JP2001288105A - Medicine for periodontitis - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a prophylactic and a therapeutic agents for periodontitis safe for human bodies. SOLUTION: This medicine for the periodontitis comprises human β-defensin 1 or human β-defensin 2 or both which are safe human antimicrobial peptides produced by humans and is used to carry out the prophylaxis and treatment of the periodontitis. Furthermore, a vector comprising genes of the human β-defensin 1 and human β-defensin 2 transduced thereinto is used to express the human β-defensin 1 and/or human β-defensin 2 in the oral cavity and suppress the proliferation of causative bacteria of the periodontitis.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a prophylactic and therapeutic agent for periodontitis utilizing an antimicrobial peptide which is safe for the human body.

[0002]

BACKGROUND OF THE INVENTION Periodontitis is a modern disease,
It is a trouble for many people. Periodontitis has been found to be an infection caused by Gram-negative bacteria, and attempts have been made to suppress the pathogenic bacteria with drugs. Conventionally, synthetic antibacterial agents such as chlorhexidine and antibiotics such as synthetic cephalosporins and tetracyclines have been used. However, long-term use of synthetic antibacterial agents and antibiotics is not preferable in terms of safety and killing even the resident bacteria necessary for maintaining oral hygiene.

[0003] Recently, juvenile periodontitis, which is difficult to treat only by controlling the periodontal pocket by a drug or brushing, has become a problem, but the cause could not be identified, and there was no definitive therapeutic agent.

[0004] Therefore, it is necessary to suppress the periodontitis-causing bacteria by using a safe human antimicrobial peptide produced in vivo by humans and to provide a medicament effective for juvenile periodontitis. It is an object of the present invention.

[0005]

[MEANS FOR SOLVING PROBLEMS] Among human antimicrobial peptides, it has been found that human β-defensin 1 and human β-defensin 2 are effective in controlling bacteria causing periodontitis. Human β
Defensin 1 and human β-defensin 2 are Actinob, a gram-negative bacterium that is one of the causative bacteria of periodontitis
acillus actinomycetemcomi
tans (AA bacterium) was confirmed to have strong antibacterial activity. Also, Porphyromonas gingiv
aris, Bacteroides forsyth
us, Prevotella intermedia,
Campylobacter rectus, Fuso
bacteriumspecies, Eubacter
ium species, Treponema spe
ces and other periodontitis causing bacteria also have antibacterial activity.

The preventive and therapeutic agents for periodontitis contain human β-defensin 1 or human β-defensin 2 as an active ingredient, and include, for example, candy, gum, troche, dentifrice, mouthwash, oral ointment, and liquid for external use. And the like, and can be used by blending with foods and drinks and medicines. Human β-defensin 1 or human β-defensin 2 is a biological component that does not harm the human body under appropriate usage and is safe. It has no effect.

[0007] Furthermore, for hereditary juvenile periodontitis in which AA bacteria are deeply involved, human β-defensin 1 and human β-defensin 2 genes are incorporated into an expression vector, and cells derived from oral epithelium such as KB cells are used. Was found to express the human β-defensin 1 and human β-defensin 2 genes. Therefore, human β
After integrating the defensin 1 and human β-defensin 2 genes into a virus vector, the gene is introduced into a virus,
It can be applied to the gingival epithelium by appropriate means to infect the gingival epithelium with the virus and to express human β-defensin 1 and human β-defensin 2.

[0008]

【Example】

Example 1 Actino, one of the causative bacteria of periodontitis
bacillus actinomycetemcom
1 × 10 ⁷ tans (AA bacteria) in 160 μl of PBS
(-) Are dispersed in two, and 40 μl of human β-defensin 2 (0.85 μg / μl) is added to one to make a total volume of 200 μl (final concentration is 0.17 μg / μl).
1, 40 μM).

The other was added with 40 μl of PBS (−) as a control, and both were incubated at room temperature for 30 minutes. Then 800 μl of Todd Hewith
Broth (culture solution) was added, and the mixture was spread in a 96-well culture dish in 100 μl aliquots. The absorbance (OD 550 nm) at each time was measured to identify the number of bacteria. The result is shown in FIG. As is clear from FIG. 1, over time, human β-defensin 2 suppressed the increase of AA bacteria. When the same operation was performed for human β-defensin 1, similar results were obtained.

The creams shown in Formulations 1 and 2 containing human β-defensin 1 or human β-defensin 2 were prepared and applied to patients with periodontitis. Formulation 1 Glycerin 85.00 (% by weight) Human β-defensin 2 0.01 Xanthan gum 4.00 Sodium chloride 0.49 Distilled water 10.50

Formulation 2 Glycerin 85.00 (% by weight) Human β-defensin 1 0.01 Human β-defensin 2 0.01 Xanthan gum 4.00 Sodium chloride 0.48 Distilled water 10.50

[0012] This cream was applied with 10 fingers to a person who had bad breath in the initial stage of periodontitis and had red and swollen gums, and massaged. Seven months later, seven people became pink and had bad breath. I can no longer feel it. They had pink gums and no swelling, but felt a slight bad breath. One had a slight gingival redness, and his bad breath was improved from the beginning of application but felt somewhat.

[0013]

Example 2 Human β-defensin 2 was isolated from SCC-9 cells (oral cancer cells) by RT-PCR,
It was incorporated into an expression vector having GFP (pEGFP-N1, trade name). (See FIG. 2). This was transfected into KB cells, and its expression was confirmed by staining with GFP fluorescence and rhodamine-labeled anti-defensin 2 antibody.
(See photo in Fig. 3)

The gene sequence of human β-defensin 2 is as follows. atgagggtctttgttatctcctcttct
cgttcctctttcatattcctgatgcc
tctttccaggtgtttttttgggtgggata
ggcgatcctgttacctgccttaaga
gtgggagcatatatgtcatccagctctt
ttgccctagagaagtataaaacaatt
ggcacctgtgtgtctcccctgggaaaaa
aatgctgcaaaaagccatga

[0015] This human β-defensin 2 introduced K
RNA was extracted from B cells, and the expression level of human β-defensin 2 mRNA was quantified by quantitative PCR (see FIG. 4). Further, proteins were similarly extracted from the KB cells, and the expression of human β-defensin 2 at the protein level was confirmed by Western blotting. Further, A was added to KB cells transfected with human β-defensin2.
Infecting bacteria A, apoptosis (cell death) of KB cells was observed. The result is shown in FIG. As shown in FIG. 5, it was found that apoptosis was less likely to occur when the human β-defensin 2 gene was introduced. When the same operation was performed for human β-defensin 1, similar results were obtained.

The gene sequence of human β-defensin 1 is as follows. atgagaacttcctacctctctgctgt
ttactctctgcttactttttgtctga
gatggcctcaggtggtaacttctc
acaggccttgggccacagactctgatc
attacaaattgcgtcagcagtgggggg
gcaatgtctcttattctgcctgcccg
attttaccacaaaaattcaggcacct
gttacagagggagagccccaggtgctg
caagtga

Human β defensin 1 or human β
The defensin 2 gene was inserted into a viral vector and introduced into an adenovirus, and this virus was used in Example 1.
0.2 g per 100 g of the same cream was added. This cream was injected with a syringe needle into a dog 5 with artificial periodontitis.
When applied to the periodontal pockets of the animals, swelling of the gingiva disappeared in one month, and no swelling of the gingiva was observed even after one year.

[0018]

Example 3 Since human β-defensin 2 was confirmed to be effective against AA bacteria, the causative agent of periodontitis, gum, candy, troche, dentifrice, mouthwash, oral ointment were prepared according to a conventional method. Or topical disinfectant. Also, human β-defensin 1 can be similarly added to foods and oral ointments.

Preparation of Dentifrice for Prevention and Treatment of Periodontitis Each component was mixed in the composition shown in Table 1 to prepare a dentifrice for prevention and treatment of periodontitis in cream form.

Table 1 Glycerin 70.00 (% by weight) Human β-defensin 2 0.01 Sodium fluoride 0.30 Xanthan gum 1.00 Sodium chloride 0.49 Silicon dioxide 20.00 Mint flavor 1.00 Titanium dioxide 0.70 Distilled water 6.50

When this dentifrice was stored in a container with a lid for three months, no change was observed in appearance. Person 1 who can feel bad breath at the beginning of periodontitis using this dentifrice
When 0 people were urged to brush for 3 minutes after each meal for 3 months, all the gingival swelling disappeared and bad breath disappeared.

[0022]

According to the present invention, human β-defensin 1 and / or
Alternatively, a prophylactic and therapeutic agent for periodontitis containing human β-defensin 2 as an active ingredient can suppress the decrease of AA bacteria which are the causative bacteria of periodontitis, and is effective for prevention and treatment of periodontitis. Further, the prophylactic and therapeutic agents for periodontitis of the present invention can be greatly improved by blending them in foods and drinks and pharmaceuticals in the form of, for example, gums, candy, troches, dentifrices, mouthwashes, oral ointments or topical disinfectants. Prophylactic and therapeutic effects are obtained. further,
The vector into which the gene of human β-defensin 1 and human β-defensin 2 is introduced expresses human β-defensin 1 and human β-defensin 2 in epithelial cells of the oral cavity, and thus is effective for juvenile periodontitis.

[Brief description of the drawings]

FIG. 1 is a graph showing the growth inhibitory effect of AA bacteria.

FIG. 2 is an explanatory diagram of an expression vector.

FIG. 3 is a photograph confirming the expression state of human β-defensin protein.

FIG. 4 is a graph showing the amount of defensin mRNA in KB cells.

FIG. 5 is a graph showing the effect of a KB cell introduced with a vector on AA bacteria.

────────────────────────────────────────────────── ───

[Procedure amendment]

[Submission date] November 9, 2000 (200.11.
9)

[Procedure amendment 1]

[Document name to be amended] Statement

[Correction target item name] 0014

[Correction method] Deleted

[Procedure amendment 2]

[Document name to be amended] Statement

[Correction target item name] 0016

[Correction method] Deleted

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 29/00 A61P 31/04 4H045 31/04 C07K 14/47 C12N 15/09 ZNA C12P 21/02 C / / C07K 14/47 A61K 37/02 C12P 21/02 C12N 15/00 ZNAA (71) Applicant 500159015 Yasunobu Takuma 6-10-2-15 Takuhoku, Kita-ku, Sapporo City (72) Inventor Yoshihiro Yasuhiko Takuhoku, Kita-ku, Sapporo City Article 3-chome 9-12 Mayur 7.4-101 (72) Inventor Toru Kaku Yamanote, Nishi-ku, Sapporo 1-chome 3-25-301 (72) Inventor Gakuko Nishimura 29-6, Yachicho, Ebetsu-shi (72) ) Inventor Toshiya Arakawa 5-6-12 Yurigahara, Kita-ku, Sapporo City Royal Park 101 (72) Inventor Yasunobu Takuma 6-10-15, Takuhoku 6-10-15, Kita-ku, Sapporo (72) Inventor Keisuke Nakajima 3-14-9 Ainosato 9-chome 14-6, Kita-ku, Sapporo-city (72) Inventor Yunori Kogashi 1-42-2, Ainosato 1-4-2, Ainosato, Kita-ku, Sapporo 9-10- 407 F term (reference) 4B018 LB01 MD16 MD20 MD69 ME09 MF14 4B024 AA01 CA03 DA03 EA02 EA04 GA11 HA17 4B064 AG01 CA10 CA19 CC24 DA01 4C083 AB172 AB242 AB332 AC122 AD352 AD411 AD412 CC05 CC41 DD31 EE33 4C08A A18A MA02 MA52 NA14 ZA672 ZB352 4H045 AA10 AA30 BA20 BA21 CA41 EA29 FA72 FA74 HA04

Claims (5)

[Claims] 1. A pharmaceutical for periodontitis comprising human β-defensin 1 and / or human β-defensin 2, which are human antimicrobial peptides, as active ingredients. 2. A food or drink comprising human β-defensin 1 and / or human β-defensin 2 which is a human antimicrobial peptide. 3. A dentifrice containing human β-defensin 1 and / or human β-defensin 2, which is a human antimicrobial peptide. 4. A vector into which either human β-defensin 1 or human β-defensin 2 gene has been introduced. 5. A drug for periodontitis comprising a vector into which either the gene of human β-defensin 1 or human β-defensin 2 has been introduced.