JP2001172196A - Composition for neurotization - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a neurotization composition that has the extremely excellent neurite-outgrowing effect. SOLUTION: This neurotization composition characteristically includes laminin-5.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

[0001] The present invention relates to a composition for nerve regeneration having an extremely excellent neurite outgrowth effect.

[0002]

2. Description of the Related Art Nerve regeneration The network of neurons (neurons) observed in the completed brain is created through various steps during brain development and postnatal development. The formation of a neural cell network is achieved through processes such as axon guidance in which neurites including axons select and run a specific part of an embryo, a spatial projection map between groups of neural cells, target identification, and the like.

[0003] Regeneration of nerves is important when nerves are damaged due to physical shocks or intrinsic causes such as traffic accidents, or when nerve cells are transplanted.

[0004] Specifically, the treatment of peripheral nerve injuries due to, for example, traffic accidents or occupational accidents is performed in the surgical field, especially in orthopedic surgery.
Occupies a large position. In recent years, surgical techniques for connecting severed nerves have made significant progress with the introduction of microsurgery. However, this treatment presents a challenge to the surgeon if the nerve deficits are large enough to be replaced. The current clinical practice is autologous nerve transplantation using the sural nerve. Autologous nerves are the most ideal auxiliary material, but their collection is limited due to the burden on the patient and the complexity of the operation. Furthermore, although it does not cause much trouble in real life, the cutaneous sensation on the little finger side from the ankle to the instep is lost by resection of the sural nerve, so it is desirable to avoid autologous nerve transplantation if possible. Therefore, the development of a transplant material that replaces the autologous nerve is eagerly desired, and various methods have been devised and studied. For example, autologous transplantation using tissues other than nerves includes autologous blood vessel transplantation and autologous fascia transplantation, but the complexity of the operation is not different from autologous nerve transplantation. In view of the above points, a nerve regeneration aid made of an artificial material has been studied (Japanese Patent Laid-Open No. 5-237139), but there is still room for improvement from the viewpoint of the effect of nerve regeneration.

[0005] In recent years, the world, including Japan, is rapidly aging. With the aging, the increase of senile dementia, so-called Alzheimer's disease, is becoming one of the serious problems, but this is also a disease involving nerve cells, and the details thereof are gradually being elucidated. There is a need for a nerve regenerating agent that is also effective against Alzheimer's disease.

II. Laminin-5 Cell-adhesive extracellular matrix such as laminin, collagen, fibronectin, vitronectin (hereinafter referred to as “EC
M ”) proteins bind to unique cell surface integrins, thereby promoting cell growth, adhesion, migration,
It is becoming clear that differentiation, cell death and the like are controlled. Such changes in cytoplasm are induced by integrin signals acting on both the cytoskeletal system and the gene expression system. Numerous reports have been made on the ECM protein suggesting a relationship with malignant growth of cancer, particularly metastasis. Metastasis of cancer cells includes adhesion to ECM cells, ECM
It is considered that three stages of destruction and cell migration are important. The tissue wetting process by cancer cells is a field of continuous interaction between cancer cells and the ECM.

[0007] Among ECM proteins, laminin is a group of major glycoproteins constituting the basement membrane. It was first identified and purified from mouse EHS sarcoma, a tumor that synthesizes a large amount of basement membrane.
It was named laminin for a). It is present in all animal tissues with a basement membrane and in Drosophila. Cell surface laminin receptor is integrin α6β
1, α3β1 and α6β4 (Iwanami Biological Dictionary, p. 1447, 1996, Iwanami Publishing).

[0008] The structure of laminin is a heterotrimeric molecule in which an α-chain, a β-chain and a γ-chain are connected by disulfide bonds, and has a characteristic cross structure. Each chain is composed of multiple domains, domains I and II forming a triple helix. Prior to the present application, laminin molecules consisted of five α chains (α1 to α5) and three β chains (β
1 to β3), at least 11 different combinations of two types of γ chains (γ1 and γ2) have been identified,
In fact, it has been suggested that several times as many species exist (Experimental Medicine Vol. 16 incorporated herein.
No. 16 (Extra Number) 1998, 114th Page-1st
See page 19).

[0009]

Table 1 Laminin molecular species and subunit composition Official name Composition Also known as laminin-1 α1β1γ1 EHS laminin laminin-2 α2β1γ1 merosin laminin-3 α1β2γ1 s-laminin laminin-4 α2β2γ1 s-melosin laminin-5 α3β3γ2 radin / Kalinin / Nicein Laminin-6 α3β1γ1 k-Laminin Laminin-7 α3β2γ1 ks-Laminin Laminin-8 α4β1γ1 Laminin-9 α4β2γ1 Laminin-10 α5β1γ1 Laminin-11 α5β2γ1 Most of the studies reported before this application are laminin-11. It is performed using. However, recent studies have revealed that this molecule is rather a special laminin molecule that is expressed very limitedly, with the most ubiquitous laminin molecules being laminin-10 and 11 (M
iner. J. H. et al: J. Cell Bio
l. , 137: p. 685-701).

[0010] Laminin-5 used in the present invention
Was discovered as a novel laminin-like protein that significantly promotes cell adhesion and motility in the culture of the human gastric cancer cell line STMK-1, and was originally named radosine (Miyaz)
aki, K .; et al. : Proc. Natl. Ac
ad. Sci. USA, 90: p. 11767-117
71, 1993). Later, it was revealed that radosin is the same molecule as laminin-5 (also called epiligulin, kalinin or neissin), a laminin molecule derived from epidermal cells (Mizushima. H. et.
al: J. Biochem. , 120: p. 1196-
1202, 1996). Hereinafter, in this specification, it is unified with "laminin-5".

Laminin-5 is composed of α3 chain, β3 chain and γ
It is composed of two chains. At present, no other laminin molecule having a β3 chain or a γ2 chain has been identified.
The α3, β3, and γ2 chains have a short arm structure in which some domains at the N-terminal side are deleted compared to the α1, β1, and γ1 chains. When the structure of laminin-5 constituent subunits is compared with that of laminin-1, the amino acid sequence homology between the subunits is 50% or less. In particular, the globular (G) domain in the C-terminal region of the α chain has low homology (25%), and this region is considered to be involved in functions unique to each laminin molecule.

It is known that squamous cell carcinoma cells and gastric cancer cells secrete laminin-5 almost universally in cultured cells (Miyazaki, K. et al .: P.
rc. Natl. Acad. Sci. USA, 90:
p. 11767-11717, 1993, supra; Miz
ushima. H. et al: J. Bioche
m. , 120: p. 1196-1202, 1996, supra). Gene expression of the three subunits of laminin-5 is
It is significantly induced by growth factors such as the tumor promoter TPA, epidermal growth factor EGF, and platelet-derived growth factor PDGF. It is known that the function promotes adhesion, migration and dispersion of various cells including the rat hepatocyte cell line BRL. In addition, squamous cell carcinoma cells and gastric cancer cells that produce laminin-5 have a particularly high tendency to selectively adhere to laminin-5. However, the cell motility promoting activity of laminin-5 differs significantly depending on the type of cell.

Laminin-5 preferentially binds to integrin α3β1 in most cells, but also binds to integrins α6β1 and α6β4 in some cells. Cell adhesion site of α3 chain of laminin-5 (α3G2A sequence:
RERFNISTPAFRGCCMNKLKTS) has been elucidated to be a binding site with integrins (Experimental Medicine Vol. 16 No. 16 (extra number), 19).
1998, supra).

With respect to the relationship between laminin molecules and nerve regeneration, it has been disclosed that collagen fibers coated with fibronectin can be used as an auxiliary agent for nerve regeneration (Japanese Patent Laid-Open No. 23713/1993).
9). Also, Cell Adhesion Commu
nication 1996, April: 3 (6):
p. 451-462 suggest that laminin-5 may have a neurite outgrowth effect on neuroblastoma cells.
However, the document describes that the neurite outgrowth effect of laminin-5 is only about the same as that of laminin-1 and 2, and the known neurite outgrowth effect of laminin-1 and the like is a neurite regenerating composition. Is not recognized to be large enough to be used as
As in 37139, it has been considered that it is used only supplementarily, such as in combination with fibronectin. In addition, no studies have been reported on examining the neurite outgrowth effect of laminin-5 on normal nerve cells.

Thus, prior to the present invention, despite its necessity, a composition for nerve regeneration having a sufficiently excellent neurite action has not been obtained.

[0016]

SUMMARY OF THE INVENTION An object of the present invention is to provide a composition for nerve regeneration having an extremely excellent neurite extension effect.

The composition for nerve regeneration of the present invention comprises laminin-
5 is included. Laminin in the present invention
5 is an α3 chain having the amino acid sequence of SEQ ID NO: 2, a β3 chain having the amino acid sequence of SEQ ID NO: 4, and SEQ ID NO: 6
A protein consisting of each subunit of the γ2 chain having the amino acid sequence of, or having an amino acid sequence in which one or more amino acid residues are deleted, added or substituted, and It is a protein having a nerve regeneration function.

The composition of the present invention is preferably used for medicaments, particularly for preventing or treating diseases associated with degeneration or damage of nerves such as Alzheimer's disease, Parkinson's disease and cerebral infarction.

[0019]

DISCLOSURE OF THE INVENTION The present invention has been intensively studied for the purpose of solving the above-mentioned problems, and as a result, laminin-5 protein was found to be contrary to the conventional expectation, to other known laminin molecules such as laminin-1. The present inventors have found a remarkable neurite action as compared with that of the present invention, and conceived the present invention.

That is, the composition for nerve regeneration of the present invention is characterized by containing a laminin-5 protein. Laminin-5 protein The source and production method of the laminin-5 protein in the present invention are not limited as long as it has the characteristics described in the present specification. That is, the laminin-5 protein of the present invention is a naturally occurring protein, a recombinant DN by genetic engineering techniques.
Any of a protein expressed from A or a chemically synthesized protein may be used.

Laminin-5 in the present invention is typically an α3 chain having the amino acid sequence of SEQ ID NO: 2 (amino acid residues No. 1 to No. 1713) (Ryan et. Al.).
al. J. Biol. Chem. 269: p. 2277
9-22787, 1994), β3 chain having the amino acid sequence of SEQ ID NO: 4 (amino acid residue No. 1-1170)
(Gerecke et al. J. Biol. Che
m. 269: p. 11073-11080, 1994)
And a γ2 chain having the amino acid sequence of SEQ ID NO: 6 (amino acid residue No. 1-1193) (Kallunkie
t al. , J. et al. Cell Biol. 119, p. 6
79-693, 1192). The α3 chain has five globular (G) domains at the C-terminus, and each domain has amino acid residue No. 794-970; 971-11
39, no. 1140-1353, no. 1354-1
529 and no. 1530-1713.

Among natural proteins, mutations having one or more amino acid mutations due to differences in varieties of the species producing them, and the presence of gene mutations due to differences in ecotypes, etc. It is well known that proteins are present. As used herein, the term “amino acid mutation” refers to substitution, deletion, insertion, and / or addition of one or more amino acids. Each subunit of the protein of the present invention has the amino acid sequence of SEQ ID NOs: 2, 4, and 6, based on the inference from the nucleotide sequence of the gene, but is not limited to only the protein having that sequence. Rather, it is intended to include all homologous proteins as long as they have the properties described herein.
The homology is at least 50% or more, preferably 60% or more, more preferably 70% or more, and further preferably 80% or more.
% Or more, particularly preferably 90% or more, and most preferably 9% or more.
5% or more. As described above, when the structure of the constituent subunits of laminin-5 is compared with that of laminin-1, the amino acid sequence homology between the subunits is 50% or less. In particular, the homology of the G domain of the α chain is low, about 25%.

As used herein, percent homology is determined, for example, by Altschul et al. (Nucl. Acid).
s. Res. 25. , P. 3389-3402,199
It can be determined by comparing with sequence information using the BLAST program described in 7). The program is available online on National Cen.
ter for Biotechnology Inf
operation (NCBI) or DNA Da
It can be used from the website of ta Bank of Japan (DDBJ). Various conditions (parameters) for homology search by BLAST program
Is described in detail on the site, and some settings can be changed as appropriate, but searches are usually performed using default values.

In general, substitution of amino acids having similar properties (for example, substitution of one hydrophobic amino acid with another hydrophobic amino acid, substitution of one hydrophilic amino acid with another hydrophilic amino acid, or substitution of a certain acidic amino acid When the amino acid is replaced with another acidic amino acid, or a certain basic amino acid is replaced with another basic amino acid), the resulting mutant protein often has the same properties as the original protein. Techniques for producing recombinant proteins having such desired mutations using genetic recombination techniques are well known to those skilled in the art, and such mutant proteins are also included in the scope of the present invention.

More specifically, for example, the composition for nerve regeneration of the present invention, even if it lacks a part of the G domain (G1-G5) of the α3 chain, as long as the neurite extension effect of the present invention is exerted. Can be used. In fact, in Examples described later, laminin-5 protein from which G4 and G5 were cleaved and removed by a protease was used, but showed strong neurite outgrowth activity. However, G3, G
Recombinant laminin-5 lacking 4 and G5 proteins do not show this activity. Method for Preparing Laminin-5 Protein The protein of the present invention can be prepared , for example, using the above-mentioned Miyazak
i, K. et al. : Proc. Natl. Aca
d. Sci. USA, 90: p. 11767-1177
1, 1993, can be purified from the gastric adenocarcinoma cell line STKM-1.

Briefly, the supernatant of a serum-free culture of STKM-1 cells was concentrated with 80% saturated ammonium sulfate, and then separated by molecular sieve (gel filtration) chromatography, heparin affinity chromatography and anion exchange chromatography. And a pure sample can be obtained.
Alternatively, as a simpler method, an anti-laminin-5 antibody such as an anti-laminin γ2 chain antibody column or an anti-laminin α3 chain antibody column may be used directly or after fractionating the concentrated culture supernatant by gel filtration chromatography. It can be fractionated on an antibody column to purify laminin-5 protein. Known anti-laminin-5 antibodies, for example, anti-laminin γ2 chain monoclonal antibody, D4B5 antibody (Chemicon, CA, USA), or anti-laminin α3 chain monoclonal antibody prepared by the present inventors, L
SαIII-4 antibody (Kihara Biology Research Institute, Yokohama City University)
Cell Biology Division Miyazaki Laboratory) can be used. In addition, those skilled in the art can prepare anti-laminin-5 antibody using a known method, if necessary.

Although not limited, laminin-5
Are natural sources from which the gastric adenocarcinoma cell line STKM-1 is derived.
Other examples include gastric adenocarcinoma cell line MKN-45 and squamous cell carcinoma cell line HSC-4.

Alternatively, SEQ ID NO: 1 encoding the α3 chain
Nucleic acid residue No. 1-No. No. 5139, the nucleic acid residue No. 3 of SEQ ID NO: 3 encoding the β3 chain. 1
No. 21-3630 and the nucleic acid residue Nos. 118-No. By introducing and expressing 3696 into Escherichia coli, yeast, insects, or certain animal cells using an expression vector that can be amplified in each host, the protein can be obtained in a large amount by genetic engineering.

The genes encoding each chain may be expressed by integrating them into one expression vector, or may be expressed by integrating them into separate expression vectors. However, each of the subunits of the α3 chain, β3 chain and γ2 chain is a very large polypeptide having 1000 or more amino acid residues, and the gene encoding each is 3
Contains more than 000 nucleic acid residues. Thus, laminin-5 protein is preferably, but not limited to, purified from a natural source rather than expressed by genetic engineering.

Alternatively, cells expressing only some of the subunits of the α3, β3 and γ2 chains may be transformed with a gene encoding a subunit that is not naturally expressed. By expressing only the deleted subunit by genetic engineering, a complete laminin-5 heterotrimer can be obtained. This is simpler than the case where all subunits are expressed by genetic engineering, and is particularly useful when, for example, it is desired to artificially obtain a mutant.

In the present specification, SEQ ID NOs: 1 to 6
Discloses the amino acid sequence of the human laminin-5 protein and the DNA sequence encoding the same,
Using the sequence or a part thereof, a gene encoding a protein having the same biological activity can be easily isolated from other species using genetic engineering techniques such as hybridization and nucleic acid amplification reaction such as PCR. Can be released. In such a case, proteins encoded by those genes can also be used in the composition for nerve regeneration of the present invention.

The hybridization conditions used for screening for homologous genes are not particularly limited, but generally, stringent conditions are preferable. For example, 6 × SSC, 5 × Denhardt's, 0.1
It is contemplated to use hybridization conditions such as% SDS, 25 ° C to 68 ° C. In this case, the hybridization temperature is more preferably 45 ° C to 68 ° C (without formamide) or 25 ° C.
To 50 ° C. (50% formamide). A DNA containing a base sequence having a certain degree of homology or more by appropriately setting hybridization conditions such as formamide concentration, salt concentration and temperature
It is well known to those skilled in the art that all the homologous genes thus cloned are included in the scope of the present invention.

The nucleic acid amplification reaction is carried out, for example, by the replication chain reaction (PCR) (Siki et al., 1985, Science 2).
30, p. 1350-1354), Ligation-chain reaction (LCR) (Wu et al., 1989, Genomics).
4, p. 560-569; Balinger et al., 1990, G.
ene 89, p. 117-122; Barany et al., 19
91, Proc. Natl. Acad. Sci. USA
88, p. 189-193) and transcription-based amplification (Ko et al., 1989, Proc. Natl. Acad.
Sci. USA 86, p. 1173-1177) and a strand displacement reaction (SD
A) (Walker et al., 1992, Proc. Natl.
Acad. Sci. USA 89, p. 392-39
6; Walker et al., 1992, Nuc. Acids. R
es. 20, p. 1691-1696), self-retaining sequence replication (3SR) (Guateri et al., 1990, Proc. N.
atl. Acad. Sci. USA 87, p. 187
4-1878) and the Qβ replicase system (Resaildy et al., 1988, BioTechnology).
6, p. 1197-1202). Further, amplification based on a nucleic acid sequence by competitive amplification of a target nucleic acid and a mutant sequence described in European Patent No. 0525882 (Nucleic Acid Sequence Ba)
(sed Amplification: NASABA)
Reactions and the like are also available. Preferably, the PCR method is used.

The homologous gene cloned using the above-described hybridization, nucleic acid amplification reaction or the like is at least 50%, preferably at least 50%, based on the nucleotide sequence of SEQ ID NO: 1, 3 or 5 in the sequence listing. 60% or more, more preferably 70% or more, still more preferably 80% or more.
% Or more, particularly preferably 90% or more, and most preferably 9% or more.
Has a homology of 5% or more.

In the present invention, a recombinant vector for expressing a protein by incorporating a gene can be prepared by a known method. Methods for incorporating the DNA fragment of the gene of the present invention into a vector such as a plasmid are described in, for example, Sambrook, J .; Et al., Molecu
lar Cloning, A Laboratory
Manual (2nd edition), Cold
Spring Harbor Laborator
y, 1.53 (1989). Conveniently, commercially available ligation kits (eg,
Takara Shuzo) can also be used. A recombinant vector (eg, a recombinant plasmid) thus obtained
Is a host cell (eg, E-coil TB1, LE
392 or XL-1 Blue).

A method for introducing a plasmid into a host cell is described in Sambrook, J .; Et al., Molecular
Cloning, A Laboratory Ma
natural (2nd edition), Cold Sp
ring Harbor Laboratory, 1.
74 (1989), a method using a chemical treatment such as a calcium chloride method or a calcium chloride / rubidium chloride method, an electroporation method, an electroinjection method, PEG, and a method using a gene gun.

The vector can be conveniently prepared by ligating a desired gene to a vector for recombination available in the art (for example, plasmid DNA) in a conventional manner. Specific examples of the vector used include plasmids derived from Escherichia coli, for example, pB
luscript, pUC18, pUC19, pBR
322 and the like, but are not limited thereto.

For the purpose of producing a desired protein, an expression vector is particularly useful. The type of expression vector is not particularly limited as long as it has a function of expressing a desired gene in various host cells of prokaryotic cells and / or eukaryotic cells and producing a desired protein.
For example, as an expression vector for Escherichia coli, pQE-30,
pQE-60, pMAL-C2, pMAL-p2, pS
E420 and the like are preferable, and p is an expression vector for yeast.
YES2 (Saccharomyces spp.), PPIC3.5K,
pPIC9K, pAO815 (above Pichia), pBacPAK8 / 9, pBK28 as expression vectors for insects
3, pVL1392, pBlueBac4.5 and the like.

Examples of vectors for mammalian expression include:
Okayama and Berg (Mol. Cell B
iol. 3: 280, 1983) is a vector constructed as disclosed. A system useful for stable and high-level expression of mammalian cDNA in C127 mouse mammary epithelial cells has been described by Cosman et al. (Mol. Im.
munol. 23: 935, 1986). Alternatively, in vivo or i
Examples of vectors for expression in nerve cells in n vitro include, for example, adenovirus vectors,
Alternatively, pEF-BOS vector (Mizushim
a, S. et al. , Nucleic Acid Re
s. 18: p. 5322, 1990) (pEF-CITE-neo, Miyata, Se)
t al. , Clin. Exp. Metastasis
s, 16: p. 613-622, 1998).

A transformant can be prepared by introducing a desired expression vector into a host cell. The host cell to be used is not particularly limited as long as it is compatible with the expression vector and can be transformed, and is a natural cell usually used in the technical field of the present invention or an artificially established recombinant cell. Various cells such as cells can be used. For example, bacteria (Escherichia, Bacillus), yeast (Saccharomyces, Pichia, etc.), animal cells, insect cells, plant cells and the like can be mentioned.

The host cell is preferably Escherichia coli, yeast or insect cells. Specifically, Escherichia coli (M15, JM10
9, BL21, etc.), yeasts (INVSc1 (genus Saccharomyces), GS115, KM71 (genus Pichia), etc.), insect cells (BmN4, silkworm larvae, etc.) and the like. Examples of animal cells include cells derived from mouse, Xenopus, rat, hamster, monkey or human, or cultured cell lines established from these cells. Further, plant cells are not particularly limited as long as cell culture is possible, and examples include cells derived from tobacco, Arabidopsis, rice, corn, and wheat.

When a bacterium, particularly Escherichia coli, is used as a host cell, the expression vector generally comprises at least a promoter / operator region, an initiation codon, a gene encoding a desired antibacterial protein, a stop codon, a terminator, and a replicable unit. .

When yeast, plant cells, animal cells or insect cells are used as host cells, the expression vector generally includes at least a promoter, initiation codon, a gene encoding a desired antibacterial protein, a stop codon, and a terminator. Is preferred. It may also contain a DNA encoding a signal peptide, an enhancer sequence, 5 ′ and 3 ′ untranslated regions of a desired gene, a selectable marker region or a replicable unit, as appropriate.

In the vector of the present invention, a preferable initiation codon is, for example, methionine codon (ATG). Examples of the stop codon include common stop codons (eg, TAG, TGA, TAA, etc.).

[0045] A replicable unit is defined as its total D in the host cell.
DNA having the ability to replicate the NA sequence means a natural plasmid, an artificially modified plasmid (a plasmid prepared from a natural plasmid), a synthetic plasmid, and the like. Suitable plasmids include E. coli. In the coil, brassmid pQE30, pET
Or pCAL or artificial modifications thereof (pQE
DNA fragments obtained by treating pET or pCAL with an appropriate restriction enzyme), plasmid pYES2 or pPIC9K in yeast, and plasmid pBacPAK8 / 9 in insect cells.

As the enhancer sequence and the terminator sequence, those commonly used by those skilled in the art, for example, those derived from SV40 can be used.

As the selection marker, a commonly used marker can be used by a conventional method. Examples thereof include tetracycline, ampicillin, or an antibiotic resistance gene such as kanamycin or neomycin, hygromycin or spectinomycin.

The expression vector is prepared by linking at least the promoter, initiation codon, gene encoding the desired antimicrobial protein, stop codon, and terminator region to an appropriate replicable unit in a continuous and circular manner. can do. At this time, if necessary, an appropriate DNA fragment (for example, a linker or another restriction enzyme site) can be used by a conventional method such as digestion with a restriction enzyme or ligation using T4 DNA ligase.

The expression vector can be introduced into a host cell by a conventionally known method. For example, bacteria (E. coil, Bacillus subtili)
s), for example, the method of Cohen et al. [Pro
c. Natl. Acad. Sci. USA, 69, 21
10 (1972)], the protoplast method [Mol. Ge
n. Genet. , 168, 111 (1979)] and the competent method [J. Mol. Biol. , 56,209
(1971)] by Saccharomyces
In the case of cerevisiae, for example, Hinnen
[Proc. Natl. Acad. Sci. U
SA, 75, 1927 (1978)] and the lithium method [J. Bacteriol. , 153, 163 (198
3)], in the case of plant cells, for example, the leaf disk method [Science, 227, 129 (198)
5)], an electroporation method [Nature, 3
19, 791 (1986)], in the case of animal cells, for example, the method of Graham [Virology, 5].
2,456 (1973)], and in the case of insect cells, for example, the method of Summers et al. [Mol. Cell. Bio
l. , 3, 2156-2165 (1983)].

The purification and isolation of the protein of the present invention
Ammonium sulfate precipitation method, ion exchange chromatography (Mono
Q, Q Sepharose, DEAE, etc.) can be performed by appropriately combining commonly used methods for purification and isolation of proteins.

For example, when the laminin-5 protein of the present invention accumulates in host cells, the host cells are collected by an operation such as centrifugation or filtration, and then collected in a suitable buffer (for example, at a concentration of about 10 to 100 mM). Buffers such as Tris buffer, phosphate buffer, HEPES buffer, MES buffer etc. The pH varies depending on the buffer used, but p
After that, the cells are disrupted by a method suitable for the host cell to be used, and the contents of the host cell are obtained by centrifugation. On the other hand, when the laminin-5 protein of the present invention is secreted out of the host cell, the culture medium is separated from the host cell by an operation such as centrifugation or filtration to obtain a culture filtrate. The host cell-disrupted liquid or the culture filtrate can be used for protein purification and isolation as it is or after ammonium sulfate precipitation and dialysis. The following methods can be mentioned as methods for purification and isolation. That is, 6 × histidine or GS
When a tag such as T or maltose binding protein is attached, a method using affinity chromatography suitable for each tag generally used can be mentioned. On the other hand, when the protein of the present invention is produced without attaching such a tag, for example, a method using antibody affinity chromatography can be mentioned. In addition, there can be mentioned a method of combining ion exchange chromatography, gel filtration, hydrophobic chromatography, isoelectric point chromatography, and the like. Nerve regeneration composition In the present invention, it was revealed that laminin-5 has an extremely powerful neurite outgrowth action. In particular,
As described in the examples below, neurite outgrowth at a low concentration of 0.3 μg / ml with respect to rat adrenal medulla pheochromocytoma PC12 cells, rat dorsal root ganglia, and rat hippocampal neurons. Remarkably prompted. In contrast,
The other ECM proteins are almost half or less than laminin-5 even when laminin-1 showing the greatest neurite outgrowth effect or when used at 10 times the concentration (3 μg / ml) of laminin-5. (Example 1, FIG. 2, etc.). Therefore, the present invention clarifies, for the first time, the potent neurite outgrowth action of laminin-5, and provides an effective nerve regeneration composition.

The neurite outgrowth effect of laminin-5 of the present invention was inhibited by anti-integrin α3 and β1 antibodies as described in Example 5 below. Therefore, it is presumed, but not limited to, that the binding of laminin-5 to integrins α3 and β1 is involved in the action.

The composition for nerve regeneration of the present invention can be prepared in vivo.
It can be used to promote neurite outgrowth in vivo, in vitro or ex vivo, and to promote nerve regeneration.

The composition of the present invention can be used, for example, by fixing it to a culture plate such as a plastic plate or a petri dish and bringing it into contact with target nerve cells, as described in Example 1 or 3 below. . As an incubator, for example,
Sumilon (Sumitomo Bakelite) or the like can be used.
For neurite extension, it is preferable to further add an inducer such as nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF).

Alternatively, as described in Example 2, it can be used in a form embedded in a collagen gel. Alternatively, the bundled collagen fibers may be coated as described in JP-A-5-237139. Alternatively, as described in Example 4, the neurite outgrowth effect is exerted even when simply added without fixing or the like.

Without limitation, the compositions of the present invention, when used in vitro or ex vivo, are preferably from 0.1 μg / ml to 1 μg / ml.
Can be used.

The composition of the present invention is particularly useful as a pharmaceutical composition. Specifically, prevention or treatment of diseases caused by damage to nerve cells due to physical or intrinsic causes, for example, trauma due to traffic accidents, or diseases related to nerve degeneration or damage such as Alzheimer's disease, Parkinson's disease or cerebral infarction. It can be used for It is also useful for regeneration after nerve tissue transplantation.

The pharmaceutical composition of the present invention comprises a therapeutically effective amount of laminin-5 in a mixture with a pharmaceutically acceptable carrier. The compositions of the present invention may be administered systemically or locally, preferably parenterally, intravenously, subcutaneously, intramuscularly. Preparation of a parenterally administrable laminin-5 protein solution can be carried out within the technical scope of those skilled in the art in consideration of pH, isotonicity, safety, and the like.

The dosage regimen of the compositions of the present invention may depend on the effect of the drug, for example on the nature and / or severity of the condition of the patient.
It can be determined by the attending physician, taking into account various factors which determine body weight, gender, diet, time of administration, and other clinical effects. One skilled in the art can determine the dose of the composition of the present invention based on these factors.

The composition of the present invention can be further used, for example, by applying it to a transplant at the time of nerve transplantation and transplanting it into a living body. Specifically, nerve regeneration can be promoted by directly applying laminin-5 or by coating it onto a suitable support, or by implanting it into a collagen gel as a transplant in vivo. It is.

Alternatively, nerve regeneration can be promoted by preparing an expression vector incorporating a gene encoding each sub-subunit of laminin-5 and expressing it at a target site in a living body.

Hereinafter, the present invention will be described with reference to examples, but the examples are for illustrative purposes and do not limit the present invention. The scope of the present invention is determined based on the description in the claims. Furthermore, those skilled in the art can easily make modifications and changes based on the description in this specification.

[0063]

EXAMPLES Materials and Methods In the examples of the present invention, unless otherwise specified, the following materials and methods were used.

(1) Materials In this example, poly-L-lysine (catalog No. P2
636) is from Sigma (St. Louis, MO); human plasma fibronectin is Iwaki glass (Tokyo,
From Japan); Bovine type collagen is from Koken (Tokyo, Japan)
From human placenta laminin-1 from Takara Shuzo Co., Ltd. (Kyoto, Japan); papain from Worthington Bio
chemical Corporation (Free
hold, NJ); bovine halotransferrin and insulin from Wako Pure Chemical Industries, Ltd. (Tokyo, Japan); progesterone and sodium selenite from Si
Penicillin G was purchased from Meiji Seika Co., Ltd .; Streptomycin was purchased from Banyu Pharmaceutical Co., Ltd. (Tokyo, Japan); and NGF was purchased from Wako Pure Chemical Industries, Ltd.

The human laminin-5 protein was obtained from Miya
zaki, K .; et al. : Proc. Natl. A
cad. Sci. USA, 90: p. 11767-11
Purified from gastric adenocarcinoma cell line STKM-1 according to the method described in 771, 1993.

Specifically, first, a serum-free culture supernatant of STKM-1 cells was prepared in RPMI medium 1640 (Nissui, Tokyo, Japan) and concentrated with 80% saturated ammonium sulfate. Then, pre-equilibrated Cellulofine GCL
Molecular sieve (gel filtration) chromatography was performed using a 2000-m column (Chisso, Tokyo, Japan) to obtain an active fraction. After dialysis, similarly equilibrated heparin-Sepharose CL-6B column (Pharmacia LKB)
Was used for heparin affinity chromatography. The protein bound to the column was extracted, and the active fraction was dialyzed. Then equilibrated Shod
Anion exchange chromatography was performed using an ex QA-824 anion exchange column (Showa Denko, Tokyo, Japan). The protein bound to the column was extracted to obtain a pure sample.

Alternatively, as a simpler method, the concentrated culture supernatant is directly or after fractionating it by gel filtration chromatography, and then subjected to an anti-laminin γ2 chain antibody column or an anti-laminin α3 chain antibody column. Laminin-
The fraction was fractionated on a 5 antibody column, and the laminin-5 protein was purified. Anti-laminin-5 antibodies include anti-laminin γ2 chain monoclonal antibody, D4B5 antibody (Chemicon,
CA, USA) or the anti-laminin α3 chain monoclonal antibody and LSαIII-4 antibody (Miyazaki Lab., Kihara Biology Research Institute, Yokohama City University) prepared by the present inventors.

The natural type laminin-5 protein purified by the above-described method is a 150 kDa α3 chain, 135 kD
a consisted of the β3 chain of a and the γ2 chain of 105 kDa. In the natural type laminin-5 protein, G4 and G5 of the G domain of the α3 chain and about 50 kDa of the N-terminus of the γ2 chain were removed by the action of a protease,
It showed neurite outgrowth activity as described below. In the examples herein, five types of purified recombinant laminin-
5 proteins (WT, delG5, delG4-G5,
delG3-5, delG2-5) were prepared and used. These recombinant laminin-5 proteins lack the carboxyl terminus of the α3 chain. That is, delG
5, delG4-G5, delG3-5, delG2-
5 are G5, G4-G of the G region of the α chain described above, respectively.
5, G3-5 and G2-5 are deleted.

The above-mentioned recombinant laminin-5 protein was prepared as follows. First, a cDNA library of gastric cancer cells (Mizushima. H. et al: J. Bi)
ochem. , 120: p. 1196-1202, 19
96, supra), cDNA of human laminin α3 chain was isolated, and the plasmid vector pGEM-3Zf (+) (P
romega, Madison, WI, USA). Next, a polymerase chain reaction (PCR) was performed using the laminin α3 chain cDNA as a template to amplify the carboxy terminal cDNA fragment of the laminin α3 chain. As a result of the PCR, the recombinant proteins delG5, delG4-G5, del
G3-5 and delG2-5 were prepared using C
A cDNA fragment encoding the terminal portion was obtained. The c
The DNA fragment was inserted into a vector together with the previously isolated restriction fragment of the α3 chain cDNA fragment to obtain a plasmid construct containing a nucleic acid fragment encoding each recombinant protein.

Next, human fibrosarcoma cells HT1080 (Japanase) expressing only the β3 chain and the γ2 chain were used.
The plasmid construct was placed in a calcium phosphate precipitation method (Chen Resources Bank) (Chen
And Okayama, 1987), and the recombinant protein was secreted into the medium. HT1080
The recombinant laminin-5 protein was purified from the serum-free culture supernatant of the cells by the same method as for the natural protein as described above.

(2) Cell culture a. PC12 cells PC12 cells consisted of 1.2 mg / ml NaHCO ₃ ,
mM glutamine, 10% bovine serum (Hy-clon)
e) (Laboratories, Logan, Uta)
h) and 5% fetal calf serum (FCS) (JRH B
R including iosciences, Lenexa, KS)
In PMI medium 1640 (Nissui, Tokyo, Japan)
It was kept at 7 ° C. in a humidified atmosphere of 5% CO ₂ -95% air.

In the examples herein, PC12 cells were cultured in serum-free RPMI on 24-well plastic culture plates pre-coated with cell adhesion proteins.
The cells were cultured in 1640 medium with 100 ng / ml NGF.

B. Dorsal root ganglion cells Cultures of dorsal root ganglion cells were obtained from 5-week-old SD rats (Japan SLC, Shizuoka, Japan). Specifically, first, about 20 pairs of right and left dorsal root ganglia on both sides of the vertebra were extracted from one rat. When removing the ganglia, the nerve bundles on both sides were cut off with a razor blade. The removed dorsal root ganglion was embedded in collagen and overlaid with a culture medium and cultured.

C. Hippocampal neurons Cultures of hippocampal neurons were obtained from pregnant Wistar rats (N
(ihon SLC, Shizuoka, Japan). Rat embryos used on day 17 were used. Single cells were obtained according to the following method.

First, hippocampal tissues of rat embryos were separated from other peripheral tissues and incubated with 0.25 units / ml of papain for 25 minutes at 37 ° C. After incubation, an additional 0.25 hippocampal tissue was
Incubated with unit / ml papain for 15 minutes at 37 ° C. Next, the hippocampus tissue was suspended using a Pasteur pipette that had been subjected to a heat flame treatment, and single cells were obtained through a lens paper net (Whatman, UK).

On the other hand, laminin-
5, and poly-L-lysine, fibronect as a control
Using chin, type I collagen and laminin-1 respectively
Coating was performed overnight at 37 ° C. D on the plate
ME / F12 serum-free medium (GibcoBRL, Gait
hersburg, MD, UK) with TIPS (100n)
g / ml transferrin, 5 ng / ml insulin
Phosphorus, 63 ng / ml progesterone and 17.3
ng / ml of sodium selenite)
ml, and the hippocampal neurons were seeded. 3 cells
5% CO at 7 ° C _TwoCulture in humidified air with 95% air
Was.

(3) Cell Adhesion Assay Laminin-5 and P for control ECM protein
C12 cell adhesion was analyzed according to conventional methods.

Specifically, a 96-well plate (Cos
ter, Acton, MA, USA) were incubated overnight at 37 ° C. with 100 μl of each ECM protein solution at the indicated concentrations. Then 1.2% (w / v) BS in phosphate buffer (PBS) without Ca ²⁺ and Mg ²⁺
A, The plate was treated with 200 μl at 37 ° C. for 1.5 hours and washed with PBS to block the plate. On the other hand, PC12 cells were washed with serum-free RPMI1640 medium, and 2 × in serum-free medium containing 0.1% (w / v) BSA.
10 ⁵ were suspended at a concentration of cells / ml. Cell suspension (10
0 μl) was seeded into each well of the ECM protein coated plate and incubated at 37 ° C. for 1 hour. Gentle shaking, and 100 μl of 15% (v /
v) Percoll (Pharmacia, Uppsal)
a, Sweden) to remove the non-adherent cells.

Next, 2.5% (v / v
v) Fix with glutaraldehyde and add 100 μl of 0.
0005% (w / v) Hoechst 33342-0.001
% (W / v) Triton X-100 for 1.5 hours. The fluorescence intensity of each well of the plate was CutoFlu
or2350 fluorometer (Millip
ore, Bedford, MA).

Example 1 Rat adrenal medulla pheochromocytoma PC
Various extracellular matrices for neurite outgrowth of 12 cells
Effect of human protein 0.3 μg / ml laminin in 24-well plate
5 (LN-5), as well as 3 μg / ml type I collagen (Col. I) and fibronectin (FN) as controls
And laminin-1 (LN-1) each for 500
Coat overnight with μl / well. PC washed twice with serum-free PRMI medium on the coated plate
12 cells were seeded at 1 × 10 ⁵ cells / ml, and at the same time, nerve growth factor (hereinafter referred to as “NGF”) was 100 ng / m 2.
1 in the medium.

Regarding the morphological change of the cells, 24
After a lapse of 48 hours, the cells were observed with a phase contrast microscope and photographed. The results after 24 hours (30-fold magnification) are shown in FIG. As shown in FIG. 1, when laminin-5 was coated, a remarkable neurite extension effect was observed as compared with any of the control type I collagen, fibronectin, and laminin-1.

At the same time after the cell seeding, the length of the neurite was measured using a monitor. The results are shown in FIG.
According to FIG. 2, when laminin-5 is coated, 24
After hours, neurites averaged 55 μm ± 2.8 μm, and after 48 hours, neurites averaged 66 μm ± 2.5 μm. On the other hand, in the case of the control, in the case of laminin-1, average 22 μm
m ± 2.1 μm, after 48 hours average 35 μm ± 2.
Stretching only 3 μm hardly stretched with type I collagen and fibronectin.

Laminin-5 includes natural laminin-5 described above (G4 and G4 of the G domain of the α3 chain).
5 and the N-terminal about 50 kDa of the γ2 chain are deleted), and the recombinant proteins delG5, del
G4-G5, delG3-5 and delG2-5 were used. The neurite outgrowth effect described above is due to natural laminin-5.
And in the case of the recombinant laminin-5 protein of delG5 and delG4-G5. On the other hand, del
No such effect was observed with G3-5 and delG2-5.

Although not limited, the results suggest that the G3 domain in the α3 chain of laminin-5 protein plays an important role in the neurite outgrowth effect. The following examples show the results when natural laminin-5, which has a neurite outgrowth effect, is used.

Example 2 Collagen of rat dorsal root ganglion
Various extracellular matrix in 3D culture in gel
Neurite Outgrowth Promoting Effect of Protein First, a collagen gel was prepared. Specifically, a collagen gel solution extracted from the tail of a rat, 10-fold concentrated F
12 medium, reconstitution buffer solution (200 mmol / L Na
HCO ₃ and 50 mmol / L NaOH) were mixed well on ice at a volume ratio of 8: 1: 1 to produce a collagen gel. In this example, laminin-5 (LN-5) (0.3 μg / m
l) and fibronectin (FN) (3
μg / ml) and laminin-1 (LN-1) (3 μg
/ Ml) were each added.

The dorsal root ganglion tissue was removed from the rat tail and embedded in 50 μl of the collagen gel at a concentration of 30 μg / ml. After the gel had set, 100 units / ml penicillin G and 0.1 m
1.5 ml to 2 ml of Ham's F12 culture medium (Nissui, Tokyo, Japan) containing g / ml streptomycin was added. 100 ng / m depending on experimental conditions
NGF was added at a concentration of 1 or no NGF was added.

As in Example 1, after adding the F12 medium,
Photographs for changes in neurite extension and measurements for neurite length were taken at 4 and 48 hours. The results are shown in FIGS. 3 and 4, respectively.

FIG. 3 shows the result (10 times) of the photograph taken 48 hours later. As shown in FIG. 3, when laminin-5 was coated, control fibronectin and laminin-1 were used.
A remarkable neurite extension effect was observed as compared with. FIG. 4 shows the measurement results of the neurite length. FIG. 4 shows that, when laminin-5 was coated, an average of 370 μm ± 14 μm, 4
Eight hours later, neurites on average extended to 1040 μm ± 49 μm. In contrast, in the case of the control, about 200 μm to 300 μm,
After about 8 hours, it was about 500 μm to 550 μm, which was significantly shorter than that of laminin-5.

Example 3 Species on rat hippocampal neurons
Neurite outgrowth effect of various extracellular matrix proteins Hippocampus tissue was removed from rat fetus on the 17th day of pregnancy,
Nerve cells were prepared by papain digestion.

On the other hand, using a 24-well plate, laminin-5 (LN-5) (0.3 μg / ml) and poly-L-lysine (PLL) (20 μg / m2) as a control were used.
l), fibronectin (FN) (3 μg / ml), I
Type collagen (Col. I) (3 μg / ml) and laminin-1 (LN-1) (3 μg / ml) each for 500
Coating was performed overnight at μl / well. The prepared hippocampal neurons were seeded on the coated plate at a rate of 4 × 10 ⁵ cells / ml, and TIPS (100 ng / ml transferrin, 5 n) was added to DME / F12 serum-free medium.
g / ml of insulin, 63 ng / ml of progesterone and 17.3 ng / ml of sodium selenite).

Twelve hours and twenty-four hours after cell seeding, photographs of changes in neurite extension and measurements of neurite length were performed in the same manner as in Examples 1 and 2. The results are shown in FIGS. 5 and 6, respectively.

FIG. 5 shows the result (30 times) of the photograph taken 12 hours later. As shown in FIG. 5, when laminin-5 was coated, a remarkable neurite extension effect was observed as compared with the control poly-L-lysine, fibronectin, type I collagen and laminin-1. FIG. 6 shows the measurement results of the neurite length. FIG. 6 shows that, when laminin-5 was coated, an average of 104 μm was obtained after 12 hours.
± 7.0 μm, after 24 hours average 112 μm ± 3.
The 4 μm neurites extended. In contrast, in the control, about 40 μm (after 12 hours) and about 88 μm with fibronectin.
(After 24 hours), about 37 μm (after about 12 hours) for laminin-1, and about 63 μm (after 24 hours) for laminin-1.
5 was significantly shorter than the case of No. 5.

Example 4 PC1 with fibronectin
Addition of laminin-5 to neurite outgrowth of two cells
3μ that effect fibronectin that most neurite promoting effects were observed in Example 1 to 24-well plates
Coating was performed overnight at a concentration of g / ml. Then
PC12 cells washed twice with serum-free RPMI medium
The cells were seeded at × 10 ⁵ cells / ml, and NGF was
g / ml was added to the medium. Twenty-four hours after the addition of NGF, laminin-5 was added at 0.015 μg / m
1, 0.03 μg / ml and 0.3 μg / ml were added to the medium.

At 0 hours, 24 hours and 48 hours after the addition of laminin-5, photographs of changes in neurite extension were taken in the same manner as in Examples 1 to 3. The results (20 times) at 0 and 48 hours are shown in FIG. From FIG.
At concentrations of 0.015 μg / ml and 0.03 μg / ml, the neurite outgrowth effect of laminin-5 was not clear, but the effect was remarkable when 0.3 μg / ml laminin-5 was added. Was. Therefore, Laminin-5
It was clarified that neurite outgrowth was significantly promoted not only when immobilized on a support such as a plate, but also when simply added to a culture solution.

Example 5 PC12 Fine by Laminin-5
Anti-integrin α3, β on neurite outgrowth effect of vesicles
Inhibition by One Antibody An 8-well chamber plate was coated with 0.3 μg / ml laminin-5 overnight. Serum-free RPMI
1 × 10 ⁵ cells / m 2 of PC12 cells washed twice with medium
and NGF was added to the medium at a concentration of 100 ng / ml. After confirming that the cells had adhered to the plate, anti-α3 integrin antibody, anti-β1 integrin antibody and mouse I as a control were added at a concentration of 50 μg / ml.
gG was added in each case.

Twenty-four hours after the addition of each antibody, a photograph of the change in neurite extension was taken in the same manner as in Examples 1 to 4. The results (30 times) are shown in FIG. 8, the neurite outgrowth effect of laminin-5 was significantly inhibited by the anti-integrin α3 and β1 antibodies. Therefore, it is presumed, but not limited to, that the binding of laminin-5 to integrins α3 and β1 is involved in the action.

[0097]

[Sequence List] SEQUENCE LISTING <110> Oriental Yeast Industry Co., Ltd. <120> Composition for nerve regeneration <130> 991998 <160> 6 <210> 1 <211> 5433 <212> DNA <213> Human <220> <221> CDS <222> (1) ... (5139) <300> <301> Ryan, M.C., Tizard, R., VanDevanter, D.R. and Carter, W.G. <302> Cloning of the LamA3 gene encoding the alpha 3 chain of the adhesive ligand epiligrin.Expression in wound repair <303> JOURNAL J. Biol. Chem. <304> 269 <305> 36 <306> 22779-22787 <307> 1994 <400> 1 atg gga tgg ctg tgg atc ttt ggg gca gcc ctg ggg cag tgt ctg 45 Met Gly Trp Leu Trp Ile Phe Gly Ala Ala Leu Gly Gln Cys Leu 1 5 10 15 ggc tac agt tca cag cag caa agg gtg cca ttt ctt cag cct ccc 90 Gly Tyr Ser Ser Gln Gln Gln Arg Val Pro Phe Leu Gln Pro Pro 20 25 30 ggt caa agt caa ctg caa gcg agt tat gtg gag ttt aga ccc agc 135 Gly Gln Ser Gln Leu Gln Ala Ser Tyr Val Glu Phe Arg Pro Ser 35 40 45 cag ggt tgt agc cct gga tac tat cgg gat cat aaa ggc ttg tat 180 Gln Gly Cys Ser Pro Gly Tyr Tyr Arg Asp His Lys Gly Leu Tyr 50 55 60 acc gga cgg tgt gtt ccc tgc aat tgc aac gga cat tca aat caa 225 Thr Gly Arg Cys Val Pro Cys Asn Cys Asn Gly His Ser Asn Gln 65 70 75 tgc cag gat ggc tca ggc ata tgt gtt aac tgt cag cac aac acc 270 Cys Gln Asp Gly Ser Gly Ile Cys Val Asn Cys Gln His Asn Thr 80 85 90 gcg gga gag cac tgt gaa cgc tgc cag gag ggc tac tat ggc aac 315 Ala Gly Glu His Cys Glu Arg Cys Gln Glu Gly Tyr Tyr Gly Asn 95 100 105 gcc gtc cac ggg tcc tg ac gcc tgc cca tgt cct cac act aac 360 Ala Val His Gly Ser Cys Arg Ala Cys Pro Cys Pro His Thr Asn 110 115 120 agc ttt gcc act ggc tgt gtg gtg aat ggg gga gac gtg cgg tgc 405 Ser Phe Ala Thr Gly Cys Val Val Asn Gly Gly Asp Val Arg Cys 125 130 135 tcc tgc aaa gct ggg tac aca gga aca cag tgt gaa agg tgt gca 450 Ser Cys Lys Ala Gly Tyr Thr Gly Thr Gln Cys Glu Arg Cys Ala 140 145 150 ccg gga tat ttc ggg aat ccc cag aaa ttc gga ggt agc tgc caa 495 Pro Gly Tyr Phe Gly Asn Pro Gln Lys Phe Gly Gly Ser Cys Gln 155 160 165 cca tgc agt tgt aac agc aat ggc cag ctg ggc agc tgt cat ccc 540 Pro Cys Ser Cys Asn Ser Asn Gly Gln Leu Gly Ser Cys His Pro 170 175 180 ctg act gga gac tgc ata aac caa gaa ccc aaa gat agc agc cct 585 Leu Thr Gly Asp Cys Ile Asn Gln Glu Pro Lys Asp Ser Ser Pro 185 190 195 gca gaa gaa tgt gat gat tgc gac agc tgt atg acc ctc ctg 630 Ala Glu Glu Cys Asp Asp Cys Asp Ser Cys Val Met Thr Leu Leu 200 205 210 aac gac ctg gcc acc atg ggc gag cag ctc cgc ctg gtc aag tct 675 Asn Asp Leu Ala Thr Met Gly Glu Gln LeuLeu Val Lys Ser 215 220 225 cag ctg cag ggc ctg agt gcc agc gca ggg ctt ctg gag cag atg 720 Gln Leu Gln Gly Leu Ser Ala Ser Ala Gly Leu Leu Glu Gln Met 230 235 240 agg cac atg gag acc cag gcc aag gac ctg agg aat cag ttg ctc 765 Arg His Met Glu Thr Gln Ala Lys Asp Leu Arg Asn Gln Leu Leu 245 250 255 aac tac cgt tct gcc att tca aat cat gga tca aaa ata gaa ggc 810 Asn Tyr Arg Ser Ala Ile Ser Asn His Gly Ser Lys Ile Glu Gly 260 265 270 ctg gaa aga gaa ctg act gat ttg aat caa gaa ttt gag act ttg 855 Leu Glu Arg Glu Leu Thr Asp Leu Asn Gln Glu Phe Glu Thr Leu 275 280 285 caa gaa aag gat ca tcc aga aaa gca caa aca tta aac 900 Gln Glu Lys Ala Gln Val Asn Ser Arg Lys Ala Gln Thr Leu Asn 290 295 300 aac aat gtt aat cgg gca aca caa agc gca aaa gaa ctg gat gtg 945 Asn Asn Val Asn Arg Ala Thr Gln Ser Ala Lys Glu Leu Asp Val 305 310 315 aag att aaa aat gtc atc cgg aat gtg cac att ctt tta aag cag 990 Lys Ile Lys Asn Val Ile Arg Asn Val His Ile Leu Leu Lys Gln 320 325 330 atc tct ggg aca gatgga gag gga aac aac gtg cct tca ggt gac 1035 Ile Ser Gly Thr Asp Gly Glu Gly Asn Asn Val Pro Ser Gly Asp 335 340 345 ttt tcc aga gag tgg gct gaa gcc cag cgc atg atg ag agg gaa ctg 1080 Phe Ser Arg Glu Trp Ala Glu Ala Gln Arg Met Met Arg Glu Leu 350 355 360 cgg aac agg aac ttt gga aag cac ctc aga gaa gca gaa gct gat 1125 Arg Asn Arg Asn Phe Gly Lys His Leu Arg Glu Ala Glu Ala Asp 365 370 375 aaa agg tcg cag ctc ttg ctg aac cgg ata agg acc tgg cag 1170 Lys Arg Glu Ser Gln Leu Leu Leu Asn Arg Ile Arg Thr Trp Gln 380 385 390 aaa acc cac cag ggg gag aac aat ggg ctt gct aac agt atc cgg 1215 Lys Thr Gln Gly Glu Asn Asn Gly Leu Ala Asn Ser Ile Arg 395 400 405 gat tct tta aat gaa tac gaa gcc aaa ctc agt gac ctt cgt gct 1260 Asp Ser Leu Asn Glu Tyr Glu Ala Lys Leu Ser Asp Leu Arg Ala 410 415 420 cgg ctg cag gag gca gct gcc caa gcc aag cag gca aat ggc ttg 1305 Arg Leu Gln Glu Ala Ala Ala Gln Ala Lys Gln Ala Asn Gly Leu 425 430 435 435 aac caa gaa aac gag aga gct ttgg gca att cag aga 350 Asn Gln Glu Asn Glu Arg Ala Leu Gly Ala Ile Gln Arg Gln Val 440 445 450 aaa gaa ata aat tcc ctg cag agt gat ttc acc aag tat cta acc 1395 Lys Glu Ile Asn Ser Leu Gln Ser Asp Phe Thr Lys Tyr Leu Thr 455 460 465 act gca gac tca tct ttg ttg caa acc aac att gcg ctg cag ctg 1440 Thr Ala Asp Ser Ser Leu Leu Gln Thr Asn Ile Ala Leu Gln Leu 470 475 480 atg gag aaa agc cag aag gaa tat gaa ga tta tta agt tta 1485 Met Glu Lys Ser Gln Lys Glu Tyr Glu Lys Leu Ala Ala Ser Leu 485 490 495 aat gaa gca aga caa gaa cta agt gac aaa gta aga gaa ctt tcc 1530 Asn Glu Ala Arg Gln Glu Leu Ser Asp Lys Val Arg Leu Ser 500 505 510 aga tct gct ggc aaa aca tcc ctt gtg gag gag gca gaa aag cac 1575 Arg Ser Ala Gly Lys Thr Ser Leu Val Glu Glu Ala Glu Lys His 515 520 525 gcg cgg tcc tta caa gag ctg gca ag cag ctg gaa gag atc aag 1620 Ala Arg Ser Leu Gln Glu Leu Ala Lys Gln Leu Glu Glu Ile Lys 530 535 540 aga aac gcc agc ggg gat gag ctg gtg cgc tgt gct gtg gat gcc 1665 Arg Asn Ala Ser Gly Asp Glu rg Cys Ala Val Asp Ala 545 550 555 gcc acc gcc tac gag aac atc ctc aat gcc atc aaa gcg gcc gag 1710 Ala Thr Ala Tyr Glu Asn Ile Leu Asn Ala Ile Lys Ala Ala Glu 560 565 565 570 570 gac gca gcc aac agg gct agt gca tct gaa tct gcc ctc cag 1755 Asp Ala Ala Asn Arg Ala Ala Ser Ala Ser Glu Ser Ala Leu Gln 575 580 585 aca gtg ata aag gaa gat ctg cca aga aaa gct aaa acc ctg agt 1800 Thr Val Ile Lyu Glu As Pro Arg Lys Ala Lys Thr Leu Ser 590 595 600 tcc aac agt gat aaa ctg tta aat gaa gcc aag atg aca caa aag 1845 Ser Asn Ser Asp Lys Leu Leu Asn Glu Ala Lys Met Thr Gln Lys 605 610 615 615 aag cta aag caa gaa gtc agt cca gct ctc aac aac cta cag caa 1890 Lys Leu Lys Gln Glu Val Ser Pro Ala Leu Asn Asn Leu Gln Gln 620 625 630 acc ctg aat att gtg aca gtt cag aaa gaa gtg ata gac acc aat 1935 Thr Leu Asn Ile Thr Val Gln Lys Glu Val Ile Asp Thr Asn 635 640 645 ctc aca act ctc cga gat ggt ctt cat ggg ata cag aga ggt gat 1980 Leu Thr Thr Leu Arg Asp Gly Leu His Gly Ile Gln Arg Gly Asp 650 655 660 att ga t gct atg atc agt agt gca aag agc atg gtc aga aag gcc 2025 Ile Asp Ala Met Ile Ser Ser Ala Lys Ser Met Val Arg Lys Ala 665 670 675 aac gac atc aca gat gag gtt ctg gat ggg ctc aac ccc atc cag 20 Asp Ile Thr Asp Glu Val Leu Asp Gly Leu Asn Pro Ile Gln 680 685 690 aca gat gtg gaa aga att aag gac acc tat ggg agg aca cag aac 2115 Thr Asp Val Glu Arg Ile Lys Asp Thr Tyr Gly Arg Thr Gln Asn 695 700 705 gaa gac ttc aaa aag gct ctg act gat gca gat aac tcg gtg aat 2160 Glu Asp Phe Lys Lys Ala Leu Thr Asp Ala Asp Asn Ser Val Asn 710 715 720 aag tta acc aac aaa cta cct gat ctt tgg cgc aag attga 2205 Lys Leu Thr Asn Lys Leu Pro Asp Leu Trp Arg Lys Ile Glu Ser 725 730 735 atc aac caa cag ctg ttg ccc ttg gga aac atc tct gac aac atg 2250 Ile Asn Gln Gln Leu Leu Pro Leu Gly Asn Ile Ser Asp Asn 740 745 750 gac aga ata cga gaa cta att cag cag gcc aga gat gct gcc agt 2295 Asp Arg Ile Arg Glu Leu Ile Gln Gln Ala Arg Asp Ala Ala Ser 755 760 765 aag gtt gct gtc ccc atg agg ttc aat ggt aaa gga gtc gaa 2340 Lys Val Ala Val Pro Met Arg Phe Asn Gly Lys Ser Gly Val Glu 770 775 780 gtc cga ctg cca aat gac ctg gaa gat ttg aaa gga tat aca tct 2385 Val Arg Leu Pro Asn Asp Leu Glu Asp Leu Lys Tyr Thr Ser 785 790 795 ctg tcc ttg ttt ctc caa agg ccc aac tca aga gaa aat ggg ggt 2430 Leu Ser Leu Phe Leu Gln Arg Pro Asn Ser Arg Glu Asn Gly Gly 800 805 810 act gag aat atg ttt gtg atg tac cttga aat aaa gat gcc tcc 2475 Thr Glu Asn Met Phe Val Met Tyr Leu Gly Asn Lys Asp Ala Ser 815 820 825 cgg gac tac atc ggc atg gca gtt gtg gat ggc cag ctc acc tgt 2520 Arg Asp Tyr Ile Gly Met Ala Val As Gly Gln Leu Thr Cys 830 835 840 gtc tac aac ctg ggg gac cgt gag gct gaa ctc caa gtg gac cag 2565 Val Tyr Asn Leu Gly Asp Arg Glu Ala Glu Leu Gln Val Asp Gln 845 850 855 atc ttg acc aag agt gag gca gtt atg gat cgg gtg 2610 Ile Leu Thr Lys Ser Glu Thr Lys Glu Ala Val Met Asp Arg Val 860 865 870 aaa ttt cag aga att tat cag ttt gca agg ctt aat tac acc aaa 2655 Lys Phe Gln Arg Ile Tyr Gln Phe Ala Arg Leu Asn Tyr Thr Lys 875 880 885 gga gcc aca tcc agt aaa cca gaa aca ccc gga gtc tat gac atg 2700 Gly Ala Thr Ser Ser Lys Pro Glu Thr Pro Gly Val Tyr Asp Met 890 895 900 gat ggt aga aat agc aat aca ctc ctt aat ttg gat cct gaa aat 2745 Asp Gly Arg Asn Ser Asn Thr Leu Leu Asn Leu Asp Pro Glu Asn 905 910 915 gtt gta ttt tat gtt gga ggt tac cca cct gat ttt aaa ctt ccc 2790 Val Phe Val Gly Gly Tyr Pro Pro Asp Phe Lys Leu Pro 920 925 930 agt cga cta agt ttc cct cca tac aaa ggt tgt att gaa tta gat 2835 Ser Arg Leu Ser Phe Pro Pro Tyr Lys Gly Cys Ile Glu Leu Asp 935 940 945 gac ctc aat gaa aat gtt ctg agc ttg tac aac ttc aaa aaa aca 2880 Asp Leu Asn Glu Asn Val Leu Ser Leu Tyr Asn Phe Lys Lys Thr 950 955 960 ttc aat ctc aac aca act gaa gtg gag cct tgt aga agg agg agg agg agg agg agg ahe Leu Asn Thr Thr Glu Val Glu Pro Cys Arg Arg Arg Lys 965 970 975 gaa gag tca gac aaa aat tat ttt gaa ggt acg ggc tat gct cga 2970 Glu Glu Ser Asp Lys Asn Tyr Phe Glu Gly Thr Gly Tyr Ala Arg 980 985 990 gtt cca act caa cca cat gct ccc atc cca acc ttt gga cag aca 3015 Val Pro Thr Gln Pro His Ala Pro Ile Pro Thr Phe Gly Gln Thr 995 1000 1005 att cag acc acc gtg gat aga ggc ttg ctg ttc ttt gca gaa aac 3060 Ile Gln Thr Thr Val Asp Arg Gly Leu Leu Phe Phe Ala Glu Asn 1010 1015 1020 ggg gat cgc ttc ata tct cta aat ata gaa gat ggc aag ctc atg 3105 Gly Asp Arg Phe Ile Ser Leu Asn Ile Glu Asp Gly Met 1025 1030 1035 gtg aga tac aaa ctg aat tca gag cta cca aaa gag aga gga gtt 3150 Val Arg Tyr Lys Leu Asn Ser Glu Leu Pro Lys Glu Arg Gly Val 1040 1045 1050 gga gac gcc ata aac aac ggc aga gac cat tc at cag atc aaa 3195 Gly Asp Ala Ile Asn Asn Gly Arg Asp His Ser Ile Gln Ile Lys 1055 1060 1065 att gga aaa ctc caa aag cgt atg tgg ata aat gtg gac gtt caa 3240 Ile Gly Lys Leu Gln Lys Arg Met Val Ele Asn Asp Val Gln 1070 1075 1080 aac act ata att gat ggt gaa gta ttt gat ttc agc aca tat tat 3285 Asn Thr Ile Ile Asp Gly Glu Val Phe Asp Phe Ser Thr Tyr Tyr 1085 1090 1095 ctg gga gga a tt cca att gca atc agg gaa aga ttt aac att tct 3330 Leu Gly Gly Ile Pro Ile Ala Ile Arg Glu Arg Phe Asn Ile Ser 1100 1105 1110 acg cct gct ttc cga ggc tgc atg aaa aat ttg aag aaa acc agt 3375 Thr Phe Arg Gly Cys Met Lys Asn Leu Lys Lys Thr Ser 1115 1120 1125 ggt gtc gtt aga ttg aat gat act gtg gga gta acc aaa aag tgc 3420 Gly Val Val Arg Leu Asn Asp Thr Val Gly Val Thr Lys Lys Cys 1130 1135 1140 tcg gaa gac tgg aag ctt gtg cga tct gcc tca ttc tcc aga gga 3465 Ser Glu Asp Trp Lys Leu Val Arg Ser Ala Ser Phe Ser Arg Gly 1145 1150 1155 gga caa ttg agt ttc act gat ttg ggc tta cca cct act gac cac 35 Gln Leu Ser Phe Thr Asp Leu Gly Leu Pro Pro Thr Asp His 1160 1165 1170 ctc cag gcc tca ttt gga ttt cag acc ttt caa ccc agt ggc ata 3555 Leu Gln Ala Ser Phe Gly Phe Gln Thr Phe Gln Pro Ser Gly Ile 1175 1180 1185 tta tta gat cat cag aca tgg aca agg aac ctg cag gtc act ctg 3600 Leu Leu Asp His Gln Thr Trp Thr Arg Asn Leu Gln Val Thr Leu 1190 1195 1200 gaa gat ggt tac att gaa ttg agc a cc agc gat agc ggc ggc cca 3645 Glu Asp Gly Tyr Ile Glu Leu Ser Thr Ser Asp Ser Gly Gly Pro 1205 1210 1215 att ttt aaa tct cca cag acg tat atg gat ggt tta ctg cat tat 3690 Ile Phe Lys Ser Pro Gln Thr Tyr Met Asp Gly Leu Leu His Tyr 1220 1225 1230 gta tct gta ata agc gac aac tct gga cta cgg ctt ctc atc gat 3735 Val Ser Val Ile Ser Asp Asn Ser Gly Leu Arg Leu Leu Ile Asp 1235 1240 1245 gac cag ctt ctg aga aat agc aaa agg cta aaa cac att tca agt 3780 Asp Gln Leu Leu Arg Asn Ser Lys Arg Leu Lys His Ile Ser Ser 1250 1255 1260 tcc cgg cag tct ctg cgt ctg ggc ggg agc aat ttt gag ggt tgt 3825 Ser Arggln Seru Leu Gly Gly Ser Asn Phe Glu Gly Cys 1265 1270 1275 att agc aat gtt ttt gtc cag agg tta tca ctg agt cct gaa gtc 3870 Ile Ser Asn Val Phe Val Gln Arg Leu Ser Leu Ser Pro Glu Val 1280 1285 1290 cta gat ttg acc agt aac tct ctc aag aga gat gtg tcc ctg gga 3915 Leu Asp Leu Thr Ser Asn Ser Leu Lys Arg Asp Val Ser Leu Gly 1295 1300 1305 ggc tgc agt tta aac aaa cca cct ttt cta atg ttg ctt a aa ggt 3960 Gly Cys Ser Leu Asn Lys Pro Pro Phe Leu Met Leu Leu Lys Gly 1310 1315 1320 tct acc agg ttt aac aag acc aag act ttt cgt atc aac cag ctg 4005 Ser Thr Arg Phe Asn Lys Thr Lys Thr Phe Arg Ile Asn Gln Leu 1325 1330 1335 ttg cag gac aca cca gtg gcc tcc cca agg agc gtg aag gtg tgg 4050 Leu Gln Asp Thr Pro Val Ala Ser Pro Arg Ser Val Lys Val Trp 1340 1345 1350 caa gat gct tgc tca cca ctt ccc aag accg gcc aat cat gga 4095 Gln Asp Ala Cys Ser Pro Leu Pro Lys Thr Gln Ala Asn His Gly 1355 1360 1365 gcc ctc cag ttt ggg gac att ccc acc agc cac ttg cta ttc aag 4140 Ala Leu Gln Phe Gly Asp Ile Pro Thr Ser His Leu Leu Phe Lys 1370 1375 1380 ctt cct cag gag ctg ctg aaa ccc agg tca cag ttt gct gtg gac 4185 Leu Pro Gln Glu Leu Leu Lys Pro Arg Ser Gln Phe Ala Val Asp 1385 1390 1395 atg cag aca aca tcc tcc gaga gtg ttt cac acg ggc act 4230 Met Gln Thr Thr Ser Ser Arg Gly Leu Val Phe His Thr Gly Thr 1400 1405 1410 aag aac tcc ttt atg gct ctt tat ctt tca aaa gga cgt ctg gtc 4275 Lys Asn Ser Phe Met Ala Leu Tyr Leu Ser Lys Gly Arg Leu Val 1415 1420 1425 ttt gca ctg ggg aca gat ggg aaa aaa ttg agg atc aaa agc aag 4320 Phe Ala Leu Gly Thr Asp Gly Lys Lys Leu Arg Ile Lys Ser Lys 1430 1435 gag aaa tgc aat gat ggg aaa tgg cac acg gtg gtg ttt ggc cat 4365 Glu Lys Cys Asn Asp Gly Lys Trp His Thr Val Val Phe Gly His 1445 1450 1455 gat ggg gaa aag ggg cgc ttg gtt gtg gat gga ctg agg Asp Gly Glu Lys Gly Arg Leu Val Val Asp Gly Leu Arg Ala Arg 1460 1465 1470 gag gga agt ttg cct gga aac tcc acc atc agc atc aga gcg cca 4455 Glu Gly Ser Leu Pro Gly Asn Ser Thr Ile Ser Ile Arg Ala Pro 1475 1480 1485 gtt tac ctg gga tca cct cca tca ggg aaa cca aag agc ctc ccc 4500 Val Tyr Leu Gly Ser Pro Pro Ser Gly Lys Pro Lys Ser Leu Pro 1490 1495 1500 aca aac agc ttt gtg gga tgc ctg aag aac ttt cag ctg tca 4545 Thr Asn Ser Phe Val Gly Cys Leu Lys Asn Phe Gln Leu Asp Ser 1505 1510 1515 aaa ccc ttg tat acc cct tct tca agc ttc ggg gtg tct tcc tgc 4590 Lys Pro Leu Tyr Thr Pro Ser Ser Ser Phe Gly Val Ser Ser Cys 1520 1525 1530 ttg ggt ggt cct ttg gag aaa ggc att tat ttc tct gaa gaa gga 4635 Leu Gly Gly Pro Leu Glu Lys Gly Ile Tyr Phe Ser Glu Glu Gly 1535 1540 1545 ggt cat gtc gt gct cac tct gta ttg ttg ggg cca gaa ttt 4680 Gly His Val Val Leu Ala His Ser Val Leu Leu Gly Pro Glu Phe 1550 1555 1560 aag ctt gtt ttc agc atc cgc cca aga agt ctc act ggg atc cta 4725 Lys Leu Val Phe Ile Arg Pro Arg Ser Leu Thr Gly Ile Leu 1565 1570 1575 ata cac atc gga agt cag ccc ggg aag cac tta tgt gtt tac ctg 4770 Ile His Ile Gly Ser Gln Pro Gly Lys His Leu Cys Val Tyr Leu 1580 1585 1590 gag gca gga aag gtc acg gcc tct atg gac agt ggg gca ggt ggg 4815 Glu Ala Gly Lys Val Thr Ala Ser Met Asp Ser Gly Ala Gly Gly 1595 1600 1605 acc tca acg tcg gtc aca cca aag cag tct ctg tgt gat gga cag 4860 Thr Ser Thr Ser Val Thr Pro Lys Gln Ser Leu Cys Asp Gly Gln 1610 1615 1620 tgg cac tcg gtg gca gtc acc ata aaa caa cac atc ctg cac ctg 4905 Trp His Ser Val Ala Val Thr Ile Lys Gln His Ile Leu His Leu 1625 1630 1635 gaa ctg gac aca gac agt agc tac aca gct gga cag atc ccc ttc 4950 Glu Leu Asp Thr Asp Ser Ser Tyr Thr Ala Gly Gln Ile Pro Phe 1640 1645 1650 cca cct gcc agc act caa gag cca cac ctt gga ggt gct cca 4995 Pro Pro Ala Ser Thr Gln Glu Pro Leu His Leu Gly Gly Ala Pro 1655 1660 1665 gcc aat ttg acg aca ctg agg atc cct gtg tgg aaa tca ttc ttt 5040 Ala Asn Leu Thr Thr Leu Arg Ile Pro Val Trp Lys Ser Phe Phe 1670 1675 1680 ggc tgt ctg agg aat att cat gtc aat cac atc cct gtc cct gtc 5085 Gly Cys Leu Arg Asn Ile His Val Asn His Ile Pro Val Pro Val 1685 1690 1695 act gaa gcc ttg gaa gtc g cct gtc agt ctg aat ggt tgt 5130 Thr Glu Ala Leu Glu Val Gln Gly Pro Val Ser Leu Asn Gly Cys 1700 1705 1710 cct gac cag 5139 Pro Asp Gln 1713 taacccaagc ctatttcaca gcaaggaaat tcacctcacgcatgcatgcatgca tgca tg tccacctccctg tgaccatgga 5289 tacccatcac tttggcattc agtgctacat gtgtatttta tataaaaatc 5339 ccatttcttg aagataaaaa aattgttatt caaattgtta tgcacagaat 5389 gtttttggta atattaattt ccactaaaaa attaaatgtc tttt 5433 <210> 2 <211> 1713 <212> PRT <213> Human <400> 2 Met Gly Trp Leu Trp Ile Phe Gly Ala Ala Leu Gly Gln Cys Leu 1 5 10 15 Gly Tyr Ser Ser Gln Gln Gln Arg Val Pro Phe Leu Gln Pro Pro 20 25 30 Gly Gln Ser Gln Leu Gln Ala Ser Tyr Val Glu Phe Arg Pro Ser 35 40 45 Gln Gly Cys Ser Pro Gly Tyr Tyr Arg Asp His Lys Gly Leu Tyr 50 55 60 Thr Gly Arg Cys Val Pro Cys Asn Cys Asn Gly His Ser Asn Gln 65 70 75 Cys Gln Asp Gly Ser Gly Ile Cys Val Asn Cys Gln His Asn Thr 80 85 90 Ala Gly Glu His Cys Glu Arg Cys Gln Glu Gly Tyr Tyr Gly Asn 95 100 105 Ala Val His Gly Ser Cys Arg Ala Cys Pro Cys Pro His Thr Asn 110 115 120 Ser Phe Ala Thr Gly Cys Val Val Asn Gly Gly Asp Val Arg Cys 125 130 135 Ser Cys Lys Ala Gly Tyr Thr Gly Thr Gln Cys Glu Arg Cys Ala 140 145 150 Pro Gly Tyr Phe Gly Asn Pro Gln Lys Phe Gly Gly Ser Cys Gln 155 160 165 Pro Cys Ser Cys Asn Ser Asn Gly Gln Leu Gly Ser Cys His Pro 170 175 180 Leu Thr Gly Asp Cys Ile Asn Gln Glu Pro Lys Asp Ser Ser Pro 185 190 195 Ala Glu Glu Cys Asp Asp Cys Asp Ser Cys Val Met Thr Leu Leu 200 205 210 As n Asp Leu Ala Thr Met Gly Glu Gln Leu Arg Leu Val Lys Ser 215 220 225 Gln Leu Gln Gly Leu Ser Ala Ser Ala Gly Leu Leu Glu Gln Met 230 235 240 Arg His Met Glu Thr Gln Ala Lys Asp Leu Arg Asn Gln Leu Leu 245 250 255 Asn Tyr Arg Ser Ala Ile Ser Asn His Gly Ser Lys Ile Glu Gly 260 265 270 Leu Glu Arg Glu Leu Thr Asp Leu Asn Gln Glu Phe Glu Thr Leu 275 280 285 Gln Glu Lys Ala Gln Val Asn Ser Arg Lys Ala Gln Thr Leu Asn 290 295 300 Asn Asn Val Asn Arg Ala Thr Gln Ser Ala Lys Glu Leu Asp Val 305 310 315 Lys Ile Lys Asn Val Ile Arg Asn Val His Ile Leu Leu Lys Gln 320 325 330 Ile Ser Gly Thr Asp Gly Glu Gly Asn Asn Val Pro Ser Gly Asp 335 340 345 345 Phe Ser Arg Glu Trp Ala Glu Ala Gln Arg Met Met Arg Glu Leu 350 355 360 Arg Asn Arg Asn Phe Gly Lys His Leu Arg Glu Ala Glu Ala Asp 365 370 370 375 Lys Arg Glu Ser Gln Leu Leu Leu Asn Arg Ile Arg Thr Trp Gln 380 385 390 Lys Thr His Gln Gly Glu Asn Asn Gly Leu Ala Asn Ser Ile Arg 395 400 405 Asp Ser Leu Asn Glu Tyr Glu Ala Lys Leu Ser Asp Leu Arg Ala 410 41 5 420 Arg Leu Gln Glu Ala Ala Ala Gln Ala Lys Gln Ala Asn Gly Leu 425 430 435 Asn Gln Glu Asn Glu Arg Ala Leu Gly Ala Ile Gln Arg Gln Val 440 445 450 Lys Glu Ile Asn Ser Leu Gln Ser Asp Phe Thr Lys Tyr Leu Thr 455 460 465 Thr Ala Asp Ser Ser Leu Leu Gln Thr Asn Ile Ala Leu Gln Leu 470 475 480 Met Glu Lys Ser Gln Lys Glu Tyr Glu Lys Leu Ala Ala Ser Leu 485 490 495 495 Asn Glu Ala Arg Gln Glu Leu Ser Asp Lys Val Arg Glu Leu Ser 500 505 510 Arg Ser Ala Gly Lys Thr Ser Leu Val Glu Glu Ala Glu Lys His 515 520 525 Ala Arg Ser Leu Gln Glu Leu Ala Lys Gln Leu Glu Glu Ile Lys 530 535 540 Arg Asn Ala Ser Gly Asp Glu Leu Val Arg Cys Ala Val Asp Ala 545 550 555 Ala Thr Ala Tyr Glu Asn Ile Leu Asn Ala Ile Lys Ala Ala Glu 560 565 570 Asp Ala Ala Asn Arg Ala Ala Ser Ala Ser Glu Ser Ala Leu Gln 575 580 585 Thr Val Ile Lys Glu Asp Leu Pro Arg Lys Ala Lys Thr Leu Ser 590 595 600 Ser Asn Ser Asp Lys Leu Leu Asu Glu Ala Lys Met Thr Gln Lys 605 610 615 Lys Leu Lys Gln Glu Val Ser Pro Ala Leu Asn Asn Leu Gln Gl n 620 625 630 Thr Leu Asn Ile Val Thr Val Gln Lys Glu Val Ile Asp Thr Asn 635 640 645 Leu Thr Thr Leu Arg Asp Gly Leu His Gly Ile Gln Arg Gly Asp 650 655 660 Ile Asp Ala Met Ile Ser Ser Ala Lys Ser Met Val Arg Lys Ala 665 670 675 Asn Asp Ile Thr Asp Glu Val Leu Asp Gly Leu Asn Pro Ile Gln 680 685 690 Thr Asp Val Glu Arg Ile Lys Asp Thr Tyr Gly Arg Thr Gln Asn 695 700 705 Glu Asp Phe Lys Lys Ala Leu Thr Asp Ala Asp Asn Ser Val Asn 710 715 720 Lys Leu Thr Asn Lys Leu Pro Asp Leu Trp Arg Lys Ile Glu Ser 725 730 735 Ile Asn Gln Gln Leu Leu Pro Leu Gly Asn Ile Ser Asp Asn Met 740 745 750 Asp Arg Ile Arg Glu Leu Ile Gln Gln Ala Arg Asp Ala Ala Ser 755 760 765 Lys Val Ala Val Pro Met Arg Phe Asn Gly Lys Ser Gly Val Glu 770 775 780 Val Arg Leu Pro Asn Asp Leu Glu Asp Leu Lys Gly Tyr Thr Ser 785 790 795 Leu Ser Leu Phe Leu Gln Arg Pro Asn Ser Arg Glu Asn Gly Gly 800 805 810 Thr Glu Asn Met Phe Val Met Tyr Leu Gly Asn Lys Asp Ala Ser 815 820 825 Arg Asp Tyr Ile Gly Met Ala Val Val Asp Gly Gln Le u Thr Cys 830 835 840 Val Tyr Asn Leu Gly Asp Arg Glu Ala Glu Leu Gln Val Asp Gln 845 850 855 Ile Leu Thr Lys Ser Glu Thr Lys Glu Ala Val Met Asp Arg Val 860 865 870 Lys Phe Gln Arg Ile Tyr Gln Phe Ala Arg Leu Asn Tyr Thr Lys 875 880 885 Gly Ala Thr Ser Ser Lys Pro Glu Thr Pro Gly Val Tyr Asp Met 890 895 900 Asp Gly Arg Asn Ser Asn Thr Leu Leu Asn Leu Asp Pro Glu Asn 905 910 915 Val Val Phe Tyr Val Gly Gly Tyr Pro Pro Asp Phe Lys Leu Pro 920 925 930 Ser Arg Leu Ser Phe Pro Pro Tyr Lys Gly Cys Ile Glu Leu Asp 935 940 945 Asp Leu Asn Glu Asn Val Leu Ser Leu Tyr Asn Phe Lys Lys Thr 950 955 960 Phe Asn Leu Asn Thr Thr Glu Val Glu Pro Cys Arg Arg Arg Lys 965 970 975 Glu Glu Ser Asp Lys Asn Tyr Phe Glu Gly Thr Gly Tyr Ala Arg 980 985 990 Val Pro Thr Gln Pro His Ala Pro Ile Pro Thr Phe Gly Gln Thr 995 1000 1005 Ile Gln Thr Thr Val Asp Arg Gly Leu Leu Phe Phe Ala Glu Asn 1010 1015 1020 Gly Asp Arg Phe Ile Ser Leu Asn Ile Glu Asp Gly Lys Leu Met 1025 1030 1035 Val Arg Tyr Lys Leu Asn Ser Glu Le u Pro Lys Glu Arg Gly Val 1040 1045 1050 Gly Asp Ala Ile Asn Asn Gly Arg Asp His Ser Ile Gln Ile Lys 1055 1060 1065 Ile Gly Lys Leu Gln Lys Arg Met Trp Ile Asn Val Asp Val Gln 1070 1075 1080 Asn Thr Ile Ile Asp Gly Glu Val Phe Asp Phe Ser Thr Tyr Tyr 1085 1090 1095 Leu Gly Gly Ile Pro Ile Ala Ile Arg Glu Arg Phe Asn Ile Ser 1100 1105 1110 Thr Pro Ala Phe Arg Gly Cys Met Lys Asn Leu Lys Lys Thr Ser 1115 1120 1125 Gly Val Val Arg Leu Asn Asp Thr Val Gly Val Thr Lys Lys Cys 1130 1135 1140 Ser Glu Asp Trp Lys Leu Val Arg Ser Ala Ser Phe Ser Arg Gly 1145 1150 1155 Gly Gln Leu Ser Phe Thr Asp Leu Gly Leu Pro Pro Thr Asp His 1160 1165 1170 Leu Gln Ala Ser Phe Gly Phe Gln Thr Phe Gln Pro Ser Gly Ile 1175 1180 1185 Leu Leu Asp His Gln Thr Trp Thr Arg Asn Leu Gln Val Thr Leu 1190 1195 1200 Glu Asp Gly Tyr Ile Glu Leu Ser Thr Ser Asp Ser Gly Gly Pro 1205 1210 1215 Ile Phe Lys Ser Pro Gln Thr Tyr Met Asp Gly Leu Leu His Tyr 1220 1225 1230 Val Ser Val Ile Ser Asp Asn Ser Gly Leu Arg Leu Leu Ile Asp 1235 1240 1245 Asp Gln Leu Leu Arg Asn Ser Lys Arg Leu Lys His Ile Ser Ser 1250 1255 1260 Ser Arg Gln Ser Leu Arg Leu Gly Gly Ser Asn Phe Glu Gly Cys 1265 1270 1275 Ile Ser Asn Val Phe Val Gln Arg Leu Ser Leu Ser Pro Glu Val 1280 1285 1290 Leu Asp Leu Thr Ser Asn Ser Leu Lys Arg Asp Val Ser Leu Gly 1295 1300 1305 Gly Cys Ser Leu Asn Lys Pro Pro Phe Leu Met Leu Leu Lys Gly 1310 1315 1320 Ser Thr Arg Phe Asn Lys Thr Lys Thr Phe Arg Ile Asn Gln Leu 1325 1330 1335 Leu Gln Asp Thr Pro Val Ala Ser Pro Arg Ser Val Lys Val Trp 1340 1345 1350 Gln Asp Ala Cys Ser Pro Leu Pro Lys Thr Gln Ala Asn His Gly 1355 1360 1365 Ala Leu Gln Phe Gly Asp Ile Pro Thr Ser His Leu Leu Phe Lys 1370 1375 1380 Leu Pro Gln Glu Leu Leu Lys Pro Arg Ser Gln Phe Ala Val Asp 1385 1390 1395 Met Gln Thr Thr Ser Ser Arg Gly Leu Val Phe His Thr Gly Thr 1400 1405 1410 Lys Asn Ser Phe Met Ala Leu Tyr Leu Ser Lys Gly Arg Leu Val 1415 1420 1425 Phe Ala Leu Gly Thr Asp Gly Lys Lys Leu Arg Ile Lys Ser Lys 1430 1435 1440 Glu Lys C ys Asn Asp Gly Lys Trp His Thr Val Val Phe Gly His 1445 1450 1455 Asp Gly Glu Lys Gly Arg Leu Val Val Asp Gly Leu Arg Ala Arg 1460 1465 1470 Glu Gly Ser Leu Pro Gly Asn Ser Thr Ile Ser Ile Arg Ala Pro 1475 1480 1485 Val Tyr Leu Gly Ser Pro Pro Ser Gly Lys Pro Lys Ser Leu Pro 1490 1495 1500 Thr Asn Ser Phe Val Gly Cys Leu Lys Asn Phe Gln Leu Asp Ser 1505 1510 1515 Lys Pro Leu Tyr Thr Pro Ser Ser Ser Phe Gly Val Ser Ser Cys 1520 1525 1530 Leu Gly Gly Pro Leu Glu Lys Gly Ile Tyr Phe Ser Glu Glu 1535 1540 1545 Gly His Val Val Leu Ala His Ser Val Leu Leu Gly Pro Glu Phe 1550 1555 1560 Lys Leu Val Phe Ser Ile Arg Pro Arg Ser Leu Thr Gly Ile Leu 1565 1570 1575 Ile His Ile Gly Ser Gln Pro Gly Lys His Leu Cys Val Tyr Leu 1580 1585 1590 Glu Ala Gly Lys Val Thr Ala Ser Met Asp Ser Gly Ala Gly Gly 1595 1600 1605 Thr Ser Thr Ser Ser Val Thr Pro Lys Gln Ser Leu Cys Asp Gly Gln 1610 1615 1620 Trp His Ser Val Ala Val Thr Ile Lys Gln His Ile Leu His Leu 1625 1630 1635 Glu Leu Asp Thr Asp Ser Ser Tyr Th r Ala Gly Gln Ile Pro Phe 1640 1645 1650 Pro Pro Ala Ser Thr Gln Glu Pro Leu His Leu Gly Gly Ala Pro 1655 1660 1665 Ala Asn Leu Thr Thr Leu Arg Ile Pro Val Trp Lys Ser Phe Phe 1670 1675 1680 Gly Cys Leu Arg Asn Ile His Val Asn His Ile Pro Val Pro Val 1685 1690 1695 Thr Glu Ala Leu Glu Val Gln Gly Pro Val Ser Leu Asn Gly Cys 1700 1705 1710 Pro Asp Gln 1713 <210> 3 <211> 3930 <212> DNA <213> Human <220> <221> CDS <222> (121) ... (3630) <300> <301> Gerecke, D.R., Wagman, D.W., Champliaud, M.F. and Burgeson, R.E. <302> The complete primary structure for a novel laminin chain, the laminin B1k chain <303> J. Biol. Chem. <304> 269 <305> 15 <306> 11073-11080 <307> 1994 <400> 3 gggcgggagg aggactgtat ctctggatgc ctggggcctg gtttcagggc ctgatttatt 60 cctcttcctg ggagctcact caggaaaggt cctttctggg gatcacccca ttggctgaag 120 atgagaccat tcttcctctt gtgttttgcc ctgcctggcc tcctgcatgc ccaacaagcc 180 tgctcccgtg gggcctgcta tccacctgtt ggggacctgc ttgttgggag gacccggttt 240 ctccgagctt catctacctg tggactgacc aagcctgaga cctactgcac ccagtatggc 300 gagtggcaga tgaaatgctg caagtgtgac tccaggcagc ctcacaacta ctacagtcac 360 cgagtagaga atgtggcttc atcctccggc cccatgcgct ggtggcagtc ccagaatgat 420 gtgaaccctg tctctctgca gctggacctg gacaggagat tccagcttca agaagtcatg 480 atggagttcc gagggcccat gcctgccggc atgctgattg agcgctcctc agacttcggt 540 aagacctggc gagtgtacca gtacctggct gccgactgca cctccacctt ccctcgggtc 600 cgccagggtc ggcctcagag ctggcaggat gttcggtgcc agtccctgcc tcagaggcct 660 aatgcacgcc taaatggggg gaaggtccaa cttaacctta tggatttagt gtctgggatt 720 ccagcaactc aaagtcaaaa aattcaagag gtgggggaga tcacaaactt gagagtcaat 780 ttcaccaggc tggcccctgt gccccaaagg ggctaccacc ctcccagcgc ctactatgct 840 gtgtcccagc tc cgtctgca ggggagctgc ttctgtcacg gccatgctga tcgctgcgca 900 cccaagcctg gggcctctgc aggctccacc gctgtgcagg tccacgatgt ctgcgtctgc 960 cagcacaaca ctgccggccc aaattgtgag cgctgtgcac ccttctacaa caaccggccc 1020 tggagaccgg cggagggcca ggacgcccat gaatgccaaa ggtgcgactg caatgggcac 1080 tcagagacat gtcactttga ccccgctgtg tttgccgcca gccagggggc atatggaggt 1140 gtgtgtgaca attgccggga ccacaccgaa ggcaagaact gtgagcggtg tcagctgcac 1200 tatttccgga accggcgccc gggagcttcc attcaggaga cctgcatctc ctgcgagtgt 1260 gatccggatg gggcagtcgc aggggctccc tgtgacccag tgaccgggca gtgtgtgtgc 1320 aaggagcatg tgcagggaga gcgctgtgac ctatgcaagc cgggcttcac tggactcacc 1380 tacgccaacc cgcgacggtg ccaccgctgt gactgcaaca tcctggggtc ccgggagatg 1440 ccgtgtgacg aggagagtgg gcgctgcctt tgtctgccca acgtggtggg tcccaaatgt 1500 gaccagtgtg ctccctacca ctggaagctg gccagtggcc agggctgtga accgtgtgcc 1560 tgcgacccgc acaactccct cagcccacag tgcaaccagt tcacagggca gtgcccctgt 1620 cgggaaggct ttggtggcct gatgtgcagc gctgcagcca tccgccagtg tccagaccgg 1680 acctatggag acgtggccac aggatgccga gcctgtgact gtgatttccg gggaacagag 1740 ggcccgggct gcgacaaggc atcaggccgc tgcctctgcc gccctggctt gaccgggccc 1800 cgctgtgacc agtgccagcg aggctactgc aatcgctacc cggtgtgcgt ggcctgccac 1860 ccttgcttcc agacctatga tgcggacctc cgggagcagg ccctgcgctt tggtagactc 1920 ccgaatgcca ccgccagcct gtggtcaggg cctgggctgg aggaccgtgg cctggcctcc 1980 cggatcctag atgcaaagag taagattgag cagatccgag cagttctcag cagccccgca 2040 gtcacagagc aggaggtggc tcaggtggcc agtgccatcc tctccctcag gcgaactctc 2100 cagggcctgc agctggatct gcccctggag gaggagacgt tgtcccttcc gagagacctg 2160 gagagtcttg acagaagctt caatggtctc cttactatgt atcagaggaa gagggagcag 2220 tttgaaaaaa taagcagtgc tgatccttca ggagccttcc ggatgctgag cacagcctac 2280 gagcagtcag cccaggctgc tcagcaggtc tccgacagct cgcgcctttt ggaccagctc 2340 agggacagcc ggagagaggc agagaggctg gtgcggcagg cgggaggagg aggaggcacc 2400 ggcagcccca agcttgtggc cctgaggttg gagatgtctt cgttgcctga cctgacaccc 2460 accttcaaca agctctgtgg caactccagg cagatggctt gcaccccaat atcatgccct 2520 ggtgagctat gtccccaaga caatg gcaca gcctgtgcgt cccgctgcag gggtgtcctt 2580 cccagggccg gtggggcctt cttgatggcg gggcaggtgg ctgagcagct gcggggcttc 2640 aatgcccagc tccagcggac caggcagatg attagggcag ccgaggaatc tgcctcacag 2700 attcaatcca gtgcccagcg cttggagacc caggtgagcg ccagccgctc ccagatggag 2760 gaagatgtca gacgcacacg gctcctaatc cagcaggtcc gggacttcct aacagacccc 2820 gacactgatg cagccactat ccaggaggtc agcgaggccg tgctggccct gtggctgccc 2880 acagactcag ctactgttct gcagaagatg aatgagatcc aggccattgc agccaggctc 2940 cccaacgtgg acttggtgct gtcccagacc aagcaggaca ttgcgcgtgc ccgccggttg 3000 caggctgagg ctgaggaagc caggagccga gcccatgcag tggagggcca ggtggaggat 3060 gtggttggga acctgcggca ggggacagtg gcactgcagg aagctcagga caccatgcaa 3120 ggcaccagcc ggtcccttcg gcttatccag gacagggttg ctgaggttca gcaggtactg 3180 cggccagcag aaaagctggt gacaagcatg accaagcagc tgggtgactt ctggacacgg 3240 atggaggagc tccgccacca agcccggcag cagggggcag aggcagtcca ggcccagcag 3300 cttgcggaag gtgccagcga gcaggcattg agtgcccaag agggatttga gagaataaaa 3360 caaaagtatg ctgagttgaa ggaccggttg ggtcagagtt ccatgctggg tgagcagggt 3420 gcccggatcc agagtgtgaa gacagaggca gaggagctgt ttggggagac catggagatg 3480 atggacagga tgaaagacat ggagttggag ctgctgcggg gcagccaggc catcatgctg 3540 cgctcagcgg acctgacagg actggagaag cgtgtggagc agatccgtga ccacatcaat 3600 gggcgcgtgc tctactatgc cacctgcaag tgatgctaca cgttccagcc cgttgcccca 3660 ctcatctgcg cgctttgctt ttggttgggg ggcagattgg gttggaatgc tttccatctc 3720 caggagactt tcatgtagcc caaagtacag cctggaccac ccctggtgtg tgtagctagt 3780 aagattaccc tgagctgcag ctgagcctga gccaatggga cagttacact tgacagacaa 3840 agatggtgga gattggcatg ccattgaaac taagagctct caagtcaagg aagctgggct 3900 gggcagtatc ccccgccttt agttctccac 3930 <210> 4 <211> 1170 <212> PRT <213> Human <400> 4 Met Arg Pro Phe Phe Leu Leu Cys Phe Ala Leu Pro Gly Leu Leu 1 5 10 15 His Ala Gln Gln Ala Cys Ser Arg Gly Ala Cys Tyr Pro Pro Val 20 25 30 Gly Asp Leu Leu Val Gly Arg Thr Arg Phe Leu Arg Ala Ser Ser 35 40 45 Thr Cys Gly Leu Thr Lys Pro Glu Thr Tyr Cys Thr Gln Tyr Gly 50 55 60 Glu Trp Gln Met Lys Cys Cys Lys Cys Asp Ser Arg Gln Pro His 65 70 75 Asn Tyr Tyr Ser His His Arg Val Glu Asn Val Ala Ser Ser Ser Gly 80 85 90 Pro Met Arg Trp Trp Gln Ser Gln Asn Asp Val Asn Pro Val Ser 95 100 105 Leu Gln Leu Asp Leu Asp Arg Arg Phe Gln Leu Gln Glu Val Met 110 115 120 Met Glu Phe Arg Gly Pro Met Pro Ala Gly Met Leu Ile Glu Arg 125 130 135 Ser Ser Asp Phe Gly Lys Thr Trp Arg Val Tyr Gln Tyr Leu Ala 140 145 150 Ala Asp Cys Thr Ser Thr Phe Pro Arg Val Arg Gln Gly Arg Pro 155 160 165 Gln Ser Trp Gln Asp Val Arg Cys Gln Ser Leu Pro Gln Arg Pro 170 175 180 Asn Ala Arg Leu Asn Gly Gly Lys Val Gln Leu Asn Leu Met Asp 185 190 195 Leu Val Ser Gly Ile Pro Ala Thr Gln Ser Gln Lys Ile Gln Glu 200 205 210 Va l Gly Glu Ile Thr Asn Leu Arg Val Asn Phe Thr Arg Leu Ala 215 220 225 Pro Val Pro Gln Arg Gly Tyr His Pro Pro Ser Ala Tyr Tyr Ala 230 235 240 Val Ser Gln Leu Arg Leu Gln Gly Ser Cys Phe Cys His Gly His 245 250 255 Ala Asp Arg Cys Ala Pro Lys Pro Gly Ala Ser Ala Gly Ser Thr 260 265 270 Ala Val Gln Val His Asp Val Cys Val Cys Gln His Asn Thr Ala 275 280 285 Gly Pro Asn Cys Glu Arg Cys Ala Pro Phe Tyr Asn Asn Arg Pro 290 295 300 Trp Arg Pro Ala Glu Gly Gln Asp Ala His Glu Cys Gln Arg Cys 305 310 315 Asp Cys Asn Gly His Ser Glu Thr Cys His Phe Asp Pro Ala Val 320 325 330 Phe Ala Ala Ser Gln Gly Ala Tyr Gly Gly Val Cys Asp Asn Cys 335 340 345 Arg Asp His Thr Glu Gly Lys Asn Cys Glu Arg Cys Gln Leu His 350 355 360 Tyr Phe Arg Asn Arg Arg Pro Gly Ala Ser Ile Gln Glu Thr Cys 365 370 375 375 Ile Ser Cys Glu Cys Asp Pro Asp Gly Ala Val Ala Gly Ala Pro 380 385 390 Cys Asp Pro Val Thr Gly Gln Cys Val Cys Lys Glu His Val Gln 395 400 405 Gly Glu Arg Cys Asp Leu Cys Lys Pro Gly Phe Thr Gly Leu Thr 410 41 5 420 Tyr Ala Asn Pro Arg Arg Cys His Arg Cys Asp Cys Asn Ile Leu 425 430 435 Gly Ser Arg Glu Met Pro Cys Asp Glu Glu Ser Gly Arg Cys Leu 440 445 450 Cys Leu Pro Asn Val Val Gly Pro Lys Cys Asp Gln Cys Ala Pro 455 460 465 Tyr His Trp Lys Leu Ala Ser Gly Gln Gly Cys Glu Pro Cys Ala 470 475 480 Cys Asp Pro His Asn Ser Leu Ser Pro Gln Cys Asn Gln Phe Thr 485 490 495 Gly Gln Cys Pro Cys Arg Glu Gly Phe Gly Gly Leu Met Cys Ser 500 505 510 Ala Ala Ala Ile Arg Gln Cys Pro Asp Arg Thr Tyr Gly Asp Val 515 520 525 Ala Thr Gly Cys Arg Ala Cys Asp Cys Asp Phe Arg Gly Thr Glu 530 535 540 540 Gly Pro Gly Cys Asp Lys Ala Ser Gly Arg Cys Leu Cys Arg Pro 545 550 555 Gly Leu Thr Gly Pro Arg Cys Asp Gln Cys Gln Arg Gly Tyr Cys 560 565 570 Asn Arg Tyr Pro Val Cys Val Ala Cys His Pro Cys Phe Gln Thr 575 580 585 Tyr Asp Ala Asp Leu Arg Glu Gln Ala Leu Arg Phe Gly Arg Leu 590 595 600 Pro Asn Ala Thr Ala Ser Leu Trp Ser Gly Pro Gly Leu Glu Asp 605 610 615 Arg Gly Leu Ala Ser Arg Ile Leu Asp Ala Lys Ser Lys Ile Gl u 620 625 630 Gln Ile Arg Ala Val Leu Ser Ser Pro Ala Val Thr Glu Gln Glu 635 640 645 Val Ala Gln Val Ala Ser Ala Ile Leu Ser Leu Arg Arg Thr Leu 650 655 660 Gln Gly Leu Gln Leu Asp Leu Gln Leu Asp Leu Pro Leu Glu Glu Glu Thr Leu Ser 665 670 675 Leu Pro Arg Asp Leu Glu Ser Leu Asp Arg Ser Phe Asn Gly Leu 680 685 690 Leu Thr Met Tyr Gln Arg Lys Arg Glu Gln Phe Glu Lys Ile Ser 695 700 705 Ser Ala Asp Pro Ser Gly Ala Phe Arg Met Leu Ser Thr Ala Tyr 710 715 720 Glu Gln Ser Ala Gln Ala Ala Gln Gln Val Ser Asp Ser Ser Arg 725 730 735 Leu Leu Asp Gln Leu Arg Asp Ser Arg Arg Glu Ala Glu Arg Leu 740 745 750 Val Arg Gln Ala Gly Gly Gly Gly Gly Thr Gly Ser Pro Lys Leu 755 760 765 Val Ala Leu Arg Leu Glu Met Ser Ser Leu Pro Asp Leu Thr Pro 770 775 780 Thr Phe Asn Lys Leu Cys Gly Asn Ser Arg Gln Met Ala Cys Thr 785 790 795 Pro Ile Ser Cys Pro Gly Glu Leu Cys Pro Gln Asp Asn Gly Thr 800 805 810 Ala Cys Ala Ser Arg Cys Arg Gly Val Leu Pro Arg Ala Gly Gly 815 820 825 Ala Phe Leu Met Ala Gly Gln Val Ala Glu Gln Leu Ar g Gly Phe 830 835 840 Asn Ala Gln Leu Gln Arg Thr Arg Gln Met Ile Arg Ala Ala Glu 845 850 855 Glu Ser Ala Ser Gln Ile Gln Ser Ser Ala Gln Arg Leu Glu Thr 860 865 870 Gln Val Ser Ala Ser Arg Ser Gln Met Glu Glu Asp Val Arg Arg 875 880 885 885 Thr Arg Leu Leu Ile Gln Gln Val Arg Asp Phe Leu Thr Asp Pro 890 895 900 Asp Thr Asp Ala Ala Thr Ile Gln Glu Val Ser Glu Ala Val Leu 905 910 915 Ala Leu Trp Leu Pro Thr Asp Ser Ala Thr Val Leu Gln Lys Met 920 925 930 Asn Glu Ile Gln Ala Ile Ala Ala Arg Leu Pro Asn Val Asp Leu 935 940 945 Val Leu Ser Gln Thr Lys Gln Asp Ile Ala Arg Ala Arg Arg Leu 950 955 960 Gln Ala Glu Ala Glu Glu Ala Arg Ser Arg Ala His Ala Val Glu 965 970 975 Gly Gln Val Glu Asp Val Val Gly Asn Leu Arg Gln Gly Thr Val 980 985 990 Ala Leu Gln Glu Ala Gln Asp Thr Met Gln Gly Thr Ser Arg Ser 995 1000 1005 Leu Arg Leu Ile Gln Asp Arg Val Ala Glu Val Gln Gln Val Leu 1010 1015 1020 Arg Pro Ala Glu Lys Leu Val Thr Ser Met Thr Lys Gln Leu Gly 1025 1030 1035 Asp Phe Trp Thr Arg Met Glu Glu Le u Arg His Gln Ala Arg Gln 1040 1045 1050 Gln Gly Ala Glu Ala Val Gln Ala Gln Gln Leu Ala Glu Gly Ala 1055 1060 1065 Ser Glu Gln Ala Leu Ser Ala Gln Glu Gly Phe Glu Arg Ile Lys 1070 1075 1080 Gln Lys Tyr Ala Glu Leu Lys Asp Arg Leu Gly Gln Ser Ser Met 1085 1090 1095 Leu Gly Glu Gln Gly Ala Arg Ile Gln Ser Val Lys Thr Glu Ala 1100 1105 1110 Glu Glu Leu Phe Gly Glu Thr Met Glu Met Met Asp Arg Met Lys 1115 1120 1125 Asp Met Glu Leu Glu Leu Leu Arg Gly Ser Gln Ala Ile Met Leu 1130 1135 1140 Arg Ser Ala Asp Leu Thr Gly Leu Glu Lys Arg Val Glu Gln Ile 1145 1150 1155 Arg Asp His Ile Asn Gly Arg Val Leu Tyr Tyr Ala Thr Cys Lys 1160 1165 1170 <210> 5 <211> 5200 <212> DNA <213> Human <220> <221> CDS <222> (118) ... (3696) <300> <301> Kallunki, P., Sainio, K., Eddy, R., Byers, M., Kallunki, T., Sariola, H., Beck, K., Hirvonen, H., Shows, TB and Tryggvason, K . <302> A truncated laminin chain homologous to the B2 chain: structure, spatial expression, and chromosomal assignment <303> J. Cell Biol. <304> 119 <306> 679-693 <307> 1992 <400> 5 gaccacctga tcgaaggaaa aggaaggcac agcggagcgc agagtgagaa ccaccaaccg 60 aggcgccggg cagcgacccc tgcagcggag acagagactg agcggcccgg caccgccatg 120 cctgcgctct ggctgggctg ctgcctctgc ttctcgctcc tcctgcccgc agcccgggcc 180 acctccagga gggaagtctg tgattgcaat gggaagtcca ggcagtgtat ctttgatcgg 240 gaacttcaca gacaaactgg taatggattc cgctgcctca actgcaatga caacactgat 300 ggcattcact gcgagaagtg caagaatggc ttttaccggc acagagaaag ggaccgctgt 360 ttgccctgca attgtaactc caaaggttct cttagtgctc gatgtgacaa ctctggacgg 420 tgcagctgta aaccaggtgt gacaggagcc agatgcgacc gatgtctgcc aggcttccac 480 atgctcacgg atgcggggtg cacccaagac cagagactgc tagactccaa gtgtgactgt 540 gacccagctg gcatcgcagg gccctgtgac gcgggccgct gtgtctgcaa gccagctgtt 600 actggagaac gctgtgatag gtgtcgatca ggttactata atctggatgg ggggaaccct 660 gagggctgta cccagtgttt ctgctatggg cattcagcca gctgccgcag ctctgcagaa 720 tacagtgtcc ataagatcac ctctaccttt catcaagatg ttgatggctg gaaggctgtc 780 caacgaaatg ggtctcctgc aaagctccaa tggtcacagc gccatcaaga tgtgtttagc 840 tcagcccaac ga ctagatcc tgtctatttt gtggctcctg ccaaatttct tgggaatcaa 900 caggtgagct atgggcaaag cctgtccttt gactaccgtg tggacagagg aggcagacac 960 ccatctgccc atgatgtgat cctggaaggt gctggtctac ggatcacagc tcccttgatg 1020 ccacttggca agacactgcc ttgtgggctc accaagactt acacattcag gttaaatgag 1080 catccaagca ataattggag cccccagctg agttactttg agtatcgaag gttactgcgg 1140 aatctcacag ccctccgcat ccgagctaca tatggagaat acagtactgg gtacattgac 1200 aatgtgaccc tgatttcagc ccgccctgtc tctggagccc cagcaccctg ggttgaacag 1260 tgtatatgtc ctgttgggta caaggggcaa ttctgccagg attgtgcttc tggctacaag 1320 agagattcag cgagactggg gccttttggc acctgtattc cttgtaactg tcaaggggga 1380 ggggcctgtg atccagacac aggagattgt tattcagggg atgagaatcc tgacattgag 1440 tgtgctgact gcccaattgg tttctacaac gatccgcacg acccccgcag ctgcaagcca 1500 tgtccctgtc ataacgggtt cagctgctca gtgattccgg agacggagga ggtggtgtgc 1560 aataactgcc ctcccggggt caccggtgcc cgctgtgagc tctgtgctga tggctacttt 1620 ggggacccct ttggtgaaca tggcccagtg aggccttgtc agccctgtca atgcaacagc 1680 aatgtggacc ccagtgcctc tgggaattgt gaccggctga caggcaggtg tttgaagtgt 1740 atccacaaca cagccggcat ctactgcgac cagtgcaaag caggctactt cggggaccca 1800 ttggctccca acccagcaga caagtgtcga gcttgcaact gtaaccccat gggctcagag 1860 cctgtaggat gtcgaagtga tggcacctgt gtttgcaagc caggatttgg tggccccaac 1920 tgtgagcatg gagcattcag ctgtccagct tgctataatc aagtgaagat tcagatggat 1980 cagtttatgc agcagcttca gagaatggag gccctgattt caaaggctca gggtggtgat 2040 ggagtagtac ctgatacaga gctggaaggc aggatgcagc aggctgagca ggcccttcag 2100 gacattctga gagatgccca gatttcagaa ggtgctagca gatcccttgg tctccagttg 2160 gccaaggtga ggagccaaga gaacagctac cagagccgcc tggatgacct caagatgact 2220 gtggaaagag ttcgggctct gggaagtcag taccagaacc gagttcggga tactcacagg 2280 ctcatcactc agatgcagct gagcctggca gaaagtgaag cttccttggg aaacactaac 2340 attcctgcct cagaccacta cgtggggcca aatggcttta aaagtctggc tcaggaggcc 2400 acaagattag cagaaagcca cgttgagtca gccagtaaca tggagcaact gacaagggaa 2460 actgaggact attccaaaca agccctctca ctggtgcgca aggccctgca tgaaggagtc 2520 ggaagcggaa gcggtagccc ggacg gtgct gtggtgcaag ggcttgtgga aaaattggag 2580 aaaaccaagt ccctggccca gcagttgaca agggaggcca ctcaagcgga aattgaagca 2640 gataggtctt atcagcacag tctccgcctc ctggattcag tgtctccgct tcagggagtc 2700 agtgatcagt cctttcaggt ggaagaagca aagaggatca aacaaaaagc ggattcactc 2760 tcaagcctgg taaccaggca tatggatgag ttcaagcgta cacaaaagaa tctgggaaac 2820 tggaaagaag aagcacagca gctcttacag aatggaaaaa gtgggagaga gaaatcagat 2880 cagctgcttt cccgtgccaa tcttgctaaa agcagagcac aagaagcact gagtatgggc 2940 aatgccactt tttatgaagt tgagagcatc cttaaaaacc tcagagagtt tgacctgcag 3000 gtggacaaca gaaaagcaga agctgaagaa gccatgaaga gactctccta catcagccag 3060 aaggtttcag atgccagtga caagacccag caagcagaaa gagccctggg gagcgctgct 3120 gctgatgcac agagggcaaa gaatggggcc ggggaggccc tggaaatctc cagtgagatt 3180 gaacaggaga ttgggagtct gaacttggaa gccaatgtga cagcagatgg agccttggcc 3240 atggaaaagg gactggcctc tctgaagagt gagatgaggg aagtggaagg agagctggaa 3300 aggaaggagc tggagtttga cacgaatatg gatgcagtac agatggtgat tacagaagcc 3360 cagaaggttg ataccagagc caagaacgct ggggttacaa tccaagacac actcaacaca 3420 ttagacggcc tcctgcatct gatggaccag cctctcagtg tagatgaaga ggggctggtc 3480 ttactggagc agaagctttc ccgagccaag acccagatca acagccaact gcggcccatg 3540 atgtcagagc tggaagagag ggcacgtcag cagaggggcc acctccattt gctggagaca 3600 agcatagatg ggattctggc tgatgtgaag aacttggaga acattaggga caacctgccc 3660 ccaggctgct acaataccca ggctcttgag caacagtgaa gctgccataa atatttctca 3720 actgaggttc ttgggataca gatctcaggg ctcgggagcc atgtcatgtg agtgggtggg 3780 atggggacat ttgaacatgt ttaatgggta tgctcaggtc aactgacctg accccattcc 3840 tgatcccatg gccaggtggt tgtcttattg caccatactc cttgcttcct gatgctgggc 3900 atgaggcaga taggcactgg tgtgagaatg atcaaggatc tggaccccaa agatagactg 3960 gatggaaaga caaactgcac aggcagatgt ttgcctcata atagtcgtaa gtggagtcct 4020 ggaatttgga caagtgctgt tgggatatag tcaacttatt ctttgagtaa tgtgactaaa 4080 ggaaaaaact ttgactttgc ccaggcatga aattcttcct aatgtcagaa cagagtgcaa 4140 cccagtcaca ctgtggccag taaaatacta ttgcctcata ttgtcctctg caagcttctt 4200 gctgatcaga gttcctccta cttacaaccc agggtg tgaa catgttctcc attttcaagc 4260 tggaagaagt gagcagtgtt ggagtgagga cctgtaaggc aggcccattc agagctatgg 4320 tgcttgctgg tgcctgccac cttcaagttc tggacctggg catgacatcc tttcttttaa 4380 tgatgccatg gcaacttaga gattgcattt ttattaaagc atttcctacc agcaaagcaa 4440 atgttgggaa agtatttact ttttcggttt caaagtgata gaaaagtgtg gcttgggcat 4500 tgaaagaggt aaaattctct agatttatta gtcctaattc aatcctactt ttcgaacacc 4560 aaaaatgatg cgcatcaatg tattttatct tattttctca atctcctctc tctttcctcc 4620 acccataata agagaatgtt cctactcaca cttcagctgg gtcacatcca tccctccatt 4680 catccttcca tccatctttc catccattac ctccatccat ccttccaaca tatatttatt 4740 gagtacctac tgtgtgccag gggctggtgg gacagtggtg acatagtctc tgccctcata 4800 gagttgattg tctagtgagg aagacaagca tttttaaaaa ataaatttaa acttacaaac 4860 tttgtttgtc acaagtggtg tttattgcaa taaccgcttg gtttgcaacc tctttgctca 4920 acagaacata tgttgcaaga ccctcccatg ggcactgagt ttggcaagga tgacagagct 4980 ctgggttgtg cacatttctt tgcattccag cgtcactctg tgccttctac aactgattgc 5040 aacagactgt tgagttatga taacaccagt gggaattgct g gaggaacca gaggcacttc 5100 caccttggct gggaagacta tggtgctgcc ttgcttctgt atttccttgg attttcctga 5160 aagtgttttt aaataaagaa caattgttag atgccaaaaa 5200 <210> 6 <211> 1193 <212> PRT <213> Human <400> 6 Met Pro Ala Leu Trp Leu Gly Cys Cys Leu Cys Phe Ser Leu Leu 1 5 10 15 Leu Pro Ala Ala Arg Ala Thr Ser Arg Arg Glu Val Cys Asp Cys 20 25 30 Asn Gly Lys Ser Arg Gln Cys Ile Phe Asp Arg Glu Leu His Arg 35 40 45 Gln Thr Gly Asn Gly Phe Arg Cys Leu Asn Cys Asn Asp Asn Thr 50 55 60 Asp Gly Ile His Cys Glu Lys Cys Lys Asn Gly Phe Tyr Arg His 65 70 75 Arg Glu Arg Asp Arg Cys Leu Pro Cys Asn Cys Asn Ser Lys Gly 80 85 90 Ser Leu Ser Ala Arg Cys Asp Asn Ser Gly Arg Cys Ser Cys Lys 95 100 105 Pro Gly Val Thr Gly Ala Arg Cys Asp Arg Cys Leu Pro Gly Phe 110 115 120 His Met Leu Thr Asp Ala Gly Cys Thr Gln Asp Gln Arg Leu Leu 125 130 135 Asp Ser Lys Cys Asp Cys Asp Pro Ala Gly Ile Ala Gly Pro Cys 140 145 150 Asp Ala Gly Arg Cys Val Cys Lys Pro Ala Val Thr Gly Glu Arg 155 160 165 Cys Asp Arg Cys Arg Ser Gly Tyr Tyr Asn Leu Asp Gly Gly Asn 170 175 180 Pro Glu Gly Cys Thr Gln Cys Phe Cys Tyr Gly His Ser Ala Ser 185 190 195 Cys Arg Ser Ser Ala Glu Tyr Ser Val His Lys Ile Thr Ser Thr 200 205 210 Ph e His Gln Asp Val Asp Gly Trp Lys Ala Val Gln Arg Asn Gly 215 220 225 Ser Pro Ala Lys Leu Gln Trp Ser Gln Arg His Gln Asp Val Phe 230 235 240 Ser Ser Ala Gln Arg Leu Asp Pro Val Tyr Phe Val Ala Pro Ala 245 250 255 Lys Phe Leu Gly Asn Gln Gln Val Ser Tyr Gly Gln Ser Leu Ser 260 265 270 Phe Asp Tyr Arg Val Asp Arg Gly Gly Arg His Pro Ser Ala His 275 280 285 Asp Val Ile Leu Glu Gly Ala Gly Leu Arg Ile Thr Ala Pro Leu 290 295 300 Met Pro Leu Gly Lys Thr Leu Pro Cys Gly Leu Thr Lys Thr Tyr 305 310 315 Thr Phe Arg Leu Asn Glu His Pro Ser Asn Asn Trp Ser Pro Gln 320 325 330 Leu Ser Tyr Phe Glu Tyr Arg Arg Leu Leu Arg Asn Leu Thr Ala 335 340 345 Leu Arg Ile Arg Ala Thr Tyr Gly Glu Tyr Ser Thr Gly Tyr Ile 350 355 360 Asp Asn Val Thr Leu Ile Ser Ala Arg Pro Val Ser Gly Ala Pro 365 370 375 Ala Pro Trp Val Glu Gln Cys Ile Cys Pro Val Gly Tyr Lys Gly 380 385 390 Gln Phe Cys Gln Asp Cys Ala Ser Gly Tyr Lys Arg Asp Ser Ala 395 400 405 Arg Leu Gly Pro Phe Gly Thr Cys Ile Pro Cys Asn Cys Gln Gly 410 41 5 420 Gly Gly Ala Cys Asp Pro Asp Thr Gly Asp Cys Tyr Ser Gly Asp 425 430 435 Glu Asn Pro Asp Ile Glu Cys Ala Asp Cys Pro Ile Gly Phe Tyr 440 445 450 Asn Asp Pro His Asp Pro Arg Ser Cys Lys Pro Cys Pro Cys His 455 460 465 Asn Gly Phe Ser Cys Ser Val Ile Pro Glu Thr Glu Glu Val Val 470 475 480 Cys Asn Asn Cys Pro Pro Gly Val Thr Gly Ala Arg Cys Glu Leu 485 490 495 Cys Ala Asp Gly Tyr Phe Gly Asp Pro Phe Gly Glu His Gly Pro 500 505 510 Val Arg Pro Cys Gln Pro Cys Gln Cys Asn Ser Asn Val Asp Pro 515 520 525 Ser Ala Ser Gly Asn Cys Asp Arg Leu Thr Gly Arg Cys Leu Lys 530 535 540 Cys Ile His Asn Thr Ala Gly Ile Tyr Cys Asp Gln Cys Lys Ala 545 550 555 Gly Tyr Phe Gly Asp Pro Leu Ala Pro Asn Pro Ala Asp Lys Cys 560 565 570 Arg Ala Cys Asn Cys Asn Pro Met Gly Ser Glu Pro Val Gly Cys 575 580 585 585 Arg Ser Asp Gly Thr Cys Val Cys Lys Pro Gly Phe Gly Gly Pro 590 595 600 Asn Cys Glu His Gly Ala Phe Ser Cys Pro Ala Cys Tyr Asn Gln 605 610 615 Val Lys Ile Gln Met Asp Gln Phe Met Gln Gln Leu Gln Arg Me t 620 625 630 Glu Ala Leu Ile Ser Lys Ala Gln Gly Gly Asp Gly Val Val Pro 635 640 645 Asp Thr Glu Leu Glu Gly Arg Met Gln Gln Ala Glu Gln Ala Leu 650 655 660 Gln Asp Ile Leu Arg Asp Ala Gln Ile Ser Glu Gly Ala Ser Arg 665 670 675 Ser Leu Gly Leu Gln Leu Ala Lys Val Arg Ser Gln Glu Asn Ser 680 685 690 Tyr Gln Ser Arg Leu Asp Asp Leu Lys Met Thr Val Glu Arg Val 695 700 705 Arg Ala Leu Gly Ser Gln Tyr Gln Asn Arg Val Arg Asp Thr His 710 715 720 Arg Leu Ile Thr Gln Met Gln Leu Ser Leu Ala Glu Ser Glu Ala 725 730 735 Ser Leu Gly Asn Thr Asn Ile Pro Ala Ser Asp His Tyr Val Gly 740 745 750 Pro Asn Gly Phe Lys Ser Leu Ala Gln Glu Ala Thr Arg Leu Ala 755 760 765 Glu Ser His Val Glu Ser Ala Ser Asn Met Glu Gln Leu Thr Arg 770 775 780 Glu Thr Glu Asp Tyr Ser Lys Gln Ala Leu Ser Leu Val Arg Lys 785 790 795 Ala Leu His Glu Gly Val Gly Ser Gly Ser Gly Ser Pro Asp Gly 800 805 810 Ala Val Val Gln Gly Leu Val Glu Lys Leu Glu Lys Thr Lys Ser 815 820 825 Leu Ala Gln Gln Leu Thr Arg Glu Ala Thr Gln Ala Gl u Ile Glu 830 835 840 Ala Asp Arg Ser Tyr Gln His Ser Leu Arg Leu Leu Asp Ser Val 845 850 855 Ser Pro Leu Gln Gly Val Ser Asp Gln Ser Phe Gln Val Glu Glu 860 865 870 Ala Lys Arg Ile Lys Gln Lys Ala Asp Ser Leu Ser Ser Leu Val 875 880 885 Thr Arg His Met Asp Glu Phe Lys Arg Thr Gln Lys Asn Leu Gly 890 895 900 Asn Trp Lys Glu Glu Ala Gln Gln Leu Leu Gln Asn Gly Lys Ser 905 910 915 Gly Arg Glu Lys Ser Asp Gln Leu Leu Ser Arg Ala Asn Leu Ala 920 925 930 Lys Ser Arg Ala Gln Glu Ala Leu Ser Met Gly Asn Ala Thr Phe 935 940 945 Tyr Glu Val Glu Ser Ile Leu Lys Asn Leu Arg Glu Phe Asp Leu 950 955 960 Gln Val Asp Asn Arg Lys Ala Glu Ala Glu Glu Ala Met Lys Arg 965 970 975 Leu Ser Tyr Ile Ser Gln Lys Val Ser Asp Ala Ser Asp Lys Thr 980 985 990 Gln Gln Ala Glu Arg Ala Leu Gly Ser Ala Ala Ala Asp Ala Gln 995 1000 1005 Arg Ala Lys Asn Gly Ala Gly Glu Ala Leu Glu Ile Ser Ser Glu 1010 1015 1020 Ile Glu Gln Glu Ile Gly Ser Leu Asn Leu Glu Ala Asn Val Thr 1025 1030 1035 Ala Asp Gly Ala Leu Ala Met Glu Ly s Gly Leu Ala Ser Leu Lys 1040 1045 1050 Ser Glu Met Arg Glu Val Glu Gly Glu Leu Glu Arg Lys Glu Leu 1055 1060 1065 Glu Phe Asp Thr Asn Met Asp Ala Val Gln Met Val Ile Thr Glu 1070 1075 1080 Ala Gln Lys Val Asp Thr Arg Ala Lys Asn Ala Gly Val Thr Ile 1085 1090 1095 Gln Asp Thr Leu Asn Thr Leu Asp Gly Leu Leu His Leu Met Asp 1100 1105 1110 Gln Pro Leu Ser Val Asp Glu Glu Gly Leu Val Leu Leu Glu Gln 1115 1120 1125 Lys Leu Ser Arg Ala Lys Thr Gln Ile Asn Ser Gln Leu Arg Pro 1130 1135 1140 Met Met Ser Glu Leu Glu Glu Arg Ala Arg Gln Gln Arg Gly His 1145 1150 1155 Leu His Leu Leu Glu Thr Ser Ile Asp Gly Ile Leu Ala Asp Val 1160 1165 1170 Lys Asn Leu Glu Asn Ile Arg Asp Asn Leu Pro Pro Gly Cys Tyr 1175 1180 1185 Asn Thr Gln Ala Leu Glu Gln Gln 1190 1193

[Brief description of the drawings]

FIG. 1 shows the neurite outgrowth effect of various extracellular matrix proteins on rat adrenal medulla pheochromocytoma PC12 cells.

FIG. 2 shows the length of neurites extended on various extracellular matrix proteins of rat adrenal medulla pheochromocytoma PC12 cells.

FIG. 3 shows the neurite outgrowth effect of various extracellular matrix proteins in three-dimensional culture of rat dorsal root ganglia in collagen gel.

FIG. 4 shows neurite lengths extended on various extracellular matrix proteins of rat dorsal root ganglia.

FIG. 5 shows neurite outgrowth effects of various extracellular matrix proteins on rat hippocampal neurons.

FIG. 6 shows the length of neurites extended on various extracellular matrix proteins of rat hippocampal neurons.

FIG. 7 shows PC12 on fibronectin substrate.
The effect of the addition of laminin-5 on neurite outgrowth of cells is shown.

FIG. 8 shows the inhibition of the neurite outgrowth effect of PC12 cells by laminin-5 by anti-integrin α3 and β1 antibodies.

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) A61P 43/00 111 C07K 14/47 C07K 14/47 A61K 37/02 // C12N 15/09 ZNA C12N 15 / 00 ZNAA F term (reference) 4B024 AA01 BA80 CA04 DA03 EA04 GA11 HA01 4C084 AA02 AA07 BA01 BA08 BA22 DA40 MA63 MA65 MA66 ZA022 ZA162 ZA202 4H045 AA30 BA10 CA41 EA21 FA71 FA72 FA74 GA06 GA10 GA22 GA23 GA26 HA07

Claims (5)

[Claims] 1. A composition for nerve regeneration comprising laminin-5. 2. A protein comprising laminin-5, which comprises subunits of an α3 chain having the amino acid sequence of SEQ ID NO: 2, a β3 chain having the amino acid sequence of SEQ ID NO: 4, and a γ2 chain having the amino acid sequence of SEQ ID NO: 6. 2. The protein according to claim 1, which is a protein having an amino acid sequence in which one or more amino acid residues are deleted, added or substituted, and which has a nerve regeneration function. Composition. 3. The amino acid sequence of laminin-5 comprises α3 chain having the amino acid sequence of SEQ ID NO: 2, β3 chain having the amino acid sequence of SEQ ID NO: 4, and γ2 chain having the amino acid sequence of SEQ ID NO: 6. 3. A protein comprising each subunit having the above homology.
A composition according to claim 1. 4. The laminin-5 comprises an α3 chain having the amino acid sequence of SEQ ID NO: 2, a β3 chain having the amino acid sequence of SEQ ID NO: 4, and a γ2 chain having the amino acid sequence of SEQ ID NO: 6. A composition according to claim 1. 5. The composition according to claim 1, which is used for medicine.