JP2001136969A - Oligonucleotide for detecting enteric bacterium and method for detecting the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain an oligonucleotide which allows accurately, simply, and rapidly detecting an enteric bacterium. SOLUTION: This oligonucleotide is DNA or RNA having a base sequence shown by sequence 1, 2 or 3, or DNA or RNA having a base sequence shown by sequence 4, 5 or 6.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to an oligonucleotide for detecting intestinal bacteria and a method for detecting intestinal bacteria, and is applied to, for example, detection of intestinal bacteria in tests related to food hygiene.

[0002]

2. Description of the Related Art As a method capable of detecting many intestinal bacteria, there is a coliform test, and this test is currently regarded as an essential test in food hygiene management. Conventional coliform group tests (hereinafter referred to as conventional methods) include the dezoxycholate method, the lactose bouillon method, and the BGLB method, all of which indicate lactose fermentability and carbon dioxide gas generation in selective culture, and indicate that the bacterium is a Gram-negative non-spore bacillus. To detect coliforms. These require four tests to determine positive and take four to five days to determine results.

[0003] As a quicker and simpler method, an enzyme substrate method has been developed and has been widely used in recent years. This method detects β-galactosylase in selective culture using a chromogenic synthase substrate, and can determine the coliform bacteria in 24 hours by only one test, which is a simpler and faster measurement method than the conventional method. .

[0004] Since β-galactosylase is the main enzyme involved in lactose fermentation, detection of β-galactosylase from cultures indirectly proves the presence of coliforms. Lactose fermentation requires β-galactosylase as well as cell-penetrating enzymes, and there are potential lactose-fermenting bacteria that produce β-galactosylase but do not ferment lactose due to lack of permease. Although these cannot be detected by the conventional method, these bacteria can also be detected as coliforms by the enzyme substrate method. Therefore, more bacterial species are detected by the enzyme substrate method than the conventional method, and Shigella sonnnei, Salmonella bongori, and Serratia
Intestinal pathogens that cannot be detected by conventional methods, such as marcescens, can be detected. The enzyme-substrate method is said to be more suitable for the purpose of hygienic tests in that a majority of intestinal bacteria can be detected as a contamination indicator than the test using lactose fermentability as an indicator.

[0005]

However, the enzyme-substrate method detects a majority of intestinal bacteria, but does not detect β-galactosylase-negative intestinal bacteria.
La-Thphi, Salmonella paratyphiA and other β-galactosylase-negative intestinal pathogens could not be detected,
Another drawback is that some bacterial species belonging to the Vibrio family, such as Aeromonas caviae, are detected as false positives. Also,
Since culture is required, there is a problem that it takes 24 hours to determine the result. The present inventor believes that the intestinal bacterial test would be better than the coliform test as an indicator of food hygiene if all intestinal bacteria, whether β-galactosylase positive or negative, could be detected quickly and accurately. . However, to detect all intestinal bacteria, after culturing on a standard agar plate medium, etc., pure isolation culture of a single strain was performed from the colonies that appeared, and then a Gram reaction test was performed on each of the obtained isolated strains, Then, biochemical tests for 50 or more items had to be performed, and there was a problem that more items and time were required than the coliform group test.

[0006] On the other hand, today, microbial tests require faster results, and various rapid detection methods have been reported. As a detection method, in addition to those based on phenotypes such as the activity of an enzyme specifically possessed by the microorganism to be detected, a method of detecting the base sequence of a gene specifically possessed by the microorganism to be detected has been reported. For example, there is a PCR method using a specific base sequence of a toxin gene as a primer, and detection primers for botulinum, Vibrio parahaemolyticus, Staphylococcus aureus, Escherichia coli O-157 and the like are commercially available. In addition, methods for detecting a target microorganism by PCR or hybridization using the base sequence of rRNA have been reported in Salmonella, Escherichia coli, Mycobacterium tuberculosis, and the like. Test methods based on genotypes can be expected to be faster than phenotypes without culturing. For intestinal bacteria, PCR using primers specific to the Lac-Z (β-galactosylase) gene
A method for detecting coliform (β-galactosylase-positive intestinal bacteria) has been reported. However, the detection rate was as low as about 70% of that of the test coliform.

The present invention has been made in view of the above circumstances, and has as its object to accurately, simply, and quickly detect intestinal bacteria.

[0008]

In order to achieve the above object, an oligonucleotide for detecting enterobacteria according to the present invention comprises a DN having a base sequence represented by SEQ ID NO: 1 to SEQ ID NO: 3.
A or RNA nucleic acid. The oligonucleotide for detecting intestinal bacteria according to claim 1 is at least 91% homologous to the nucleotide sequence of SEQ ID NOS: 1 to 3. Further, the oligonucleotide for detecting intestinal bacteria according to the present invention is characterized in that it is a nucleic acid of DNA or RNA having the base sequence represented by SEQ ID NO: 4 to SEQ ID NO: 6. The oligonucleotide for detecting intestinal bacteria according to claim 3 comprises SEQ ID NO: 4 to SEQ ID NO: 6.
Is at least 75% homologous to the nucleotide sequence of In addition, the present invention is characterized in that the intestinal bacteria detecting oligonucleotide according to claim 1 or 2 is hybridized to a nucleic acid to be detected, and the hybridized detection target is regarded as intestinal bacteria. Provide a method for detecting bacteria. In addition, the method for detecting intestinal bacteria comprises hybridizing the oligonucleotide for detecting intestinal bacteria according to claim 3 or 4 with a nucleic acid to be detected and treating the hybridized detection target as intestinal bacteria. Features. In the method for detecting enterobacteria according to claim 5, the base sequence of the oligonucleotide for detecting enterobacteria and the base region of the same region of the nucleic acid to be detected are compared, and the base sequence of the nucleic acid to be detected is intestinal. The detection target is regarded as an intestinal bacterium when it is within a numerical value (reference value) based on the number of bases mismatched with the base sequence of the bacterial detection oligonucleotide. Further, in the method for detecting enterobacteria according to claim 6, the base sequence of the oligonucleotide for detecting enterobacteria is compared with the same region base sequence of the nucleic acid to be detected, and the base sequence of the nucleic acid to be detected is intestinal. The detection target is regarded as an intestinal bacterium when it is within a numerical value (reference value) based on the number of bases mismatched with the base sequence of the bacterial detection oligonucleotide. Further, in the method for detecting intestinal bacteria according to claim 7 or claim 8, the reference value is the nucleotide sequence of claim 1 or claim 2 or claim 3 or claim 4 and enterobacteriaceae and pasteurellae. It is characterized by comparing the 16S rDNA of the strain belonging to each Vibrio family with the nucleotide sequence of the same region and deriving from the number of mismatched bases. Further, in the method for detecting intestinal bacteria according to any one of claims 7 to 9, when the nucleotide sequence of the nucleic acid to be detected is within the range of the reference value, the nucleic acid to be detected and the oligo for detecting intestinal bacteria are used. It is characterized in that the nucleotides hybridize. Further, in the method for detecting intestinal bacteria according to claim 7, the reference value is set to 2 or less. Further, in the method for detecting intestinal bacteria according to claim 8, the reference value is set to 6 or less.
In the method for detecting enteric bacteria according to claim 5 or 6, the temperature conditions for the hybridization and washing are such that the base sequence of the oligonucleotide for detecting enteric bacteria and the base sequence in the same region of the nucleic acid to be detected are used. In comparison, the base sequence of the nucleic acid to be detected is derived from the number of bases that mismatch with the base sequence of the oligonucleotide for detecting enterobacteria.

[0009]

BEST MODE FOR CARRYING OUT THE INVENTION The oligonucleotide for detecting intestinal bacteria and the method for detecting intestinal bacteria according to the present invention use a labeled product of an oligonucleotide specific for intestinal bacteria as a probe and detect a hybrid with the labeled product. I thought.
In addition, if a short oligonucleotide probe having about 20 bases is used at that time, in situ removal of nucleic acid is not required.
u Hybridization can be performed, and the advantage of detecting up to a single base difference can be obtained. In that case,
The question is what kind of DNA or RNA is to be detected. The present inventor has proposed that intestinal bacteria,
Since the species belonging to Enterobacteriaceae are a taxon that is systematically organized, we thought that the specific nucleotide sequence of enterobacteria might be found in 16S rDNA for the following reasons: . That is, 16S rDNA is
It is known that RNA of about 1500 bases in total length present in mein Bacteria (bacteria) has a base sequence that is highly conserved in all bacteria and a region that varies depending on the type of bacteria. 9 areas with changes (V1 to V9)
This is because these nucleotide sequences differ depending on the species or genus level, and are said to reflect the evolved strain of bacteria. For this reason, 16S rDNA or 16S rDNA was used as the detection target for intestinal bacteria. They searched for 16S rDNA nucleotide sequences specific to enterobacteria, and based on those sequences, developed oligonucleotides for detecting enterobacteria.

From the phylogenetic analysis using 16S rDNA, Enterobacteriaceae
It belongs to the Preteobacteria γ group, in which the Enterobacteriaceae are systematically closest to Pasteurellaceae (Pasteurellaceae), followed by Vibrionaceae (Vibrionaceae)
Is said to be close. Therefore, the 16S rDNA nucleotide sequences of Enterobacteriaceae, Pasteurellaceae and Vibrioceae are compared, and a nucleotide sequence common to Enterobacteriaceae and different from the latter two Pasteurellae and Vibrioceae is found. If possible, the sequence differences should be even greater for bacteria systematically farther than the latter two. Therefore, intestinal bacteria 12 genera 29 species (β-galactosylase (+) 9 genera 19 species, β
-Galactosylase (-) 5 genera 9 species, β-galactosylase (unknown) 1 species) and 3 bacteria belonging to Pasteurella family 6 genera
Nucleotide sequence information of 16S rDNA of three species and eight species of bacteria belonging to the Vibrio family was collected, and multiple alignment of these sequences was performed to search for nucleotide sequences common to only intestinal bacteria. The 16S rDNA base sequence information can be obtained by, for example, the following analysis operation. That is, after culturing various bacteria at an appropriate temperature using an appropriate liquid medium, DNA is extracted from the cultured cells using an Instagene DNA purification matrix (Nippon Bio-Rad). This extracted DNA and two universal primers (10F: AGTTTGATCCTGGCTC, 1540 R: AAGGAGGTG
ATCCAGCC) and PCR kit (Gene Amp PCR Core Rea)
gents: PeakinElmer) to prepare a reaction solution (general composition), which is subjected to a PCR reaction (general conditions) to obtain 16S
Amplify rDNA. The obtained PCR product is applied to a gel filtration column (Chromaspin-100 columns: Clontech Laboratories)
Purified PCR product, one universal primer (10F or 1540R or universal primer encoding the other region of 16S rDNA) and DNA
Sequence kit (Dye Terminator Cycle Sequencing)
Using Ready Rection (Peakin Elmer), a sequence reaction is individually performed for various regions in the entire 16S rDNA. Next, these sequence reactions are transferred to a DNA sequencer.
(Model 377: Peakin Ermer) to obtain 16S rDNA partial nucleotide sequence information. Then edit these sequence information and edit 16S
The entire base sequence of the rDNA will be determined.

As a result, the intestinal bacteria-specific nucleotide sequence was 16S rDNA regardless of whether the β-galactosylase was positive or negative.
V2 (179-194 in E. coli No.), V5 (834-8
56 in E.coli No.), V7 (1123-1141 in E.coli N)
o.), V8 (1251-1274 in E.coliNo.), and the E.coli sequence in each region is defined as an intestinal bacteria-specific nucleotide sequence, and A (ATAACGTCGCAAGACC) B (TTGTGCCCTTGAGGCGTGGCTTC) C (TGTTGCCAGCGGTCCGGCC) D (AAGAGAAGCGACCTCGCGAGAGCA) (see FIG. 1). A consists of 16 bases, B consists of 23 bases, C consists of 19 bases and D consists of 24 bases.

Next, the intestinal bacteria-specific nucleotide sequences A, B,
The nucleotide sequences of the same region of 16S rDNA of C and D and each of the above bacterial species (Enterobacteriaceae, Pasteurellaceae and Vibrioaceae) used in the multiple alignment were compared. The specific base sequence A-D
Showed a relatively large number of mismatches for 14 strains of Pasteurellaceae and Vibrioaceae, and a small number for 29 intestinal bacteria (see Tables 1 and 2). The minimum number of mismatches of the above specific nucleotide sequence AD with respect to Pasteurellaceae and Vibrioaceae is 5 for A, 3 for B, 3 for C, and 3 for D, respectively.
Was 7 bases. This means that as a standard for intestinal bacteria, at most 4 or less mismatches for the specific base sequence A, 2 or less for B, 2 or less for C, and 6 or less for D (The number of mismatches is hereinafter referred to as “the number of allowable mismatches”). Based on this criterion, the number of bacteria that each sequence of AD considers as enterobacteria for 29 enterobacteria is 26 species (90%) for A, 27 species (93%) for B, In C, 18 strains (62
%) And D were 29 bacterial species (100%). This number (%)
Can be regarded as the detection rate when intestinal bacteria are detected using an oligonucleotide derived from the nucleotide sequence of each AD. From these viewpoints, B and D can be said to be very promising. Therefore, the oligonucleotide for detecting enterobacteria according to the present invention has a nucleic acid and sequence of DNA or RNA having the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 3 based on Sequence B. Based on D, the nucleic acid was a DNA or RNA nucleic acid having the nucleotide sequence of SEQ ID NO: 4 to SEQ ID NO: 6.

[0013]

[Table 1]

[0014]

[Table 2]

Here, the range of homology (%) of intestinal bacteria-specific nucleotide sequences will be described. [0011] From Sequence B and Sequence D, the number of bases is 23 and 24, respectively.
[0012] The minimum number of mismatches for Pasteurellaceae and Vibrioceae is 3 for sequence B and 7 for sequence D.
Based on this value, the criterion for considering the detection target as intestinal bacteria is Sequence B
And a sequence having a mismatch number of 2 or less (including 0) or a sequence having an array D and a mismatch number of 6 or less (including 0). That is, this value (“2” or “6”) is a reference value for considering the detection target as intestinal bacteria, and is the “allowable mismatch number”.

The number of bases in sequence B is 23. Therefore, the allowable range of the homology (%) of nucleotides that can be regarded as intestinal bacteria with sequence B is (23-2) / 23 x 100 = 91%. Therefore, the allowable range of homology (%) to sequence B is 91
% To 100%. Therefore, looking at the nucleotide sequences of the oligonucleotides of SEQ ID NOS: 1 to 3 derived from Sequence B, oligonucleotides that are at least 91% homologous to the nucleotide sequences of the oligonucleotides of SEQ ID NOs: 1 to 3 are also intestinal. This is effective as an oligonucleotide for detecting bacteria inside.

Next, regarding sequence D, the number of bases in D is
24 bases. Therefore, the homology (%) of the base sequence that can be regarded as an intestinal bacterium with respect to sequence D is that the number of allowable mismatches for 24 bases is 6 or less, so (24−6) / 24 × 100 = 75 %. Therefore, the homology (%) of the base sequence with the sequence D that can be regarded as enterobacteria is 75% or more. Therefore, with respect to SEQ ID NOs: 4 to 6 derived from Sequence D, oligonucleotides having at least 75% homology to the base sequence of the oligonucleotides of SEQ ID NOs: 4 to 6 are also used as oligonucleotides for detecting enterobacteria. Becomes effective.

The oligonucleotides for detecting enterobacteria according to the present invention show the base sequences of the following three nucleic acids. That is, the nucleotide sequence of claim 1 comprises SEQ ID NO: 1 to SEQ ID NO: 3.
Are shown.

Further, the nucleotide sequence of claim 2 has SEQ ID NO: 4.
To SEQ ID NO: 6 are shown.

Next, a method for detecting intestinal bacteria using the oligonucleotide for detecting intestinal bacteria thus developed will be described. Oligonucleotides can be prepared by chemical synthesis using an automatic DNA synthesizer or by enzymatically excising the Escherichia coli gene. As the label, for example, a detectable label such as an isotope or a fluorescent substance is bound to the oligonucleotide by an ordinary method. Hybridization between the labeled substance and the sample can be performed by a conventional method, for example, FISH (Fluorescence In Situ Hybridization) or other methods. The formed hybrid can be confirmed by observing the labeled substance by fluorescence microscopy. Observe it.

[0021] Among these oligonucleotides, the DNA fragment represented by SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 5 can also be used as a primer in the PCR method. For example, a cell to be confirmed is lysed, and any one of the DNA fragments of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 5 is added as one of the primers to the DNA of the cell. At this time, the other primer uses a DNA fragment encoding an arbitrary 16S rDNA universal region. Alternatively, the DNA fragments of SEQ ID NO: 1 and SEQ ID NO: 5 may be used simultaneously as two primers. Next, a PCR reaction is performed, and if amplification of a DNA of a specific length can be confirmed by electrophoresis of the product, it can be specified that the target cell is an intestinal bacterium.

An example of detection of intestinal bacteria by FISH will be specifically described. The method was R. Amann, J. Snaidr, M. Wagner, W. L.
udwig, and K.-H.Schleifer: J. Bacteriol., 178, 3
496 (1996). The target of the probe was 16S rRNA. Preparation of probe The 5 'end of the nucleotide sequence of the oligonucleotide of SEQ ID NO: 2
Single-stranded D labeled with FITC (fluorescein isothiocyanate)
NA (FITC-5'-GAAGCCACGCCTCAAGGGCACAA-3 ') was synthesized and used as probe 1 for detecting intestinal bacteria (hereinafter abbreviated as probe 1). In addition, single-stranded DNA (FITC-labeled) in which the 5 'end of the nucleotide sequence of the oligonucleotide of SEQ ID NO: 5 is labeled with FITC.
5'-TGCTCTCGCGAGGTCGCTTCTCTT-3 ') and synthesize it with Probe 2 for detecting intestinal bacteria (hereinafter abbreviated as Probe 2)
And

On the other hand, as a probe for detecting all eubacteria, 16S rDNA universal region (342-357 / in E.col.
i No.) with the fluorescent substance TAMRA at the 5 'end of the complementary base sequence.
(N, N, N ', N'-tetramethyl-6-carboxyrhodamine) single-stranded DNA (TAMRA-5'-CTGCTGCCTCCCGTAG-3')
(This is referred to as probe 350R). This probe was used as a positive control for verifying that the intestinal bacteria detection probes 1 and 2 function correctly.

Next, the FISH method will be described in detail as follows. Preparation of glass slides Glass slides in 10% potassium hydroxide / ethanol
After soaking for a time, it was rinsed with distilled water and air-dried. Next, a gelatin solution (0.1% gelatin, 0.01% potassium chromium sulfate) at 70 ° C. was placed on the surface, and the glass slide was erected and dried.

Fixation of the strain In order to increase the rRNA content in the cells, a preculture of the used strain was used.
0 μl was inoculated into 3 ml of a liquid medium suitable for culture, and cultured for 1 hour as the time required for one cell division. Cells were collected from 1 ml of this culture by centrifugation (10,000 rpm × 10 minutes), and
250 μl of 0 mM phosphate buffer (pH 7.2) was added and suspended. Next, 750 μl of 4% paraformaldehyde / 200 mM phosphate buffer (pH 7.2) was added to the bacterial suspension, followed by gentle stirring (2 hours at room temperature). 100% of this in 1%
Add Nonidet P-40 (sigma) and add 3 μl of this suspension.
Was placed on a glass slide and air-dried. Next, the slide glass was immersed in 50% ethanol, 80% ethanol, and 100% ethanol in this order for 3 minutes and air-dried.

Hybridization / Fluorescence Microscopy Observation 9 μl of hybridization solution (0.9 M NaCl, 20% formamide, 200 mM Tris HCl (pH 7.4), 0.01% SDS) was placed on the site where the strain was immobilized on the slide glass. ,
This was placed in a moisture chamber and kept warm for 30 minutes (prehybridization). Next, 1 μl of a probe (50 ng / μl) was added to the same site on the slide glass, and the slide glass was kept warm for 2 hours (hybridization). Next, a hybridization washing solution (20 mM TrisHCl (pH 7.4), 180 mM N
After washing with 5 ml of aCl, 0.01% SDS), the plate was immersed in 20 ml of a maintained washing solution for 15 minutes, then immersed in 20 ml of distilled water for several seconds and air-dried. The slide glass is filled with an encapsulant (DABCO
Company): 0.13 g, glycerol: 9 ml, PBS (pH 8.8): 1 m
l) was mounted thereon, covered with a cover glass, and observed with a fluorescence microscope. Fluorescent filters are used for probes 1 and 2
A G2A filter (Nikon) was used for the band passfilter for FITC / Rhodamine (Nikon) and the probe 350R.
In addition, to confirm that the fluorescence is a signal derived from FISH, FI
SH operation was performed.

Judgment of the presence or absence of intestinal bacteria Since the intestinal bacterial detection probes 1 and 2 were labeled with FITC, the bacteria hybridized with probe 1 or probe 2 turned green when observed with a fluorescence microscope using the above-mentioned fluorescent filter. Glow. Therefore, this can be determined as intestinal bacteria. It should be noted that the probe 350R that hybridizes with all bacteria glows red due to the labeled TAMRA.

Criteria for Intestinal Bacteria Criteria for intestinal bacteria were determined from the number of allowable mismatches with sequence B or sequence D. At this time, the aforementioned (0012)
By setting the numerical conditions described above, the above criteria can be changed from loose ones to tight ones as follows. Sequence B Most loose criterion: 2 or less mismatches, most severe criterion: 0 mismatches Sequence D Most loose criterion: 6 or less mismatches, most severe criterion: 0 mismatches In the present invention, the criteria for intestinal bacteria are compared. The number of mismatches for the above two sequences was set to not more than 1/3 of the number of mismatches at the time of the loosest standard. Thus, the number of mismatches with sequence B regarded as enterobacteria is 2/3
Therefore, the criterion for intestinal bacteria is 0, and the number of mismatches with sequence D is 6/3, so the criterion is within 2 bases.

Process for Determining FISH Temperature Conditions Based on the above criteria, conditions for discriminating mismatches of one or more bases for probe 1 and conditions for discriminating mismatches of three or more bases for probe 2 are established. Therefore, the FISH temperature conditions (hybridization temperature and washing temperature) of each probe were examined.

Material Probe 1 Probe 2

Test strain 1 (for FISH of probe 1) Number of mismatched bases with probe 1 Escherichia coli IAM 12119T 0 Enterobacter amunigenus JCM 1237T 2 Aeromonas hydrophila IAM 12337T 3

Test strain 2 (for FISH of probe 2) Number of mismatched bases with probe 2 Escherichia coli IAM 12119T 0 Serratia ficalia IAM13540T 1 Serratia rubidaea IAM13545T 3

Method In order to examine the FISH temperature condition of probe 1, E
scherichia coli IAM12119T, Enterobacter amunigenu
s JCM 1237T and Aeromonas hydrophila IAM 12337T were used (test strain 1). The number of mismatched bases with these probes 1 is 0, 2, and 3, respectively. FISH temperature condition 45
C., 50.degree. C., 60.degree. C., 55.degree. C., 60.degree. C., 65.degree. C., and 70.degree. In order to examine the FISH temperature conditions for probe 2, Escherichia coli IAM 12119T, Serratia ficalia
IAM13540T and Serratia rubidaea IAM13545T were used (test strain 2). The number of mismatched bases with these probes 2 is 0, 1, and 3, respectively. FISH temperature condition is 45 ℃, 5
At 5 ° C, 60 ° C, and 65 ° C, FISH between the test strain 2 and the intestinal bacterial probe 2 was performed. After FISH, the relationship between the temperature conditions of each probe and the fluorescence signal intensity was evaluated.
In addition, the signal intensity was evaluated visually as follows. (++: very strong, ++: strong, +: normal, w: weak,-: signal cannot be detected)

Results For FISH using probe 1 (Table 3),
It was possible to distinguish a single base difference from the probe up to ℃, and the signal was the strongest at 55 ℃. But from 60 ° C to 65
Conversely, there was no specificity for the probe at ℃, and even a difference of 3 bases could not be distinguished. At 70 ° C no signal was detected. From this, it was judged that 55 ° C. was appropriate as a hybridization temperature and a washing temperature for distinguishing one base difference, and the FISH temperature condition of the probe 1 was set to 55 ° C.
Next, in FISH using probe 2 (Table 4), at 45 ° C., although a strong signal was obtained from any of the strains, the specificity for the probe was low and the difference of 3 bases could not be distinguished. However, it was observed that the specificity increased with increasing temperature conditions, while the fluorescence signal gradually weakened. At 65 ° C., the specificity was high enough to distinguish one base, but the signal was the weakest. It was judged that 60 ° C was appropriate as the hybridization temperature and washing temperature condition for distinguishing the difference of 3 bases.
The temperature condition of FISH of probe 2 was set to 60 ° C.

[0035]

[Table 3]

[0036]

[Table 4]

(Assay of Intestinal Bacteria Detection Accuracy of Probes 1 and 2) The intestinal bacteria detection accuracy of the oligonucleotide for detecting intestinal bacteria according to claims 1 and 2 was assayed. Intestinal bacteria were detected using the above-mentioned probes 1 and 2 under FISH conditions determined as described above. The probe 350R described above was used as a positive control. The test strains were intestinal bacteria of 14 genera and 34 species (β-galactosylase positive: 9 genera 18 species, β-galactosylase negative: 8 genera 16 species)
Species) and nine non-intestinal bacteria of 6 genera were used as different non-enteric bacteria from the enteric bacteria.

Table 5 shows the results. Regarding FISH using the probe 350R, which is a positive control, fluorescence was detected from all the test bacteria, and no fluorescence was observed from all strains using FISH without the probe 350R. From this, it was confirmed that the FISH using the probe 350R was correctly performed using the signal derived from the probe as the fluorescence. In addition, FISH using the intestinal bacteria detection probes 1 and 2 was also considered to be correctly performed.

[0039]

[Table 5]

Next, with respect to the FISH using the test intestinal bacterial strains and probes 1 and 2 for detecting intestinal bacteria, fluorescence was detected from almost all of probes 1 and 2 regardless of whether they were positive or negative for β-galactosylase. No fluorescence was observed in FISH without probe (see Table 5). This means that the detected fluorescence was the signals of the probes 1 and 2. The intestinal bacteria detected are test bacteria
29 strains (85%) of probe 1 and 32 strains of probe 2
Strain (94%). On the other hand, as a result of performing FISH with non-intestinal bacteria and probes 1 and 2, no signal was detected in any case. From the above, intestinal bacteria detection probe 1
And No. 2 are capable of specifically detecting bacteria in the test intestine, the detection rates of which are all high and that of Probe 1 is 85%,
Probe 2 was 94%. Therefore, it was found that the detection accuracy of intestinal bacteria according to the present invention was high. In addition, Salmonella serovar enteritidis and β-galactosylase-negative enterobacterial pathogens
Since Salmonella serovar typhimurium and the like can be detected (Table 5), the present invention is more useful than a coliform test as an indicator of food hygiene.

According to the invention of the present application, detection of enterobacteria is simple because it is only necessary to regard the detection target that has developed fluorescence as a result of hybridization as intestinal bacteria.

Further, the detection of intestinal bacteria according to the present invention comprises:
There is an effect that the process can be performed quickly for about 5 hours without requiring many processes.

Next, an embodiment will be described.

Example 1 Method for Detecting Intestinal Bacteria from Sample Mixture of Various Bacteria Using Intestinal Bacterial Detecting Oligonucleotide A probe derived from the nucleotide sequence of the intestinal bacterium detecting oligonucleotide and labeled with a fluorescent substance is used. The following is an example of a method by which FISH can rapidly detect enteric bacteria from a sample containing enteric bacteria and a mixture of a plurality of bacterial species. Material Probe: Probe 1 described in (0022) above was used. Strain used: The following three strains were mixed and used. Escherichia coli IAM12119T, (Bacterial species selected as representative of intestinal bacteria, bacillus) Vibrio fluvialis IAM14403T (Bacterial species selected as representative of non-enteric bacteria similar in strain to intestinal bacteria, bacillus) Bacillus subtilis IAM12118T ( (Bacterial species selected as representative of non-intestinal bacteria distant from the intestinal bacteria, long bacilli) Method FISH: Fixation of strains, hybridization and fluorescence microscopy were in accordance with (0025, 0026) described above. FISH temperature conditions: The criteria to be regarded as intestinal bacteria in FISH using probe 1 was 0 as the number of mismatches as in (0028) above. Therefore, the hybridization temperature and the washing temperature should be 55
° C (see 0034). Results Probe 1 was used on a sample in which three strains were mixed.
FISH was performed, and observation was performed about 5 hours later using a fluorescence microscope. As a result, only short rods that glow strongly in green were observed. these
When three strains were FISH using probe 1 alone, Bacill
us subtilis IAM 12118T and Vibrio fluvialis IAM1
Since 4403T does not show fluorescence, and Escherichia coli IAM12119T hybridizes with probe 1 and emits green light, which is the fluorescence color of FITC (Table 5), the observed green bacilli are Esc
herichia coli IAM12119T. Therefore, probe 1
By using FISH, it was possible to rapidly detect only intestinal bacteria for about 5 hours from a sample containing intestinal bacteria and a mixture of multiple bacterial species.

Example 2 (Method for detecting enteric bacteria from food using oligonucleotide for detecting enterobacteria) FISH using a probe derived from the nucleotide sequence of the oligonucleotide for detecting enterobacteria and labeled with a fluorescent substance was carried out to obtain food. An example of a method capable of rapidly detecting intestinal bacteria contained therein will be described. Material Probe: Probe 2 described in (0022) above was used. Bacteria used: same as in Example 1 Food material: sausage was used as a food example. Method Sample preparation: Sausage should be sterilized in advance (121 ℃, 15
After that, the used strain of Example 1 was added aseptically, and 90 ml of sterilized physiological saline was added to 10 g of the prepared sample, and the mixture was supplied to a stomacher and mixed uniformly. This sample supernatant is
Subjected to SH. FISH: Fixation of the strain, hybridization and fluorescence microscopy were performed according to Example 1. The fluorescent filter used was a B-3 filter (Nikon). FISH temperature condition: The criteria to be regarded as intestinal bacteria in FISH using probe 2 was defined as the number of mismatches 2 as in (0028) above. Therefore, set the hybridization temperature and washing temperature to 60.
° C (see 0034). Counterstaining: After FISH, propidium io
A dide (PI) final concentration of 0.25 μg / ml was added and used for counterstaining. Results FISH using probe 2 was performed on the sample, and observed about 5 hours later with a fluorescence microscope. As a result, short rods glowing yellow and short rods and long rods glowing red were observed. PI
Since PI has the property of emitting red fluorescence when bound to nucleic acids, all bacteria glow red when PI is given to bacteria. FITC, on the other hand, emits green fluorescence. Therefore, bacteria hybridized with probe 2 are affected by the effects of PI and FITC labeled on the probe.
The two fluorescences show a mixed yellow fluorescence, and the unhybridized bacteria show a red fluorescence. In other words, yellow bacilli are Escherichia coli IAM12119
T, the red bacillus is Vibrio fluvialis IAM14403T, and the long red bacillus is Bacillus subtilis IAM 12118T. The presence of yellow bacilli indicates the presence of enterobacteria, and by measuring the number, the number of enterobacteria contained in the food can be determined. Also, by measuring the numbers of all yellow and red bacteria, the total number of bacteria contained in the food can be obtained. As described above, FISH using probe 2 was able to rapidly detect intestinal bacteria from food for about 5 hours. At this time, by using PI for counterstaining, detection of all bacteria contained in food can be performed separately from detection of intestinal bacteria. The same results were obtained using probe 1 (provided that the FISH temperature was 55 ° C.).

[0046]

As described above, according to the oligonucleotide for detecting intestinal bacteria and the method for identifying intestinal bacteria according to the present invention,
Intestinal bacteria can be detected accurately, simply, and quickly. Therefore, it can be used as an excellent index in, for example, an inspection relating to food hygiene, and can contribute to analysis of the microflora. The latter is useful for environmental tests, for example, for the analysis of flora in seawater.

[0047]

[Sequence Listing] Sequence Listing <110> Technopolis Hakodate Industrial Technology Promotion Organization <120> The oligonucleotide for ditection of enterobacteria and the method for ditection of enterobacteria <130> P99TP01 <160> 6 <210> 1 <211> 23 <212 > DNA <213> Escherichia coli <400> 1 TTGTGCCCTT GAGGCGTGGC TTC 23 <210> 2 <211> 23 <212> DNA <213> Escherichia coli <400> 2 GAAGCCACGC CTCAAGGGCA CAA 23 <210> 3 <211> 23 <212 > RNA <213> Escherichia coli <400> 3 UUGUGCCCUU GAGGCGUGGC UUC 23 <210> 4 <211> 24 <212> DNA <213> Escherichia coli <400> 4 AAGAGAAGCG ACCTCGCGAG AGCA 24 <210> 5 <211> 24 <212 > DNA <213> Escherichia coli <400> 5 TGCTCTCGCG AGGTCGCTTC TCTT 24 <210> 6 <211> 24 <212> RNA <213> Escherichia coli <400> 6 AAGAGAAGCG ACCUCGCGAG AGCA 24

[Brief description of the drawings]

FIG. 1 shows the secondary structure of 16S rDNA.

Claims (13)

[Claims] An oligonucleotide for detecting enterobacteria, which is a nucleic acid of DNA or RNA having the base sequence represented by SEQ ID NO: 1 to SEQ ID NO: 3. 2. The method according to claim 1, which is at least 91% homologous to the nucleotide sequence of SEQ ID NO: 1 to SEQ ID NO: 3.
The oligonucleotide for detecting intestinal bacteria according to the above. 3. An oligonucleotide for detecting enterobacteria, which is a nucleic acid of DNA or RNA having a base sequence represented by SEQ ID NO: 4 to SEQ ID NO: 6. 4. The method according to claim 3, wherein the nucleotide sequence is at least 75% homologous to the nucleotide sequence of SEQ ID NO: 4 to SEQ ID NO: 6.
The oligonucleotide for detecting intestinal bacteria according to the above. 5. An intestinal bacterium, wherein the oligonucleotide for detecting an intestinal bacterium according to claim 1 or 2 is hybridized to a nucleic acid to be detected, and the hybridized to-be-detected target is regarded as an intestinal bacterium. Detection method. 6. An intestinal bacterium, comprising hybridizing the oligonucleotide for detecting an intestinal bacterium according to claim 3 or 4 to a nucleic acid to be detected, and treating the hybridized detection target as an intestinal bacterium. Detection method. 7. The method for detecting enteric bacteria according to claim 5, wherein the base sequence of the oligonucleotide for detecting enteric bacteria is compared with the base sequence in the same region of the nucleic acid to be detected. A detection target is regarded as an intestinal bacterium when is within a range of numerical values (reference values) based on the number of bases mismatched with the base sequence of the intestinal bacterium-detecting oligonucleotide. 8. The method for detecting enteric bacteria according to claim 6, wherein the base sequence of the oligonucleotide for detecting enteric bacteria is compared with the base sequence of the same region of the nucleic acid to be detected. A detection target is regarded as an intestinal bacterium when is within a range of numerical values (reference values) based on the number of bases mismatched with the base sequence of the intestinal bacterium-detecting oligonucleotide. 9. The method for detecting enteric bacteria according to claim 7 or claim 8, wherein the reference value is determined by comparing the base sequence of claim 1 or claim 2 or claim 3 or claim 4 with the enterobacteriaceae. A method for detecting intestinal bacteria, comprising comparing the 16S rDNA of the strain belonging to each of the Pasteurellaceae and Vibrioaceae with the same nucleotide sequence in the same region, and deriving the same from the number of mismatched bases. 10. The method for detecting intestinal bacteria according to any one of claims 7 to 9, wherein the nucleic acid to be detected and the intestinal bacteria are present when the nucleotide sequence of the nucleic acid to be detected is in the range of the reference value. A method for detecting intestinal bacteria, wherein the detection oligonucleotide hybridizes. 11. The method for detecting intestinal bacteria according to claim 7, wherein the reference value is 2 or less. 12. The method for detecting enteric bacteria according to claim 8, wherein the reference value is 6 or less. 13. The method for detecting enteric bacteria according to claim 5 or 6, wherein the temperature conditions for the hybridization and washing are the same as the base sequence of the oligonucleotide for detecting enteric bacteria and the same region of the nucleic acid to be detected. A method for detecting enteric bacteria, comprising comparing the nucleotide sequence with a base sequence, and deriving the nucleotide sequence of the nucleic acid to be detected from the number of bases that mismatch with the nucleotide sequence of the oligonucleotide for detecting enteric bacteria.