sequence (s) that can be used as specific probes is known to those skilled in the art and is specific to target sequence or specific or highly specific to target sequence (s). Including sequence selection. It is preferred that the probe polynucleotide has at least about 14 nucleotides, more preferably at least about 20-25 nucleotides, more preferably about 30-35 or more nucleotides. It is believed that longer probes are more specific for AOMF05 genes and RNA and can be used under more stringent hybridization conditions. The longer the probe, the easier it is to use, but the more difficult it is to synthesize, and the lower the synthesis yield. Examples of sequences within Sequences 1 and 3 that are useful as probes or primers are the AOMF05 primer series shown in Example 1. However, one of ordinary skill in the art will appreciate that these are only a few examples of sequences useful as probes or primers from Sequences 1 and 3.

A polynucleotide having a sequence specific to AOMF05 or a highly specific sequence can be used as a primer in an amplification reaction assay. These assays can be used for tissue typing as described herein. In addition, amplification reactions using primers derived from the AOMF05 sequence can be used to obtain amplified AOMF05 DNA using cellular AOMF05 DNA as a starting template. The AOMF05 DNA thus obtained comprises one or more nucleotides of the open reading frame (ORF) of AOMF05 or its flanking sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 3.
AOMF05 is a mutated or polymorphic form that differs from AOMF05. This difference may be related to the defective, naturally occurring allele or defective form of AOMF05. Accordingly, the polynucleotides of the present invention can be used for identifying alleles of various AOMF05 genes or detecting defective AOMF05 genes.

[0068] Any of several methods known in the art, particularly isotopes, enzymes, substrates, chemiluminescence,
Probes can be labeled by methods such as electrochemiluminescence, biotin-fret pairs, and the like. A probe so labeled can directly detect (eg, isotope) a detectable signal.
Alternatively, it may be generated by hybridization (fret pairs) or indirectly after a chemical reaction (eg, chemiluminescence) or after a biochemical reaction (eg, enzyme-substrate), or may directly or indirectly detect a signal. Can occur after binding of the streptavidin binding moiety. Probe labeling and generation of a detectable signal are known in the art.

Primers are specific for the amplification of AOMF05 if one skilled in the art can use standard techniques to determine the amplification reaction conditions that will produce the predominant amplification product corresponding to the AOMF05 sequence. Primers are highly specific if the background amplification product is not visually detectable.

Many types of amplification reactions are known in the art, for example, the polymerase chain reaction and the reverse transcriptase polymerase chain reaction (PCR Primer, CW Die).
ffenbach & G. S. Dveksler, (1995), Cold
See Spring Harbor Laboratory Press), strand transfer amplification, independent sequence reactions and any other amplification reaction known to those skilled in the art using primers. Any of these or similar reactions may use primers from sequence 1 or sequence 3.

Polynucleotide Cloning AOMF05 nucleotide and amino acid sequences presented herein are based on AOMF0
5 polynucleotides can be used to isolate and / or clone. A
Various procedures can optionally be used to clone OMF05. Non-limiting examples of these methods include (1) RACE PCR cloning technology (Froh
man et al., 1988, Proc. Natl. Acad. Sci. 85: 8998
-9002). 5 'and / or 3' RACE can be performed to generate full length cDNA sequences. This tactic uses gene-specific oligonucleotide primers for PCR amplification of AOMF05 cDNA. These gene-specific primers are designed through the identification of expressed sequence tag (EST) nucleotide sequences identified by consulting a database of any number of publicly available nucleic acids and proteins; A method for directly functionally expressing AOMF05 cDNA after constructing an AOMF05-containing cDNA library in a simple expression vector system; (3
A) AOMF constructed in bacteriophage or plasmid shuttle vector
A method for screening a 05-containing cDNA library with a labeled degenerate oligonucleotide probe designed from the amino acid sequence of AOMF05 protein; (4)
AOMFO constructed in bacteriophage or plasmid shuttle vector
5 containing cDNA library with partial cD encoding AOMF05 protein
A method for screening with NA. This partial cDNA can be used to design degenerate oligonucleotide plasmids from the known amino acid sequences of other receptors closely related to the AOMF05 protein (eg, receptors such as luteinizing hormone, follicle stimulating hormone, and thyroid stimulating hormone). (5) A method of screening an AOMF05-containing cDNA library constructed in a bacteriophage or plasmid shuttle vector with a partial cDNA encoding the AOMF05 protein. This tactic is also based on the AOMF05 cDN identified as the EST described in the text.
Use gene-specific oligonucleotide primers for PCR amplification of A; or (6) Design 5 ′ and 3 ′ gene-specific oligonucleotides using Sequence 1 as a template and prepare full-length cDNA by known PCR techniques Or the known P
A portion of the coding region is created by CR technology to create and isolate a portion of the coding region, and these are used as probes to make many types of cDNAs and / or
Alternatively, a genomic library is screened to isolate the full-length form of the nucleotide sequence encoding AOMF05.

Other types of libraries and libraries constructed from other types of cells or species may be human AOMF05 encoding DNA, mammalian AOMF05 homologs, or mutated or polymorphic forms of AOMF05 receptor DNA or RNA Will be readily appreciated by those skilled in the art as being useful for isolating Non-limiting examples of other types of libraries include non-human cells or tissues, such as primate, murine, rodent, porcine and bovine cells or any other vertebrate host containing AOMF05 encoding DNA. There are cDNA libraries from cells or cell lines. In addition, vertebrate genomic libraries, including but not limited to primate, murine, rodent, porcine and bovine genomic libraries, and associated human genomic DNA
The AOMF05 gene can be isolated by hybridization screening based on oligonucleotides or polynucleotides in the library.

It will be readily appreciated by those skilled in the art that suitable cDNA libraries can be generated from cells or cell lines that express the AOMF05 receptor. AOMF05 cDNA
To select cells or cell lines to be used to generate a cDNA library for isolating AOMF05, one first uses an assay for AOMF05, such as an assay using the antibodies described herein or a PCR assay using AOMF05-specific primers. Used to detect cell-associated AOMF05 receptor.

The production of a cDNA library is performed by standard techniques known in the art. Known cDN
A library construction techniques are described, for example, in Sambrook et al., 1989, Molec.
ullar Cloning: A Laboratory Manual; Col
d Spring Harbor Laboratory, Cold Spri
ng Harbor, New York. Complementary DNA libraries are also available from a number of commercial sources. Non-limiting examples include Clonte
ch Laboratories, Inc. , Palo Alto, CA, US
A and Stratagene, Inc. , La Jolla, CA, USA.

It will also be readily appreciated by those skilled in the art that DNA encoding AOMF05 can be isolated from a suitable genomic DNA library. Construction of a genomic DNA library can be performed by standard techniques known in the art. Known genomic DNA library construction techniques are described in Sambrook et al., Supra.

To clone the AOMF05 gene by one of the preferred methods, the amino acid or DNA sequence of AOMF05 or a homologous protein will be required. To achieve this, the AOMF05 or homologous protein is purified, for example, by cross-reaction with the anti-AOMF05 antibody taught herein and the partial amino acid sequence (s) determined by a fully automated sequenator. It is not necessary to determine the entire amino acid sequence, but rather to determine the linear sequence of two regions of 6-8 amino acids in order to PCR amplify a partial fragment of AOMF05 DNA. After identification of appropriate amino acid sequences, DNA sequences capable of encoding them are synthesized. Because the genetic code is degenerate, more than one codon can be used to encode one amino acid, and thus the amino acid sequence can be encoded by any set of similar degenerate DNA oligonucleotides. Only one sequence of the degenerate set will match the AOMF05 sequence, but the other sequences in the set will be able to hybridize to AOMF05 DNA even in the presence of mismatched DNA oligonucleotides. The mismatched DNA oligonucleotide is A
AOMF5 is sufficient to identify and isolate the DNA encoding OMF05.
Can hybridize to DNA. Alternatively, the nucleotide sequence of one region of the expressed sequence can be identified by searching one or more available genomic databases. Gene-specific primers can be used to perform PCR amplification of the desired cDNA obtained from the cDNA library or cDNA population. As pointed out herein, the proper nucleotide sequence for use in the PCR-based method can be obtained from SEQ ID NO: 1, which isolates the 5 'and 3' overlapping PCR products and encodes the full-length AOMF05 encoding The AOMF05 protein or AOMF05-like protein can be used to generate a sequence, or can be used as a probe to isolate a portion of the nucleotide sequence encoding AOMF05 and screen one or more cDNA or genomic-based libraries. Can be isolated.

In the method used in Example 1, the AOMF05 full-length cDNA of the present invention was
ucd Complexity cDNA Analysis (RCCA). Briefly, there are two commonly used methods: filter screening of a cDNA library by hybridization with a labeled probe, and whole cell mRNA by PCR.
Elongation of the partial cDNA sequence was performed by conventional procedures using one or both of the 5'- and 3'-RACE methods. The former method is more efficient but takes more time, and the latter method is faster but less efficient. This RACE protocol has the disadvantage that the length of extension is limited since the entire cellular mRNA population is used in a single reaction. The PCR products obtained using the second method are often very small, as small fragments are amplified much more efficiently in PCR than large fragments during the same reaction.

The RCCA method involves constructing a cDNA library first, subdividing it,
A method for improving the screening of known cDNA libraries by isolating 5'- and 3'-flanking fragments by R. Since each pool is unlikely to contain more than one clone of a given gene that is low to moderately expressed, there is no competition between large and small PCR products in one pool Thus, it is possible to isolate fragments of different sizes. One obvious advantage of the methods described herein is the efficiency, throughput, and ability to isolate alternative spliced cDNA forms.

The RCCA method rapidly elongates a partial cDNA sequence based on the secondary division of a primary cDNA library and DNA amplification by the polymerase chain reaction (PCR). A cDNA library is constructed with cDNAs primed with random primers, oligo-dT primers or a combination of both, and then subdivided into approximately 10,000-20,000 clones per pool ("superpool"). Since each superpool is amplified individually, each superpool has a starting mR
Represents an independent part of the cDNA molecule obtained from the NA source. Collect samples from all superpools and transfer to 96-well plates. Partial cD like sequence 1
To extend the NA sequence, a positive pool containing the partial cDNA sequence is first identified by PCR using a primer pair complementary to the cDNA sequence. Each of the positive pools in the library contains an independent clone of the cDNA sequence,
A partial cDNA sequence and its flanking fragments are embedded within each clone. The flanking fragments are isolated by PCR using primers complementary to the known vector and cDNA sequence and then sequenced directly. Assembling the DNA sequence obtained from these fragments and the starting partial cDNA sequence as a continuous fragment extends the partial cDNA sequence and eventually repeats the method as necessary until a complete open reading frame is obtained, ultimately resulting in The full-length gene sequence can be determined.

The basic principle of this method is that a complex library can be transformed from about 10,000 to about 20,000
Subdivision into a superpool of 0 clones. M expressed in tissue
A library of 2 million primary clones, a sufficiently large number covering almost all RNA transcripts, can be subdivided into 188 pools and stored in two 96-well plates. Since the number of transcripts for most genes is less than one copy per 10,000 transcripts or less in total cellular mRNA, each pool contains two clones of a given cDNA sequence.
It is unlikely to include more than one. This reduced complexity allows for the isolation of flanking fragments of partial cDNA sequences that are larger than those obtained by known methods.

Those skilled in the art will appreciate from the teachings herein the extensive cDNA cloning methods disclosed herein. Numerous primer combinations obtained from ESTs or other partial cDNA sequences, along with flanking vector primer oligonucleotides, can be used to easily "walk" the internal gene-specific sequence and each primer in both directions, As a result, c representing full-length cDNA
ontig can be constructed. This procedure relies on the ability to screen large pools that make up a representative portion of the entire cDNA library. This procedure does not rely on the use of a cDNA library with directional cloned inserts. Conversely, both the vector primer and the gene-specific primer are added to the 5 'and 3', and a contig map is constructed by additional screening of the positive pool using both the vector primer and the gene-specific primer. Of course, these gene-specific primers are initially constructed from known nucleic acid fragments, such as the expression sequence tag. However, as walking continues, cD
Gene specific primers are utilized from the 5 'and 3' boundaries of the newly identified region of NA. With the continuation of walking, it is not necessary to know the vector orientation of the unidentified fragment. Instead, test all combinations in the positive pool,
The actual orientation of the vector is determined by the ability of some vector primers / gene-specific primers to produce the predicted PCR fragment. Next, full-length cDNAs can be easily constructed by known subcloning procedures.

Isolation of Homologs of the AOME05 Gene of Another Species Using PCR primers designed from the human AOMF05 sequence,
By screening a cDNA library with a portion of the gene obtained from the DNA, another species of AOMF05 gene, such as a mouse, rat, or dog, is isolated. Degenerate PCR is performed by selecting regions encoding amino acids with low codon degeneracy, such as Met and Trp, and designing primers of 17-20 nucleotides with 32-128 fold degeneracy. When selecting these primers, the conserved region of the protein is preferred. The PCR products are analyzed by DNA sequence analysis to confirm similarity to human AOMF05. Screen the cDNA library by highly stringent colonies or plaque hybridizations using the correct product. Alternatively, a cDNA sequence of AOMF05 is isolated from a plurality of different species by low stringency hybridization using a probe directly derived from the human AOMF05 gene. A cDNA library can be made by procedures known in the art or by procedures described in the text.

Transgenic Animals The term transgenic animal as used in the present invention also means transgenes and genes. A "transgene," as used herein, is a genetic construct containing a gene. The transgene is integrated into one or more chromosomes of the animal or its progeny cells by methods known in the art. Once integrated, the transgene is maintained in at least one location on the chromosome of the transgenic animal. A gene is a nucleotide sequence that encodes a protein. Genes and / or transgenes can further include genetic regulatory and / or structural elements known in the art.

The term “animal” as used herein includes all mammals except humans. The term also encompasses all stages of development of the individual animal, including the embryonic and fetal stages. Preferably the animal is a rodent, most preferably a mouse or rat. A "transgenic animal" is an animal that contains one or more cells that carry the genetic information integrated, directly or indirectly, through subcellular, deliberate genetic manipulations such as microinjection or infection with a recombinant virus. . The introduced DNA molecule can be integrated inside the chromosome or replicate the DNA outside the chromosome. Unless otherwise noted or understood in the context of a description of an animal, a "transgenic animal" as used herein is one in which genetic information has been introduced into the germline, thereby transmitting that information to progeny. Means a transgenic animal that has been given the ability to do so. In fact, if the progeny have some or all of such genetic information, these progeny are also transgenic animals. The genetic information is typically presented in the form of a transgene contained by the transgenic animal.

The genetic information incorporated into an animal other than a human is information that is foreign to the species of the animal to which the recipient belongs or information that is foreign only to a specific individual recipient. In the latter case,
The information may be altered or exhibit a different expression than the native gene. Alternatively, a "knock-out" animal is obtained when the altered or introduced gene renders the innate gene non-functional.

As used herein, “targeting gene” or “knockout” (KO)
A transgene is a DNA sequence that has been introduced into the germline of a non-human animal by human intervention, such as, but not limited to, the methods described herein. The targeted genes of the present invention include nucleic acid sequences designed to specifically alter syngeneic endogenous alleles of non-human animals.

[0087] The modified AOMF05 receptor gene need not completely encode the same endogenous receptor as the host animal. Also, the expression product may be modified small, large, or not at all. If the modified AOMF05 gene is used to express a non-innate AOMF05 receptor in a transgenic animal in the absence of the endogenous AOMF05 receptor, the modified AOMF05 gene will have a null "knockout" expression in the animal. It is preferred to induce a pattern. However, lightly modified AOMF05 genes are also useful, and such genes are included within the scope of the invention.

A typical target cell for transgene introduction is an embryonic stem (ES) cell. ES
Cells are obtained by culturing pre-implantation embryos in vitro and fusing them to the embryos (MJ).
. Evans et al., Nature 292: 154-156 (1981); Bra
dley et al., Nature 309: 255-258 (1984); Gossl.
er et al., Proc. Natl. Acad. Sci. USA 83: 9065-9
069 (1986); and Robertson et al., Nature 322: 44.
5-448 (1986)). The transgene is a DNA transfection,
A variety of standard techniques such as microinjection or retrovirus-mediated transduction can be efficiently introduced into ES cells. The resulting transformed ES cells are then allowed to bind to blastocysts of a non-human animal. The introduced ES cells are then implanted into embryos and integrated into the germline of the resulting chimeric animal (R. Jaenisc).
h, Science 240: 1468-1474 (1988)). Animals that have produced germline transformants are screened. These are crossed to produce animals that are homozygous for the transgene.

Methods for evaluating targeted recombination events and resulting knockout mice are known in the art and can be readily used. Non-limiting examples of such methods include DNA (Southern) hybridization, polymerase chain reaction (PCR), polyacrylamide gel electrophoresis (PAG) to detect targeted alleles.
E) and Western blots for detecting DNA, RNA and proteins.

These may be used for therapeutic purposes (gene therapy is described below). When a mutated, allelic or mutated sequence is present inside a cell of an organism, particularly when it is substituted for a homologous endogenous sequence, the organism is affected by the action of the AOMF05 gene or inv.
It can be used as a model to test and / or study substances that modulate the activity of the in vitro encoded polypeptides and / or promoters or other substances that have proven therapeutic potential.

AOMF05 Expression The present invention also relates to recombinant vectors and prokaryotic and eukaryotic recombinant hosts comprising the substantially purified nucleic acid molecules disclosed herein.

Thus, the present invention also provides methods for expressing AOMF05 and the biological equivalents disclosed herein, assays using these recombinantly expressed gene products,
Cells expressing these gene products are directed to compounds identified as modulators, agonists and / or antagonists through the use of assays utilizing these recombinant forms. Non-limiting examples thereof include acting in direct contact with a receptor, particularly a ligand binding domain, or acting in direct or indirect contact with a ligand that interacts with the receptor, or in the transcription or translation of AOMF05. One or more compounds or molecules that act and thereby regulate AOMF05 expression.

A variety of expression vectors can be used to express recombinant AOMF05 in a host cell. An expression vector is defined herein as a DNA sequence necessary for the transcription of cloned DNA and translation of its mRNA in a suitable host. Such vectors can be used to express eukaryotic DNA in a variety of hosts, such as bacteria, cyanobacteria, plant cells, insect cells and animal cells. Specifically designed vectors are used to transfer DN between hosts such as bacteria-yeast or bacteria-animal cells.
A may be shuttled. A properly constructed expression vector must contain an origin of replication for autonomous replication in a host cell, a selectable marker, a few useful restriction enzyme sites, a high copy number capability and an active promoter. A promoter is defined as a DNA sequence that directs RNA polymerase to bind to DNA and initiate RNA synthesis. A promoter that initiates mRNA at a high frequency is called a strong promoter. Non-limiting examples of expression vectors are cloning vectors, modified cloning vectors, specifically designed plasmids or viruses.

Non-limiting examples of commercially available mammalian expression vectors suitable for recombinant human AOMF05 expression include pcDNA3.1 (Invitrogen), pLITMUS28, pLIT
MUS29, pLITMUS38 and pLITMUS39 (New Engla
nd Biolabs), pcDNAI, pcDNAIamp (Invitro)
gen), pcDNA3 (Invitrogen), pMC1neo (Stra)
tag, pXT1 (Stratagene), pSG5 (Strata)
gene), EBO-pSV2-neo (ATCC 37593), pBPV-1
(8-2) (ATCC 37110), pdBPV-MMTneo (342-12)
) (ATCC 37224), pRSVgpt (ATCC 37199), pRSV
neo (ATCC 37198), pSV2-dhfr (ATCC 37146),
pUCTag (ATCC 37460) and IZD35 (ATCC 37565).

A variety of bacterial expression vectors can be used to express recombinant human AOMF05 in bacterial cells. Non-limiting examples of commercially available bacterial expression vectors suitable for recombinant human AOMF05 expression include pQE (Qiagen), pET11a (Novagen).
), Lambda gt11 (Invitrogen) and pKK223-3 (
Pharmacia).

Various fungal cell expression vectors can be used to express recombinant human AOMF05 in fungal cells. Non-limiting examples of commercially available fungal cell expression vectors suitable for recombinant human AOMF05 expression are pYES2 (Invitrogen) and Pichi
a Expression vector (Invitrogen).

[0097] A variety of insect cell expression vectors can be used to express the recombinant receptor in insect cells. Non-limiting examples of commercially available insect cell expression vectors suitable for recombinant human AOMF05 expression include pBlueBacIII and pBlueBacHis2 (Inv
(Itrogen) and pAcG2T (Pharmingen).

An expression vector containing DNA encoding a human AOMF05-like protein can be used to express human AOMF05 in a recombinant host cell. Recombinant host cells can be prokaryotic or eukaryotic, non-limiting examples of which include bacteria such as E. coli,
Fungal cells such as yeast, mammalian cells including, but not limited to, cell lines of human, bovine, porcine, monkey and rodent origin, and insect cells including, but not limited to, cell lines derived from Drosophila and silkworm. Non-limiting examples of commercially available cell lines from suitable mammalian species include L
Cell LM (TK-) (ATCC CCL 1.3), L cell LM (ATCC CCL 1.2), Saos-2 (ATCC HTB-85), 293 (AT
CC CRL 1573), Raji (ATCC CCL 86), CV-1 (
ATCC CCL 70), COS-1 (ATCC CRL 1650), CO
S-7 (ATCC CRL 1651), CHO-K1 (ATCC CCL 6
1) 3T3 (ATCC CCL 92), NIH / 3T3 (ATCC CRL)
1658), HeLa (ATCC CCL 2), C1271 (ATCC C
RL 1616), BS-C-1 (ATCC CCL 26), MRC-5 (A
TCC CCL 171) and CPAE (ATCC CCL 209).

[0099] Expression vectors can be introduced into host cells via any of a number of techniques including, but not limited to, transformation, transfection, protoplast fusion, and electroporation. Expression vector-containing cells are individually analyzed to determine whether they produce human AOMF05 protein. Identification of cells expressing human AOMF05 can be accomplished by several means, including, but not limited to, immunoreactivity with anti-human AOMF05 antibody, labeled ligand binding, and the presence of host cell-related human AOMF05 activity. .

The cloned human AOMF05 cDNA obtained by the method described herein can be used to prepare an expression vector (eg, pc
DNA 3.1, pQE, pBlueBacHis2, and pLITMUS28) can be recombinantly expressed and introduced into prokaryotic or eukaryotic host cells to produce recombinant human AOMF05. Such manipulation techniques are described in Sambrook et al., Supra, are known and readily available to those skilled in the art.

In addition, human AOMF05 was synthesized using in vitro produced synthetic mRNA.
DNA can also be expressed. Synthetic mRNA is also efficiently translated into various cell-free systems such as wheat germ extract and reticulocytes as non-limiting examples, and also efficiently into cell-based systems such as micro-injection into frog oocytes as non-limiting examples. Although translated, microinjection into frog oocytes is preferred. In order to determine the human AOMF05 cDNA sequence (s) that produce human AOMF05 at optimal levels, cDNA molecules can be constructed, including, but not limited to: a cDNA comprising the full length open reading frame of human AOMF05 Various constructs comprising a fragment and a portion of the cDNA encoding only the specific domain of the protein or the translocation domain of the protein. All constructs are human AOMF05
The cDNA can be designed to contain no 5 'and / or 3' untranslated regions or to contain all or a part thereof. The expression level and activity of human AOMF05 can be measured after introducing these constructs alone or in combination into appropriate host cells. After determining the human AOMF05 cDNA cassette that yields optimal expression in a transient assay, the AOMF05 cDNA construct is transformed into various cells, including but not limited to mammalian cells, plant cells, insect cells, oocytes, bacteria and yeast cells. It is introduced into an expression vector (including a recombinant virus).

After expression of AOMF05 in a host cell, AOMF05 polypeptide may be recovered. Several available AOMF05 protein purification procedures can be used as appropriate. Ultrafiltration, acid extraction, alcohol precipitation, salt fractionation, ion exchange chromatography, phosphocellulose chromatography, lecithin chromatography, affinity (eg, antibody or His-Ni) chromatography, size exclusion chromatography, hydroxylapatite adsorption chromatography AOMF05 proteins and polypeptides can be purified from cell lysates or extracts or conditioned media by using, in combination, or in various combinations, methods such as and chromatography based on hydrophobic or hydrophilic interactions. In some cases, protein denaturation and regeneration steps can be used. High performance liquid chromatography (HPLC) and reverse phase HPLC are also useful. Dialysis can be used to adjust the final buffer composition.

Anti-AOMF05 Antibodies The present invention also relates to polyclonal and monoclonal antibodies that are raised in response to the human AOMF05 form disclosed herein or a biologically active fragment thereof. It is particularly preferred to raise antibodies to epitopes on the NH2-terminal domain or extracellular intermembrane domain of AOMF05. Also,
It is preferred to raise antibodies to epitopes with the least homology to other known glycoprotein hormone receptor proteins.

An antibody is specific for an AOMF05 epitope, provided that one skilled in the art can determine, using standard techniques, the conditions under which Western blotting can detect AOMF05 in samples taken from host cells displaying AOMF05 on the surface. Depending on the epitope, the blot may be a raw gel or a denaturing gel. If non-specific background binding cannot be detected visually, the antibody is highly specific for the AOMF05 epitope. Also, the non-AOMF05 peptide, polypeptide or protein is AO
An antibody may also be considered highly specific for AOMF05 if it cannot compete with the antibody for binding to MF05.

The recombinant AOMF05 protein is a full-length AOMF05 protein or AOM
It can be separated from other cellular proteins by using an immunoaffinity column made with monoclonal or polyclonal antibodies specific for the polypeptide fragment of the F05 protein. In addition, polyclonal or monoclonal antibodies can be raised in response to synthetic peptides (typically about 9 to about 25 amino acids in length) obtained from a portion of the protein as disclosed in SEQ ID NO: 2. Monospecific antibodies to human AOMF05 can be purified from mammalian antiserum containing antibodies reactive with human AOMF05, or can be obtained from Kohler & Milstein.
n (1975, Nature 256: 495-497) as a monoclonal antibody reactive to human AOMF05. The term monospecific antibody as used herein is defined as a single antibody species or multiple antibody species with uniform binding properties to human AOMF05. The expression homogeneous binding as used herein refers to the ability of an antibody species to bind to a particular antigen or epitope, such as the human AOMF05-related antigen or epitope described herein.
Immunization of animals such as mice, rats, guinea pigs, rabbits, goats and horses with appropriate concentrations of human AOMF05 protein or a synthetic peptide made from a portion of human AOMF05 with or without an immunological adjuvant.
MF05-specific antibodies are raised.

Pre-immune serum is collected prior to the first immunization. Each animal receives from about 0.1 mg to about 1000 mg of human AOMF05 protein along with a qualified immune adjuvant. Non-limiting examples of such eligible immunological adjuvants include Freund's complete adjuvant, Freund's incomplete adjuvant, alum precipitate, Coryneb
There are water-in-oil emulsions containing acterium parvum and tRNA. For the first immunization, the human AOMF05 protein or peptide fragment thereof in subcutaneous (SC) or intraperitoneal (IP) or both routes, preferably in Freund's complete adjuvant, is administered at multiple sites. Blood is periodically collected from each animal, preferably once a week, to measure the antibody titer. The animals after the first immunization can optionally be given a booster injection. Booster injected animals are usually given an equal volume of human AOMF05 in Freund's incomplete adjuvant by the same route. Booster injections are given approximately every three weeks until maximum antibody titer is obtained.
Animals are bled approximately 7 days after each booster immunization or once a week after one immunization, serum is collected, and aliquots are stored at approximately -20 ° C.

Monoclonal antibodies reactive with human AOMF05 (mAb) by immunizing inbred mice, preferably Balb / c, with human AOMF05 protein
) Is produced. Immunize mice by the IP or SC route by admixing about 1 mg to about 100 mg, preferably about 10 mg, of human AOMF05 protein in about 0.5 ml of buffer or saline with a suitable adjuvant as described herein. Make. Freund's complete adjuvant is preferred. On day 0, mice are initially immunized and allowed to stand for about 3 to about 30 weeks. Immunized mice are boosted with one or more doses of about 1 to about 100 mg of human AOMF05 in a buffer solution such as phosphate buffered saline by the intravenous (IV) route. The spleen is excised from the immunized mouse by standard procedures known in the art to obtain lymphocytes, preferably spleen lymphocytes, of the antibody-positive mouse. The spleen lymphocyte vesicle is mixed with a suitable fusion partner, preferably a myeloma cell, under conditions capable of forming a stable hybridoma, to produce a hybridoma cell. Non-limiting examples of fusion partners include mouse myeloma P3 / NS1 / Ag4-1; MP
C-11; S-194 and Sp2 / 0, with Sp2 / 0 being preferred. About 30%
-Fusing antibody producing cells with myeloma cells in about 1000 molar weight of polyethylene glycol at about 50% concentration. Hypoxanthine using procedures known in the art,
Dulbecco's modified Eagle's medium supplemented with thymidine and aminopterin (DME
M) Select fused hybridoma cells by growing in. About 14,
Supernatant fluids are collected after 18 and 21 days from growth positive wells and screened for antibody production by immunoassays such as solid phase immunoradiometric assay (SPIRA) using human AOMF05 as antigen. The culture fluid is also tested in an Ouchterlony sedimentation assay to determine the isotype of the mAb. Tissue
Culture Methods and Applications, Kr
use and Paterson, Eds. , Academic Press
MacPherson, 1973, Soft Agar Technik
Hybridoma cells are cloned from antibody-positive wells by techniques such as the soft agar method described in Ues.

Pristine-primed Balb / c mice were injected with monoclonal antibodies by injecting about 2 × 10 ^{6 to} about 6 × 10 ⁶ hybridoma cells in about 0.5 ml per mouse about 4 days after priming. Antibodies in vivo
vo production. Approximately 8-12 days after cell introduction, ascites is collected and monoclonal antibodies are purified by techniques known in the art.

To produce anti-human AOMF05 mAb in vitro, hybridomas are grown in DMEM containing about 2% fetal calf serum to obtain sufficient quantities of specific mAbs. The mAb is purified by techniques known in the art.

The antibody titer of the ascites fluid or hybridoma culture fluid is determined by various serological or immunological assays. Non-limiting examples of assays include sedimentation, passive aggregation, enzyme linked immunosorbent antibody (ELISA) and radioimmunoassay (
RIA) method. Similar assays can be used to detect the presence of human AOMF05 in body fluids or in extracts of tissues and cells.

One of skill in the art will readily appreciate that the methods for producing monospecific antibodies described herein can be used to produce human AOMF05 peptide fragments or full length human AOMF05.

For example, a human AOMF05 antibody affinity column can be prepared by adding an antibody to Affigel-10 (Biorad). Affigel-1
0 is a gel support that has been pre-activated with N-hydroxysuccinimide ester so that the antibody forms a covalent bond with the agarose gel bead support. The antibody binds to the gel via an amide bond with the spacer arm. The remaining activated ester is quenched with 1 M ethanolamine HCl (pH 8). The column is washed sequentially with water and 0.23 M glycine HCl (pH 2.6) to completely remove unbound antibody or contaminating proteins. Next, phosphate buffered saline (pH 7.3)
)) And equilibrate the column, and slowly pass the cell culture supernatant or cell extract containing the full-length human AOMF05 or human AOMF05 protein fragment through the column. Next, the column is washed with phosphate buffered saline until the optical density (A ₂₈₀ ) drops to background, then 0.23 M glycine-HCl (pH 2.10).
The protein is eluted in 6). The purified human AOMF05 protein is then dialyzed into phosphate buffered saline.

The level of human AOMF05 in the host cells is quantified by various techniques, including but not limited to immunoaffinity and / or ligand affinity methods.
Isolating ³⁵ S- methionine labeled either or unlabeled AOMF05 using AOMF05 specific Ati sanity beads or AOMF05 specific antibodies. The labeled AOMF05 protein is analyzed by SDS-PAGE. Unlabeled AOMF0
The 5 proteins are detected using AOMF05 protein specific antibodies and / or anti-phosphotyrosine antibodies in Western blots, ELISA assays or RIA assays.

AOMF05 Modulators, Agonists and Antagonists The present invention also provides DNA or RNA encoding human AOMF05 protein.
A method for screening a compound or a molecule that regulates the expression of a compound. The compound or molecule that modulates these activities may be a DNA, RNA, peptide, protein or non-proteinaceous organic molecule. They can regulate the expression of DNA or RNA encoding human AOMF05 by enhancing or attenuating. Human AOM
Compounds that modulate the expression of DNA or RNA encoding F05 or compounds that are agonists or antagonists of their biological function can be detected by a number of assays. The assay may be a simple “yes / no” assay to determine whether there has been a change in expression or function. The assay can be made quantitative by comparing the level of expression or function in a test sample to the level of expression or function in a standard sample. A kit containing human AOMF05, an antibody against human AOMF05, or modified human AOMF05 can be prepared by a known kit preparation method.

The DNA molecules, RNA molecules, recombinant proteins and antibodies of the present invention are human AOMF
05 can be used to screen and measure. Recombinant proteins, DNA molecules, RNA molecules and antibodies are suitable for making kits suitable for the detection and typing of human AOMF05. Such a kit comprises a compartmentalized carrier suitable for holding at least one container in a sealed state. The carrier also contains reagents suitable for detecting human AOMF05, such as recombinant AOMF05 or anti-AOMF05 antibody. The carrier also contains a detection means, such as a labeled antigen or enzyme substrate.

Pharmaceutical Compositions Human AOMF may be prepared according to known methods, such as mixing with a pharmaceutically acceptable carrier.
Pharmaceutically effective compositions comprising the agonists, antagonists or modulators of the present invention can be prepared. Examples of such carriers and formulation methods are Remington's
s Pharmaceutical Sciences. When a pharmaceutically acceptable composition is formed suitable for effective administration, such composition will contain an effective amount of protein, DNA, RNA, modified human AOMF05 or a modulator, agonist or agonist of AOMF05. Will contain an antagonist.

A therapeutic or diagnostic composition of the present invention is administered to an individual in an amount sufficient to treat or diagnose a disorder. The effective amount can vary depending on various factors such as the condition, weight, sex and age of the individual. Another factor is the mode of administration.

The pharmaceutical compositions can be supplied to an individual by various routes, such as subcutaneous, topical, oral and intramuscular.

The term “chemical derivative” refers to a molecule that contains additional chemical moieties that are not normally part of the underlying molecule. Such moieties can improve the solubility, half-life, absorption, etc. of the base molecule. Alternatively, such moieties attenuate unwanted side effects of the basal molecule or reduce the toxicity of the basal molecule. An example of such a part is R
It is described in various documents such as emington's Pharmaceutical Sciences.

Compounds identified according to the methods disclosed herein can be used alone at appropriate dosages. Alternatively, simultaneous or sequential administration with other agents may be desirable.

The present invention also provides a means for obtaining suitable topical, oral, systemic and parenteral formulations for use in the treatment methods of the present invention. Compositions comprising a compound or molecule identified according to the invention as an active ingredient can be administered in a variety of therapeutic forms using conventional vehicles suitable for administration. For example, the compounds may be tablets, capsules (each including time release formulations, sustained release formulations, etc.), pills, powders, granules, elixirs, tinctures, solutions, suspensions, syrups and emulsions It can be administered by oral dosage form such as or by injection. Similarly, it can be administered intravenously (condensed mass and infusion), intraperitoneally, subcutaneously, topical, optionally with blockade, or intramuscular form. Both are forms known to the average person skilled in the pharmaceutical industry.

Advantageously, the compounds of the present invention may be administered in a single daily dose, or
The daily dosage may be divided into two, three or four divided doses. In addition, the compounds of the present invention may be administered in intranasal form by topical use of a suitable intranasal vehicle, or by the transdermal route using transdermal patches forms known to those of ordinary skill in the art. You can also. When administered in the form of a transdermal delivery system, the dosage administration will be continuous rather than intermittent throughout the dosage regimen.

In the case of a combination therapy using two or more active substances, when the active substance is a preparation to be administered separately, the active substances may be administered simultaneously, or each may be administered separately with a time delay. You may.

Dosage regimens using the compounds of the invention will depend on the type of patient, the species
ies), selection according to various factors such as age, weight, sex and medical disorder, severity of disorder to be treated, route of administration, renal function, hepatic or cardiovascular function of the patient, specific compounds used, etc. I do. A physician or veterinarian of average skill can readily determine and prescribe the effective amount of the drug required to prevent or counter the disorder or to arrest the progress of the disorder. In order to provide a drug concentration within a range in which a drug can exert its efficacy without toxicity with optimal accuracy, a dosing schedule based on drug use kinetics by a target site is required.
This includes considerations regarding drug delivery, equilibrium and elimination.

The following examples are representative, but it should be understood that the scope of the invention is limited by the following examples, as various other embodiments will be apparent to those skilled in the art. No.

Example 1 Isolation of AOMF05 Receptor cDNA Identification of Partial AOMF05 Receptor cDNA Using the human G protein-coupled glycoprotein hormone receptor polypeptide sequence as a probe, and using the survey program tFASTA, NCBI ( Nati
onal Center for Biotechnology Inform
EST) dbEST was searched. The sequence chosen was the protein sequence of a known human receptor, namely the receptor for FSH (follicle stimulating hormone), TSH (thyroid stimulating hormone), LH (luteinizing hormone). One EST (GenBank, accession number # T73957) was found to encode a polypeptide that is approximately 30% equivalent to these receptors at the amino acid level. This EST containing a 350 base pair sequence was sequenced from the 5 'of a clone obtained from a whole human liver cDNA library (IMAGE, ID of this clone = 84521).

Using the DNA sequence information of this EST, a cDNA fragment containing the starting EST was isolated. Next, when the DNA sequences of these fragments were determined and analyzed,
The full length coding sequence of the AOMF05 gene was identified. Next, the full-length cDNA
The sequence was cloned into a mammalian expression vector.

Primers AOMF05 was isolated by the procedure described below using the following primers. For convenience and clarity, the SEQ ID NOs are shown here. In the following description, the primers are indicated by respective designating symbols including numerical elements.

[0129] R71: GGCCATTAATAAAAATGCTAGTGA (array 5) R77: GCATTTTTATTAATGGCCGTTATC (array 6) F30: GCCATCATTAGGATTCACTGTAAC (array 7) R117: GGTCCCTTTTTCCAAGTTGC (array 8) R175: TGGATAAAAGAAAGGTCGTTGC (array 9) R167: AGAAAGGTCGTTGCCCGCCAAT (array 10) F31: ACTGCTCCGGGAAGGGGCTGAC (array 11) R104s: GAGTCACAACCCCAAAATGC (sequence 12) R126s: GGCAACCCATTAAAACTTGGA (sequence 13) F1803s: AGACAGTTCTGACCAGGTGC (sequence 14) 210s: GGCCTGATATCTCTAAGGATTC (SEQ 15) R69: GCTTGGGTGAAGGCGCTGAG (SEQ 16) F16: CCTGTGAGCCCCTGAGGTTCA (SEQ 17) R2289: ATAAACTGCCACCTCTCCTTCTT (SEQ 18) NNheMF05-1569: CTAGCTAGCGCCATCATGCCG
GGCCCGCTAGGGCTG (sequence 19) CNheMF05-2479: GAACTGTTTGAGATGATTGCT
CTT (sequence 20) PBS. 838F: TTGTGTGGAATTGTGAGCGGATAAC (
Sequence 21) PBS. 873F: CCCAGGCTTTACACTTTATGCTTCC (
Sequence 22) PBS. 543R: GGGGATGTGCTGCAAGGCGA (sequence 23) PBS. 578R: CCAGGGTTTTCCCAGTCACGAC (sequence 2
4).

Cloning and Sequencing of AOMF05 The full-length sequence of AOMF05 was obtained from a fetal brain cDNA library by multi-cycle RCCA (Reduced Complexity cDNA Analyzes described in the text).
is). Oligo dT, each consisting of about 4 million primary clones
The fetal brain cDNA library randomly primed with
luscript SK- (Stratagene, La Jolla, CA
A) built in.

[0131] The primary clones were subdivided into 188 superpools, each pool containing approximately 20,000 clones.

For an initial scan of the fetal brain cDNA library, AOMF05 EST T
5 'and 3' primers predicted to be specific to 73597 (primers F30 and R117) and 5 'and 3' oligonucleotide primers of the polylinker sequence of the vector (primers PBS.873F and PBS.543R).
)It was used. Under standard PCR conditions, Amplitaq Gold (Perkin
Elmer-Roche, Branchberg, NJ, U.S.A. S. PCR reactions were performed using A) as per the enzyme manufacturer's instructions.

After identification of the positive pool, nested insert-vector PCR was performed on the positive pool in the following combinations. Primary reaction F30 + PBS. 543R, F30 + PBS.
873F; R117 + PBS. 543R, R117 + PBS, 873F. secondary(
Nested type) Reaction F77 + PBS. 578R, F77 + PBS, 838F, R71
+ PBS. 578R, R71 + PBS. 838F. Next, the PCR products were sequenced and assembled. Two new sequencing primers, R126s and F1803s, were synthesized in the 3 'and 5' directions and used to sequence previously nested PCR products. The assembled sequence contained an open reading frame.

The sequence containing the open reading frame was amplified using the two primers F16 and R2289 and the vector pCR2.1 (Invitrogen) by TA cloning.
, San Diego, CA). Convert AOMF05 sequence to Kpn
Excluded by I + NotI digestion and digested with the same enzymes pcDNA3.1 (In
(Vitrogen, San Diego, CA). This plasmid was designated as pMF053.1. A. It was named. Next, a new 5 'sequence containing a longer open reading frame was obtained by the procedure described below.

Based on the assembled AOMF05 sequence, two new primers F210s and R104s were synthesized and used to scan fetal brain and prostate cDNA libraries. After identification of the positive superpools, 5 'extensions of these pools were performed using the following primer combinations. 104s + PBS. 578R, R
104s + PBS. 838F. The products were sequenced and assembled to construct a contig.

A 5 ′ walking primer R175 was synthesized from the new contig. This primer and the vector-specific primer PBS. The superpooled library was scanned using 538R. After identifying the positive rows, a 5 'extension of these rows was performed and the products were sequenced and assembled. Two primers, F31 and R167, were selected from the new sequence to identify new pools in the fetal brain and prostate cDNA libraries. After identification of the positive pool, 5 'extension was performed using the following primer combinations. R167 + PBS. 578R, R167 + PBS
. 838F. The PCR products were then sequenced and assembled to construct a contig.

[0137] Based on the new sequence, another 5 'primer R69 was synthesized. Next, this primer was added to PBS. 838F or PBS. The positive pool was amplified with 543R in the presence of 5% DMSO. The PCR products were then sequenced and assembled to construct a single contig. This sequence contains a 2850 base pair open reading frame encoding a 949 amino acid polypeptide. Two PCR primers NNheM
F05-1569 and CNheMF05-2479 were synthesized and used for 5 'end amplification. The PCR fragment was digested with NheI and NheI-digested pMF0
53.1. A. Was bound. The resulting plasmid was confirmed by physical mapping and sequencing and named pcDNA3.1MF05.

Example 2 DNA Analysis The sequences of the two variants of the full length AOMF05 cDNA are shown in FIGS. 1A-1B (sequence 1).
4A to 4C (sequence 3). The amino acid sequence of this receptor mutant is shown in FIG.
(Sequence 2) and FIG. 5 (Sequence 4). GCG (Genetics Compu)
ter Group, Madison, Wisconsin, USA)
FASTA surveys and phylogenetic analyzes were performed using the plot program. Analysis indicated that AOMF05 belongs to the G-protein coupled glycoprotein hormone receptor family. GCG (Genetics Computer G
Hydropathy analysis using the Pepplot program of Roup, Madison, Wisconsin, USA) showed that AOMF05 had seven transmembrane domains typical of the rhodopsin family of G protein-coupled receptors. The domain starts at about amino acid 539 of sequence 2 or sequence 4. A
The deduced polypeptide sequence of OMF05 contains seven sites that cleave the signal peptide from the N-terminus of the protein (FIG. 7).

Example 3 Analysis of AOMF05 Expression Pattern Multi-tissue Northern blot analysis was performed as follows. Ready-made human multi-tissue northern blots were prepared using Clontech (Clontech, Palo Alto, C
A, USA). AOM in human tissue using a total of 6 blots
The expression of F05 was analyzed.

Random Priming REDDY-PRIME® Labeling Kit (Amersham. Inc.)
. , Chicago, IL, USA) were labeled with ³² P by random priming using the AOMF05 cDNA fragment. Reactions were performed using the kit according to the manufacturer's protocol. Approximately 50 ng of DNA in 45 μl H ₂ O was boiled for 3 minutes and then quickly cooled to 0 ° C. for 5 minutes. Transfer DNA solution to RE
Transferred to DDY-PRIME® tube and mixed with frozen reagent in tube. Then 5.0 μl of α- ³² P-dCTP (<5000 Ci / mM) was added and the tubes were incubated at 37 ° C. for 15 minutes. 5.0 μl of 0.5 M EDTA (pH
The reaction was stopped by adding 8.0). Unincorporated nucleotides were removed by gel filtration using a span column.

Northern Hybridization A labeled fragment was used as a probe for AOMF05 RNA. Hybridization was performed in Clontech's ExpressHyb buffer according to the protocol of the membrane manufacturer Clontech (Palo Alto, CA, USA). The membrane was prehybridized at 68 ° C. for 1 hour with gentle agitation in Expresshyb buffer. The ³² P-labeled probe was denatured by adding NaOH to a final concentration of 0.2 nM and then added to the hybridization solution. Hybridization was performed at 68 ° C. for 3 minutes. The membrane was removed from the hybridization buffer and washed once in 2 × SSC, 0.1% SDS at room temperature for 10 minutes. Next, the membrane is 0.1 × SSC, 0.1% SDS
At 50 ° C. for 30 minutes. Phosphaimager (Molecula
The blots were analyzed by r Dynamics (Sunnyvale, CA, USA).

Analysis AOMF05 was extremely abundantly expressed in the pancreas and in normal amounts in the heart, brain, liver, kidney, skeletal muscle, placenta, adrenal medulla, adrenal cortex, thyroid, stomach and testis (
(FIG. 8). AOMF05 was detected as a transcript of 5.5 kb or less in all these tissues except the placenta, and an additional 4.5 kb messenger was detected in the placenta.

Example 4 Isolation of Genomic DNA Encoding AOMF05 To isolate human genomic DNA encoding the receptor, AOMF05 cDN
A is used as a probe. The cDNA may be used in its entirety or a portion of the sequence. When using a portion of a sequence of less than 100 nucleotides as a probe, it is necessary to perform homology analysis of the selected probe sequence on the entire human sequence to confirm that the selected sequence is non-repeated in human DNA There is. If the selected sequence shows high homology to diverse human DNA sequences, this sequence cannot function well as a probe specific to AOMF05 genomic DNA. For example, portions of cDNA encoding amino acid sequences that are highly conserved in G protein-coupled receptors can be used. However, in this case, it is expected that multiple receptor genes other than AOMF05 will be identified, so that a large number of the identified fragments will need to be further examined, after which any identified DNA will be identified as AOMF0.
You will need to determine if you are coding 5. This is the identified genomic DN
All that is required is to sequence the A fragment and compare that sequence to the AOMF05 sequence presented in the text (sequences 1 and 4).

After selection of the probe sequence, the probe is labeled by any means known in the art, including but not limited to, the incorporation of a radioisotope or biotin. The probe is hybridized under appropriate stringent conditions to a library of human genomic DNA fragments. To obtain a properly specific hybridization of the probe to the target sequence, the stringency of the hybridization reaction can be adjusted by means known in the art, such as, for example, changing the salt concentration and temperature. The fragment identified by the probe is sequenced or treated with restriction digestion to confirm that the fragment contains AOMF05 genomic DNA.

It is possible that none of the identified fragments contain the complete genomic gene. In this case, in order to isolate the entire gene, it is necessary to perform chromosome walking, for example using the identified fragment as a probe, to isolate additional fragments that overlap in the chromosome. If isolation of overlapping fragments is required, the complete A
A continuous DNA fragment encoding the OMF05 genomic DNA may be constructed.

Example 5 Transgenic Animals Transgenic animals expressing AOMF05 as a transgene are provided as follows. AOMF05 nucleotide sequence, eg, full length AOMF0
A polynucleotide having a nucleotide sequence of cDNA or genomic DNA encoding the 5 receptor, or a polynucleotide encoding a partial sequence of the receptor, a flanking sequence of the coding sequence, or both, is incorporated into the genome of the animal. Ligation to vector. AOMF05 sequence is human AOM
It may be derived from F05 or from animal AOMF05.

In this example, the target cells for transgene introduction are mouse embryonic stem (ES) cells. ES cells are obtained from various non-human animal embryos cultured and fused to embryos in vitro before implantation (MJ Evans et al., Nature 2).
92: 154-156 (1981); Bradley et al., Nature 309:
255-258 (1984); Gossler et al., Proc. Natl. Aca
d. Sci. USA 83: 9065-9069 (1986); and Robert.
tson et al., Nature 322: 445-448 (1986)).

The transgene is introduced into murine ES cells by microinjection, but various standard techniques such as DNA transfection or retrovirus-mediated transduction may be used. The injected ES cells are then allowed to bind to blastocysts of a non-human animal. The introduced ES cells are transferred to the embryo, proliferated, and integrated into the germ line of the obtained chimeric animal (R. Jaenisch, Science 2).
40: 1468-1474 (1988)). Individuals of chimeric mice that have undergone germline transformation are screened. These are crossed to produce animals that are homozygous for the transgene.

The targeted recombination events and the resulting mice were analyzed by DNA (Southern) hybridization, polymerase chain reaction (PCR), polyacrylamide gel electrophoresis (PAGE), and D
It is assessed by techniques known in the art, including, but not limited to, Western blots detecting NA, RNA and proteins.

[0150] Three basic types of transgenic animals are produced, depending on the structure of the transgene vector. When the vector comprises a nucleotide sequence encoding the full-length human AOMF05 receptor and is designed to be integrated at a site other than the animal's endogenous AOMF05 gene, the resulting transgenic animal will have a native AOMF05 receptor and a human AOMF05 receptor. And both will be expressed. The vector is AO
If the MF05 gene is not contained and is designed to be integrated at the site of the endogenous AOMF05 gene of the animal, and the endogenous gene after integration has been modified to the extent that the functional AOMF05 receptor of the animal is deleted, , A knockout animal is produced. Finally, if the vector is designed to replace the endogenous AOMF05 gene with a human gene or if the sequence of the endogenous gene has been altered to encode the amino acid sequence of a human gene, i.e., it will be designed to be humanized. If so, the resulting animal's innate AOMF05 receptor is deleted and the human AOMF05 receptor is expressed. An animal having a human gene and lacking an endogenous gene also
It is obtained by crossing an animal of the first type with a knockout animal and producing an animal homozygous for the knockout and for the additional human AOMF05 gene.
This would be readily obtained if the human gene was integrated into a chromosome other than the chromosome containing the endogenous AOMF05 gene.

[0151] Transgenic animals are a source of cells and tissues used in assays for the regulation, activation or inhibition of AOMF05. Cells are harvested from the animal, established as a cell line and maintained in culture as appropriate.

Example 6 Assay for AOMF05 Receptor Ligands Glutathione S-transferase ("GST") AOMF05 Receptor Fusion Construct All or part of the N-terminal ligand binding domain of G protein-coupled glycoprotein hormone receptor AOMF05 and the GST gene A polypeptide fusion construct is made by in-frame fusion with the carboxy terminus. From the disclosure of Sequences 1-4,
The average person skilled in the art can construct any such nucleic acid molecule encoding a GST-AOMF05 fusion protein. In particular, a fusion is constructed wherein the polynucleotide encoding amino acids from about 20 to about 539 or about 20 to the end of sequence 2 of the N-terminal fragment of AOMF05 is fused to the GST C-terminus.

[0153] Soluble recombinant AOMF05 fusion proteins can be expressed in a variety of expression systems. Some expression systems are described in the text, for example, Spodoptera f using a baculovirus expression vector (eg, Bac-N-Blue DNA from Invitrogen or pAcG2T from Pharmingen).
rugiperda (Sf21) insect cells.

Next, the fusion protein is packed into a glutathione column. The C-terminal domain of GST binds to glutathione, and the N-terminal region of AOMF05 contacts the buffer phase. After washing the column, a sample, which may contain a ligand for the AOMF05 receptor, is passed through the column. The sample may be a purified or synthesized extract of cells or tissues, body fluids or compounds or molecules in the body. The sample may be used directly on the column or may be used after dilution or dialysis in a buffer close to physiological conditions. The N-terminal domain of AOMF05 binds to the ligand of the receptor. After washing the column,
Elute the ligand. For this purpose, for example, NaC is added to the column in the washing buffer.
A gradient of 1 is applied. Unknown ligands present in biological extracts or fluids can be characterized by standard chemical and biochemical methods. Ligands identified in this manner can be used as candidates in assays for agonists or antagonists of the AOMF05 receptor.

The ligand assay can also be performed by the following assays suitable for AOMF05 agonists and antagonists. Candidate compounds or molecules that exhibit agonist or antagonist activity can also be ligands for AOMF05.

Example 7 Assays for Receptor Agonists and Antagonists Any assay using recombinant host cells requires that cells be first generated as described elsewhere in the text. Briefly, the polynucleotides of the invention are used to transform or transfect appropriate cells,
Alternatively, cells are collected from an appropriate transgenic animal and cultured.

Melanophore system The melanophore screening system is described in International Patent Publication WO 92/0, published February 6,1992.
1810. Briefly, the G protein receptor AOMF0
Transfect melanophores to express 5. In assays for antagonists, the transformed melanophore is contacted with both the active ligand and the candidate compound. Inhibition of the signal generated by the ligand is indicative that the candidate compound is a potential antagonist of the receptor. In assays for agonists, cells are contacted with a plurality of candidate compounds to determine which compounds activate the receptor and generate a signal. Receptor activation is an indicator that the candidate compound is a potential agonist of the receptor.

Yeast Expressing Mammalian Adenylate Cyclase A screening method using yeast expressing mammalian adenylate cyclase is described in International Patent Publication WO 95/3012 published Nov. 9, 1995.
These yeasts can be engineered to co-express the AOMF05 receptor in the presence of the appropriate G protein. In assays for antagonists, the transformed yeast is contacted with both the active ligand of AOMF05 and the candidate compound. Inhibition of the signal generated by the ligand is indicative that the candidate compound is a potential antagonist of the receptor. In assays for agonists, cells are contacted with a plurality of candidate compounds to determine which compounds activate the receptor and generate a signal. Receptor activation is an indicator that the candidate compound is a potential agonist of the receptor.

Screening for Yeast Pheromone Protein Surrogates As described in International Patent Publication WO 94/23025 published October 13, 1994, yeast engineered to produce pheromone-based protein surrogates comprises:
It can be used to screen for the ability of surrogates to substitute for the syngeneic yeast pheromone receptor. In this method, generally, Saccharomyces cerevisiae in which the G-protein coupled receptor AOMF05 is linked to the pheromone pathway.
e to express the receptor. In this system, the yeast Ga subunit is generally deleted and replaced with a mammalian Ga protein, resulting in the coupling of the mammalian G protein-coupled receptor to the yeast pheromone pathway. A plasmid belonging to a plasmid library capable of expressing a peptide having a random sequence is introduced into an appropriate yeast strain. A
Clones encoding agonist ligands for the OMF05 receptor are selected based on stimulation of the pheromone pathway. Clones encoding an antagonist ligand for the AOMF05 receptor are selected based on inhibition of the pheromone pathway in the presence of the AOMF05 agonist. Alternatively, chemical libraries may be screened based on their agonist or antagonist activity by directly testing the chemical.

Phospholipase Secondary Signal Screening Another screening method involves the binding of A to phospholipase C or D
The OMF05 receptor is expressed. Cells such as CHO, endothelium, embryonic kidney and other cells can be used. As with other screens, ligands and candidate compounds are screened for agonist or antagonist activity by detecting activation or inhibition of phospholipase secondary signal or receptor activation. One example of such a system using yeast cells expressing a heterologous phospholipase is described in International Patent Publication WO 96/40939 published December 19, 1996.

Yeast Two-Hybrid System The yeast two-hybrid system expressing the G protein-coupled receptor AOMF05 can be used for screening for agonists and antagonists of the receptor (Fi
elds and Song, 1989, Nature 340: 245-24.
6). More specifically, all or part of the extracellular domain of the G protein-coupled receptor can be fused to the DNA binding domain of the transcription factor Gal4 or LexA.
Screening for molecules that interact with G protein-coupled receptors using yeast cells expressing these constructs has been described in the literature (Fields and Song).
, 1989) using the standard protocol of the two-hybrid screening method. Such molecules represent potential agonists or antagonists of the receptor.

Example 8 Assays for Modulators of Receptors Compounds or molecules that modulate receptors can be detected as described in the assays or as described below. Antibodies specific for the extracellular domain of the receptor are produced by standard techniques. Antibodies can be monoclonal or polyclonal. In order to facilitate the assay, the affinity of the antibody for the extracellular domain of the receptor should preferably be at least 10 ⁶ , more preferably at least 10 ⁸ . Prepare a cell culture that expresses the receptor. The cell culture may be one which naturally expresses the receptor, a cell line stably or transiently transfected with an expression vector comprising the receptor gene, or a transgenic animal having a transgene comprising the receptor gene. May be used.

Two samples of the culture are used for the assay. One sample is used as a control and is treated with a placebo, ie, a compound or molecule that has been determined to produce no modulatory effect of the receptor in the assay. The second sample is processed with modulator candidates. Aliquots of the culture are taken after treatment or at various points during treatment. The antibody is then used to qualify and quantify the amount of receptor present on the surface of the cell. This can be accomplished by a number of techniques known in the art using antibodies detectably labeled with ¹²⁵ I, gold, enzyme or other known labels. Alternatively, a second antibody specific for the first antibody may be labeled with a detectable label. The amount of receptor found in cells treated with the potential modulator is quantitatively and qualitatively compared to the amount of receptor found in control cells. The difference between the treated cells and the control cells serves as an indicator of whether the test compound is a receptor modulator.

In an alternative assay, cells are treated as described herein, and the receptor present in the treated and control cells is then isolated. The receptor preparation is prepared as a crude cell extract, a cell membrane or an intracellular fraction, or after a purification step, such as chromatography, precipitation or an affinity-based isolation step. The receptor content of a crude or partially or highly purified preparation of the receptor is analyzed using, for example, receptor-specific antibodies.

In any assay, it will be advantageous to create an internal control so that the results of the different series of assays can be compared to each other. Cellular proteins that are present in relatively constant amounts in the cells used in the assay and are not closely related to the receptor can be used as internal controls.

Example 9 Identification Assay for Compounds that Bind to AOMF05 Protein The present invention includes methods for identifying compounds that specifically bind to AOMF05 protein and compounds identified by such methods. The binding specificity of a compound having affinity for the AOMF05 protein is shown by measuring the compound's affinity for recombinant cells expressing the cloned receptor or membranes obtained from these cells. A method for screening for a compound that expresses a cloned receptor and binds to AOMF05 protein, or a compound that inhibits the binding of a known radiolabeled ligand of AOMF05 to these cells or membranes prepared from these cells, comprises a method of screening for AOMF05 protein. The present invention provides a rapid method for selecting a compound having a high affinity for a compound. Such ligands need not necessarily be radiolabeled and may be non-radioactive compounds that can be used to displace bound radiolabeled compounds or can be used as activators in functional assays. Compounds identified by the methods of the present invention are likely to be agonists or antagonists of AOMF05 and are peptides, proteins or non-proteinaceous organic molecules.

Accordingly, the present invention includes assays that can identify agonists and antagonists of AOMF05. Methods for identifying agonists and antagonists of other receptors are known in the art and can be applied to identify agonists and antagonists of AOMF05. Accordingly, the present invention provides a method for determining whether a candidate compound is a potential agonist or antagonist of AOMF05, comprising: (a) transfecting a cell with an expression vector encoding AOMF05 protein; Growing the transfected cells for a time sufficient for expression of the AOMF05 protein; (c) contacting the cells with a labeled ligand of the AOMF05 protein in the presence and absence of the candidate compound; and (d) AOMF05. Measuring the binding of the labeled ligand to the protein, wherein the candidate compound is a potential agonist or antagonist of the AOMF05 protein if the amount of the labeled ligand bound is less in the presence of the candidate compound than in the absence of the candidate compound. Is provided.

The operating conditions for step (c) of the method are those conditions typically used in the art to study protein-ligand interactions, eg physiological pH, conventional buffers such as PBS Or salt conditions as indicated by the tissue culture medium;
A temperature of 5 ° C. is used.

The present invention also includes a method of determining whether a candidate compound is capable of binding to AOMF05 protein, ie, determining whether the candidate compound is a potential agonist or antagonist of AOMF05 protein. The method includes: (a) preparing a test cell by transfecting the cell with an expression vector that directs the expression of AOMF05 protein in the cell; (b) contacting the test cell with a candidate compound; A) measuring the amount of binding of the candidate compound to AOMF05 protein; and (d) determining the amount of binding of the candidate compound to AOMF05 protein in the test cells by A.
Comparing the amount of binding of the candidate compound to a control cell that has not been transfected with the OMF05 protein, if the amount of binding of the candidate compound is greater in the test cells than in the control cells.
It is determined that the candidate compound can bind to the AOMF05 protein. To determine whether a candidate compound is in fact an agonist or an antagonist, a functional assay is used, such as an assay that involves the use of the promiscuous G proteins described herein.

The operating conditions of step (b) of the method are those typically used in the art to study protein-ligand interactions, eg, physiological pH, conventional buffers such as PBS. Or salt conditions as indicated by the tissue culture medium;
A temperature of 5 ° C. is used.

In certain embodiments of the methods described herein, the cells are eukaryotic cells. In another embodiment, the cells are mammalian cells. In other embodiments, the cells are L cell LM (TK-) (ATCC CCL 1.3), L cell LM (AT CC CCL 1.2), 293 (ATCC CRL 1573), Raji (
ATCC CCL 86), CV-1 (ATCC CCL 70), COS-1
(ATCC CRL 1650), COS-7 (ATCC CRL 1651)
, CHO-K1 (ATCC CCL 61), 3T3 (ATCC CCL 92)
), NIH / 3T3 (ATCC CRL 1658), HeLa (ATCC C
CL2), C1271 (ATCC CRL 1616), BS-C-1 (AT
CC CCL 26) or MRC-5 (ATCC CCL 171).

The assays described herein can be performed with cells that have been transiently or stably transfected with AOMF05 protein. Transfection is AO
By any method known in the art for introducing MF05 protein into a test cell. For example, transfections include calcium phosphate or calcium chloride mediated transfection, lipofection, infection with an AOMF05 protein-containing retroviral construct, and electroporation.

When measuring the binding of a candidate compound or agonist to AOMF05, such binding can be measured by using a labeled candidate compound or agonist. Candidate compounds or agonists can be any convenient label known in the art, eg, radioactive, fluorescent, enzymatic.

In certain embodiments of the methods described herein, the AOMF05 protein has the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4.

[0175] Variations of the methods described herein, instead of contacting a test cell with a candidate compound,
Membranes may be prepared from test cells and these membranes may be contacted with a candidate compound. Such variations using membranes instead of cells are known in the art and are described, for example, in Hess et al., 1992, Biochem. Biophys. Res. Comm.
184: 260-268.

Accordingly, the present invention provides a method for determining whether a candidate compound is capable of binding to AOMF05 protein, comprising: (a) transfecting a cell with an expression vector that directs the expression of AOMF05 protein in the cell; Preparing a test cell; (b) preparing a membrane containing AOMF05 protein from the test cell;
Contacting the ligand of the A.05 protein with a ligand of the AOMF05 protein in the membrane under conditions such that the ligand binds to the AOMF05 protein in the membrane; and (c) candidate membrane prepared from the test cells after or simultaneously with step (b). (D) measuring the amount of ligand binding to AOMF05 protein in the membrane in the presence and absence of the candidate compound; and (e) measuring the amount of ligand binding to AOMF05 protein in the membrane. Comparing in the presence and absence of the candidate compound, wherein the decrease in the amount of ligand bound to AOMF05 protein in the membrane in the presence of the candidate compound is an index by which the candidate compound can bind to AOMF05 protein. Provide a way.

The present invention provides a method for determining whether a candidate compound is capable of binding to AOMF05 protein, comprising: (a) transfecting a cell with an expression vector that directs expression of AOMF05 protein in the cell; (B) preparing a membrane containing AOMF05 protein from the test cells, and contacting the membrane prepared from the test cells with a candidate compound; and (c) reacting with AOMF05 protein in the membrane prepared from the test cells. Measuring the amount of binding of the candidate compound; and (e) determining the amount of binding of the candidate compound to AOMF05 protein in the membrane prepared from the test cells by comparing the amount of binding of the candidate compound to the membrane prepared from control cell cells not transfected with AOMF05 protein. Comparing to the amount of binding. If binding amount of a candidate compound to the AOMF05 proteins in the membrane is larger than the amount of binding of a candidate compound on membranes prepared from control cells cell candidate compound to provide a method for determining that may bind to AOMF05 protein.

Example 10 Use of AOMF05 Sequences for Gene Therapy For example, a nucleic acid of the invention that encodes a biologically active AOMF05 polypeptide preparation or a functional fragment thereof cannot synthesize active polypeptides or synthesize to normal levels. It can be used in gene therapy methods to treat patients, thereby conferring the effect provided by wild type and serving the purpose of treating and / or preventing one or more symptoms of one or more other diseases.

Vectors, such as viral vectors, have been used to introduce genes into different and diverse types of target cells. Typically, the vector is contacted with a target cell to cause transfection of a sufficient percentage of cells to achieve an effective therapeutic or prophylactic effect by expression of the desired polypeptide. The transfected nucleic acid can be permanently integrated into the genome of each target cell, providing a long lasting effect. Otherwise treatment must be repeated periodically.

A variety of vectors are known in the art, including viral and plasmid vectors. For example, US Pat. No. 5,252,479 and International Patent WO93 / 0
See 7282. In particular, retroviruses such as adenovirus, papovavirus such as SV40, vaccinia virus, herpes virus such as HSV and EBV, gibbon leukemia virus, Rous sarcoma virus, Venezuelan equine encephalitis virus, Moloney murine leukemia virus and murine breast tumor virus. Many viruses, such as viruses, have been used as gene transfer vectors. Many gene therapy protocols use murine neutralizing retroviruses.

[0181] Neutralizing viral vectors are produced in helper cell lines in which genes required for the production of infectious viral particles are expressed. Helper cell lines generally lack sequences recognized by the mechanism that packages the viral genome, producing nucleic acid-free virions. A viral vector comprising an intact packaging signal together with the gene or other sequence to be delivered (eg, a sequence encoding an AOMF05 polypeptide or a fragment thereof) is packaged in infectious virion particles in helper cells, and then The virion particles can be used for gene delivery.

Other known methods for introducing nucleic acids into cells include electroporation, calcium phosphate co-precipitation, and mechanical techniques such as microinjection, liposome-mediated transfer, direct DNA absorption, and receptor-mediated DNA transfer. . Liposomes entrap RNA, DNA and virions to be delivered to cells. Depending on factors such as pH, ionic strength and divalent cations present, the composition of the liposome can be adjusted depending on the targeting of particular cells or tissues. Liposomes may be phospholipids, lipids and steroids, and may alter the composition of each such component. Also, specific binding pairs such as antibodies or binding fragments thereof, proteins, sugars or glycolipids may be used to target liposomes.

The purpose of gene therapy using a nucleic acid encoding a polypeptide or an active portion thereof is to increase the amount of the expression product of the nucleic acid in cells where the wild-type polypeptide is absent or present at very low levels. That is. Such treatments may be therapeutic or prophylactic, and are particularly suitable for treatment of individuals in which the presence of a disease-associated AOMF05 allele has been found by screening or testing and thus has been shown to be predisposed to a disease.

Similar techniques can be used for antisense regulation of gene expression. For example,
It serves the purpose of targeting the antisense nucleic acid to cells in which the mutant form of the gene is expressed to suppress the production of the mutant gene product. Other methods for performing specific down-regulation of genes are known in the art, for example, the use of ribozymes designed to cleave specific nucleic acid sequences. Ribozymes are
Nucleic acid molecules that can specifically cleave single-stranded RNA, such as mRNA, with a predetermined sequence and manipulate their specificity, are actually RNA. Hammerhead ribozymes are preferred. This is because this ribozyme can recognize a base sequence of about 11-18 bases in length, and therefore has greater specificity than a tetrahymena-type ribozyme that recognizes a sequence of about 4 bases in length. However, the latter type of ribozyme is also useful in some situations as will be appreciated by those skilled in the art. References on the use of ribozymes include: Maskall et al., 1994, Cellular and Mol.
ecological Neurobiology 14 (5): 523; Hassel
Hoff, 1988, Nature 334: 585 and Cech, 1988,
J. Amer. Med. Assn. 260: 3030.

Example 11 Construction of a Polynucleotide Encoding the AOMF05 Receptor Protein Sequences 2 and 4 are shown as two examples of the full length amino acid sequence of the AOMF05 receptor protein. Sequences 1 and 3 show the innate human cDNA sequence containing the open reading frame encoding the amino acid sequence of AOMF05. Due to the degeneracy of the genetic code, the sequences in the open reading frames of SEQ ID NOS: 1 and 2 are only examples of the many nucleotide sequences that can code for the amino acid sequences of variants a and b of AOMF05. The average person skilled in the art is familiar with the genetic code and has to use standard techniques of molecular biology to obtain polynucleotides having alternative nucleotide sequences which encode the same amino acid sequence as shown in SEQ ID NO: 2 or SEQ ID NO: 4. Nucleotides could be made.

The alternative nucleotide sequence may be DNA, RNA, a mixture of DNA and RNA, or have alternative linkages between the nucleotides described herein.

[Brief description of the drawings]

FIG. 1A schematically shows the nucleotide sequence (SEQ ID NO: 1) of a cDNA polynucleotide encoding AOMF05 receptor variant a.

FIG. 1B schematically illustrates the nucleotide sequence (SEQ ID NO: 1) of a cDNA polynucleotide encoding AOMF05 receptor variant a.

FIG. 2 schematically shows the full-length amino acid sequence (sequence 2) of AOMF05 receptor protein variant a in one-letter code.

FIG. 3A schematically shows the nucleotide sequence of the polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 1) and the translation of the AOMF05 open reading frame (SEQ ID NO: 2).

FIG. 3B schematically shows the nucleotide sequence of the polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 1) and the translation of the AOMF05 open reading frame (SEQ ID NO: 2).

FIG. 3C schematically shows the nucleotide sequence of the polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 1) and the translation of the AOMF05 open reading frame (SEQ ID NO: 2).

FIG. 3D schematically shows the nucleotide sequence of the polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 1) and the translation of the AOMF05 open reading frame (SEQ ID NO: 2).

FIG. 3E schematically shows the nucleotide sequence of a polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 1) and translation of the AOMF05 open reading frame (SEQ ID NO: 2).

FIG. 3F schematically shows the nucleotide sequence of the polynucleotide encoding AOMF05 (nucleotide 2-3950 of SEQ ID NO: 1) and the translation of the AOMF05 open reading frame (SEQ ID NO: 2).

FIG. 4A schematically illustrates the nucleotide sequence (SEQ ID NO: 3) of a cDNA polynucleotide encoding variant b of the AOMF05 receptor.

FIG. 4B schematically illustrates the nucleotide sequence (SEQ ID NO: 3) of the cDNA polynucleotide encoding variant b of the AOMF05 receptor.

FIG. 5 schematically shows the full-length amino acid sequence (sequence 4) of mutant b of the AOMF05 receptor protein in one letter code.

FIG. 6A schematically shows the nucleotide sequence of the polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 3) and the translation of the AOMF05 open reading frame (SEQ ID NO: 4).

FIG. 6B schematically illustrates the nucleotide sequence of the polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 3) and the translation of the AOMF05 open reading frame (SEQ ID NO: 4).

FIG. 6C schematically illustrates the nucleotide sequence of the polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 3) and translation of the AOMF05 open reading frame (SEQ ID NO: 4).

FIG. 6D schematically illustrates the nucleotide sequence of a polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 3) and translation of the AOMF05 open reading frame (SEQ ID NO: 4).

FIG. 6E schematically illustrates the nucleotide sequence of a polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 3) and translation of the AOMF05 open reading frame (SEQ ID NO: 4).

FIG. 6F schematically shows the nucleotide sequence of a polynucleotide encoding AOMF05 (nucleotides 2-3950 of SEQ ID NO: 3) and translation of the AOMF05 open reading frame (SEQ ID NO: 4).

FIG. 7 shows nine predicted signal peptide cleavage sites of the AOMF05 protein. The nine sequences shown are amino acids 7-49, 55 of sequence 2, respectively, represented by one letter code.
7-599, 12-54, 5-47, 664-706, 634-675, 9-5
1,666-708 and 553-595. The predicted cleavage sites are mutants a and b
Is common to both.

FIG. 8A shows a multi-tissue northern blot analysis of AOMF05 receptor gene expression.

FIG. 8B shows a multi-tissue Northern blot analysis of AOMF05 receptor gene expression.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) G01N 33/15 G01N 33/50 Z 33/50 C12N 15/00 ZNAA New Jersey 07065, Lowway, East Lincoln Avenue 126 (72) Inventor McDonald, Terrence P. United States of America, New Jersey 07065, Lowway, East Lincoln Avenue 126 (72) Inventor O'Neill , Gary P. United States, New Jersey 07065; Lowway, East Lincoln Avenue 126 (72) Inventor Wan, Luipin United States, New Jersey 07065; -Way, East Lincoln Avenue Avenue 126 F-term (Reference) 2G045 AA29 AA34 AA35 BB05 BB14 BB20 BB29 CB01 CB17 CB21 DA13 DA36 FB02 FB05 FB08 4B024 AA01 AA11 BA80 CA04 GA11 4B064 AG20 CA19 CC24 A10A4A10A20 FA72 FA74

Claims (12)

[Claims] (1) a polynucleotide having the sequence represented by Sequence 1, (b) a polynucleotide complementary to the polynucleotide (a), and (c) a polynucleotide having the sequence represented by Sequence 3. (D) a polynucleotide complementary to the polynucleotide (c); (e) a polynucleotide representing a polymorphic form of the polynucleotide (a), (b), (c) or (d); (F) the polynucleotide (a), (b), (c), (d) or (e), comprising at least 20 consecutive nucleotides, wherein said 20 nucleotides are A
A polynucleotide that is highly specific for the OMF05 gene; and a purified and isolated polynucleotide selected from the group consisting of: 2. A purified and isolated polynucleotide having a nucleotide sequence that encodes a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4 and mutant sequences thereof. 3. The polynucleotide of claim 1, having a nucleotide sequence encoding a polypeptide having at least one amino acid sequence from about 20 to about 539 amino acids of SEQ ID NO: 2. 4. An expression vector for directing the expression of AOMF05 protein, wherein the vector comprises: (a) a polynucleotide encoding a polypeptide having the amino acid sequence of sequence 2, and (b) about 20 amino acids of sequence 2 (C) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 4; and (d) a polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 4. An expression vector, comprising a polynucleotide representing the polymorphic form of b) or (c), and a polynucleotide selected from the group consisting of: 5. A polynucleotide encoding a polypeptide having the amino acid sequence of sequence 2; and (b) encoding a polypeptide having at least one amino acid sequence from about 20 to about 539 amino acids of sequence 2. A polynucleotide, (c) a polynucleotide encoding a polypeptide having the amino acid sequence of sequence 4, (d) a polynucleotide representing a polymorphic form of the polynucleotide (a), (b) or (c); A host cell comprising an expression vector having a polynucleotide selected from the group consisting of: 6. (a) (i) a polynucleotide encoding a polypeptide having the amino acid sequence of sequence 2, and (ii) a polypeptide having at least one amino acid sequence from about 20 to about 539 amino acids of sequence 2. (Iii) a polynucleotide encoding a polypeptide having the amino acid sequence of sequence 4, and (iv) a polynucleotide representing a polymorphic form of the polynucleotide (i), (ii) or (iii). Introducing an expression vector having a polynucleotide selected from the group consisting of nucleotides into a suitable host cell; and (b) conducting the host of step (a) under conditions capable of expressing the AOMF05 protein from the expression vector. Culturing the cells; and expressing the AOMF05 protein in a recombinant host cell comprising How to let. 7. A polypeptide having the amino acid sequence of sequence 2; (b) a polypeptide having at least one amino acid sequence from about 20 to about 539 amino acids of sequence 2; A polypeptide having at least one amino acid sequence from about 20 amino acids to about the terminus; (d) a polypeptide having the amino acid sequence of Sequence 2; (e) a polypeptide (a), (b), (c) or A polypeptide representing the polymorphic form of (d); and a substantially purified AO having an amino acid sequence selected from the group consisting of:
MF05 protein. 8. A method for determining whether a candidate compound or molecule is an agonist of AOMF05 protein, comprising: (a) transfecting an expression vector that directs intracellular expression of AOMF05 protein into a suitable host cell. To prepare the test cells,
Binding the 05 protein to a second component that provides a detectable signal when the agonist is bound to the protein; and (b) providing the compound or compound under conditions sufficient to bind the cell to a candidate. Contacting with a molecule; and (c) determining whether the candidate is an agonist by detecting a signal generated by said second component. 9. A method for determining whether a candidate compound or molecule is an antagonist of AOMF05 protein, comprising: (a) transfecting an expression vector that directs intracellular expression of AOMF05 protein into a suitable host cell. To prepare the test cells,
Binding the protein to a second component that provides a detectable signal when the antagonist is bound to the protein; and (b) providing the compound or compound under conditions sufficient to bind the cell to a candidate. Contacting with a molecule; and (c) determining whether the candidate is an antagonist by detecting the signal generated by said second component. 10. A polynucleotide encoding a polypeptide having the amino acid sequence of sequence 2; (b) a polynucleotide encoding a polypeptide having the amino acid sequence of sequence 4; and (c) a polynucleotide (a). A) a polynucleotide representing the polymorphic form of (b) or (b); and a transgene having a polynucleotide selected from the group consisting of: 11. A method for determining whether a candidate compound can bind to AOMF05 protein, comprising: (a) transfecting an appropriate host cell with an expression vector that directs intracellular expression of AOMF05 protein. Preparing a test cell; (b) contacting the test cell with a candidate compound; (c) measuring the amount of the candidate compound bound to the AOMF05 protein; and (d) measuring the amount of AOMF05 protein in the test cell. The amount of bound candidate compound is determined by AO
Determining whether the candidate compound can bind to the AOMF05 protein by comparing to the amount of the candidate compound bound to control cells that have not been transfected with the MF05 protein. 12. The method of claim 1, further comprising the step of preparing a membrane containing AOMF05 protein from the test cells, wherein in step (b) the membrane of the test cells is contacted with a candidate compound. In step (c), the amount of the candidate compound bound to the AOMF05 protein in the membrane of the test cell is measured. In step (d), the amount of the candidate compound bound to the AOMF05 protein in the membrane of the test cell is determined by the AOMF05 protein. A method of determining whether a candidate compound can bind to AOMF05 protein by comparing to the amount of candidate compound bound to the membrane of untransfected control cells.