JP2001512142A - Method for enabling re-administration of AAV vectors via immunosuppression of the host - Google Patents

Abstract

  (57) [Summary] The present invention relates to a method for providing AAV-mediated gene therapy to a patient, comprising the step of administering to the patient a replication-defective adeno-associated virus particle that infects a patient's cells, wherein the particle is required by the patient. An immunosuppressive agent that suppresses a humoral immune response in a patient at about the time of the above-described administration steps. Also administered to the patient. The present invention also relates to a pharmaceutical composition comprising the adeno-associated virus described above and a humoral immunosuppressant in a pharmaceutically acceptable carrier. Examples of proteins expressed by the above vectors include erythropoietin, thrombopoietin, human growth factor, leptin, factor VIII, factor IX, factor Xa, and the like.

Description

DETAILED DESCRIPTION OF THE INVENTION

BACKGROUND A. Field of the Invention The present invention relates to methods for providing somatic gene therapy. In particular, the present invention
The present invention relates to a method for somatic gene therapy, particularly in humans, comprising the steps of administering an adeno-associated virus vector encoding a gene of interest and an immunosuppressant. The method is useful because it allows expression of the gene encoded by the AAV vector without inducing neutralization of the immune response.

B. Background of the Invention All viruses that have been proposed for gene therapy, including, for example, retroviruses, adenoviruses, herpes viruses, and adeno-associated viruses, include:
Expresses proteins recognized as foreign in their mammalian host. But,
Some viral vectors express more foreign proteins than others and are therefore more antigenic. For example, retroviral vectors are vectors based on integrated RNA and require the expression of both wild-type reverse transcriptase and integrase in order to obtain the highest expression of the recombinant gene. Adenovirus vectors are vectors based on non-integrated DNA. But it is
Obtaining expression of the recombinant gene still requires much expression of the protein. Thus, in patients previously exposed to the wild-type virus of the viral vector, an immune response is generated that destroys any cells infected by the viral vector. To avoid this problem, some viral vectors are prepared by modifying a wild-type virus that is selectively pathogenic for species other than its intended target. For example, wild-type Moloney mouse leukemia virus (MoML)
The envelope protein of V) (whose usual host is a mouse) has been modified to be amphotropic, and is therefore capable of infecting other non-mammalian species. Such modification of the viral envelope protein is extremely difficult. It is therefore desirable to provide alternative methods of gene therapy that do not require a genetic alteration of the specificity of the species-specific virus.

[0003] Viral vectors are integrated (ie, host cell DNA to be expressed).
Or non-integrated type). Integrating viral vectors offer the promise of long term gene expression. In contrast, non-integrated vectors provide for short-term gene expression. Accordingly, it is an object of the present invention to provide a method for somatic gene therapy for a patient, wherein the vector is integrated into the DNA of the patient's host cell to provide long-term somatic gene expression. I will provide a.

[0004] AAV vectors are non-pathogenic, single-stranded, linear DNA integration vectors, and are capable of infecting both dividing and non-dividing cells. The AAV genome, which can be exemplified by AAV-2, has two inverted terminal repeats (ITRs) that are 145 bp long
At the opposite end of the virus. Gerry et al., (1973) J. Mol. Mol. Bi
ol. 79: 207-225; Kozcot et al., (1973) PNAS USA.
70: 215-219; and Lusby et al., (1980) J. Am. Virol.
34: 402-409. Each repeat consists of two repeats adjacent to the large palindrome.
It can form a T-shaped hairpin structure consisting of two small palindromes. Two IT
The AAV coding region between R is divided into three regions: rep, lip,
And cap. The function of the rep region is to encode four nonstructural proteins that regulate AAV DNA replication and expression. The function of the cap region is to encode three structural proteins: the capsids VP1, VP2, and VP3. AAV preparations are stable and can be produced at high titers (>
10 ¹² particles / ml). For example, Flotte & Carter (1995) Gen
e Ther. 2,357-362 and Samulski, (1989) J. Am.
Virol. 63, 3822-3828. There are recent reports demonstrating long-term expression of transgenes after delivery of AAV vectors to lung, liver, muscle, heart, and brain. Flotte, (1993) Proc. Natl. Acad.
Sci. USA 90, 10613-10617; Koeberl, (1997)
) Proc. Natl. Acad. Sci. USA 94, 1426-1431
Fisher, (1997) Nat. Med. 2,306-312; Xiao
, (1996) J. Mol. Virol. 70, 8098-8108; Kaplit,
(1994) Nat. Genet. 8, 148-154; and Kaplit
, (1996) Ann. Thorac. Sur. 62, 1669-1676. Similarly, injection of the rAAV vector into skeletal muscle has been shown to lead to permanent high level expression of the transgene. Fisher, (1997) Nat. M
ed. 3, 306-312 and Xiao, (1996) J. Am. Virol. 70
, 8098-8108.

[0005] Unfortunately, however, a number of experiments indicate that after a single intramuscular injection of the rAAV vector, re-administration of the rAAV vector may result in a loss of the recombinant protein even if the vector encodes a different recombinant protein. No expression was demonstrated. AA
Gene delivery experiments performed with the V vector show that AAV proteins expressed intracellularly elicit a potent cell-mediated immune response that eliminates transduced cells. Even when the replication-defective AAV virion lacks all virally encoded genes, virions can enter cells and packaged DN.
It is encapsulated in the AAV capsid protein responsible for transport of A to the nucleus. Because the AAV virus is relatively ubiquitous and non-pathogenic, the majority of animal and human populations have been exposed to one or more of the seven serotypes of AAV and have developed an immune response against them. I have. This response is due to AAV of the same serotype as the immune strain.
Neutralizes any attempted gene therapy using the vector. Accordingly, it is an object of the present invention to administer AAV vectors to patients in need of somatic gene therapy and to develop a method wherein protein expression is not neutralized by the patient's immune system.

SUMMARY OF THE INVENTION Applicants have identified that a patient who has developed an immune response to one or more adeno-associated virus (AAV) can receive the rAAV vector particles before, during, or immediately after administration. It has been discovered that if the humoral arm of the patient's immune system is transiently immunosuppressed, it may still be the recipient of AAV vector-mediated gene therapy.
Thus, in one aspect, the invention relates to a method for obtaining in vivo expression of a therapeutic agent encoded by a gene contained in an AAV vector in a patient. The patient is suspected of having an immune response to AAV, and the method comprises providing a replication deficient recombinant AA having a gene encoding the therapeutic to a patient in need of the therapeutic.
Administering V particles (virions); and prior to administering the AAV vector,
During or immediately after administration, the patient's humoral immune response is transiently immunosuppressed to obtain expression of the therapeutic agent. In the above method, the therapeutic agent is a protein, polypeptide, antisense RNA or ribozyme. Preferably, the therapeutic agent is a protein or polypeptide.

As used herein, the phrase “temporarily immunosuppressed” or “transient immunosuppression” when compared to the immune response of a patient without immunosuppressive treatment, It is meant that the patient's humoral (antibody-producing) immune response is reduced. Transient immunosuppression of a patient's humoral immune response is achieved by administering to the patient a pharmaceutical composition comprising another art-recognized humoral immunosuppressive agent or a combination thereof. Preferably, the patient's immune system comprises an anti-CD-4 antibody, an anti-CD-40
By administering to a patient a pharmaceutical composition comprising an antibody that is an (antagonistic) antibody, anti-CD40L antibody, anti-B7-1 antibody, or anti-B7-2 antibody, transient immunosuppression is achieved.

Thus, in another aspect, the invention relates to a mammalian patient, preferably a human patient,
Provided is a method of delivering multiple doses of a rAAV virion encoding a therapeutic protein, comprising: (a) administering to the patient a therapeutically effective amount of the rAAV virion encoding the therapeutic protein. (B) prior to and immediately after administration of the rAAV virion, transiently immunosuppressing the patient's humoral immune system to obtain expression of the therapeutic protein; and at a later date, steps (a) and (b). ) Is repeated. Preferably, the patient's immune system is transiently immunosuppressed both before and after the first administration of the rAAV virion. The administration step of the present invention is performed using one of many conventional techniques known in the art for administering pharmaceuticals. Preferably, these techniques include intramuscular, intranasal, intraarterial, and subcutaneous administration.

[0009] In yet another aspect, the invention provides an effective amount of a rAAV virion encoding a therapeutic protein, preferably a human therapeutic protein, and transiently immunosuppresses a mammalian patient, preferably a human patient. Compositions comprising an effective amount of an immunosuppressive agent suitable for the combination in a pharmaceutically acceptable carrier.

[0010] In one embodiment, the pharmaceutical composition is in an aerosol form suitable for administration by inhalation. The solution can include about 10 ⁶ to about 10 ¹⁶ particles of the rAAV virion and a humoral immunosuppressant in a sterile solution of about 0.9% sodium chloride. The aerosol may be included in a sterile aerobic aerosol generator reservoir such that the aerosol of the solution is produced at a rate of about 8-12 liters / minute with compressed air at about 30-50 psi. In another embodiment, the agent can be in lyophilized form,
Reconstitution using 0.9% saline, D50 water, Ringer's lactic acid, etc. is required.

DETAILED DESCRIPTION The present invention has many aspects. In its broadest aspect, the invention relates to AA
A method for obtaining in vivo expression of a therapeutic agent encoded by a gene contained in a V vector in a patient, wherein the patient is suspected of having an immune response to AAV, the method comprising the steps of: (A) administering to the patient in need of a therapeutic agent a replication deficient recombinant AAV particle (virion) having a gene encoding the therapeutic agent; and (b) administering before, or before, administering the AAV vector. During or immediately after administration, transiently immunosuppressing the patient's humoral immune system to obtain expression of the protein.

In this embodiment, each patient is "suspected to have an immune response to AAV." This is because the ubiquitous nature of AAV seems to make most patients already have an immune response. Thus, rather than prior screening of each patient, which is expensive and slow, the vector and immunosuppressive agent (also referred to herein as "immunosuppressant") are treated. It is administered in combination to any patient in need of the agent.

[0013] The methods of the present invention are particularly useful where a patient in need of a therapeutic protein requires multiple or ongoing treatments over a period of years. Applicants' invention allows multiple administrations of the same replication deficient recombinant AAV particles having a gene encoding a therapeutic protein required by the patient to the same patient,
And provides for expression of the desired recombinant protein, even if the patient develops immunity to the vector particles' AAV. Accordingly, in this second aspect, the present invention provides a method for delivering multiple administrations of a rAAV virion encoding a therapeutic protein to a mammalian patient, preferably a human patient, comprising the steps of: Comprising: (a) administering to the patient a therapeutically effective amount of a rAAV virion encoding the therapeutic agent protein; Transiently immunosuppressing the humoral immune system to obtain expression of the therapeutic protein; and (c) repeating steps (a) and (b) at a later date. In an embodiment of the method described above (collectively, "methods"), the patient's immune system is transiently immunosuppressed both before and after the first administration of the rAAV virion.

[0014] Therapeutic agents expressed by the methods of the present invention include proteins, polypeptides, antisense RNAs, and ribozymes. Preferably, the therapeutic agent is a protein or polypeptide. Because AAV has a wide cell and host range, the methods of the present invention can transform cells of any patient and express therein one of the therapeutic agents described above. The present invention is particularly useful for those patients requiring or benefiting from a therapeutic agent based on continuous or bolus administration.

To determine which part of the host's immune response is responsible for the inability to re-administer the rAAV vector, as described in Example 9, Class I, Class II,
Re-administration experiments were performed in mice lacking CD40 ligand. The results of Example 9 demonstrate that the humoral division of the immune system plays a key role in initiating an immune response against AAV transfected cells, and that the Indicated that it caused destruction. By transiently immunosuppressing the humoral arm of the host's immune system upon the first administration of the AAV vector, it is possible to readminister the rAAV virions as described in Example 9. Factors used to achieve transient humoral immunosuppression of the patient's immune system include anti-B7-1 or anti-B7-2 antibodies, anti-CD40 (antagonistic) antibodies or CD40 ligand antibodies, or These combinations are included. Methods for making and using many of these antibodies, and antigen-binding fragments thereof,
US patent application Ser. No. 08 / 015,147 (now patented); US Pat. No. 5,397
U.S. Patent No. 5,677,165; U.S. Patent No. 5,747,034.
No. 08 / 469,015, U.S. Ser. No. 08 / 463,893,
And US application Ser. No. 08 / 606,293, all of which are expressly incorporated herein by reference. Other agents useful for transient immunosuppression of a patient's humoral immune response include cyclophosphamide and deoxyspergulin. Smith, Gene Thera
py 3 (1996) 496-502. Still other drugs, which are useful for transient immunosuppression of a patient's humoral immune response, include anti-CD3 (
OKT3) antibody, CTLA4Ig (Bristol Myers) and anti-CD
4 antibodies, as well as FK506. Preferably, the patient's humoral immune response is such that an anti-CD4 antibody, an anti-CD40 (antagonistic) antibody, an anti-CD40L antibody, an anti-B7-1
Administration of a pharmaceutical composition comprising the antibody or anti-B7-2 antibody, or a combination thereof, results in transient immunosuppression.

[0016] The replication defective AAV vectors and virions utilized in the methods and pharmaceutical compositions of the present invention are prepared using conventional methods of virology, molecular biology, microbiology, and recombinant DNA technology. . Such techniques are well known and are fully explained in the literature, for example, Sambrook, Molecular Cloning.
: A Laboratory Manual (current version); DNA Clonin
g: A Practical Approach (D. Glover, ed.); O
lignocleide Synthesis (current edition, edited by N. Gait); Nucleic Acid Hybridization (current edition, B.H.)
ames and S.M. Higgins ed.); Transcription and
Translation (current version, B. Hames and S. Higgins)
Ed.); CRC Handbook of Parvoviruses (P. Ti
Jessen); Fundamental Virology 2nd Edition (BN
. Fields and D.A. M. Knipe)); Current Protocol
ols in Human Genetics, Vol. 1 (N. Dracopoli
Ed.) These publications and all other publications referred to throughout this specification are expressly incorporated herein by reference.

Gene transfer, gene therapy, or gene delivery refers to a method, technique, or system for accurately inserting heterologous or foreign DNA, or DNA that is not normally expressed, into a host cell. The resulting insertion may be by integration of the transferred genetic material into its host cell genomic DNA, by extrachromosomal replication and expression of the transferred replicon, or by a non-integrated mode.

Vector refers to any genetic element that can replicate when combined with the appropriate regulatory elements, and any DNA or RNA sequence that can move between cells. Examples include plasmids, phages, transposons,
Cosmids, chromosomes, viruses, and virions are included, and cloning and expression vehicles and viral vectors are included.

The AAV vector and replication-defective AAV virion utilized herein encode a therapeutic protein operably positioned between a pair of adeno-associated virus inverted terminal repeats ("AAV ITRs"). Contains DNA. The AAV ITR is a region known in the art found at each end of the AAV genome that functions in cis with each other as recognition signals for DNA replication and for packaging this AAV vector into an AAV coat. For the various AAV serotypes (ie, AAV-1 to AAV-7), the nucleotide sequence of the AAV ITR region is known in the art and varies in size with the serotype. Typically, this AAV ITR ranges in size from about 125 to 145 bp. For example, Kotin, Human Gene Therapy 5 (1994) 6
93-801 and Berns "Parvoviridae and theei
r Replication "Fundamental Virology, 2nd edition (ed. by BN Fields and DM Knipe).
As used herein, AA of Applicants' recombinant replication-defective retrovirions
The V ITR need not be identical to the nucleotide sequence of the native, ie, wild-type sequence, but can be modified by nucleotide insertions, deletions, or substitutions. Furthermore, as long as the two AAV ITRs allow the integration of the heterologous sequence of interest into the recipient cell genome when the AAV rep gene product is present in the cell, these two may be of any AAV serotype. For example, AAV-1, AAV-2, A
It can be derived from AV-3, AAV-4, AAV-5, and AAV-7, and need not be identical or derived from this same serotype.

The AAV rep coding region is an art-recognized region of the AAV genome that encodes a protein essential for replication of the viral genome during latent infection and insertion of the viral genome into the host genome. The rep coding region contains at least four genes encoding two long forms of rep (rep78 and rep68) and two short forms of rep (rep52 and rep40). More specifically, for example, Muzyczka, Current
Topics in Microbiol. 158 (1992) 97-129 and Kotin, Human Gene Therapy 5 (1994) 79.
See 3-801. The rep coding region can be from any AAV serotype or functional homolog such as the human herpesvirus 6 rep gene. This region need not include all of the native sequence, but as long as the sequence present is provided for sufficient integration when the appropriate recipient cell is expressed.
It can be modified by nucleotide insertions, deletions or substitutions. Preferably, AAV vectors and virions utilized in the present invention lack one or more of this rep protein to render it replication-defective. More preferably, AAV vectors of the invention lack all four rep proteins.

The AAVcap coding region contains a capsid or coat protein, VP1
, VP2, and VP3, which package the viral genome, are art-known regions of the AAV genome. More specifically, for example, Muzyczka, Current Topics in Microbio
l. 158 (1992) 97-129 and Kotin, Human Gene.
See Therapy 5 (1994) 793-801. The cap coding region may be from any AAV serotype or functional homolog. This ca
The p coding region, when the sequence present is expressed in a suitable recipient cell,
Modifications may be made by insertion, deletion, or substitution of nucleotides as long as they provide sufficient packaging. This cap coding region is preferably not included in the AAV vectors and replication deficient AAV virions used in the present invention, although the ITR
And need to be included in a helper vector that is expressed in packaging cells that recognize and package the genes located between them.

Thus, as used herein, the term “AAV vector” refers to sequences required for replication and packaging at least in cis, eg, heterologous (ie, non-A
AV) means a vector derived from an adeno-associated virus serotype that contains a pair of functional ITRs flanked by nucleotide sequences. Using this criterion, any AAV vector of any serotype can be used in the methods of the invention. Examples of vectors for use in the present invention are Srivastava, AAV-2-based vectors disclosed in PCT International Publication No. WO 93/09239, or simply one or more operably located therebetween. A pair of AAV-7 having a gene
ITR.

The AAV ITR used in the vectors and virions of the present invention can be a natural (wild-type) AAV ITR, or they can be modified. If the ITRs are modified, they are preferably modified with their D sequence. This AAV
The natural D sequence of the ITR is the sequence of 20 consecutive nucleotides in each AAV ITR that is not involved in HP formation (ie, one sequence at each end). The D sequence of the ITR is such that the nucleotides retain 5-18 natural nucleotides, preferably 10-18 natural nucleotides, most preferably 10 natural nucleotides, and the remaining nucleotides of the D sequence are deleted or non- Natural (
That is, it is modified by nucleotide substitution so that it is replaced by a foreign) nucleotide. One preferred sequence of the five natural nucleotides retained is 5′C
TCCA3 '. The foreign or non-naturally occurring substituted nucleotide has the natural D
It can be any nucleotide other than the nucleotide found at the same position in the sequence. For example, a suitable replacement nucleotide for the natural D sequence nucleotide C is
A, T and G; suitable replacement nucleotides for natural D sequence nucleotide A are T, G and C. Construction of four such AAV vectors
No. 08 / 921,467, filed Sep. 2, 1997. Other exemplary vectors that can be used are pWP-19 and pWN-1, both of which are Nahreini, Gene 124 (1993) 257-6.
2 is disclosed. Other examples of such AAV vectors are described in Samulski, J.
. Virol. 61 (1987) 3096.

[0024] Another suitable AAV vector is a double DITR vector. Double D IT
Methods for making the R vector are disclosed in U.S. Patent No. 5,478,745. Still other suitable AAV vectors are described in US Pat. No. 4,797,368 (C
arter) and US Pat. No. 5,139,941 (Muzyczka), US Pat. No. 5,474,935 (Chartejee) and PCT International Patent Publication WO 94/28157 (Kotin). Yet a further example of an AAV vector that can be used in the methods of the invention is SSV9AF
ABTKneo, which contains the α-fetoprotein (AFP) enhancer and the albumin promoter, and directs the expression of the herpes simplex thymidine kinase (TK) gene mainly in the liver. Its structure and method of construction are described in Su,
Human Gene Therapy 7 (1996) 463-70.

This replication deficient AAV vector comprises the replication deficient AAV vector used in the method of the invention.
Packaged in an empty AAV capsid to produce the AV virion helper virus. This replication-defective AAV vector (which typically comprises a pair of ITRs)
A helper construct having an AAV-derived coding sequence that acts in trans to allow AAV replication, and including the AAV rep and cap sequences, for packaging one or more genes in between) Or use a helper virus. This helper virus has an AAV coding sequence,
It lacks the AV ITR and is therefore not packaged in the resulting capsid. The helper virus then uses the AAVr that has been deleted in the AAV vector.
Provides for transient expression of the ep and cap genes. For further details, including exemplary AAV helper constructs, see, eg, Samulski, J. et al. Virol
. 63 (1989) 3822-28; McCarty, J. Mol. Virol 65 (
(1991) 2936-45 and U.S. Patent No. 5,139,941. One such AAV helper construct includes pKS rep / cap,
It contains the genes encoding AAV-2 rep and cap polypeptide sequences. Further examples of helper viruses, constructs and functions that can be used are plasmids pAAV / Ad and pIM29 + 45 (Samulski, J. Vi.
rol. 63 (1989) 3822-28 and McCarthy, J. Mol. Vir
ol 65 (1991) 2936-45) and US Patent No. 5,622,85.
No. 6 disclosed.

Auxiliary function and auxiliary function vectors are non-AAV-derived functions and vectors that contain sequences encoding functions that the AAV depends on for its replication. Such ancillary functions may be derived from or obtained from any known helper virus (eg, adenovirus, herpes virus (except for herpes simplex virus type 1) and vaccinia virus), and include gene transcription, DNA replication,
Contains parts and / or sequences involved in the synthesis of the cap expression product and activation of the capsid assembly. For example, Carter, "Adeno-Associ
atted Virus Helper Functions "CRC Hand
book of Parvoviruses, Vol. 1 (1990) (P. Tij
ssen); Muzyczka, Current Topics in Mi
crobiol. 158 (1992) 97-129; Janik, Proc. N
atl. Acad Sci 78 (1981) 1925-29; Young, P.
log. Med Virol. 25 (1979) 1213 and Schleho
fer, Virology 152 (1986) 110-17.

[0027] The heterologous nucleotide sequence inserted into the replication-defective AAV vectors and virions of the invention encodes one or more therapeutic agents, including therapeutic proteins, polypeptides, antisense RNAs or ribozymes, or combinations thereof. Typically, the vector or virion comprises one or two therapeutic agents, natural or non-natural, but having the desired biological or therapeutic effect on the recipient cells.

As disclosed above, the heterologous nucleotide sequence introduced into the replication-defective AAV vectors and virions of the present invention includes a gene encoding a therapeutic protein or polypeptide, preferably a human protein or polypeptide. Examples of therapeutic proteins and polypeptides suitable for expression in the methods of the invention include LDL
Receptor, factor VIII, factor IX, phenylalanine hydroxylase, ornithine transcarbamylase, or α1-antitrypsin; cytokines (eg, interleukin (IL) -1, IL-2, IL-3, IL-
4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-
11, IL-12, IL-13, IL-14 and IL-15, α-interferon, β-interferon, γ-interferon, tumor necrosis factor CD3
, ICAM-1, LFA-1 or LFA-3), chemokines (RANTES)
1α or MIP-1β (Cocci, Science 70 (1996) 18
11-15)); colony stimulating factors (eg, G-CSF, GM-
CSF and M-CSF); growth factors (eg, IGF-1 and IGF-2)
A human hormone (eg, growth hormone, insulin, calcitonin, prolactin, vesicle stimulating hormone, luteinizing hormone, chorionic gonadotropin, or thyroid stimulating hormone); any one hepatitis gene; thrombopoietin, erythropoietin, or leptin or a combination thereof including. The nucleotide coding sequences for these proteins and polypeptides are already known in the art. Additional sequences that can be expressed in the methods and compositions of the present invention include Protein S and Gas6, thrombin, coagulation factor Xa, acidic fibroblast growth factor (FGF-
1), basic FGF (FGF-2), keratinocyte growth factor (KGF), TG
F, platelet derived growth factor (PDGF), epidermal growth factor (EGF), hepatocyte growth factor (HGF) and HGF activator, PSA, nerve cell growth factor (NCFG)
Glial cell-derived nerve growth factor (GDNF), vascular endothelial growth factor (VEGF),
Arg-Vasopressin, thyroid hormone asoxymethane
n), triodothyronine, LIF, amphiregulin, soluble thrombomodulin, stem cell factor, osteogenic protein 1, bone morphogenetic protein, MFG, MGSA, heregulin, and melanotropin. Preferred proteins include erythropoietin, thrombopoietin (G-CSF), VIII
These include, but are not limited to, factor, factor IX, factor Xa, human growth hormone, leptin, and IL-2, and their DNA sequences (particularly human DNA sequences) are all known in the art. In vivo expression of erythropoietin ("Epo") and leptin from two representative proteins, rAAV-Epo and rAAV leptin, using the methods of the invention is disclosed in the Examples herein. Is done.

The antisense sequences expressible by the replication-defective AAV vectors and virions of the present invention are sufficiently complementary to the target sequence in the sequence that binds to the target sequence to allow for overproduction, deletion, or other RNA sequences that can prevent or limit the expression of undesired molecules. For example, the target sequence can be part of an mRNA encoding a protein, and the antisense RNA
Binds NA and blocks translation. The target sequence may be part of a gene essential for transcription, and the antisense RNA binds to the gene segment and blocks or restricts transcription. For example, the group C adenoviruses Ad2 and Ad5 bind to class 1 MHC molecules in the endoplasmic reticulum of the cell and prevent the terminal glycosylation and translation of this molecule to the cell surface by a 19 kDa glycoprotein encoded by the E3 region of the virus. (Gp19). Prior to liver transplantation, the liver cells are converted to the gp19
Gp19 encoding A inhibits surface expression of class 1 MHC transplantation antigen upon expression of
It can be infected with an AV vector or virion. These donor cells can be transplanted with low-risk graft rejection and may require minimal immunosuppressive regimens for this patient. It may also allow a donor-recipient condition to exist with few complications.

In the methods of the present invention, the ribozymes expressed by the replication-defective AAV vector and virions are useful in treating various diseases and conditions. Ribozymes are RNA polynucleotides that can catalyze RNA cleavage at specific sequences and are therefore useful for attacking specific mRNA molecules. For example, in chronic myeloid leukemia, a "Philadelphia chromosomal translocation" causes expression of the bcr-abl fusion protein and aberrant function of the abl oncoprotein. Because the fusion mRNA occurs only in cells that have undergone this chromosomal translocation, and because the fusion transcript has only two possible sequences at the splice junction, two bc
A ribozyme specific to any of the r-abl fusion mRNA splice junctions
It may inhibit the expression of this oncoprotein. Exemplary ribozymes include ribozymes for hepatitis A, B, and C. Christofferse
n and Marr, J. et al. Med Chem 38 (1995) 2023-37 and Baarporome, J. et al. Hepatol 22 (1995) 57-64.
checking ... See US Provisional Patent Application No. 60 / 025,616, filed September 6, 1996, and incorporated herein by reference.

In another embodiment of the present invention, the protein or polypeptide encoded by the replication defective AAV vector and the gene inserted into the virion of the present invention is derived from a virulence factor that can be used to immunize this patient Of one or more antigens. In this embodiment, the rAAV vector or virion is administered according to the methods of the invention, but is filed on June 12, 1998, and incorporated by reference herein in US patent application Ser. No. 09/096. , 966, used as a vaccine. Preferred antigens are HCV antigens (eg, HCV
NS3, NS4, E1, E2, and / or E2a). H. Pylor
Also preferred are i antigen VacA (cytotoxin), heat shock proteins, CagA (cai antigen) and urease B. Specific examples of other antigens useful in the present invention include HSV (herpes simplex virus), gD, gB and other glycoproteins, H
IVgp120, p24 and other proteins, CMV (cytomegalovirus) gB or gH glycoprotein, hepatitis D virus (HDV) Δ antigen, hepatitis A virus (HAV) antigen, EBV (Epstein Barr virus), MM
R and VZV (water scar-herpesvirus) antigens, influenza antigens, rabies antigens and B. pertussis, Neisseria meningitides (A
, B, C, Y135). The nucleotide sequences encoding these antigens or antigen-active fragments thereof are well known to those skilled in the art.

As used herein, the term “active fragment” refers to a polypeptide comprising less than full-length sequence that retains sufficient biological activity to be used in the methods of the invention. As used herein, the term "analog" refers to a truncated form of a mature protein or polypeptide, a splice variant, an amino acid substitution, having one or more of the natural biological activities of the full-length protein or polypeptide. A mutein, allele, or derivative having a deletion or addition is meant. Thus, whether derived from human or non-human sources, is identical or at least 60%, preferably 70%, more preferably 80%, to the amino acid sequence of the mature protein.
And polypeptides containing most preferably 90% amino acid sequence homology are included within this definition.

In addition to the AAV ITR and the nucleotide sequences described above, the replication-defective AAV vectors and virions used in the methods and compositions also include control sequences (eg, promoters and polyadenylation sites), selectable markers, reporter genes. , Enhancers, and other regulatory elements that allow transcription induction and / or selection. Insertion of these sequences and sites is performed using conventional techniques well known in the art.

To generate the replication-defective AAV virions of the invention, the AAV helper construct complements the AAV vector-deficient AAV functions (particularly rep and cap functions) that are necessary for the generation of AAV virions. Used for Suitable helper constructs with complementary functions are well known in the art. The AAV vector, helper construct, and adenoplasmid accessory (helper) construct can be transferred to host cells either simultaneously or sequentially using any transfection technique well known in the art, for example, by calcium phosphate co-precipitation. be introduced. Culture conditions include incubation in the range of 33-39 ° C, preferably at 37 ° C, for about 48-120 hours. The cells are collected and lysates are generated by sonication using three freeze / thaw cycles. The lysate is then centrifuged to remove cell debris and the rAAV virion is purified by cesium chloride equilibrium gradient centrifugation. Any remaining adenovirus particles can be inactivated by heating the purified rAAV preparation to at least 56 ° C for 20-30 minutes. Alternatively, the rAAV virion was obtained from Tamaose, Human Gene Therap.
y, 7 (1996) 507-13, and can be purified by cellulose sulfonate column chromatography.

The AAV virions of the present invention may be used for the treatment of diseases and / or conditions where systemic administration of a therapeutic substance, eg, a secreted protein, is desired, or for preventing infection by an organism whose antigen is incorporated into the AAV vector. Used in pharmaceutical compositions. A pharmaceutically acceptable carrier, such as a sterile non-immunogenic solution (eg, 0.9% NaCl
, D50 water, Ringer's lactate, or phosphate buffered saline), or a pharmaceutical composition comprising an effective amount of an AAV virion of the invention in admixture with an adjuvant / antigen presentation system (eg, alum). Other adjuvant / antigen presentation systems, such as MF59
(Chiron Crop.), QS-21 (Cambridge Biote)
ch Corp. ), 3-DMPL (3-deacyl-monophosphoryl lipid A)
(RibiImmnochem Research Inc.), clinical grade incomplete Freund's adjuvant (IFA), fusogenic
Liposomes, water-soluble polymers, or Iscoms (immunostimulatory complexes) can also be used. PCT International Patent Publication WO 9 published June 29, 1995
As described in 5/17211 (Biocine application number PCT / IB95 / 00013), mucosal adjuvants for the preparation of intranasal formulations are preferably used.

[0036] In another aspect, the present invention relates to a method of treating a therapeutic agent, preferably a therapeutically effective amount of a replication-defective AAV virion having a gene encoding a protein, in combination with an effective amount of a humoral immunosuppressant, and And a pharmaceutical composition contained in a carrier that is acceptable.

The pharmaceutical composition comprising the vectors and virions of the present methods is administered using conventional techniques known in the art for administering any medicament. Preferably, the pharmaceutical compositions used in the present invention are administered intranasally, intramuscularly, subcutaneously, intravenously or intraarterially. Formulations and modes of administration are discussed in more detail below.

Modes of Administering Formulations and AAV Vectors A. Intranasal Administration The nasal cavity provides an important route of administration for the recombinant AAV virions of the present invention. The human nasal cavity has a total surface area of about 150 cm ² and is covered by a highly vascularized mucus layer. Respiratory epithelium, consisting of columnar cells, goblet cells, and pilus cubic cells line most of the nasal cavity. Chien, Crit. Rev .. Th
See erap Drug Car sys 4 (1987) 67-194. The subepithelium contains a dense network of blood vessels and venous blood from the nose enters the systemic circulation directly, avoiding first-pass metabolism in the liver. By avoiding first pass metabolism, delivery to the upper region of the nasal cavity can result in slower clearance and increased bioavailability. The absence of pili in this area is an important factor in increasing the efficiency of nasal spray over drops. Viscosity molding agent (
The addition of (eg, methylcellulose) can alter the pattern of deposition and clearance of intranasal applications. In addition, bioadhesives can be used as a means of extending residence time in the nasal cavity. Various formulations, including sprays, drops and disperses, have been studied with or without the addition of absorption enhancers. For example, Wear
y, Crit Rev in Therap Drug Car Sys 8 (
(1991) 331-94.

It is advantageous to administer rAAV via the intranasal route. Intranasal administration is easy and convenient, economical, safe (overdose is treatable in most cases), and does not require medical personnel. The nasal route has been shown to be effective for the administration of many molecules due to the extensive capillary network located beneath the nasal mucosa. This facilitates effective systemic absorption, and when the drug is administered with an absorption enhancer, absorption occurs rapidly with high bioavailability (Gizurwaron, Acta Pharm 2 (1990) 105
checking). However, if the adenovirus vector is administered intranasally,
Cell, body fluid, and mucosal CTL responses occur. In addition, it is also advantageous that rAAV can be re-administered via the intranasal route.

It is within the skill of the art to prepare such intranasal solutions with due regard to such considerations as pH, isotonicity, and stability. Exemplary formulations of AAV vectors containing lactose, trehalose or mannitol for intramuscular or subcutaneous administration can be prepared by combining 1 part 2 × formulation buffer with 1 part purified rAAV. Lactose buffer and trehalose buffer were 25 mM trimethamine, 70 mM NaCl, 2 mg / ml arginine, 10 mg / ml, respectively.
Human serum albumin (HSA) and 100 mg / ml lactose or 100
Any of the mg / ml trehalose is included at a pH of 7.4 in a final volume of 100 ml. The mannitol buffer was 25 mM trimethamine, 35 mM NaCl,
mg / ml arginine, 10 mg / ml HSA and 80 mg / ml mannitol are contained at a pH of 7.4 in a final volume of 100 ml.

Dosage regimens may vary with the physician's knowledge of altering drug effects such as physician conditions, weight, gender, diet, severity of the condition, time of administration and other clinical factors. Is determined by considering the following factors. Exemplary dosage ranges are:
It comprises between 10 ^{3 and} 10 ¹⁴ particles, preferably between 10 ^{6 and} 10 ¹⁶ particles, more preferably between 10 ^{8 and} 10 ¹⁴ particles, most preferably between 10 ^{10 and} 10 ¹² particles.

There are several types of drug delivery devices for the nasal cavity (Chein, Cr
it. Rev .. Therap. Drug Carr. Sys. 4 (1987) 6
7). These systems include nasal sprays, nasal drops, saturated pledgets, aerosol sprays and inhalers. Meter-dose nebulizers
A predetermined volume of the formulation may be delivered to the nasal cavity. One such nebulizer is Ultr
event, which is available from Mallinckrodt.

The desired formulation of the rAAV virion is placed in the reservoir of an Ultravent pulmonary aerosol generator. This generator has a capacity of about 30 to 50 psi, preferably 40 psi.
Driven with compressed air at psi to produce an aerosol at 10 liters / minute (at 40 psi). With one-way valve, nose clip and mouthpiece,
The system is closed and all gases are drawn in or out through the filter.

B. Intramuscular Administration Prior to intramuscular administration of a replication-defective rAAV virion, muscle tissue can be injected with a cell growth agent. See U.S. Patent No. 5,593,972. Preferably, the cell growth agent is bupivacaine. Bupivacaine can be injected up to about 24 hours before the injection of the rAAV virion. About 50 μl to about 2 ml of 0.5% bupivacaine HCl and 0.1% methylparaben in isotonic NaCl are used for this rAAV.
The virions can be administered at the site to be administered. Cell growth agents can be included in formulations with rAAV virions. Preferably, 50 μl to about 1500 μl, more preferably about 1 ml of the agent may be included.

C. Subcutaneous Administration Any of the formulations described above are administered subcutaneously using standard techniques known to those of skill in the art. For example, a pharmaceutical composition comprising a therapeutically effective amount of a replication-defective AAV virion of the invention can be used alone or in combination with a humoral immunosuppressant and in a pharmaceutically acceptable liquid carrier (eg, 0.9% sterile physiological saline). (Saline) in a sterile syringe fitted with a 22 gauge needle and injected subcutaneously into the forearm of the patient in need of treatment. If necessary, this administration can be continued with one or more doses of humoral immunosuppressant using the manufacturer's recommendations as a guideline with due consideration of age, health, gender and patient size. Is administered.

D. Arterial Administration Using the same liquid pharmaceutical composition described above, a dose of the replication-defective AAV vector or virion is administered to the patient via the artery. Intra-arterial administration is performed using standard techniques known in the art, including the use of catheters. This can be penetrated through arteries to accumulate dose at the preferred tissue site. The use of such catheter technology has been widely used in cardiac visualization and is readily available to those skilled in the art. Replication-defective AAV
A specific example of administering a virion to a patient's renal artery is described in Example 10 herein.
Is disclosed.

In Examples 1-4, we used mouse leptin cD
An rAAV vector with NA was generated and demonstrated the ability of this vector to express leptin in vitro or in vivo. Leptin protein is a satiety factor responsible for controlling food intake in mammals. Ob / ob mice lack functional leptin; continuous delivery of recombinant leptin protein corrects the deficiency and leads to weight loss. Example 1 details the construction of a rAAV leptin construct. Example 2 describes the preparation and titration of rAAV leptin particles. Example 3 details in vitro analysis of rAAV leptin. And Example 4
Discloses in vivo administration of this construct in mice. We have shown that rAAV vectors with leptin in ob / ob mice lacking a functional leptin gene, long-term correction (> 80 days) of all metabolic disorders (including obesity and diabetes) tested by intramuscular injection Demonstrated to lead.

It is also interesting to note that the weight loss in treated animals is found to be much more gradual than in bolus or recombinant protein administered experiments. This reflects the kinetics of gene expression by the rAAV vector. Marker gene expression from rAAV vectors injected into mouse muscle gradually increases over 4-6 weeks before stabilizing (unpublished data). In contrast, adenovirus gene delivery results in a rapid onset of protein expression, which disappears within two weeks. This is probably due to immunity to adenovirus proteins. Muzzin, Proc. Natl. Acad. Sc
i. USA 93: 14804-14808.

The present invention is further exemplified by the administration of a heterologous sequence encoding monkey erythropoietin (Epo) to a mammal. Epo is produced in the kidney of adult mammals and is found in erythrocytes (red blood cells; red blood cells).
cell)) is an important hormone involved in regulating differentiation and maintaining physiological levels of circulating red blood cells. Clinically, Epo is a treatment option for anemia associated with chronic renal failure or for the treatment of thalassemia. The biological effect of Epo gene expression is monitored by determining hematocrit levels,
The circulating concentrations of the hormone are then measured by standard immunoassays or ELISA.

Example 1 rAAV Leptin Vector Construct pKm201CMV is an AAV cloning vector, wherein the expression cassette consists of the CMV immediate early enhancer, promoter and intron and bovine growth hormone (BGH) polyadenylation site, -2 adjacent to the inverted terminal (ITR) sequence. pKm201CMV was derived from pKm201. pKm201 is a pEMBL-AAV-ITR ampicillin resistance gene (Srivastava, (1989) Proc. Natl. Acad. Sci.
. USA 86, 8078-8082) is a modified AAV vector plasmid in which the gene for kanamycin resistance has been replaced. pCMV6c
(Chapman (1991) Nucleic Acids Res. 19, 1
93-198), an expression cassette from pCMVlink which is a derivative of
The GBH poly A site has been replaced with the SV40 terminator) with pKm20
Insertion between one ITR to generate pKm201 CMV. In order to construct the AAV leptin expression vector pc @ CMVAAV-m-leptin, mouse leptin cDNA (Giese, (1996) Molecular Medici) was used.
ne2, 50-58) was ligated into pKm20
1 Cloned into the XbaI-BamHI site of CMV. In addition to the CMV immediate early promoter / enhancer and intron, this AAV vector
Post-transcriptional regulatory element (PRE) from hepatitis B. PRE (Huang, Mol. Cell. Bio. 15, 3864-3) that increases the efficiency of mRNA transport.
869) to increase the size of the vector genome for more efficient packaging. A 579 bp fragment of the post-transcriptional regulatory element (PRE) region of hepatitis B (HBV) (Huang and Yen, (199)
5) Mol. Cell. Biol. 15: 3864-3869) was amplified using the following primer set: 5 ′ ACATACGCGTGCTTGCGGTGGAACCTTTG3 ′ (SEQ ID NO: 1), and 5′TTGTTGGCGCGCCAGCTTATCGATTTCGAACCCG
3 '(SEQ ID NO: 2). The resulting fragment was digested with AscI and MluI and inserted at the MluI site between the leptin coding region and the GH polyA site. The coding region for mouse leptin was included in this construct to give a 3.4 kb packageable vector genome. This vector plasmid was packaged using standard methods and a purified stock of 1.25 × 10 ¹² particles / ml was obtained.

The AAV helper plasmid, pKSrep / cap, which encodes the rep and cap proteins, is transferred to the ATR-2 genome without ATR (AAV
-2 nucleotides 192-4493) to pBluescript II KS +
(Stratagene, La Jolla, CA).

Example 2 Preparation and Titering of Recombinant AAV Leptin Particles rAAV vectors were produced by a modified transient plasmid transfection protocol. Zhou, (1994) J. Mol. Exp. Med. 179
1867-1875. Briefly, human fetal kidney 293 cells were
Propagated to 5% dish to 60% confluence and co-transfected with 12.5 μg helper plasmid pKSrep / cap and 12.5 μg vector plasmid pCMVAAV-m-leptin or pCMVAAV-lacZ using calcium phosphate coprecipitation. Eight hours later, the transfection medium was changed to a multiplicity of infection (MOI) of 2 with adenovirus type 5 d1312.
And 10% (calf serum) FBS. 72 hours after infection, cells were harvested in HEPES buffer (2.5 ml per dish) and lysed by three cycles of freeze-thawing. Cell lysates were grown at 12,000 × g for 2 hours.
Cell debris was removed by centrifugation for 0 minutes. The packaged rAAV virus was purified through two cesium chloride equilibrium density gradients to remove any contaminating proteins and heated to 56 ° C. for 45 minutes to inactivate residual adenovirus particles. To estimate the total number of vector particles,
The DNAs treated with NaseI and encapsidated were extracted with phenol chloroform and ethanol precipitated. Released DNA was compared to known standards by dot blot analysis.

Example 3 In Vitro Analysis of Recombinant AAV Leptin (rAAV-leptin) 10 ⁹ or 10 ¹⁰ rAAV-leptin particles were diluted in 2 ml of IMDM + 10% FBS and this was 50% on a 6-well dish Added to 1 × 10 ⁶ human fetal kidney cells (293 cells) plated at confluence. The virus was left on the cells for 24 hours. Wash cells and add 2 ml fresh IMDM
+ 10% FBS was added. Supernatants were collected for Western blot or RIA analysis (24-48 hours post-infection). See FIGS. 1A and 1B.

As a control, supernatant was collected from cells transfected with 2 μg of pCMVAAV-m-leptin packaging plasmid. For transfection, 2 μg of pCMV-AAV-m-leptin plasmid was added to 10 μl of transfection reagent LT1 (Panvera Inc., Ma.
WI) and added to 5 × 10 ⁵ human fetal kidney cells (293 cells) seeded on a 6-well dish. The complex was incubated with the cells for 4 hours and re-fed with 2 ml of medium. Cell supernatants were harvested 48 hours after transfection and analyzed by Western blot or RIA.

For Western blots, 10 μl of supernatant from infected or transfected cells was mixed with 5 μl of 3 × Laemmli buffer and boiled to denature the protein. The denatured supernatant was subjected to 14% SDS-PAGE (Noveve).
x, San Diego, CA) and transferred onto nitrocellulose. The blot was blotted at 4 ° C. with a rabbit anti-leptin antibody (Giese) at a 1: 5000 dilution in PBS containing 0.1% Tween and 0.2% non-fat dry milk.
, (1996) Molecular Medicine 2, 50-58). After thorough washing, goat anti-rabbit IgG (Boehri
nger Mannheim, Indianapolis, Ind.) was added. After 1 hour incubation and further washing, the immunoreactive bands were labeled with chemiluminescence (ELC kit, Amersham,
(Buckinghamshire, England).

Western analysis using a rabbit anti-mouse leptin antibody showed a single immunoreactive protein in supernatants from transfected cells and cells infected with 10 ¹⁰ particles. The secreted leptin protein migrates to an estimated size of 16 kDa. The supernatants from infected cells or mock-transfected cells to ¹⁰⁹ particles bands were not observed. See FIG. 1A.

The level of leptin expression was quantified using a sensitive RIA. Mock-infected cells, but did not release a detectable leptin into the media, the cells infected with 10 ⁹ and 10 ¹⁰ particles per 24 hours / ¹⁰⁶ cells, respectively, releasing the leptin 47 and 290ng did. See FIG. 1B. Interestingly, we find that r
It has been found that the packaging capacity of the AAV vector is sensitive to the size of the packaged vector genome. 2840 to 3 including the PRE sequence
Increasing the size of the vector to 430 bp helped improve the functional titer (data not shown). This result is shown in Dong et al. (1996) Human.
Gene Ther. 7, 2101-2112. This author
A direct correlation between the genome size and titer of the recombinant AAV vector was demonstrated.

Example 4 In Vivo Administration of rAAV Leptin Previous reports using recombinant leptin protein showed that this protein was i.p. p.
Or i. v. It has been demonstrated that it can be delivered by any of the routes of administration. Reports demonstrating rodent leptin delivery by gene therapy utilized adenovirus-based delivery (iv), and transgene expression probably occurred in the liver. Muzzin, (1996) Proc. Natl. Acad. Sci. U. S
. A. 93, 14804-14808 and Chen, (1996) Proc.
Natl. Acad. Sci. U. S. A. 93, 14878-14882. We administered the rAAV vector by the intramuscular route and monitored food intake and weight gain over the course of 10 weeks as follows.

[0059] Twenty 4-6 week old female C57BL / 6J-ob / ob mice were injected with The Ja
Obtained from ckson Laboratory (Bar Harbor, ME). The body weight of 10 rAAV-leptin treated mice was compared weekly with 10 mice treated with 0.9% saline vehicle. After anesthesia with a mixture of ketamine and xylazine, 50 μl of normal saline or normal saline and 1 × 10 ¹¹ rAAV particles were injected into the tibialis anterior (TA) muscle. In some experiments, both limbs were injected on two consecutive days, while in other experiments, twice the volume of particles was injected in one day.

The results are summarized in FIG. 2A. The effect of rAAV leptin administration was gradual. The treated mice continued to gain weight for the first three weeks, but at a rate that was significantly slower than saline-treated controls (FIG. 2A). (P = 0 in the second week
. 004, and at week 3 p = 0.005). During the fourth week after vector administration,
The rAAV-injected mice began to lose weight, but were treated with saline (sale).
The treated mice continued to gain weight. During weeks 5, 6, and 7, the treated mice had relatively steady rates (mean 2.3, 2.4, and 2.0 g / 2.0 g / respectively, respectively).
(Animals / week). Weight loss of treated mice was 8, 9, 10
, Continued through week 11, but at a reduced rate (1.4, 0.5, respectively).
9 and 0.35, 1.02 g / animal / week). At week 12, there was a slight increase in body weight of 0.2 g on average. Mice infused with saline continued to gain weight between weeks 5 and 12, but at a slightly reduced rate. By week 8, the mean weight of leptin-treated mice was less than half that of control (saline-treated) ob / ob mice (25.9 vs. 52.1 g) (FIG. 3). Mann-Whitney
Statistical calculations were performed using the two-sample test. Calculations were performed on the InSTAT software program. From week 4 onwards, the difference in body weight between the two groups is p <0.000
5 was statistically significant. Treated mice were treated with saline
It was observed that it was much more physically active than b / ob mice.

In summary, compared to saline-treated mice, rAAV leptin-treated mice gained significant weight loss beginning at week 1 and continuing through the observation period.
Treated animals began to lose weight by week 4 and continued to lose weight by week 8, at which point body weight began to stabilize. At week 8, the average body weight of these animals is much closer to age-matched C57 control mice than to untreated ob / ob mice.

[0062] Monitoring of food intake began 3 weeks after injection. Pre-weighed standard mouse food was placed in cages (including 5 mice) every night, and the amount of food consumed was measured the next day. The reduction in food intake of the treated mice corresponded to the degree of weight loss. As shown in FIG. 2B, at the very first time point monitored (18-2
Day 3) rAAV leptin-treated mice averaged 3.80 / mouse / day.
Controls consuming 4 g of food and receiving saline treatment averaged 5.1.
g. In the following week (Days 24-29), the mice averaged 2.9 daily.
g of food and untreated mice ate 4.6 g / day. 4-7
By week, leptin-treated mice consistently consumed an average of 1.9 g of food per day, and by week 9 this consumption was approximately 2.3 g / day. Week 10 and 1
At 1 week, consumption reached a plateau of 2.75 g / mouse / day in leptin-treated mice. Throughout this period (weeks 4-11), saline controls consumed an average of 4.6 g / mouse / day. This stable low level of food intake in treated mice is consistent with a steady and gradual rate of weight loss.

[0063] A second study was performed to confirm that the observed weight loss was not due to the side effects of rAAV injection. In this experiment, ob / ob mice were injected with either the rAAV leptin vector or the rAAV-β-galactosidase vector as a negative control. The kinetics of weight gain for β-galactosidase-treated mice were identical to saline-treated mice in the first experiment (data not shown). As in the first experiment, leptin-treated mice gained weight more slowly during the initial period and began to lose weight by week 4 (data not shown).

The levels of circulating leptin were measured at 5, 7, 9, and 11 weeks after intramuscular delivery of rAAV-leptin. Blood for isoflurane
Blood was collected from mice anesthetized by orbital blood sampling and serum was separated. The level of circulating leptin was measured using the Lincomose Leptin RIA kit (Li
nco, St. (Charles, MO). At week 5, serum leptin levels from five AAV-leptin-treated mice and five saline-treated control mice were measured. Serum was collected from the mice at the indicated times and leptin levels were measured using the Linco Ria kit. Values are means ± SEM of 5 mice. At 7 weeks, mice were fasted for 18 hours before serum collection. Mice tested at 5, 9, and 11 weeks were allowed free access before serum collection. Serum was not collected from C57 mice at 5 weeks.

As shown in FIG. 4, at week 5, the average leptin concentration of the treated mice was 1.
7 ng / ml, ranging from 1.3 to 2.34 ng / ml. Saline-treated ob / ob mice average 1.19 ng / ml and range from 1.01 to 1.34.
ng / ml. This background may be due to reactivity with truncated leptin protein, which is predicted to be the product of an ob mutation. In the seventh week,
The same group of mice and five C57 control mice were tested. rAAV-
Mean serum leptin levels in leptin-treated mice increased to 3.33 ng / ml (width = 2.9-4.56), and saline-treated mice also increased to 1.2 ng / m2.
and normal C57 mice had an average serum leptin level of 3.76 ng / ml. Serum leptin levels in rAAV leptin-treated mice decreased to 2.46 ng / ml at 9 weeks. Untreated ob / ob mice are
Wild type C57 mice had circulating leptin levels of 65 ng / ml and 4.19 ng / ml at this time. At 11 weeks, leptin concentration was 1.03 ng / reactive protein in untreated ob / ob mice.
It was 2.97 ng / ml in treated mice versus ml. This is also
It is within the range of normal C57 black mice (2.31 ng / ml). The P values for treated versus untreated were 0.09, 0.0005, 0.007, and 0.0079 for 5, 7, 9, and 11 weeks, respectively.

Thus, ectopic expression of physiological levels of leptin may prevent the development of obesity. Interestingly, the RIA used in this study also detected some activity in untreated ob / ob mouse sera. This may be due to the presence of endogenous inactive leptin secreted in this mouse strain (ob deletion may be due to an immature stop codon in the leptin coding sequence).

The ob / ob phenotype is characterized by insulin resistant diabetes;
Ob mice are hyperglycemic despite elevated levels of circulating insulin. To determine the effect of leptin gene therapy on diabetes, blood glucose and insulin in fasting mice were measured. Six weeks after the injection,
Mice were fasted for 18 hours and bled for determination of fasting glucose (FIG. 5A) and insulin (FIG. 5B). The values shown here are the mean ± SEM of 5 mice (FIG. 5C). Glucose tolerance in saline (Δ), r-AAV-leptin treatment (○), or C57 mice (*) is determined by measuring blood glucose levels at the indicated times after intraperitoneal injection of glucose. . Values are means ± SEM of 3 mice in each group. The study was performed on mice fasted 18 weeks after injection. At week 6, all five saline-treated mice tested were hyperglycemic (FIG. 5A). Glucose levels in fasting mice range from 168 to 355 mg / dl (normal =
(91-129 mg / dl), the average of 259.2 mg / dl. In contrast,
All of the rAAV-leptin treated mice were in the normal range with a group mean of 91.2 mg / dl, or slightly below, in the range of 74-125 mg / dl. Insulin levels in serum from fasted mice were also measured (
(FIG. 5B). All sham-treated animals showed significant hyperinsulinemia, with serum insulin levels between 8 and 20 ng / ml. The average serum insulin concentration in AAV-leptin treated animals was 0.54 ± 0.1 ng / ml.

A glucose tolerance test was performed to determine the ability of AAV-leptin treated mice to remove glucose from the circulation. Eight weeks after vector administration, 1 mg / m
mice that fasted with a glucose bolus i. p. Injections and serum glucose were monitored over time. In control C57 and leptin-treated ob mice, circulating glucose levels peaked at 30 minutes and returned to normal within 120 minutes (FIG. 5C). In sham-treated ob / ob mice, glucose levels were at least 2-fold higher than in leptin-treated mice at all time points. Glucose levels in these mice were not normalized within 3 hours of the course of the study.

Therefore, hyperinsulinemia and insulin resistance could be corrected in leptin-treated mice. As shown in FIG. 5, complete reversal of hyperinsulinemia and hyperglycemia in treated animals was at 6 weeks. The levels of circulating insulin in the treated mice were similar to those reported for C57 mice (0.54 ng / ml vs. 0.40 ng / ml). rAAV-leptin treated mice had a normal response to the glucose challenge. In the eighth week,
Control ob / ob mice failed to correct the exaggerated hyperglycemic state after glucose injection after fasting. In contrast, leptin-treated and age-matched C57BL mice corrected hyperglycemia. This indicates that insulin resistance has been corrected and that these mice can properly regulate insulin secretion in response to a glucose challenge.

Thus, intramuscular administration of rAAV vector encoding mouse leptin,
It leads to an overall correction of the obesity phenotype of ob / ob mice. Long-term correction of gene deletion by somatic gene therapy is possible with rAAV-based vectors.

Example 5 Preparation of rAAV-Epo Particles and In Vitro Analysis pKm201CMV is an expression cassette composed of the CMV immediate early enhancer, promoter and intron, and a bovine growth hormone (bGH) polyadenylation site. 2 is an AAV cloning vector flanked by inverted terminal repeat (ITR) sequences from the vector. pKm201CMV is equal to pKm
201 (pEMBL-AAV-ITR (Srivastava, (1989) P
rc. Natl. Acad. Sci. USA 86: 8078-8082) (a modified AAV vector plasmid in which the ampicillin resistance gene has been replaced by a kanamycin resistance gene). pCMVlink (pCMVlink
6c derivatives (Chapman (1991) Nucleic Acids Re
s. 19, 193-198) (the BGH poly A site was replaced with the SV40 terminator) was inserted between the ITRs of pKm201 to generate pKm201CMV. AAV-Epo expression vector pC
To construct MVAAV-Epo, we used the AvrII-BglII fragment from clone pMKE83 (ATCC Accession No. 67545), which encodes the full-length monkey Epo sequence, to obtain pKm201 CM.
V at the XbaI-BamHI site. In addition to the CMV immediate early promoter / enhancer and intron, the AAV vector contains a post-translational regulatory element (PRE) from hepatitis B virus. PRE (Huang, Mol. Cell. Bio. 15, 3864-3) increases the efficiency of mRNA transport.
869) was included to increase the size of the vector genome for more efficient packaging. A 579 bp fragment derived from the hepatitis B virus (HBV) post-translational regulatory element (PRE) region (Huang and Yen (1995) Mol. Cell. Biol. 15, 3864-386).
9) was amplified using the following primer set: 5 'ACATACCGGTGCTTGCCGTGGAACCTTTG3' (SEQ ID NO: 1) and 5'TTGTGGCGGCGCAGCTTATCGAATTTCGAACCCG3
'(SEQ ID NO: 2). The resulting fragment was digested with AsI and MluI and inserted at the MluI site between the leptin coding region and the BGH polyA site. Inclusion of the mouse leptin coding region in this construct results in a 3.4 kb packageable vector genome. The vector plasmid was packaged using standard methods and resulted in a purified stock of 1.25 × 10 ¹² particles / ml.

The AAV helper plasmid pKSrep / cap (encoding the rep and cap proteins) was transformed with the AAV-2 genome without the ITR (AAV-2 nucleotides 192-4493) into pBluescript II KS + (Stra
tag, La Jolla, Calif.).

Recombinant AAV-Epo particles transform HT1080 cells (human fibroblasts) into DME
M + 10% fetal calf serum (FCS), produced and plated according to Examples 2 and 3 below, except that they were plated on 6-well dishes (2 × 10 ⁵ cells) the day before infection was used. Was analyzed. The cells were transformed at different MOIs with
After 48 hours of infection with AV-EPO, R & D Quantikine EL was used.
Supernatants were monitored for Epo using an ISA kit (R & D Systems, Minneapolis, MN). The results of the ELISA are shown in FIG.
The rAAV-Epo titer is shown on the X-axis. The lane showing leptin is rAAV-m
- represents a background level of Epo secreted from cells infected with 5 × 10 ⁹ particles of leptin. The results show that infection of HT1080 cells with 5 × 10 ⁹ particles produced 10,800 mIU / 10 ⁶ cells / day,
Equivalent to 86.4 ng Epo per day (1 mIU is about 8 pg Epo
Is equivalent to On the other hand, infection with 2 × 10 ⁸ and 1 × 10 ⁹ particles led to production of 480 and 2200 mIU / 10 ⁶ cells / day, respectively.

Example 6 In Vivo Administration of rAAV-Epo in Mice Seven-week-old female C57BL / 6 mice were obtained from Charles River Labo
ratories (Wilmington, MA). Recombinant AAV
-Epo, as described in Example 4, 50 μl of normal saline or 2
Normal saline containing × 10 ¹¹ rAAV particles was administered by injection into TA muscle of mice anesthetized with a mixture of ketamine and xylazine.

Blood (200 μl) was collected after isoflurane sedation by using orbital blood sampling. Whole blood was used for hematocrit estimation and separated serum was used to detect Epo by ELISA. FIG. 7 shows the results. Panel A shows serum Epo concentration (± SEM) after rAAV administration. At all time points, saline-injected mice have undetectable serum Epo levels and are not included in the figure. Panel B represents the average hematocrit of four mice injected with either rAAV-Epo or saline. Error bars are included, but they are obscured by the plot symbols. Week 0, untreated C5
5 represents the mean basal hematocrit and serum Epo concentration for 7BL / 6 mice.

The results indicate that circulating levels of Epo began to rise within one week of injection (36
. 1 mIU / ml), and peaked at week 7 (65 mIU / ml).
ml). The biological effect of rAAV-Epo is monitored by measuring hematocrit. Hematocrit levels are measured in circulating Epo in treated mice.
Closely reflects the amount of (see FIG. 7B). Hematocrit rose from 7 weeks, indicating that red blood cells exceeded 90% of the blood volume (FIG. 7B). Remarkably, the mice maintained this high level of hematocrit for 11 weeks and showed no apparent adverse effects.

To determine whether Epo levels were affected by an immune response to a foreign transgene, a bioluminescence ELISA assay was developed to detect antibodies to Epo. Microtiter plate (Dynatech
Microlite, Chantilly, VA) at 1 μg / ml in PBS.
50 μl of EPOGEN® (h-erythropoietin, Amgen,
(Thousand Oaks, CA) solution and incubated overnight at 4 ° C or 1 hour at 37 ° C. The coated wells were washed with 1 × Aqualite Streptavidin Assay buffer containing 5% goat serum (Sea
(Lite Science, Bogard, GA) for 1 hour at 37 ° C. The plates were then plated with 1% goat serum and 3% Tween-2.
Washed 3 times with 1 × Aqualite Washing Buffer containing 0. The diluted serum sample (50 μl) was transferred to the coated plate and incubated at 37 ° C. for 1 hour. Then, it was washed six times with a washing buffer. Primary antibody (goat anti-mouse IgG from Sigma) diluted 1: 1000 was added to each well and incubated for 1 hour at 37 ° C., followed by 6 washes. Streptavidi
n Aqualite antibody (1: 500) was added to each well, incubated at 37 ° C. for 1 hour, and then washed 6 times. Luminescence was measured in 5 × of 1 × Trigger buffer.
Triggered by injection of a 0 μl aliquot, the plate was washed with Dynatech M
Reading was performed using an L3000 luminometer (Chantilly, VA).
For saline-treated mice, sera were pooled prior to ELISA and rA
Serum from AV treated mice was measured individually. The positive control (+ control) was the anti-cm-Ep injected with cynomolgus monkey Epo-plasmid DNA.
o shows sera from BALB / c mice previously shown to have antibodies. The titer is defined as the dilution of serum required to reduce the signal to the level obtained in the wells containing dilution buffer alone.

The results are shown in FIG. 8 and show that in rAAV-Epo injected mice and saline injected mice, the serum sample with an anti-Epo titer of 4 × 10 ⁵ titers was 1/1000 lower. Was. These results are based on the recently published human Epo DN
In contrast to reports using rAAV delivering A (Kestrel, Pro
c. Natl. Acad. Sci. 93 (1996) 14082-87). This report shows the long-term expression of human Epo in BALB / C mice, while reduced circulating reticulocytes and fatal anemia were observed in C57BL / 6 mice. In contrast, our results show that after intramuscular delivery, C57B
Figure 6 shows long-term expression of monkey Epo in L / 6 mice. We have developed C57BL
No significant amount of antibody to monkey Epo could be detected in the serum of / 6 mice.

Example 7 In Vivo Administration of rAAV-Epo in Baboons Two 1-year-old female baboons weighing 3.5-4.0 kilograms (C57BL / 6)
(150-200 times the size of a mouse). Prior to injection, baboons were monitored for 2 months to determine baseline circulating serum Epo and hematocrit.
Animals were sedated with 10 mg / kg ketamine and 0.5 ml of 2 × 10 ¹² particles /
A ml stock of rAAV-Epo was injected into the TA in both legs (10 times more than in mice). As a control, two baboons were given r-encoding β-galactosidase.
Similar amounts of AAV vector were given.

[0080] 2.5 ml of blood was collected from each baboon for performing hematocrit and ELISA assays. Change the level of Epo to R & D Systems Quant
ikine kit (R & D Systems, Minneapolis, MN)
Was determined from monkey plasma or mouse serum.

The results are shown in FIGS. 9A-9B. FIG. 9A shows plasma E measured by ELISA.
Indicates the po level. FIG. 9B shows the hematocrit of two baboons before (negative numbers) and after injection. To prevent seizures, 34 or 40 ml of blood was drawn from baboon 2 at 11 and 13 weeks. As shown in FIG. 9A, pre-injection values of serum Epo ranged from 1.5 to 3.3 mIU / ml;
Week-to-week variability was small. One week after injection, Epo levels increased to 4.5 mIU / ml for baboon 1. Baboon 2 increased over mIU / ml. At 4 weeks, the value increased to 11.8 mlU / ml for baboon 1 and 11.3 mlU / ml for baboon 2. Values peaked at 8-10 weeks, at which time baboon 1 had a circulating level of 35.9 mIU / ml and baboon 2 had a circulating level of 41.6 mIU / ml.

Prior to treatment, baboon 1 hematocrit ranged from 35.7 to 40% and baboon 2 hematocrit ranged from 38.7 to 42.3%. Elevated serum E
Despite the presence of po levels, the hematocrit of both baboons did not increase significantly during the first week. This probably reflects the gap between exposure to Epo and the differentiation of precursor cells into red blood cells. By the fourth week, the hematocrit of both baboons had increased beyond the range seen before injection. Hematocrit is 1
It continued to increase until week 0, at which time both baboons showed at least a 25 point increase above pre-treatment levels. The baboon 2 hematocrit exceeded 70%; therefore, the animal was phlebotomized to reduce the risk of thrombosis. 34ml
After the phlebotomy to extract the venous blood of the monkey, the hematocrit level in this monkey was
It continued to rise until the 13th week. In contrast, the monkeys were phlebotomized at week 13 and recovered only at week 14 prior to phlebotomy. The hematocrit of baboon 1 is 1
It reached a maximum of 61.6 at week 0 and remained at this level between weeks 10 and 16. The hematocrit level stabilizes in baboon 1 and this stabilization
Occurred despite high levels of circulating Epo. Control rAAV-LacZ
Animals injected with the virus did not show any increase in serum Epo levels (data not shown).

Example 8 Formulation and Intranasal Administration of rAAV Virions To generate an aerosol comprising rAAV virions carrying Epo, rAAV
A solution of 50 μl of AV-EPo virion at a concentration of 1 × 10 ¹² in 0.9% NaCl is placed in the reservoir of an Ultravent nebulizer (Mallinckrodt). The atomizer is driven with compressed air at 40 psi. The size distribution of the aerosol droplets was determined using laser particle size analysis, and the relative proportions of the virion preparations were determined by Hubbard, Proc. Natl. Acad. Sci. 86 (
1989) 680-684, phosphorylated saline (pH 7.0).
4) Evaluate by collecting the aerosolized droplets in.

A 7-week-old female C57BL / 6 mouse was transformed into Charles River Labo
ratories (Wilmington, MA). After anesthesia with a mixture of ketamine and xylazine and obtaining bronchoalveolar lavage fluid, blood, and lung samples, 50 μl of normal saline containing 1 × 10 ⁶ to 1 × 10 ¹² rAAV-Epo particles was added to Ultravent (Mallin) according to the manufacturer's instructions
clobt) is administered via intranasal drops using an aerosol nebulizer.

Blood (200 μl) is collected after isoflurane edition by using orbital blood sampling. Whole blood is used for hematocrit evaluation, and the separated serum is used to detect Epo by ELISA.

[0086] To determine whether Epo levels were affected by an immune response to this foreign transgene, use a bioluminescence ELISA assay to
o can be detected. Microtiter plate (Dynatech
Microlite, Chantilly, VA) at 1 μg / ml in PBS.
50 μl of EPOGEN® (h-erythropoietin, Amgen,
Thousand Oaks, CA) solution and incubate overnight at 4 ° C or 1 hour at 37 ° C. The coated wells were washed with 1 × Aqualite Streptavidin Assay buffer containing 5% goat serum (Sea
(Lite Science, Bogard, GA) at 37 ° C. for 1 hour. The plates were then plated with 1% goat serum and 3% Tween-2.
Wash three times with 1 × Aqualite Washing Buffer containing 0. Transfer the diluted serum sample (50 μl) to the coated plate and incubate at 37 ° C. for 1 hour. Then, wash 6 times with wash buffer. Primary antibody (goat anti-mouse IgG from Sigma) diluted 1: 1000 is added to each well and incubated at 37 ° C. for 1 hour, followed by 6 washes. Streptavidi
n Aqualite antibody (1: 500) is added to each well, incubated at 37 ° C. for 1 hour, and then washed 6 times. Luminescence was measured in 5 × of 1 × Trigger buffer.
Triggered by injection of a 0 μl aliquot, the plate was washed with Dynatech M
Read using an L3000 luminometer (Chantilly, VA). The titer is defined as the dilution of serum required to reduce the signal to the level obtained in the wells containing dilution buffer alone.

For administration in humans, an equivalent human dose per body weight should be used, for example, 1 × 10 ⁷ to 1 × 10 ¹⁶ particles in a 50 μl volume. 199 Subcommittee for NHLBI Institutional Clinical Trials on September 21, 2002, NIH Biosafety Committee on August 21, 1992, RAC on December 3, 1992, and April 1993.
Office of Recombinant DNA Activity for Administration of Adenovirus Viruses Containing Human CFTR cDNA, Approved by the FDA on March 16 (B
building 31, Room 4B11, National Institute
ute of Health, 9000 Rockville Pike, Be
Thesda, Maryland, USA 20892).

Intranasal formulations of rAAV virions with other heterologous sequences (eg, rAAV-
Leptin) can be made according to the methods disclosed herein, and administered, tested, and using art-recognized methods as described above.

Such formulations may be formulated in a manner analogous to the administration to mice, for example, by using Ultraveh.
It is administered to humans via intranasal drops using an nt (Mallinckrodt) aerosol nebulizer according to the manufacturer's instructions.

Example 9 Transient Immunosuppression to Block Humoral Immunity Typically, after a single intramuscular injection of rAAV vector, transgene expression from a second vector injection Is not possible. To determine that the division of the host immune response is responsible for the inability to readminister the rAAV vector,
Experiments were performed in class I deficient, class II deficient, and CD40L deficient mice. Class I deficient mice do not develop a normal population of CD8 ⁺⁺ T cells and fail to mount a cellular immune response. (Zijlstra, Nat
ure 344, (1990) 742-746). Class II deficient mice are negative for CD4 ⁺ T cells and lack a humoral immune response. (See Grusby, Science 253 (1991) 1417-20).

[0091] Six-week-old female C57BL / 6 mice were isolated from Charles River Labs.
(Wilmington, MA). C57BL / 6 class I deficient and C57BL / 6 class II deficient mice were isolated from Taconic Labs (Ge
rmantown, NY). CD40 ligand deficient mice and B
129 mice were purchased from Jackson Labs (Bar Harbor, ME).

The vector pAAV-lacZ was transformed with the CMV promoter, intron, LacZ
, And pCMV-β (Clontec) containing the SV40 polyadenylation signal
h, Palo Alto, CA) from pEMBL-
Constructed by cloning into AAV-ITR. Plasmid pkm2
01 is a derivative of pEMBL-AAV-ITR in which the ampicillin resistance gene has been replaced with a gene for kanamycin resistance. See Example 1. Plasmid pAAV-Luc was transformed with CMV promoter / intron, luciferase,
And an expression cassette containing a bovine growth hormone polyadenylation signal with pKm2
01 was constructed by cloning. Plasmid pKSrep / ca
p is an AAV- containing no ITR (AAV-2 nucleotides 192-4493).
2 genomes were transformed into pBluescript II KS + (Stratagene, L
a Jolla, CA). See Example 1.

[0093] Recombinant AAV particles were generated as disclosed in Example 2. The remaining adenovirus contaminants were inactivated by heating at 56 ° C. for 45 minutes.
To evaluate the total number of rAAV particles, the stock was treated with DNAseI and the enveloped DNA was extracted with phenol-chloroform and precipitated with ethanol. Titers were determined using DNA dot blot analysis against known standards. To assay for adenovirus contamination, add 10 μl to 293 cells.
Were purified and any signs of cytopathic effect were followed. All stocks were negative and 100 pfu of adenovirus contaminants
/ Ml.

The rAAV particles were diluted in 0.9% saline and a final volume of 50 μl was injected into the tibialis anterior (TA) muscle. On day 0, five classes I knockout, to the group of class II knockout or C57BL / 6 mice,, 1 × 10 ¹⁰ particles r
AAV-LacZ was injected into the right TA. Four weeks after the first injection, mice are bled for serum and 1 × 10 ¹⁰ particles rAAV-LacZ (3 mice) or 1 × 10 ¹⁰ particles rAAV-Luc (2 mice) One of the left T
A was injected. At week 6, mice were bled again, sacrificed, and muscle was collected and immediately frozen in liquid nitrogen for either LacZ staining or luciferase assay.

For transient immunosuppression by anti-CD4 antibodies, mice were given 100 μg of rat anti-mouse CD4 on days -3, 0, and +3 compared to the first (day 0) injection of rAAV. (Clone GK1.5, Pharmingen, San Diego
, CA) was injected by intraperitoneal injection. For anti-mouse CD40 ligand treatment, mice were given 100 μg of antibody (clone MR1, Pharming) by intraperitoneal injection on days -3, 0, +3 and +6 compared to the first injection of rAAV.
en, San Diego, CA). Cyclosporin A (Sandim
mune, Sandoz) were treated with rAA by the end of the experiment.
One week prior to the first injection of V, every 5 days, an intraperitoneal injection of 10 mg / kg of the drug was given.

For the luciferase assay, frozen muscle was ground in a pre-chilled mortar and pestle, transferred to a 1.5 ml microcentrifuge tube, and in 500 μl of 1 × reporter lysis buffer (Promega, Madison, Wis.). Was resuspended. The tubes were vortexed for 15 minutes at room temperature, followed by three freeze / thaw cycles. Lysates were clarified by centrifugation at maximum speed for 10 minutes in a microcentrifuge and then stored at -80 ° C until assayed. Luciferase assays were performed according to the manufacturer's protocol (Promega, Madison, WI).
) And Dynatech ML3000 (Chantill)
y, VA) Read on plate luminometer. The protein concentration of each lysate was assayed by the BCA protein assay (Pierce, Rockford, IL) and luciferase activity was expressed as luciferase (picogram) per mg protein.

Frozen sections (8 μm) were fixed in 10 mM phosphate buffered saline (PBS) containing 1% paraformaldehyde for 5 minutes at room temperature. Fix the fixed section with X
-Gal solution (1 mg / ml of 5-bromo-4-chloro-3-indoyl-β-
(Galactopyranoside, PBS containing 1 mM MgCl ₂ , 5 mM K ₃ Fe (CN) ₆ , and 5 mM K ₄ Fe (CN) ₆ ) for 16 hours at 37 ° C. Sections were counterstained with Nuclear Fast Red.

[0098] To carry out the AAV capsid ELISA, microtiter plates were coated overnight at 4 ° C. in rAAV-LacZ particles / well in PBS 10 ^9. The next day, the plates were washed, then 1% goat serum and 0.3% Tween 2
Blocked with PBS containing 0 for 30 minutes at 37 ° C. Serial three-fold dilutions of sample and control sera were loaded onto plates starting at 1:75 (control sera were from mice that received multiple injections of AAV). The microtiter plate was then incubated at 37 ° C. for 1 hour. Plates were washed and incubated with 1: 2000 goat anti-mouse Ig-HRP (horseradish peroxidase labeled immunoglobulin) for 30 minutes at 37 ° C (
Dako, Carpenteria, CA). Plates were developed using O-penylenediamine substrate. Plates were run at 492 nm with a 0.2 OD cutoff.
Read in.

To perform the AAV neutralizing antibody assay, 293 cells were plated at 3 × 10 ⁴ cells / well in a 96-well microtiter plate. The following day, previously collected positive controls and sample sera were inactivated at 56 ° C. for 30 minutes. Next, IMDM (Biowhite) containing no fetal calf serum (FCS) was used.
, serum) were incubated with 10 ⁸ particles of rAAV-Luc at 37 ° C. for 1 hour. Medium was removed from the 293 cells and diluted serum and virus were added and incubated at 37 ° C for 1 hour. After this incubation, the plates are washed and 10%
A new IMDM containing FCS was added. After 24 hours, cells were rinsed with PBS and lysed in reporter lysis buffer (Promega, Madison, WI). The cells were then harvested and assayed for luciferase activity. AAV neutralizing antibody titers were defined as the dilution of serum required to detect 50% luciferase activity in 293 cells infected with rAAV-Luc preincubated with negative control serum.

The results are shown in Table 1 below. In Table 1, + indicates 1 to 10%, and ++ indicates 10%.
５０50%, +++ indicates 50-90%, and ++++ indicates 90-100.
%. NA indicates not applicable.

[0101]

[Table 1]

As shown in Table 1, rAAV-LacZ pre-injected C57B
No luciferase expression was found in L / 6 mice. High levels of luciferase expression were found in the muscle of class II deficient mice, and moderate levels were found in the muscle of class I deficient mice. The results were similar when the second injection was rAAV-LacZ. Antibody titers against the AAV capsid were determined by ELISA. The titers are shown in Table 1 above.
Control C57BL / 6 mice had high ELISA and neutralizing titers. As expected, class II deficient mice had antibody titers, E, against AAV.
LISA, or neutralization did not increase. Antibody titers in class I deficient mice were lower than those found in control mice and resulted in moderate luciferase or lacZ expression.

To further establish the role of the humoral immune response in re-administration, CD40L (
The experiment was performed in mice lacking CD40 ligand). CD40L is activated C
It is important for the ability to be expressed on D4 + T cells and to provide help to B cells. (Durie, Immunol. Today 15 (1994)
406-11; see Xu, Immunity 1 (1994) 423-31 and Yang, Science 272 (1996b) 1862-67). CD40 ligand-deficient mice are known to be deficient in humoral immune responses. Identical to experiment above (second injection was rAA in all mice)
V-Luc and using B129 mice as controls) were performed in CD40 ligand deficient mice. The results are shown in Table 2 below. NA indicates not applicable and ND indicates not determined.

As shown in Table 2, re-administration of rAAV was not possible in wild-type control mice (B129) due to high anti-AAV titers, but CD
This was possible in mice lacking 40 ligands. The ability to obtain recombinant protein (ie, luciferase) expression upon vector re-administration inversely correlated with anti-AAV antibody titers and AAV neutralizing antibody titers.

[0105]

[Table 2]

To determine whether the dose of the first injection affected the efficacy of the second injection, groups of 5 C57BL / 6 mice were given increasing doses of rAAV-LacZ in the right tail Inject into the artery (TA), then 1 × 10 ¹⁰ particles 4 weeks after the first injection
AAV-Luc was injected into the left TA. The results are shown in Table 3 below. ND indicates not determined.

[0107]

[Table 3]

As shown in Table 3, low doses (10^Four, 10^Five) Received group, native control
Were re-injected as efficiently as These same groups of mice are also
Does not demonstrate neutralizing the antibody response to
Indicates that the amount of antigen was too low and might not elicit an immune response. Actual
In addition, the right TA muscle of these mice were all negative for lacZ expression (
Data not shown). 10⁸The group that received the rAAV-lacZ of the particles elicited a weak antibody response to AV. This lower antibody response is an intermediate response from the second injection.
Bell luciferase expression occurred. In this group, measurable neutralizing antibody titers
Of the two animals having the lowest luciferase activity. 10 ^Ten The group receiving the particles demonstrated a strong antibody response to AV and the second dose
Did not succeed.

Based on the results of previous experiments, we have determined that rAAV by transient immunosuppression
To reduce the host's antibody response to Mice treated with anti-CD4 antibody at the time of the first injection could be re-injected with rAAV-Luc. Formulations and injection protocols are as previously described. All injections, unless otherwise indicated, are 1
× 10 ¹⁰ particles (rAAV). Measure luciferase activity and
Expressed in picograms of luciferase per g of protein. The results are shown in Table 4 below. ND indicates not determined.

[0110]

[Table 4]

[0111]

Blood was collected one day after the last dose of anti-CD4 antibody (α-CD4)
Harvested from antibody-treated mice and subjected to FACS analysis. All mice showed more than a 99% reduction in the number of CD3 ⁺ CD4 ⁺ T cells (data not shown) and had a normal number of CD3 ⁺ CD8 ⁺ T cells. As shown in Table 4, there was some variability in the level of luciferase expression achieved in alpha CD4-treated mice, and 4 out of 10 mice showed little or no luciferase activity. As seen in previous experiments,
The level of luciferase expression inversely correlated with AAV antibody titer. In anti-CD40 ligand antibody experiments, only one out of three mice was efficiently re-injected. This indicates that anti-CD40 ligand antibody treatment alone is probably not the optimal treatment for readministration. Treatment with cyclosporine alone had no effect on the ability to re-inject rAAV. The ligand antibody experiments for both anti-CD4 and anti-CD40 were repeated with similar results.

The results with class I and class II deficient animals demonstrate that the humoral arm of the immune system plays an important role in preventing re-administration. Experiments with class I and class II knockout mice included an appropriate wild-type background mouse (C57BL / 6) as a control, as mouse haplotypes can affect the likelihood of re-administration. To further establish the role of the humoral arm of the immune system in re-administration, experiments were performed on CD40L knockout mice. CD4
0L is expressed in activated CD4 ⁺ T cells and is important for its ability to provide help to B cells. Therefore, the CD40L knockout mouse
It should mimic the response seen in class II knockout mice. This result demonstrated that, as in class II deficient mice, CD40L deficient mice can be efficiently re-administered with a second dose of virus. The level of rAAV-mediated transgene expression in control mice of this strain (B129) is significantly lower than in C57B1 / 6 control mice, which can also affect rAAV vector-mediated expression levels in mouse haplotypes. It is interesting to see that it shows.

The results of these in vivo preliminary studies demonstrate that blocking the humoral response during the primary administration of the vector allows for effective re-administration.

Example 10 Formulation and Direct Administration of rAAV Virions into the Renal Artery Seven-week-old female C57BL / 6 mice were obtained from Charles River Lab.
oratories (Chambridge, MA). After obtaining anesthesia with a mixture of ketamine and xylamine and obtaining a baseline blood sample, a mid-abdominal incision is made and the junction between the ureter and the urethropelvic, except for connective tissue and vasculature, is left The renal artery is exposed, which is then clamped. An aliquot of 50 μl of a 5% dextrose solution containing 10 ⁸ -10 ¹² particles of rAAV-Epo or rAAV-leptin (produced as described in Examples 1-4 above) was injected using a 30 gauge needle. Within one minute, it flows directly into the left renal artery. Then 5 minutes after injection by removing the clamp,
Reestablish renal blood flow. Close the incision and allow the animals to recover. Lai, Ge
ne Therapy 4 (1997) 426-31 and Yamada, J.
See Clin Invest 96 (1995) 1230-37.

[0116] Three days after injection, blood samples are collected for analysis. Whole blood is used for hematocrit estimation, and the separated serum is used to detect Epo by ELISA.

[0117] To determine whether Epo levels are affected by an immune response to this foreign transgene, a bioluminescent ELISA assay can be used to detect antibodies to Epo. Microtiter plate (Dynatech Mi)
crolite, Chantilly, VA) in Epogen (Ep.
otin, Amegen, Thousand Oaks, CA)
Coat with 50 μl of the solution and incubate overnight at 4 ° C. or 1 hour at 37 ° C. Coated wells were washed with 1 × Aquali containing 5% goat serum.
te Streptavidin Assay Buffer (Sealite
(Sciences, Bogard, GA) at 37 ° C. for 1 hour. The plate is then washed three times with 1 × Aqualite Washing Buffer containing 1% goat serum and 3% Tween-20. Transfer the diluted serum sample (50 μl) onto the coated plate and incubate at 37 ° C. for 1 hour, then wash 6 times with wash buffer. 1: 1000
The diluted primary antibody (goat anti-mouse IgG from Sigma) is added and incubated for 1 hour, followed by 6 washes. Streptavidin A
The qualite antibody (1: 500) is added to each well and incubated at 37 ° C. for 1 hour, followed by 6 washes. Luminescence was induced by injection of a 50 μl aliquot of 1 × Trigger buffer and the plate was treated with Dyn
atech ML3000 Luminometer (Chantilly, V
Read using A). The titer is defined as the dilution of serum required to reduce the signal to the level obtained in the wells containing dilution buffer alone.

For mice injected with rAAV-leptin, animals are fasted for 18 hours and blood is collected from the tail vein to determine fasting glucose levels. The mice were then given a 1 mg / g body weight of a sterile glucose solution i. p. Give by injection.
The mice were anesthetized with isoflurane and blood samples were collected 15, 30 post-injection.
, 60, 120, and 180 minutes by retroorbital blood collection. The circulating glucose is converted into Lifescan One To
Measure using an uch monitor (Life Scan, Milpitas, CA). Insulin levels were measured using Linco Rat Insulin RIA.
Kit (Linco Research Immunoassay, St. Ch.
arles, MO). Leptin levels were measured with Linco Mou
Measure using the se Leptin RIA kit.

Formulations of rAAV virions for direct injection into renal arteries bearing other heterologous sequences can be made according to the methods disclosed herein and are described above and recognized in the art. Can be administered and tested using the methods described. Formulations of rAAV virions for human administration via direct injection into the renal arteries can be made and administered in a manner similar to that described above. Human doses (per body weight) equivalent to the doses used in mice can be used. Administration can be provided by improvements in angiographic medical technology. As is well known in the art, in angiography, a catheter is inserted into a patient's femoral artery and a dye is injected to visualize the kidney. Pharmaceutical compositions comprising a sterile solution containing an effective amount of rAAV virions when a catheter is inserted into the femoral artery and mixed with a pharmaceutically acceptable carrier to administer the rAAV virions directly to the renal artery in a human Injection. Diseases of the Kidney, 5th edition,
Protocol described in Chapter 14; Diagnostic and Thera
Peutic Angiography of the Renal Circ
ulation, pages 465-83 (R. Schrier and C. Gottsc).
Halk, 1993) can be used.

All patents, patent specifications, and scientific literature cited in the present specification are hereby incorporated by reference. The present invention is fully described herein, and
It is understood that many changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

[Sequence list]

[Brief description of the drawings]

FIGS. 1A and 1B disclose leptin expression by rAAV vectors. FIG. 1A shows human 293 cells infected with 1 × 10 ⁹ AAV-leptin (lane 1); 1 × 10 ¹⁰ AAV-leptin particles (lane 2); mock-infected cells (lane 3).
Or cells transfected with 2 μg of pCMVKm201-leptin (
Figure 5 is a representation of a Western blot analysis of leptin expression in vitro from supernatant collected from lane 4). The quantification of leptin expression for lanes 1-3 in FIG. 1A, as reported in μg leptin / 10 ⁶ cells / day by radioimmunoassay, is shown in FIG. 1B.

FIGS. 2A and 2B show ob / received subcutaneous injections of 10 ¹¹ particles of either rAAV-leptin (open circles) or saline (open triangles) and monitored body weight three times a week. 9 shows the effect of rAAV-leptin treatment on body weight and food intake in ob mice, respectively. The mean ± sem of 10 mice in each group was measured. For simplicity, only one time point is shown for each week in FIGS. 2A and 2B.

FIG. 3 is a photograph showing the physical appearance of mice after rAAV-leptin treatment. Mice were photographed 6 weeks after treatment with rAAV-leptin (left) or saline vehicle (right).

FIG. 4. Ob / ob mice receiving saline (filled bars) and C
Circulating leptin levels (ng / ng) in ob / ob mice (hatched bars) 5-14 weeks after rAAV-leptin administration compared to 57 mice (bars with hatched lines)
(ml) shows the results of the measurement.

FIGS. 5A-5C show the results of measuring the effect of rAAV-leptin on glucose metabolism and insulin secretion in treated and untreated ob / ob mice.
Six weeks after injection, mice were fasted for 18 hours and exsanguinated for determination of fasting glucose (FIG. 5A) and insulin (FIG. 5B). The values shown are the mean ± SEM of 5 mice. Values are means ± of 3 mice in each group. The test was performed on fasted mice 8 weeks after injection.

FIG. 6 shows the results from rAAV-Epo 5 × 10 ⁹ particles; 1 × 10 ⁹ particles; 2 × 10 ⁸ particles; HT1080 cells infected with leptin rAAV (control) and uninfected HT1080 cells (control). The erythropoietin of Example 4 ("E
5 is a bar graph showing an ELISA assay resulting from expression (po ") (mIU / 10 ⁶ cells / day).

7A and 7B show the results of in vivo administration of rAAV-Epo virions (particles) to mice. FIG. 7A shows rAAV-E measured by ELISA.
Figure 4 is a graph showing plasma Epo concentration in mIU / ml as a function of time (weeks) in mice receiving po. FIG. 7B is a corresponding graph showing the hematocrit of four mice that received either rAAV-Epo (squares) or saline (circles) as a function of time (weeks) to injection.

FIG. 8 shows the results of an ELISA assay using serum from rAAV-treated and saline-treated mice.

FIGS. 9A and 9B show the results of in vivo administration of rAAV-Epo virions (particles) to baboons. FIG. 9A shows rAAV-E measured by ELISA.
In baboons dosed with po, the plasma Epo concentration as a function of time (weeks)
It is a graph shown in IU / ml. FIG. 9B is a corresponding graph showing the hematocrit of two baboons administered rAAV-Epo as a function of time (weeks) to injection.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme court ゛ (Reference) // C12N 15/09 C12N 15/00 A (31) Priority claim number 60 / 054,692 (32) Priority Date July 31, 1997 (July 31, 1997) (33) Priority country United States (US) (31) Priority claim number 60 / 054,689 (32) Priority date July 31, 1997 (33 Jul. 31, 1997) (33) Priority claim country United States (US) (31) Priority claim number 60 / 056,139 (32) Priority date Aug. 19, 1997 (August 19, 1997) ( 33) Priority Claimed States United States (US) (81) Designated States EP (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE, IT, LU, MC, NL, PT, SE), OA (BF, BJ, CF, CG, CI, C , GA, GN, GW, ML, MR, NE, SN, TD, TG), AP (GH, GM, KE, LS, MW, SD, SZ, UG, ZW), EA (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), AL, AM, AT, AU, AZ, BA, BB, BG, BR, BY, CA, CH, CN, CU, CZ, DE, DK, EE, ES, FI, GB, GE, GH, GM, HR, HU, ID, IL, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR, LS, LT, LU, LV, MD , MG, MK, MN, MW, MX, NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM, TR, TT, UA, UG, UZ, VN, YU, ZW (72) Inventor Murphy, John E. United States of America California 94618, Auckland, Harbourcourt 49 (72) Inventor Manning, William Sea. California 94061, Redwood City, Country Club Drive 3660 (72) Inventor Escobeid, Jame United States 94507, Alamo, Laborna Road 1470 F-term (reference) 4B024 AA01 BA03 BA21 BA27 BA30 BA31 BA80 CA04 CA11 DA03 EA02 EA04 GA11 HA17 4C084 AA02 AA03 AA13 AA17 DA14 DA19 DB22 DB56 DC15 DC16 DC17 NA14 ZA662 ZB052 ZB082 ZC352 4C085 AA13 GG02 GG03 GG04GG

Claims (23)

[Claims] 1. A method for obtaining in vivo expression in a patient of a therapeutic agent encoded by a gene contained in an AAV vector, wherein said patient is suspected of having an immune response to AAV. Comprises: (a) administering to said patient in need of said therapeutic agent a replication-defective recombinant AAV particle (virion) having a gene encoding said therapeutic agent; and (b) administering said AAV vector. Transiently immunosuppressing the humoral immune response of the patient to obtain expression of the therapeutic agent before, during, or within a short period after administration. 2. The method of claim 1, wherein said patient is a human. 3. The method of claim 1, wherein said replication-defective recombinant AAV particles are intranasally, intramuscularly, intraarterially,
3. The method of claim 2, wherein the method is administered intravenously or subcutaneously. 4. The patient's immune system comprises an anti-CD4 antibody, an anti-B7-1 antibody, an anti-B
7-2 antibody, anti-CD40 (antagonistic) antibody, anti-CD40L antibody, anti-CD3 (OKT
3) Antibodies, cyclophosphamide, deoxyspergulin (deoxysperg)
4. The method of claim 3, wherein the immunosuppressive agent is transiently immunosuppressed by administration of a humoral immunosuppressive agent that is ulin (ulin), CTLA4Ig, FK506, or a combination thereof. 5. The method according to claim 5, wherein the humoral immunosuppressant is an anti-CD4 antibody, an anti-B7-1
Anti-B7-2 antibody, anti-CD40 (antagonistic) antibody, anti-CD40L antibody, anti-CD3 (O
The method according to claim 4, which is a KT3) antibody or CTLA4Ig. 6. The method of claim 1, wherein said therapeutic agent is a protein or polypeptide. 7. The method according to claim 7, wherein the protein or polypeptide is erythropoietin,
Thrombopoietin (G-CSF), factor VIII, factor IX, factor Xa,
3. The method according to claim 2, wherein the method is human growth hormone, leptin or IL-2. 8. The method of claim 7, wherein said protein or polypeptide is leptin. 9. The method of claim 7, wherein said protein is erythropoietin. 10. The method of claim 4, wherein the patient's immune system is transiently immunosuppressed both before and after the first administration of rAAV virions. 11. A rAAV encoding a therapeutic protein in a mammalian patient
A method for delivering multiple doses of a virion, comprising: (a) administering to said patient a therapeutically effective amount of a rAAV virion encoding said therapeutic protein; (b) said rAAV virion Transiently immunosuppressing the patient's humoral immune system to obtain expression of the therapeutic protein before and immediately after administration of the compound; and (c) repeating steps (a) and (b) at a later date Performing the method. 12. The method of claim 11, wherein said patient is a human. 13. The method of claim 12, wherein said replication deficient recombinant AAV particles are administered intranasally, intramuscularly, intraarterially, intravenously, or subcutaneously. 14. The patient's immune system may include an anti-CD4 antibody, an anti-B7-1 antibody, an anti-B7-2 antibody, an anti-CD40 (antagonistic) antibody, an anti-CD40L antibody, an anti-CD3 (OK
T3) Antibody, cyclophosphamide, deoxyspergulin, CTLA4Ig, F
14. The method of claim 13, wherein the immunosuppression is transiently by administration of a humoral immunosuppressant that is K506, or a combination thereof. 15. The humoral immunosuppressant may be an anti-CD4 antibody, an anti-B7-1 antibody, an anti-B7-2 antibody, an anti-CD40 (antagonistic) antibody, an anti-CD40L antibody, an anti-CD3 (
15. The method of claim 14, which is an OKT3) antibody, or CTLA4Ig. 16. The method of claim 11, wherein said therapeutic agent is a protein or polypeptide. 17. The method according to claim 12, wherein the protein or polypeptide is erythropoietin, thrombopoietin (G-CSF), factor VIII, factor IX, factor Xa, human growth hormone, leptin or IL-2. the method of. 18. The method of claim 17, wherein said protein or polypeptide is leptin. 19. The method of claim 17, wherein said protein is erythropoietin. 20. The method of claim 14, wherein the patient's immune system is transiently immunosuppressed both before and after the first administration of rAAV virions. 21. A pharmaceutical composition comprising an effective amount of a rAAV virion encoding a therapeutic agent protein and an effective amount of a humoral immunosuppressant suitable for transient immunosuppression of a humoral immune response in a mammalian patient. A pharmaceutical composition comprising a combination in a pharmaceutically acceptable carrier. 22. The pharmaceutical composition according to claim 21, wherein said mammalian patient is a human. 23. The humoral immunosuppressant comprises an anti-CD4 antibody, an anti-B7-1 antibody, an anti-B7-2 antibody, an anti-CD40 (antagonistic) antibody, an anti-CD40L antibody, an anti-CD3 (
23. The pharmaceutical composition according to claim 22, which is an OKT3) antibody or CTLA4Ig.