JP2001501483A - Alphavirus-retrovirus vector - Google Patents

Abstract

(57) Abstract The present invention relates to an RNA vector comprising an alphavirus RNA having inserted therein a recombinant retroviral genome containing a foreign RNA sequence encoding a biologically active substance. The vectors of the invention provide for high level expression of the recombinant retroviral genome directly in the cytoplasm of eukaryotic cells. When co-expressed with retroviral structural proteins, the recombinant genome can be efficiently packaged into an infectious recombinant retrovirus, also referred to as a retroviral vector, which transduces foreign RNA into recipient cells. I can do it. More importantly, the cytoplasmic expression system facilitates efficient production of vectors containing foreign RNA containing genes in combination with introns or other regulatory elements of gene expression. Such vectors have been impossible or very difficult to produce with conventional nuclear expression systems due to RNA splicing.

Description

DETAILED DESCRIPTION OF THE INVENTION                 Alphavirus-retrovirus vector Technical field   The present invention relates to the production of genes in eukaryotic cells, for example for the purpose of human gene therapy. Of infectious recombinant retroviruses that can be used to establish stable expression For production. Background of the Invention   The classic type of human gene therapy involves stabilizing genes in somatic cells of the human body. It is desired to achieve a defined expression. This has been the case in previous experiments. Has been achieved primarily by infecting human cells with retroviral vectors . Retroviruses are RNA viruses that are enveloped in the viral body membrane and whose genome Into a dsDNA, and further into the DNA of the host chromosome Retains an integrase that performs an enzymatic reaction for insertion of the genome of Lucifer d Leung 1992). Integrated viral genome or provirus Is copied by transcription into an RNA molecule, which is transported to the cytoplasm. , And then covered with the viral particle capsid. Use as a vector In some cases, engineering of the proviral DNA is performed and this is (Miller and Rosman 1) 989; Hodgson 1996). Engineered provirus Torovirus DNA vector You. It represents the recombinant retroviral genome. In this DNA, retrovirus Most or all of the gene regions encoding the structural proteins and enzymes of Have been replaced by two foreign genes. Packaging cells, retrovirus Structural proteins (eg, capsid protein gag and membrane protein env); Represents a stably transformed cell line producing the enzyme (Miller 1990) . The retroviral DNA vector is packaged, for example, by transfection. When transfected into ging cells, this vector is transformed into RNA by nuclear transcription machinery. Will be transcribed. This RNA is equivalent to viral RNA. This is recombination Also referred to as retroviral RNA or retroviral RNA vector. Les Torovirus RNA is transported from the cell nucleus to the cytoplasm. There is a retro ui Ruth RNA is a viral body membrane signal (predetermined RNA) by viral structural proteins. Sequence) through the recognition of recombinant retroviral particles, Will be packaged in Like wild-type retroviruses, The ils vector infects target cells and integrates the recombinant genome into the chromosome Can be promoted. However, contrary to wild-type retrovirus, The genome is unable to express viral structural proteins for particle production. Recombination Genomes can only express foreign genes. Recombination in this way Retroviruses are used, for example, with vectors for the expression of foreign genes in human cells. Can be used. Today most retroviral vectors are Molonema Mouse leukemia virus (Moloney Mosc Leukemia Vir us) (MLV) but based on the human immunodeficiency virus (Huma) n Immunodeficient A vector based on the disease virus (HIV) -1 has also been developed ( Miller and Rosman 1989; Naldi 997).   The principle of using retrovirus-based vectors for human gene therapy is experimental Proven, but its practical use still has many problems You. These include, among others, (1) low levels of vector production in current production systems. (2) instability of vector preparations, (3) vector preparations against complement attack Susceptibility, (4) lack of cell targeting specificity of the particle, (5) infecting non-dividing cells (6) Insufficiency of exogenous genes in the transduced cells. (7) lack of tissue and cell differentiation specific gene expression, and And (8) a short expression period of the exogenous gene.   The latter three issues are related to the mode of gene expression and these are mainly The vector system actually transduces the cDNA form of the processed mRNA. Is the result of the fact that it is limited to These minigenes are usually Is not compatible with efficient, durable and regulatable gene expression. This For example, introns, enhancers, and others such as locus regulatory elements Of natural genetic elements. This is the case in many studies today. (Grosveld, van Assendelft et al. 19). 87; Konieczny and Emerson 1987; Rossi and de Crombrugge 1987; Bender, Mille 1988; Brinster, Allen et al. 198. 8; Buchman and Berg 1988; Chang, Liu et al. 92; Jonsson, Foresman et al. 1992). However, like this Elements cannot be incorporated into retroviral vectors because These elements are the recombinant redo if they are reproduced in the nucleus of the producer cell. This is to bring about the splicing of rovirus. For example, one intron When introduced into a retroviral vector with a foreign gene, the Ron will be efficiently removed by splicing (Shimotoh no and Temin 1982; Sorge and Hughes 1 982). Insert foreign gene with intron into provirus in reverse orientation Attempts have been made to “hide” splice signals, In some cases, a new accidental splice signal is usually placed in the opposite sequence. (Lebowch, Huang et al. 1994; Jonsson, Ha. bel et al. 1995). A wide variety of alternative regulatory elements for gene expression A similar problem is encountered when introducing into a lus vector (Mclvor 199). 0).   Another problem with modern retroviral vector systems is that the virus in the producer cell Slow synthesis rate of the structural proteins, the nature of the retroviral assembly process, and And the function of retroviral structural proteins. So in theory a virus Newly redesigned structural proteins increase stability and It should be possible to obtain particles with even more important functions. For example, The cell targeting function of the vector is achieved by engineering the env protein May be changeable. However, there are a number of different Doctor breaks Variant and, therefore, rapid to produce retroviral vectors Construction and testing of a convenient system is required. Different series for such purpose The establishment of all packaging cell lines in the US will be extremely time consuming. Therefore recombination A transient production system for retroviral particles has recently been developed (Landau).   and Littman 1992; Soneoka, Cannon et al. 199. 5) In these systems, genes for retroviral structural proteins and retroviruses are used. The irs recombinant genome is co-transfected into cells and the recombinant Virus particles, recombinant retroviral RNA, as well as viral structural proteins Produced as a result of transient nuclear co-expression of mRNA for quality and enzymes. This The use of these systems for only about 3 days requires the preparation of recombinant retroviral vector preparations. Required for creation. However, the yield of vectors obtained by these systems is Usually very low, especially the three component gene mixture (envgene,gag-p ol Gene and recombinant retroviral DNA) Required.   The present invention provides an infectious recombinant retrovirus when introduced into the cytoplasm of a eukaryotic cell. Alphavirus-retrovirus or RNA driving efficient production of ruth particles Provide the vector. Preparations containing high concentrations of recombinant retroviral vectors are: Produced by incubating producer cells for only 10 hours Can be. In addition, it contains introns, as well as other regulatory elements of gene expression The gene can be encapsulated in the recombinant particles with a capsid. These vectors are Based on the alphavirus genome RNΛ molecule. These RNA molecules are positive ( +) Polar and virus polymer at the onset of alphavirus infection La Translated into a protein. This polymerase replicates the viral genome, and Furthermore, the 3 'end is used as an mRNA for an alphavirus structural protein. Transcribes into a functional viral subgenome. Alphavirus expression is very efficient And results in mass production of viral RNA and proteins. These properties Thus, alphaviruses are required for expression of foreign genes in eukaryotic cells. Self-replicating "RNA vectors (Xiong, Levis et al. 1). 989; Lilj Within the exogenous gene is inserted within the subgenomic region of the alphavirus. Recombination When the RNA is transfected into the cell cytoplasm, the recombinant RNA Replicates and is transcribed into a recombinant subgenome, which Translated into sex gene product. As an alternative to transfection, recombinant Packaging the rufavirus genome into alphavirus particles, and The cells can also be transduced by ills infection. This recombinant particle is Replace the alphavirus genome with a "helper" variant of the alphavirus genome It is produced by co-expression together with The latter is a complete alphavirus Gene and its promoter region, and all RNs required for RNA replication A element is included. However, the RNA elements required for packaging are lacking. ing. The main advantages of using an alphavirus expression system are high level expression, rapid Fast and easy to use, as well as alfa to infect a wide variety of host cells The possibility of using virus particles.   Thus, the recombinant retroviral genome (introns and gene expression With or without other regulatory elements), and then Into infectious recombinant retroviral particles, also known as retroviral vectors Alphavirus-retroviral RNA molecules that can be packaged with Is also referred to as alphavirus-retroviral RNA-vector) It is one object of the present invention to provide.   Recombinant alphavirus comprising an alphavirus-retroviral RNA molecule as described above It is another object of the present invention to provide irs particles.   Replication of the previously described recombinant alpha-retroviral RNA in cells, its recombination Transcription into the retroviral genome and infectious recombinant retroviruses of the latter genome It is an object of the present invention to provide methods and compositions that allow for packaging into particles. It is yet another object of the invention.   We use the alphavirus-retroviral RNA vector to In our efforts to produce functional retroviral vectors, I was able to predict a difficult point. First, all retroviral patches described so far In the caging system, the retroviral gene is produced in the nucleus and It is not produced in the cytoplasm as is the case when using a lus expression vector. Les If nuclear localization of the Torovirus genome is required for efficient packaging, It is very likely that the alphavirus operable expression system will be inappropriate. Second, the book The production of retroviral genomes in the form of alphavirus subgenomes Is not possible because the latter has alphavirus features at its 5 'and 3' ends. This is because some heterologous sequences are required. These are alphavirus-subgenic Nom promoter 3 'region and non-structural protein 4 The 5 'terminal sequence which constructs both coding sequences, as well as the viral RNA 3 'terminal sequence for constructing a signal (Strauss and Stra uss 1994). Therefore, these sequences were added to the 5 'end of the retroviral genome. And the 3 'end can be added to the retrovirus by the alphavirus vector. Required for expression of the lus genome. The addition of such an arrangement would result in retro-introduced particles. Packaging, reverse transcription, polymerization of double-stranded DNA, chromosomal integration And how much it affects expression was not clear to us. Summary of the Invention   The present invention relates to an alphavirus R into which a recombinant retroviral genome has been inserted. A vector containing NA. In one aspect of the invention, an alphavirus RN A: Semliki Forest virus (S) FV) RNA and the recombinant retroviral genome comprises one recombinant genome including.   In another aspect of the invention, an intron (or some other alternative for gene expression) is used. Inserted recombination vectors, including foreign genes with or without regulatory elements) An alphavirus RNA having a torovirus genome is provided. The viral RNA is used to replicate the alphavirus structural proteins Alphavirus particle replication of said RNA in the presence of tent helper RNA And packaging.   In yet another aspect of the invention, introns (or some for gene expression) Other regulatory elements), including exogenous genes with or without Alphavirus RNA with inserted recombinant retrovirus genome provided This alphavirus RNA allows the replication of the retrovirus genome, Replication helper RNA encoding structural and retroviral proteins Of the retroviral genome into recombinant retroviral particles in the presence of Aging becomes possible.   In yet another aspect of the invention, introns (or some for gene expression) Recombinant regulatory elements, including foreign genes with or without additional regulatory elements Genetically modified, including alphavirus RNA into which the ils genome has been inserted Provided alphaviruses and / or cells are provided. BRIEF DESCRIPTION OF THE FIGURES   FIG. 1A depicts the DNA sequence near the SFV subgenomic promoter. M The LV recombinant genome was inserted into the SmaI site of the pSFV1-Nru1 vector. ing.   FIG. 1B depicts the pSFV1 / LN3i construct. SFV recombination of construct Only the area is shown. This region is from the SP6 promoter (white arrow) to Nru It extends to the I site. The constructs were constructed in the 5 'to 3' direction with (i) SFV RNA 5 'replication signal of (ii) SFV replication complex (nonstructural protein, nsp, Gene encoding 1-4), (iii) internal subgenomic promoter of SFV (Black arrow), (iv) MLV vector pLN (Miller and Rosm an 1989), an envelope signal (ψ).⁺), Neo^R Recombinant MLV genome containing gene and 3 'U3-R sequence and 5' R region 38 SFV-specific bases both in front and between the 3 'U3 and the R region (* (V) 3V replication signal of SFV RNA and (vi) SFV geno It contains a polyA region of the gene. The code shown Note that the region is not to scale.   FIG. 2 depicts the construction of plasmid pSFV1 / LN3i. Related restrictions The nuclease sites and engineering steps are indicated.   FIG. 3 depicts RNA analysis of transfected cells. BHK- 21 cells were treated with SFV1 / LN3i RNA (row 1), SFV1 / gag-pol RNA (lane 2), SFV1 / Pr80env RNA (lane 3) or three RNAs Transfection using all (column 4) I did. Transfected cells¹⁴C] Actino using uridine Labeled for 6 hours in the presence of mycin D. Isolate cellular RNA and formaldehyde On a 0.7% agarose gel containing Radioactively labeled bands Visualization by autoradiography. Replicated genomic RNA and transcribed Shows the location of the subgenomic RNA.   FIG. 4 shows SFV1 / LN3i RNA, SFV1 / gag-pol RNA, S BHK-2 co-transfected with FV1 / AMenv RNA 1 depicts cell-associated and extracellular protein analysis from one cell. lys: Cell lysate, ip: cell lysate immunoprecipitation, med: medium, M: marker . The envelope and gag protein products are shown.   FIG. 5 shows transfection using SFV1 / gag-pol RNA. Using SFV-C / gag-pol RNA in cells That gag precursor production is more effective in I have. MLV-specific Pr65 gag, p30 and pp12 proteins are shown. ing.   FIG. 6 depicts the construction of the pSFV1 / LN-U3 insert. pSFV1 / LN For the -U3 insert, pLN (Miller and Rosman 198 9) Recombinant MLV genome (U3-R-U5-ψ)⁺-Neo^R-U3- R) was replaced with the BamHI and SmaI portions of the plasmid pSFV1-NruI plasmid. It was inserted between the positions (FIGS. 6A and B). The 5 'end of the recombinant MLV genome 35-base containing a portion of the SFV subgenomic promoter The SFV sequence (indicated by *) specifies DNA integration (specifying) Immediately after the array Note that is also inserted into 3'U3 at (Fig. 6B and C).   FIG. 7 depicts the construction of plasmid pSFV1-I-CAT. (A) is pC 1 is a schematic diagram of the structure of an AT3-promoter vector. pSFV1-I-CAT The engineering strategy is shown in (B). (C) shows recombination of SFV1-I-CAT. It is a schematic diagram of the obtained SFV region. CAT gene having introns is transformed into pCAT 3-promoter vector (Promega) (FIG. 7A) It was inserted into pSFV1 / LN3i as an I-BamHI fragment. this For ease, a unique BamHI site was added in the latter plasmid, neo neo.^RRemains Made at a location after the gene region. Intermediate was pSFV1 / LN3i (BNNP ). This involves first removing the two existing BamHI sites, followed by It was necessary to insert a new site. Figure 7B abbreviates engineering strategy Shown diagrammatically, FIG. 3C shows the recombinant SFV portion in pSFV1-I-CAT. 2 shows a functional gene region of the present invention. PSFV1-CAT without intron is an intro The pS-containing DNA fragment is excised with Hind III to give pS Derived from FV1-I-CAT.   FIG. 8 shows introns (SFV1-I-CAT) or without introns (SFV1-I-CAT). SFV1-CAT) infected with recombinant retroviral particles containing Cat gene 7 depicts CAT activity in allowed NIH 3T3 cells. NIH 3T3 fine The vesicles are 5 × 10 4 in a 60 mm dish 24 hours prior to infection.^FivePlate on cells / dish Nourished. 1x10 cells^FiveWere infected with the recombinant 4 retroviral particles. Feeling 52 hours after dyeing, CAT E nzyme Assay System With Reporter Lys CAT activity was examined using is Buffer (Promega). Brief note The cell extract was¹⁴C] labeled chloramphenicol and n-butyryl complement In a reaction mixture containing enzyme A (n-Butyryl Coenzyme A) For 16 hours at 37 ° C. CAT is the cofactor n-butyl The rill moiety is transferred to chloramphenicol. The reaction product was Extracted with ren. n-butyrylchloramphenicol is mainly in the chilesin phase Chloramphenicol remains primarily in the aqueous phase. Xylene phase Is mixed with 3 ml of scintillant, and the I undone. The cpm measured in each sample is the butyrylated chloramphene. Indicates Nicole. Detailed description of the invention   The RNA vectors of the present invention may be used in the host cytoplasm in several different eukaryotic cells. Means to replicate and express the recombinant retroviral genome independent of the nucleus provide. The expressed recombinant retrovirus genome is transcribed into retrovirus structural When co-expressed with proteins, they are also infectious, also called "retroviral vectors" It can be packaged into recombinant retroviral particles. Recombination Leto Lovirus genome is the envelope of the retrovirus genome in retrovirus particles, Reverse transcription, dsDNA synthesis, retroviral DNA integration into host chromosome and RN required in cis for retroviral DNA transcription in the cell nucleus Refers to "retroviral RNA genome" containing all A elements. Further recombination In the retroviral genome, retroviral structural The region encoding the protein was replaced with a heterologous sequence encoding a heterologous protein. Different The seed gene may also be linked to an intron or some other regulatory element of gene expression. it can. Since RNA replication in this expression system is cytoplasmic, the latter sequence is Will not see nuclear RNA processing phenomena such as licensing. Recombination Leto Virus particles are recombinant retrovirus genomes (introns or gene (With or without any other current regulatory elements) Refers to particles that are packaged. This recombinant particle is retrovirally transmitted Of the recombinant retroviral genome into new cells through the process Entry can be mediated.   The method and composition are briefly described below. For construction of RNA vector, we Used the pSFV1-NruI plasmid, in which we used the plasmid pLN ( Miller and Rosman 1989). Nom, RU5-ψ⁺-Neo^R-U3-R was inserted (Figure 1). pSFV1-N The ruI plasmid has been described previously. f 1991), which is the StuI and HindIII of pSFV1. Includes a 527 base pair deletion between the sites, and a SpeI site in pSFV1 Has been changed to a NruI site. Recombinant retro into pSFV1-Nrul Insertion of the viral genome was performed by combining the recombinant retrovirus genome with the SFV subgenome. (FIG. 1A). using this method Recombinant retroviral genome is expressed instead of viral subgenomic RNA You. However, the promoter region for the SFV subgenome is the subgenomic transcript itself. End (e xtreme) 5 'region, so that The 5 'end cannot be directly linked at the transcription start site, and (Strauss and Strauss 1994) ). We used the 5'-gene fusion to transfer the plasmid pSFV1-NruI plasmid. Performed at the SmaI site 38 bases downstream from the transcription start site. Thus roll The transcribed recombinant retroviral genome has a 38-base SFV gene at its 5 'end. It will contain extraneous residues (see FIG. 1A). This creates another problem Was. According to the model for retroviral DNA synthesis by reverse transcriptase, Strong-stop DNA near the 5 'end of the rovirus RNA genome. stop DNA) is synthesized (Ramsey and Panganiba). n 1993). This strong-stop DNA then jumps to the 3 'end and the exposed R Sequence is the 3 'end of the retroviral RNA genome for the synthesis of minus-strand DNA Hybridizes with the complementary R sequence. 38 inserted before the 5 'terminal R region SFV-specific bases will interfere with negative strand synthesis. To double-stranded DNA To facilitate the conversion of RNA, we used the same 38-base long SFV sequence to 3 Also inserted between the 'U3 and R regions (FIG. 1B). In all of these operations, We are interested in molecular biology, which can be used by any expert in the art. Standard methods were used.   We have found that the 38-base SFV sequence in the pSFV1 / LN3i insert has been integrated. From the 5 'end of the modified recombinant retrovirus genome and the integrated genome 5 'of the resulting transcript (Ramsey and   Panganiban 1993). this Is expected to have a negative effect on the expression efficiency of the recombinant gene. Avoid this problem To construct, we constructed the pSFV1 / LN-U3 insert. In this construct, Recombinant retrovirus genome derived from pLN (U3-R-U5-ψ)⁺-Ne o^R-U3-R) was replaced with BamHI and SmaI of the pSFV1-NruI plasmid. Inserted between sites (see FIGS. 6A and B). SFV Subgenome Promo The 35-base SFV-specific sequence containing part of the promoter region And the beginning of the recombinant retroviral genome. Transpose same sequence The 3'U3 region of the retroviral genome also regulates retroviral DNA integration. This was inserted at a position immediately downstream of the region to be defined (FIGS. 6B and C). In this case, The process of double-stranded DNA synthesis of the recombinant retrovirus may be integrated into the chromosome. Resulting in a DNA molecule with no SFV-specific sequence at its 5 'end and The FV sequence will not be at the 5 'end of the transcribed RNA.   Plasmid pSFV for transcription of the corresponding RNA vector in vitro 1 / LN3i was used. This was recorded using SP6 polymerase. ff 1991). RNA was transfected into BHK-21 cells and cells were Following its replication in the cytoplasm¹⁴Labeled with C-uridine for 6 hours. Cytoplasm Samples containing RNA were analyzed on agarose gel. Row 1 of FIG. Indicates that both subgenomic RNAs were produced. This is SFV1 / LN3i   RNA vectors for the production of recombinant retroviral genomic molecules in the cytoplasm It shows that it can be used. In this way, we get into the cytoplasm Derivation of vector RNA RNA transfection was used for input. Another method is SFV ff 1991) using this transfection with SFV particles. And then infect BHK-21 cells with the recombinant SFV particles. Is Rukoto.   The key question is that the recombinant retroviral genome produced in the cytoplasm of the cell is When sensitive to packaging into recombinant retroviral particles there were. This relates to the SFV1 / LN3i RNA, the RNA and the retrovirus. Two other SFV-RNA vectors expressing a ruth structural protein and an enzyme Were examined by co-transfection. The latter RNA is plasmid p SFV-C / gag-pol (or pSFV1 / gag-pol) and pSFV Transcribed from 1 / AMenv (or pSFV1 / Pr80env). pSFV1 / Gag-pol plasmid contains the coding region of gag-pol of MLV. (Suomalainen and Garoff 1994). This is pS It is also present in FV-C / gag-pol. The latter plasmid is also used for SFV The psid coding region is contained before gag-pol. Transcribed C-gag-p ol RNA, the C-region is gag-p erg, Suomalainen et al. 1994). pSFV1 / Pr 80env contains the coding region of the cognate (homogeneous) MLV env precursor protein. SFV1 / AMenv encodes a heterologous amphoteric env precursor protein Containing territory. The latter envelope protein becomes a recombinant retroviral particle Wide range of animal hosts, including human cells Has the ability to target cells, but homologous env recognizes only mouse cells . SFV1 / LN3i, SFV-C / gag-pol and SFV1 / AMenv   Protein synthesis in cells co-transfected with RNA [³⁵Followed by metabolic labeling with [S] methionine. Results of pulse-labeling experiment Is shown in FIG. This means that all retroviral structural proteins are It shows that it was expressed. Co-transfected viral particle formation Followed by analysis of cultures from the isolated cells. Has the correct protein composition Particles were found (FIG. 4). NIH 3T3 cells using media containing particles And then Neo with G418^RBy selecting transformed cells And studied the infectivity of the particles. The results (Table 1, p. 15) are based on our production method. Showed that infectious particles were formed. This is a significant finding, which is (1 ) Produced in the cytoplasm and in the nucleus as during wild-type retroviral infection Non-recombinant recombinant retrovirus packaged in infectious retroviral particles And (2) a subgenomic recombinant retroviral RNA molecule Of SFV-derived RNA sequence into recombinant retroviral particle Efficient packaging of recombinant retroviral RNA, reverse transcription, dsDNA synthesis, Integration of retroviral DNA into the host chromosome and expression of the integrated gene Because it shows that it is compatible with the present. Most importantly recombination The time course of particle production (Table 1) includes SFV-C / gag-pol RNA. When using an RNA combination, 10 ml / ml of culture medium⁶More than one grain Incubation required for generation of vector composition (preparation) having an offspring Ovation time is 10 hours It indicates that: This is the case for both homogeneous and amphoteric env proteins. This is true for recombinant retroviral particles having 3 consecutive 5 hours Analysis of cultures from incubations at each of the incubation intervals Between 2-4x10⁶Particles were released. These recombination records The concentration of torovirus particles is very high and can be used in other stable or transitional producer cell lines. Highest enrichment reported for more produced recombinant retroviral vectors Degrees (Miller and Rosman 1989; Landau)   and Littman 1992; Pear, Nolan et al. 1 993; Finer, Dull et al. 1994; Soneoka, Ca Nonn et al. 1995).   Similar studies were performed using RNA made from the pSFV1 / LN-U3 insert. Was. The titer of the corresponding recombinant retrovirus composition depends on pSFV1-LN3i. The titers were approximately the same as those obtained with the incoming RNA.   It is possible to encapsulate a gene containing introns into recombinant retroviral particles. Whether they can be used and whether they can be used for gene transduction To investigate, we have chloramphenicol acetyl tiger with intron The transferase (CAT) gene was inserted into SFV1 / LN3i (FIG. 7). The resulting plasmid was called pSFV1-I-CAT. As standard we The corresponding construct without plon (pSFV1-CAT) was used. Intron For producing a retroviral particle containing a CAT gene with or without CAT gene First, we first correspond to SFV1-I-CAT and SFV1-CAT RNA. Transcribed in vitro from the plasmid. Each RNA was then converted to SFV-C / gag- pol and SFV1-env RNA into BHK-21 cells. Was taken. The latter two RNAs are responsible for gag-pol and env precursor production. Stipulate. Incubate cells for 10-15 hours after transfection And collected the culture. Then, using the released recombinant retrovirus, CAT The gene was transduced into NIH 3T3 cells. After 52 hours, the standard CAT The CAT activity of the cells was measured using Sey (FIG. 8). CAT with intron Very high CAT activity found in cells infected with the vector containing the gene Cells transfected with an intronless vector Very low activity was found in the vesicles. Thus this is an intron containing CA The T gene was successfully transformed into recipient cells using the retroviral vector. And that it resulted in effective CAT expression.   Consider using recombinant retroviral vectors for human gene therapy It is important to evaluate the safety hazards at the time Recombination Retro Will The major danger in the case of vector compositions is replication sensitive (1 replication). component) contamination by retroviral particles. Duplicate sensitive particles Have acquired all retroviral structural protein genes, and It has the ability to spread from to cells. Such particles can process RNA recombination Produced in producer cells. Replication-sensitive particles in our production system Was investigated using a marker rescue assay (van Beu). See, Chem, Kukler et al. 1990). 2.6x10⁶ No replication-sensitive particles were found in samples containing infectious recombinant particles Was. We have developed an alphavirus-retrotype without detectable production of replication sensitive particles. Expression of recombinant retroviral genome using viral RNA vector That possesses an amphoteric or homologous envelope protein. Concluded that it could be packaged into an infectious recombinant retroviral vector. Was.   Overall, we herein describe the production of retroviral vectors for production. A novel cytoplasmic expression system is described. We believe that this system is an intron containing gene 5 promotes efficient packaging into retroviral vectors. I They also show that such vectors, as expected, do not contain introns. And directing gene expression much more efficiently than vectors carrying. We have previously produced vectors carrying the intron-associated CAT gene. Although only the suitability of this system has been demonstrated for Considered equally applicable to the production of vectors with different intron-containing genes There are good reasons. For example, effective and tissue-specific expression of β-globulin Using a β-globulin gene complex that contains Obtained in transfected cells (Chang, Liu et al. al. 1992). Using our system, this gene complex can be retrovirused at high titer. Lus vector and package it with a hemoglobin disorder such as β-thalassemia. Could be used to treat harm. Similarly, directing effective Factor IX expression Factor IX gene-intron complex has been characterized (Kurachi, Hi tomi et al. 1995). This is also the system we described in this disclosure. Can be packaged into a retroviral vector. That Such vectors are useful for gene therapy in patients suffering from hemophilia B, a bleeding disorder. possible.   We also find that our retroviral vector production system is very fast and effective. R: high concentration of vector particles (> 10⁶Composition containing particles / ml) The incubation time of transfected cells needed to Indicates only 10 hours. This system is based on the quality of the packaging components and thus the It also allows for convenient variation in the function of the recombinant retroviral particle. So this new A simple retrovirus vector production system is effective for the use of recombinant retroviral particles, Would meet the demand for a simple and easy production system. Its use is specific to gene therapy It will speed up the engineering of more suitable particles for the purpose.   In our example, we used an SFV expression vector to produce the MLV vector. Was used. Due to the great similarity between the various alphaviruses (Strauss   and Strauss 1994), any alphavirus expression vector -(Eg, Sindbis virus vector, (Xiong, Levis et a) l. 1989)) could also be used to produce retroviral vectors Is done. Similarly, we use the alphavirus vector in our example. Has shown only how to produce MLV vectors. Retrovirus-based vectors, such as the HIV-1 vector (Naldin) i, et al. 1997) would be equally possible. Finally, I In various embodiments, we use the SFV RNA vector It should be noted that it has produced retroviral structural proteins and enzymes. You. This is one of the main reasons for obtaining high titer stock solutions, Packaging components of other heterologous expression systems (both transitional and stable) Obviously, it can be produced byExample 1   All restriction enzymes and DNA modifying enzymes are from Promega (SDS, folder). Kemberg, Sweden), New England Biolabs (New England Bi olabs) (In Vitro AB, Stockholm, Sweden) and Stratagene ( Straragene) (La Jolla, California, USA), and Used as indicated. [³⁵[S] methionine is available from Amersham (Buckinga) Musia, UK). [¹⁴C] Uridine is DuPont (Du Medica Le Scandinavia: Du Medical Scandinavia AB, Sorenluna, Sweden ). PCR primers are available from Scandinavi Gene Synthesis, Inc. ian Gene Synthesis AB) (Couping, Sweden) and Cybergene (C yberGene AB) (Hüding, Sweden). Plasmid pSFV1 / Pr80  env was described by Suomalainen et al. (Suomalainen and Garoff 1994). Plastic Smid pLN was described in Miller (Miller and Rosman 1989).Example 2   This example demonstrates the construction of pSFV1 / LN3i. This procedure is shown schematically in FIG. ing. pSFV1 / LN3i is a recombinant MLV genome derived from pLN (R-U5-ψ⁺-neo^R-U3-R) (Mille r and Rosman 1989) were transformed with the pSFV1-NruI plasmid vector.SmaIInsert into site (FIG. 1A). Recombinant retroviral genome in pSFV1 / LN3i Was blunted at the 5 'end with 38 SFV-specific bases (some of which were internal SFV pro Motor and SFV unstructured auss and Strauss 1994). Easy conversion of RNA to double-stranded DNA To do this, the same 38-base long SFV sequence was inserted between the 3'U3 and R regions. this Fusion-PCR using Vent DNA polymerase (New England Biolabs) Was performed. The following primers were used in the fusion PCR reaction;   PLN containing 3 'LTR /EcoRIThe fragment was used as template DNA. The reaction mixture is 9 Denature at 4 ° C for 45 seconds, anneal at 50 ° C for 45 seconds, and extend for 1 minute at 72 ° C. I let you. After 25 cycles of amplification, the fusion PCR product is transferred to the Wizard PCR Preps DNA purification system. (Promega, SDS, Valkenberg, Sweden). Fusion Combined PCR fragmentHindIIIandXba IAnd digest with pUC18 plasmid vector. OfHindIIIandXba ISubcloned between sites, pUC18 / inserted plasmid It was created. The fusion PCR fragment was confirmed by sequence analysis. This pUC18 / insertion plus MidHindIIITo cut the DNA polymerase I large (Klenow) fragment. Fill, and thenXba IAnd cut. 262bpHindIII(plant)-Xba I The fragment was isolated. pLN plasmidAsc IWith DNA polymerase I Fill large (Klenow) pieces and thenXba IAnd cut. 222lbpA sc I (plant)-Xba IThe fragment was isolated. pSFV1 / LN3i is pLN /Asc I(plant)-Xba I Fragment and pUC18 / insertHindIII(P (Land)-Xba IThe fragment was digested with pSFV1-NruI as shown in FIG.Sma IBe tied to cutting And created by.Example 3   This example shows the construction of pSFV1 / gag-pol and SFV-C / gag-pol. Plasmi PSFV1 / gag-pol is the MLV retrovirus structural precursor protein gag and fusion protein Contains the coding sequence of the gag-pol protein. The latter pol-part is for all viruses It is a precursor for enzymes. In plasmid pSFV-C / gag-pol, SFV capsi An RNA sequence that enhances the translation of the gad-pol gene in pSFV1 / gag-pol Was inserted. pSFV1 / gag-pol is an MLV gag-pol cDNA derived from pNCA (Colicelli and G off 1988), pSFV1BamH IIt was created by insertion into the site. gag-pol cDNA Two ofSpe IThe site is an oligonucleotide (Su and El-Gewely 1988) using site-directed mutagenesis . pSFV-C / gag-pol is the pSFV-1 / gag-polNot I-Bsm IFragment (14410 bp) and pSFV-C / P r65gagNot I-Bsm IFragment (2723 bp) was created by ligation (Suomalainen And Garoff 1994).Example 4   This example shows the construction of pSFV1 / AMenv. Plasmid pSFV1 / AMenv is used for mouse Includes coding sequence for tuberculosis virus (4070A) envelope protein. pPA An amphoteric envelope genetic fragment from M3 (Miller and Burtimore 1986) was first Was inserted into pUC18 by a subcloning step to prepare pUC18 / AMenv. plus Mid pSFV1 / AMenv is pUC18 / AM8nv Of originSma I-HpalThe fragment (1976 bp) was ligated with pSFV1-NruI.Sma IBy inserting into the site Created.Example 5   This example demonstrates the construction of pSFV1-NruI. Plasmid pSFV1 [Lijes The pieces were filled with ONA polymerase I large (Klenow) fragment and ligated. The deleted pixmid molecule is cloned and used for in vitro mutagenesis. Used. In this process,Spe IRecognition sequence (ACTAGT)Nru I(TCGCGA) recognition sequence Was. This created the plasmid pSFV1-NruI.Example 6   This example demonstrates the replication of SFV1 / LN3i and the transcription of recombinant retroviral RNA. Show. Run-off transcripts are obtained in vitro.Nru-I-Linearized pSFV1 / roff 1991). 8 × 10 RNA (20 μl)⁶BHK-21 cells (Rockby, MD, USA To the American Type Culture Collection) by electroporation. I did it. Electroporation is performed at room temperature at 0.85 kV and 25 μF with two successive passes. Lus uses the Bio-Rad Gene Balcer device (Richmond, California) (Fornia, USA). Transfected BHK-21 cells into 3 Plated on 3 mm culture dishes and incubated at 37 ° C. for 2 hours. Medium Was removed and 1 μg / ml of actinomycin D (Sigma-Aldrich Sway) Den, Stockholm, Sweden) in 1 ml aliquots of medium containing Was. After incubation at 37 ° C for 2 hours, the medium was incubated at 1 μg / ml. Chinomycin D and 75 Kbq [¹⁴C] Uridine (2.1 GBq / mmol, DuPont Med. 1m of medium containing Scandinavia, Sorenluna, Sweden) l Changed to an aliquot. After incubation at 37 ° C for 6 hours, cellular R NA uses TRIzol reagent (GIBCO, Life Technologies: GIBCO Life Technologie s AB, Tevay, Sweden) was used as described by the manufacturer. RNA RNase-free H_Two0.7% agaro dissolved in O and containing formaldehyde Electrophoresis through a gel was performed (Sambrook, Frisch et al., 1989). Let the gel dry And the radiolabeled RNA was visualized by autoradiography. FIG. As shown in lane 1, high levels of replicated genomic SFV1 / LN3i RNA and Both transcribed subgenomic SFV1 / LN3i RNAs are present in transfected cells Transcribed. BHK-21 cells were transformed with SFV1 / LN3i RNA and two other RNAs (each Is the SFV1 / gag-pol RNA containing the coding regions of the retrovirus gag-pol and env And SFV1 / Pr80env RNA) when cotransfected All genomic and subgenomic RNA is produced in co-transfected cells (FIG. 3, lane 4). Lanes 2 and 3 show SFV1 / gag-pol RNA and SFV1 4 shows RNA production in cells transfected with / Pr80env RNA, respectively.Example 7   This example uses SFV1 / LN3i RNA, SFV1 / gag-pol RNA and SFV1 / AMenv RNA. Protein synthesis in co-transfected cells by electroporation This is shown. The transfected cells were added to 9 ml of complete BHK-21 medium and three 33 Seed in mm culture dishes and incubate at 37 ° C Privation. Eight hours after electroporation, the transfected cells were phosphate-relaxed. Wash with buffer (PBS) and supplement 2 ml of 20 mM Hepes at 37 ° C. for 30 minutes Methionine-free minimum essential medium (MEM, GIBCO Life Technologies, Theby, Sweden). Next, the medium is 0 μCi [³⁵Replaced with 0.5 ml methionine-free MEM containing [S] methionine . After a 30 minute pulse, cells were washed twice with 20 mM Hepes and 150 μg / ml unlabeled methionine. Then, the cells were washed with MEM containing chloroplast (Chase medium). Next, check the incubation. For 3 hours in medium. Collect the medium, wash the cell monolayer once with PBS, and Then 0.3 ml of lysis buffer [1% sodium dodecyl sulfate (SDS), 10 mM iodophor Cetamide]. Media samples and cell lysates are clarified by centrifugation (Eppendorf centrifugation, 6000 rpm, 6 minutes). Cell lysate (0.3 ml) is transferred to a 3 ml NET buffer. Buffer (150 mM NaCl, 1 mM EDTA, 50 mM Tris-HCl, pH 7.5, 0.1% NP-40, 0.25% Gelatin, 0.02% sodium azide). Immunize MLV-specific proteins For sedimentation, 5 μl of polyclonal porcine anti-MLV antiserum (HCl85, quali Tea Biotech: Quality Biotech, Candem, NJ, USA ) And 40 μl of protein A-Sepharose (Pharmacia, Uppsala) , Sweden) slurry [1: 1 (vol / vol) in 10 mM Tris-HCl] Added to diluted cell lysate and samples incubated overnight at 4 ° C . Immunoprecipitates were washed as previously described [Wahlberg, 1989 # 23] and SDS- Analyzed under reducing conditions by PAGE (12%). Extracellular particles in medium samples are reduced to 20% Pelleted through a blue cushion (17,000 rpm, 2 hours, 10 ° C, bed) Kuman: Beckman JA 18.1 rotor). The pellet was analyzed by SDS-PAGE as described above. Dry the gel and (Fuji) film (Fuji Photo Film Co., Tokyo, Japan). Figure the result It is shown in FIG. In cells transfected with all retroviral proteins And incorporated into virus-like particles. gag precursor protein (Pr 65) was observed in cell lysates and virus-like particles. Most Pr65 It was cleaved into mature products p30 and pp12. Two additional gag proteins P15 (matrix protein) and p10 (nucleocapsid protein) Invisible because it lacks methionine. Amphoteric envelope precursors in cell lysates Protein (Pr85) is converted to surface proteins (gp70) and membranes by cellular proteases. It was cleaved into a penetrating protein (p15E). Only gp70 and p15E are virus-like particles Was taken in. p15E was cleaved to p12E by viral protease.Example 8   This example demonstrates gag in cells transfected with SFV-C / gag-pol RNA. -pol product expression is higher in cells transfected with SFV1 / gag-pol RNA Is also very high. BHK-21 cells contain 20 μl of SFV-C / gag-pol RNA or 20 μl of SFV1 / Transfection was performed by electroporation using gag-pol RNA. Transfect The cells were pulsed for 30 minutes and chased for 15 minutes to 2 hours as described above. Was. MLV proteins associated with the cell and extracellular are converted to SDS-PAGE under reducing conditions. (12%). FIG. 5 shows the results. Transcript using SFV1 / gag-pol RNA SFV-C / gag-pol R compared to the product gag-pol produced in the transfected cells About 5 times more gsg-pol product in cells transfected with NA Was produced. Example 9   In this example, the infectious recombinant retroviral particles were identified as SFV1 / LN3i R NA, RNA of SFV1 / gag-pol (or SFV-C / gag-po 1 RNA) and RNA of SFV1 / Pe80env (or SFV1 / A Produced by cells co-transfected with Menv RNA) Prove that. Transfected BHK-21 cells were added to 9 ml of complete B Dilute in HK medium and add 6 ml of cell suspension (4 × 10⁶Contains viable cells On a 60 mm culture dish (Nunclon, Roskilde, Denmark) Was. The cells are incubated at 37 ° C. and the medium is removed from the same dish for 5 hours Harvested at intervals and replaced with 2 ml aliquots of fresh complete BHK medium. Culture Pass the ground through a 0.45 μm filter and store at −130 ° C.^RTransduction Viable retroviral particles were titred in NIH 3T3 cells. . This allowed NIH 3T3 cells to be transferred on day 1 to 5 × cells per dish (60 mm). Ten^FiveInoculated individually. On the second day, a 1 ml aliquot of a 10-fold serial dilution of the media sample The coat was coated with 4 μg / ml Polybrene (Sigma-Aldrich). ldrich) monolayer of cells in the presence of Sweden, Stockholm, Sweden Was added. After 2 hours incubation at 37 ° C, 4 μg / ml polybrene Add a 1 ml aliquot of medium containing to each dish and incubate at 37 ° C. Continued. On the third day, after 24 hours of incubation, cells were harvested at 1 mg / m l G418 (Geneticin, Gibco, Life Technologies AB (L contains ife Technologies AB), Tebii, Sweden 1: 100 in selective media. On day 9, place the selection medium fresh Changed. On day 15, G418-resistant colonies were grown in methylene blue (50% methanol (0.5% in toluene) and counted. Virus titer is determined by colony shape per ml Give as an adult unit (cfu / ml). Multiply them by the number of colonies and the number of dilutions. And divided by 2 to account for cell doubling . Table 1. Infectious recombinant retro from transfected BHK-21 cells Release of virus particles ** About 4 × 10 in each experiment⁶Transfected BHK-21 cells Was placed in a 60 mm culture dish and incubated at 37 ° C. Medium every 5 hours Collected and replaced. Pass the medium sample through a 0.45 μm filter, And stored at -130 ° C before being used for titration. ＲＮＡRNA used for transfection of BHK-21 cells ‡ CFU, colony forming unit §-, not analyzed ¶ Transfer 3T3 cells to diluted culture of transfected BHK-21 cells. Incubate with the ground and then select G418 I made a choice. Numbers refer to resistant colonies after 12 days of incubation.   Table 1 shows the results. SFV1 / LN3i, SFV1 / gag-pol and S Transfect BKH-21 cells with FV / Pr80env RNA 3.7 × 10^FourIndividual infectious particles were incubated for the first 5 hours Per ml during the subsequent interval; this is 6.5 per ml during subsequent intervals. × 10^Five~ 1.1 × 10⁶To transducible particles. Production of infectious particles To increase the SFV capsid in front of the gag-pol gene. PSFV-C / gag-pol construct encoding an RNA sequence that enhances gene transcription I used a kimono. Transfection with SFV-C / gag-pol RNA Expression of the gag-pol product in the isolated cells was determined by the RN of SFV1 / gag-pol. Much larger than that of the corresponding product in cells transfected with A . Co-transfection of SFV-C / gag-pol RNA / time course When used in experiments, the production of infectious particles was significantly increased. Most 5 hours Is about 4 × 10⁶CFU / ml. Inner of target cell of this particle Also suitable for human cells in order to extend the main spectrum and for example in the context of gene therapy In order to create a system, we use pseudogenes with envelope glycoproteins An experiment was set up for the production of pseudotyped MLV particles. . This allows us to obtain pSFV1 / AMenv, pSFV1 / LN3i And BHK-21 cells with RNA transcribed from pSFV-C / gag-pol Was co-transfected. The results in Table 1 show that high titer stocks Also obtained when using the env protein Indicates that In the control experiment, the particles capable of transducing were each SFV1 / L. N3i and SFV-C / gag-pol, SFV1 / LN3i and SFVI / Pr80env or SFV1 / LN3i and SFV1 / AMenv Indicates that cells transfected with RNA were not released into the medium did. These are those that are produced in the cytoplasm of cells using the SFV expression system. Rovirus recombinant genome is shaped by the co-expressed packaging protein. Can be encapsulated in a high-titer stock of recombinant retroviral particles capable of transducing Suggest that Example 10   This example demonstrates that no replication competent particles were detected. Supernatant medium Rescue assay for possible presence of replication competent particles in (supernatant medium) Tested by A. NIH with recombinant provirus consisting of MLV LTR 3T3-derived cell line, 3T3 Zipneo SV (X) p cells, packaging system Gunnar and neo^RThe gene was utilized in this assay. That is, g of MLV Ag-pol and env proteins encode these cells Transfection is neo^RFor the production of infectious particles containing recombinant genomes Connect. 3T3 Zipneo SV (X) p cells were transformed with 4 μg / ml polybrene. 2.6 × 10 in the presence⁶Using a supernatant medium containing two infectious recombinant retroviral particles And infected. Infected cells were passaged for 8 days. Cells are about 50% confluent Medium, replace the medium with fresh medium and incubate the cells at 37 ° C. Was an option. The medium was collected after a 24-hour incubation and the 0.45 μm Through the Luther, and as described above As described above, neot was determined by titration in NIH 3T3 cells.^RGrains capable of transduction The presence of offspring was analyzed. Uninfected 3T3 Zipneo SV (X) p cells and Medium from cells infected with the wild type and amphoteric retrovirus (4070A). Used as negative and positive controls, respectively. The colony is determined by the SFV expression system 3T3Zi infected with either produced recombinant particles or negative control medium Not obtained for media from pneoSV (X) p cells. In contrast, about 40 00 colonies were grown using positive control medium containing wild-type retrovirus. Obtained. Example 11   This example demonstrates the construction of the pSFV1 / LN-U3 insert. pSFV1 / LN The -U3 insertion is a recombinant retroviral genome U3-R-U5-Ｕ⁺-Neo^R-U 3-R is contained in the SFV subgenomic region (FIG. 6). This is done as follows (1) A 464 bp SfcI-KpnI fragment from the 3 'LTR of pLN was It was cloned between the BglII and KpnI cleavage sites of P73 to create pSP73 / U3 was created. The SfcI and BglII ends were filled with Klenow fragment. (2) The 2370 bp KpnI-KpnI fragment from pLN was replaced with the KpnI of pSP73 / U3. It was cloned into the cleavage site to create pSP73 / LN. (3) SFV subge The gene segment corresponding to the 35 base fragment from the 5 'end of the nome was fused with fusion PCR ( Houton, Hunt et al. 1989) specify for DNA integration Inserted into the 3 'U3 region just downstream of the site. Primers used for fusion PCR Is the upper 5 ′ TGCTTGCCGAATATCATGGTG3 ′, the lower ( lower) Primer-5'CCCAAGCTTTGCAACTGCAAGAGGGT TTA3 'and fusion Primer 5 'GATCCAATCAGAATTCTGTGTATTAACGC ACCAATGGTGGGGTCTTTCATTCCCCC 3 ', 5'ATTGG TGCGGTTAATACACAGAATTCTGATTGGATCTTGTAGG TTTGGCAAGCTAGC3 '. The PCR reaction was performed at 94 ° C. for 45 seconds using an NcoI-NdeI fragment as a template DNA. For 45 seconds at 60 ° C. and 2 minutes at 78 ° C. After 25 cycles, 862bp fusion The combined fragment was used for the Wizard PCR Preps DNA Purification System (Wizard PCR). Preps DNA Purification System) (Promega, SDS, Sweden) , Falkenberg). (4) The fusion PCR fragment was And HindIII, and NgoMI and Hi of pSP73 / LN. An insertion was made between the ndIII cleavage sites to create a pSP73 / LN-U3 insertion. ( 5) The pSP73 / LN-U3 insert was cut with HindIII and the ends were Klenow fragment And then cut with BglII. 2973 bp BglII-HindII The I (blunt) fragment was isolated. Insert pSFV1 / LN-U3 into SP73 / LN- The BglII-HindIII (blunt) fragment of the U3 insertion was ligated with pSFV1-NruI Ba. Created by inserting between the mHI and SmaI cleavage sites. Example 12   This example describes the construction of pSFV1 / LN3i (BNNP). The plus The mid removes two existing BamHI cleavage sites and a group of unique cleavages Site (also BamHI) to generate from pSFV1 / LN3i Was terrified The BamHI cleavage site was digested with BamHI to cut pSFV1 / LN3i. , Filled with Klenow fragment, and re- Removed by ligation. The resulting plasmid was designated pSFV1 / LN3i (-B ). A group of new cleavage sites was inserted by fusion PCR. The cleavage sites included BamHI, NdeI, NsiI and PmeI. Primers for fusion PCR were 5 'TGTCAAGACCGACCTGTC GC3 '(primer 1), 5' CCCAAGCTTTGCAACTGCAAG AGGGTTTA 3 '(primer 2), 5' GGATCATATATGCATG TTTAAACGGGACTCTGGGGTTCGATAAA3 '(primer 3 ) And GTTTAAACATGCATATGGATCCCGCTCAGAAG AACTCGTCAA3 '(primer 4). As a template, we pSFV1 / LN3i (-B) was used. Using the first two primers, neo^RA 678 bp fragment containing the 3 'end of the gene was synthesized. Primer 3 and Using 4 and 4, we have a partially overlapping 641 bp containing the 3 'LTR. Was synthesized. The fusion PCR reaction is a 1297 fusion fragment containing a unique cleavage site Brought. This was cut with BssH2 and a 747 bp fragment was isolated and Then, it was inserted into pSFV1 / LN3i (-B) cut with BssH2. Arising The resulting plasmid was called pSFV1 / LN3i (BNNP). Example 13   Construction of pSFV1-I-CAT and pSFV1-CAT. A CAT gene fragment containing one intron was cut with BglII and BamHI. PCAT3 ™ -promoter vector (Promega, Tag number E1861). The 1389 bp fragment was purified and pSF V1 / LN3i (BNNP). This This is due to BamHI CAT and dephosphorylated pSFV1 / LN3i ( BNNP). The resulting plasmid is called pSFV Called 1-I-CAT. pSFV1-CAT, from which introns were removed The same procedure was performed using the previously provided pCAT3 ™ -promoter vector. This was done by cutting the latter plasmid with HindIII. Example 14   Retroviral vectors containing the CAT gene with or without introns Manufacturing   Recombinant retrovirus containing CAT gene with or without intron Ruth particles were converted to SFV-C / gag-pol RNA and SFV for BHK cells. SFVI-I-CAT RNA or SFV1 with both 1-env RNA -Made by co-transfection of CAT RNA. 10-15 hours in After the incubation, collect the medium and^ROf transducing particles Used for titration. The titer is about 4 x 10 particles for SFV1-I-CAT.^FivePieces / Ml, and about 1 × 10 5 particles for SFV1-CAT.⁶Pcs / ml. Example 15   Recombinant retrovirus containing CAT gene with or without intron CAT expression efficiency in cells transduced with Ruth particles. About 1 × 10⁶1 x 1 cells 0^FiveWere infected with the recombinant retroviral particles. Prepare lysate after 52 hours And CAT activity in a standard assay (CAT enzyme with reporter lysis buffer) Assay system (CAT Enzyme Assay System With Reporter Lysis Buffer), Promega (Promega)) And was measured. The results show that the recombinant retrovirus containing CAT with introns It showed more than 30-fold CAT activity in cells transduced with irs particles (FIG. 8). ). Therefore, this example demonstrates that the gene containing introns is Transduced into cells with virus particles, and this results in improved expression To bring.

────────────────────────────────────────────────── ─── Continuation of front page    (81) Designated countries EP (AT, BE, CH, DE, DK, ES, FI, FR, GB, GR, IE, IT, L U, MC, NL, PT, SE), AU, CA, JP, U S

Claims (1)

[Claims] 1. Alphavirus-retroviral RNA vector comprising a replication component, Alphavirus containing recombinant retroviral genomic RNA in the genomic region Genomic RNA, wherein this retroviral genomic RNA is A vector comprising an exogenous RNA sequence encoding the substance, and After introduction into the cell, the recombinant letto having the inserted exogenous RNA from the vector. Evidence set wherein rovirus genomic RNA is transcribed and comprises the exogenous RNA Recombination of package components that can be packaged into recombinant retroviral particles The alphavirus-retrovirus vector producing genomic RNA. 2. The exogenous RNA sequence includes an exogenous gene, and the exogenous gene is suitably small. At least one of the introns and / or others required for efficient expression of the gene Wherein the control element is endogenous to the gene and / or 2. The alphavirus-retrovirus vector according to claim 1, which is exogenous. Doctor. 3. Roughly modified retroviral genome is an alphavirus subgenomic promoter Inserted in the downstream county and the recombinant retroviral genome From the transcriptional start site of the viral subgenome to the start site of the recombinant retroviral genome 3'U3 and R corresponding to a part of the 5 'alphavirus subgenomic region extending to 3. An alpha according to claim 1 or claim 2 containing an insertion between the Virus-retroviral vector. 4. The recombinant retroviral genome has the addition of a U3 sequence at its 5 'end and an alpha Recombinant retrovirus from transcription start site of viral subgenome Insertion corresponding to part of the 5 'alphavirus subgenomic region extending to the beginning of the genome Claims, wherein the 3'U3 region comprises a region immediately after the DNA-integration specific region. An alphavirus-retroviral vector according to paragraph 1 or 2. 5. 5. The method according to claim 1, wherein the alphavirus is SFV. Or an alphavirus-retrovirus vector. 6. The Alf gamma virus according to claim 5, wherein the retrovirus is MLV. S-RNA vector. 7. The alphavirus genomic RNA is Semliki Forest Virus (SFV), Sindbis virus, Ross River virus and Venezuela, western and eastern horse brain The alphavirus selected from the group consisting of myelitis virus, 2. The alphavirus-RNA vector according to claim 1. 8. The alphavirus-reto according to any one of claims 1 to 7, A DNA molecule comprising a DNA sequence complementary to a viral RNA vector. The alphavirus-retrovirus RNA vector from the DNA molecule Such a DNA molecule that can be transcribed. 9. The alphavirus sequence is represented by pSFV1-NruI and the recombinant MLV genomic 9. The DNA component according to claim 8, wherein the DNA sequence is inserted into the polylinker region. Child. 10. The alphavirus according to any one of claims 1 to 7, A recombinant alphavirus particle comprising a torovirus RNA vector. 11. The alphavirus-retrovirus R according to claim 1. Cells containing the NA vector. 12. A cell comprising the DNA molecule according to claim 8. 13. The cells are birds; mammals, including humans]; amphibians; insects; and fish cells. 13. The method according to claim 11, which is a eukaryotic cell selected from the group consisting of A cell according to any of the preceding claims. 14． Of infectious recombinant retroviral particles, also called retroviral vectors A method of making comprising: a) tissue culture cells according to any of claims 1 to 7; Alphavirus retroviral RNA vector and retrovirus Other alphavirus-RNA vectors that specify structural protein and enzyme production B) Incubate the cells C) recovering a medium containing the released recombinant retrovirus particles. The above method comprising: 15. Of retrospective retroviral particles, also called retroviral vectors A method of making; a) tissue culture cells according to any of claims 1 to 7; An alphavirus retroviral RNA vector as described in Env precursor protein of leukemia virus or another membrane protein that recognizes human cells Retrovirus structural proteins, including proteins, and other alphas that identify enzyme production B) cells transfected together with the virus RNA vector; C) a medium containing the released recombinant retroviral particles. The above method comprising the step of reclaiming land. 16. Of infectious recombinant retroviral particles, also called retroviral vectors A method of making comprising: a) tissue culture cells according to any one of claims 1 to 7; Alphavirus retrovirus RNA vector described in Alphavirus particles containing a retroviral structural protein Others, including alphavirus RNA vectors that specify quality production and enzyme production Infecting with the recombinant alphavirus-particles together; b) C) recovering the medium containing the released recombinant retrovirus particles The above method comprising the step of: 17． Introduce genes into animal cells, including human cells, in vitro and in vivo Of Recombinant Retroviral Particles, Also Called Retroviral Vectors A) retrofitting according to the method of claims 14 and 15 Preparing an ills vector; and b) a recombinant retrovirus to infect cells. The above use, comprising using a loose particle. 18. Recombinant leto also called retroviral vectors for human gene therapy A method of using virus particles, comprising: a) following the method of claim 15; A retroviral vector is prepared; and b) the recombinant The above use comprising using torovirus particles.