JP2006166912A - Gene probe for quickly and specifically counting living food poisoning bacteria and group of biological indicator for sanitation by in situ hybridization method with cultivation - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To establish a rapid and secure method for identification and/or counting living bacteria for food poisoning bacteria such as genus aeromonas bacteria, Listeria monocytogenes, Clostridium perfringens, Vibrio parahemolyticus, Salmonella typhimurium, E. coli bacillus, etc. <P>SOLUTION: The invention relates to the gene probes specific to each food poisoning bacteria. The probes can be used in determination of specificity of the target genus bacteria and non-target genus bacteria in situ hybridization with culture after labeling with a fluorescent materials on the probes, etc. <P>COPYRIGHT: (C)2006,JPO&NCIPI

Description

  The present invention relates to a technique for rapidly detecting and measuring food poisoning bacteria and hygiene indicator bacteria.

  The Aeromonas group is a resident bacterium in a freshwater environment, but includes bacteria that infect humans with diarrhea or wounds, such as Aeromonas hydrophila. Also known are fungal species that cause disease in aquacultured fish such as A. salmonicida. The examination of the genus Aeromonas can be made only by examining the phenotypes of about 10 items after isolating the strain using a non-selective medium. It takes a few weeks to a month to identify Elomonas. In addition, although about 8 types of media for selecting the genus Aeromonas are known, none of them are sufficiently selective for the genus Aeromonas.

  Listeriosis is an acute bacterial disease with a high fatality rate mainly caused by sepsis, meningitis, encephalitis, miscarriage, etc. in humans due to infection with Listeria monocytogenes. The Listeria monocytogenes is a Gram-positive facultative anaerobic short spore bacillus, which is highly resistant to low temperatures and salt and has the property of growing at 4 ° C. Since oral infection via food was revealed in the 1980s, it has been recognized as one of the most important food poisoning bacteria in food hygiene together with enterohemorrhagic Escherichia coli O157. Conventionally, the presence of Listeria monocytogenes has been cultivated at 30 ° C for 2 days in various selective enrichment media, then cultured at 30-37 ° C for 2 days in a selective separation medium, and suspicious colonies are further identified by characterization tests. Separation and detection at the level required at least 4 days, and identification at the species level had to take days.

  Clostridium perfringens is a gram-positive, obligate anaerobic gonococci that forms spores. When this bacterium infects humans, the toxin produced by the bacterium (mainly type A toxin) causes food poisoning with diarrhea and abdominal pain as main symptoms. In Japan, the number of food poisoning caused by this bacterium is relatively small, but the number of patients per food poisoning accident is very large, which is characterized by large-scale outbreaks. Conventionally, the presence of Clostridium perfringens is prepared by preparing a 10-fold emulsion of the sample, applying it to a selective medium, culturing at 37 to 46 ° C. for about 24 hours, and identifying a suspicious colony by pure separation and then identifying it by a property test, It takes several weeks for separation and identification.

  Vibrio bacteria are resident bacteria in the marine environment, particularly in the digestive tract of marine animals, but also include human pathogenic species such as Vibrio cholerae, V. parahaemolyticus, and V. vulnificus. Of these, Vibrio parahaemolyticus is a food poisoning bacterium that causes great harm in Japan, which has a habit of eating seafood. This bacterium was isolated in Japan in 1950 as a causative bacterium of mass food poisoning caused by Shirasu. Until the late 1980s, 5,000 to 15,000 people with Vibrio parahaemolyticus are recorded every year. Currently, food poisoning countermeasures due to Vibrio parahaemolyticus are permeating, and the number of patients due to food poisoning is decreasing. However, the main cause of food poisoning of seafood in summer is Vibrio parahaemolyticus food poisoning, and the annual number of patients is 2,000-3,000.

  In order to control Vibrio parahaemolyticus food poisoning, it is important to know early on Vibrio parahaemolyticus contamination in seafood and other foods. Even now, methods that can easily and quickly test for Vibrio parahaemolyticus contamination continue to be developed. The official identification method of Vibrio parahaemolyticus is a culture inspection method in which the culture solution is detected with alkaline peptone water or saline polymyxin broth at 37 ° C for 18 hours, and then the culture solution is detected using a selective medium for Vibrio such as TCBS. . In this method, it is necessary to carry out biochemical characterization of at least 20 items after obtaining a pure culture by the end of the definitive test for Vibrio parahaemolyticus. Cost.

  In order to investigate the cause of food poisoning, rapidity is required, so a simpler and quicker culture counting method than the official method has been devised, using a chromobibrio medium that uses the specific glycolytic specificity of Vibrio parahaemolyticus. One example is the culture detection / counting method (Non-Patent Document 2: Hara-Kudo et al. 2001). In this method, the enrichment culture solution with polymyxin broth is cultured at 35-37 ° C. for 20 hours in a chromobibrio medium. Those that form purple colonies on the chromobibrio medium are identified as Vibrio parahaemolyticus. Vibrio parahaemolyticus causing food poisoning is a “Kanagawa phenomenon positive strain” that produces heat-resistant hemolysin. Detection of Vibrio parahaemolyticus pathogenic strains isolated from the environment requires a method for amplifying and detecting specific toxin genes.

  Pathogenic E. coli is E. coli that has acquired the pathogenicity that causes diarrhea. It is the fourth most common cause of food poisoning in Japan. Pathogenic Escherichia coli includes pathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), enterotoxigenic E. coli (ETEC), enterohemorrhagic EHEC (Enterohemorrhagic E. coli). E. coli) and Enteroagregative E. coli (EAggEC). In particular, mass food poisoning caused by meals in Osaka is due to EHEC having a serotype of O157: H7. These pathogenic E. coli are difficult to distinguish from E. coli living in the human intestine, and a rapid and specific test system is important. The pathogenic E. coli test is the same as the normal E. coli isolation method. After selective culture in DHL medium or MacConkey medium, characterization and serotype are determined and identified. ETEC and EHEC will be classified by toxin type. There is no culture method that can selectively isolate each group of pathogenic E. coli. It takes several days to identify.

  Salmonella is a bacteria that occupies the top cause of food poisoning in Japan, circulates between humans and animals, and infects humans through food and water. Salmonella colonization is higher in chickens and pigs. For the purpose of diagnosis and treatment of patients with acute gastroenteritis or diarrhea, Salmonella is isolated by triple sugar iron (TSI) medium, etc., and colonies specific to Salmonella are isolated, and biochemical characterization and serotyping are used. Identify. In addition, in the inspection for administration or management, since the number of Salmonella in the sample is small, it is enriched using a selenite cystine medium, etc., and then separated using a selective medium such as MLCB medium or brilliant green agar medium. Identify by serum reaction. It takes several days to identify.

  Recently, detection methods using probes or primers for gene sequences specific to microorganisms have been used for identification of microorganisms. For example, with respect to Aeromonas salmonicida, a primer / probe is described in Patent Document 1.

In addition, since there are 10 ⁴ rRNAs per cell, the sensitivity of the probe is remarkably improved. Furthermore, since there are conserved regions and variable regions among species, the classification of organisms from these variable regions is possible. A group-specific sequence has been found (Non-patent Document 1).

JP 08-266286 Biotechnology Vol.8, pp.233-236 Hara-Kudo et al. Appl. Environ. Microbiol. 67: 5819-5823 (2001).

  In the detection and identification method of food poisoning causal bacteria in accordance with the food hygiene inspection guideline, which is a conventional official method, it takes 2 days at the earliest to obtain the final result of viable cell count measurement. Some strains take more than a week, and data that can be evaluated at the time of product shipment could not be provided.

  In addition, for example, among bacteria belonging to the genus Aeromonas (abbreviated as Aeromonas genus bacteria), bacterial species exhibiting characteristics very similar to those of the Escherichia coli group are known. Technology development is desired (Journal of Applied Microbiology. Vol93.60-68). Furthermore, a technique for comprehensively detecting and measuring bacteria belonging to the genus Aeromonas is desired, and rapid bacterial detection is possible with the PCR method, but there is a problem that it is not possible to distinguish between dead and live bacteria. In particular, it has been desired to develop a technique for measuring live bacteria, which is important in the field of food processing.

  Furthermore, for Listeria monocytogenes and Clostridium perfringens, there has been a demand for faster and more reliable identification and detection of live bacteria and / or establishment of counting methods. In particular, Clostridium perfringens is not suitable for examination by FISH (fluorescence in situ hybridization) because it exists in the form of spores (dormant cells) in food.

  In addition, as described above, in the conventional method for detecting and identifying Vibrio parahaemolyticus, it takes time to measure the number of viable bacteria. On the other hand, in the method using rRNA, the small subunit rRNA gene of Vibrio parahaemolyticus is related to Vibrio parahaemolyticus. Since the species and base sequence are similar, it has been difficult to develop a fluorescent oligonucleotide probe that specifically detects Vibrio parahaemolyticus.

  Furthermore, no method is known for detecting and identifying living bacteria in a sufficiently short time for Salmonella and pathogenic E. coli.

  The present inventors first (1) collect the sequence information of the ribosomal RNA genes of the bacteria to be detected and other related bacterial groups from the gene database, search for gene sequences that can be distinguished from other bacterial groups, and specific gene sequences It was determined. The nucleic acid molecule represented by the specific gene sequence is called a probe. Furthermore, (2) after labeling the probe with a fluorescent substance or the like, it was found that the specificity of the detection target bacterial species and the non-detection bacterial species can be determined using a culture combined in situ hybridization method.

  According to the method of the present invention, the food poisoning causative detection / identification method can be completed within 10 hours until the final result of the viable cell count measurement is obtained, which is extremely excellent.

  The present invention is a series of methods that enables food poisoning bacteria or hygiene indicator bacteria to be specifically detected from minute bacterial colonies produced by short-time culture. In-situ hybridization combined with culture, if oligonucleotides that complementarily bind to a specific base sequence of the gene (DNA or RNA) of the bacterium to be tested are prepared, it can be used for detection and counting of various food poisoning bacteria and hygienic indicator bacteria. Can do. The inventors of the present invention have determined for the first time a reaction condition for specifically detecting a bacterium to be examined and a condition for optimal formation of a small colony by a new gene probe and a culture combined in situ hybridization method.

1. 1. In-situ hybridization with culture 1-1. Characteristics / Advantages of In-Situ Hybridization with Culture In conventional in situ hybridization methods using fluorescently labeled probes, there are the following problems. (1) Particularly for identification and detection of microorganisms that contaminate foods, a fluorescently labeled probe cannot be detected unless the microorganisms have grown, that is, contamination has not progressed considerably. (2) In food contamination, where the number of viable bacteria is particularly a problem, since the probe hybridizes to dead bacteria, it was impossible to distinguish between live bacteria and dead bacteria.

  In contrast, in the in-situ hybridization method combined with culture, a sufficiently diluted sample is cultured for about 1 to 10 hours, so that only viable bacteria are propagated and formed into a small colony, under a normal fluorescence microscope. The colonies can be observed and counted. (3) Furthermore, in a normal in situ hybridization method, mixed bacteria that are mistakenly identified as positive can be used in combination with culture to control the culture conditions and eliminate false positives.

1-2. Outline of in-situ hybridization method combined with culture (1) Sample fixation, for example, collection of sample on membrane filter Sample collector for collecting sample separated from food, environment, etc., for example, polycarbonate or cellulose acetate It is collected by sucking on the filter made of the product. As the filter, for example, a nucleopore filter, an isopore filter, and a mirex filter can be used, and for example, a filter isopore membrane filter having a pore diameter of 0.4 μm can be preferably used.

(2) Cultivation of sample Formation of microcolony The sample collection body to which the sample adhered, for example, a membrane filter, is transferred to a Petri dish containing a medium. The culture is performed at 37 ° C. until a micro colony is formed, for example, for 1 to 10 hours, preferably 4 to 8 hours, for example, 6 hours.

(3) Outline of bacteria detection and bacterial count measurement using a fluorescent label (A) Cells on a slide glass or filter are fixed with ethanol or the like. The filter is fixed to the glass slide.
(B) Dried in ethanol or oven.
(C) The filter and the slide glass are immersed in the hybridization buffer and incubated at the hybridization temperature.
(D) The oligonucleotide probe is added and the incubation is continued.
(E) The filter or slide glass on which the sample is placed is washed and air-dried.
(F) Observe with a fluorescence microscope. It is usually observable with X10 to X1000.

1-3. Preparation of Probes of the Present Invention 16S rRNA and 23S rRNA were used as target genes for probes for identification, detection and / or counting.
1-3-1. Probe for detecting genus Aeromonas Specifically, (1) Species belonging to the genus Aeromonas and related strains of bacteria, specifically, Alcaligenes, Vibrio, Shewanella, Brenneria, Pseudoalteromonas, and 16S rRNA base sequences of fungi belonging to the family Enterobacteriaceae are collected, and base sequences that are common to the genus Aeromonas, and are closely related bacteria, specifically Alcaligenes, Vibrio, Shewanella, Brenneria, Pseudoalteromonas , And the base sequence of about 20 bases that mismatch with the bacteria belonging to the family Enterobacteriaceae. (2) By comparing the base sequence common to the bacteria of the genus Aeromonas and the base sequence of the same region of the 16S rRNA of each of the above strains used for multiple alignment, a relatively mismatch is found for strains other than the genus Aeromonas Those having a large number and few mismatches to the species of Aeromonas were selected as candidates for probes specific to the genus Aeromonas. This operation can be verified by an on-line probemer (http://probemer.cs.loyola.edu/). (3) Next, the genus Aeromonas and non-Eronomonas were actually assayed by the FISH method using the probe candidates for the genus Aeromonas. As a result, it is possible to use a probe for detecting Aeromonas as a probe for which fluorescence is detected from most of the bacteria of the genus Aeromonas and no fluorescence is observed in FISH without adding a probe.

  The sequence includes GCAAGCTACTTTCCCGCTGCCGCT (SEQ ID NO: 1: probe name AER-mrf) (24 bases) and GCTAGCTTGCAGCCCTCTGTACGC (SEQ ID NO: 2: probe name AER-mmr) (24 bases), or both include sequences in the vicinity. A complementary sequence of these sequences can be used for the probe. It is more preferable to use GCAAGCTACTTTCCCGCTGCCGCT (SEQ ID NO: 1: probe name AER-mrf) (24 bases) and GCTAGCTTGCAGCCCTCTGTACGC (SEQ ID NO: 2: probe name AER-mmr) (24 bases).

1-3-2 Listeria monocytogenes
Probes belonging to the genus Listeria were designed based on the 23S rRNA gene sequence.
Specifically, (1) collecting 23S rRNA nucleotide sequences of bacteria belonging to the species belonging to Listeria and related strains, specifically Bacillus, Staphylococcus, Enterococcus, Brochothrix, and Lactobacillus. And a base sequence of about 20 bases that is mismatched with bacteria of related strains. (2) By comparing the base sequence common to Listeria and the base sequence of the same region of 23S rRNA of each of the above strains used for multiple alignment, a relatively mismatch is found for strains other than Listeria Those having a large number and few mismatches against Listeria species were selected as Listeria bacterium-specific probe candidates. (3) Next, the Listeria bacteria and non-Listeria were actually assayed by the FISH method using Listeria bacteria probe candidates. As a result, the fluorescence is detected from most of the Listeria bacteria samples, and a probe for which no fluorescence is observed in FISH without adding a probe can be used as a Listeria detection probe.

  Preferably, the probe sequence includes CGC ACA TTT CCA TTC GTG CGA TTC C (SEQ ID NO: 3 probe name LIS1400) (25 bases) or a sequence in the vicinity thereof. Complementary sequences of these sequences can also be used for the probe. It is more preferable to use CGC ACA TTT CCA TTC GTG CGA TTC C (SEQ ID NO: 3 probe name LIS1400) (25 bases) as a probe.

1-3-3 Clostridium perfringens
The procedure was basically the same as that for bacteria belonging to the genus Aeromonas.
Specifically, (1) 16S rRNA base sequences of bacteria belonging to the genus C. perfringens and related Closridum, Bacillus, and Desulfotomaculum are collected, and base sequences common to C. perfringens and related A search is made for a base sequence of about 20 bases that mismatches with bacteria belonging to the genus Clostridium, Bacillus, and Desulfotomaculum. (2) By comparison, the base sequence common to Clostridium perfringens and the base sequence of the same region of the 16S rRNA of each of the above strains used for multiple alignment were compared. Those having a large size and few mismatches against the C. perfringens species were selected as candidates for C. perfringens specific probes. This operation can be verified by an on-line probemer (http://probemer.cs.loyola.edu/). (3) Next, the C. perfringens and non-C. Perfringens bacteria were actually assayed by the FISH method using a C. perfringens probe candidate. As a result, fluorescence is detected only from the C. perfringens sample, and a probe that does not show fluorescence in FISH without the addition of a probe can be used as a C. perfringens detection probe.

  Specific examples include AAT GAT GAT GCC ATC TTT CAA CA (SEQ ID NO: 4: probe name CLP180) (23 bases) or a sequence in the vicinity thereof. Complementary sequences of these sequences can also be used. It is preferable to use AAT GAT GAT GCC ATC TTT CAA CA (SEQ ID NO: 4: Probe name CLP180) (23 bases).

1-3-4 Vibrio parahaemolyticus
The procedure was basically the same as that for bacteria belonging to the genus Aeromonas.
Specifically, (1) Bacteria from strains closely related to Vibrio parahaemolyticus, specifically, the 16S rRNA base sequences of bacteria belonging to Vibrio, Shewanella, and Photobacterium are collected, and the base sequences common to Vibrio parahaemolyticus And closely related strains of bacteria, specifically Vibrio campbellii, V. rotiferianus, V. harveyi, V. natriegenes, V. proteolyticus, V. alginolyticus, V. scophthalmi, V. tubiashii, V. furnissii Search for a base sequence of about 20-30 bases that mismatches with Vibiro species such as V. fluvialis, V. orientalis, V. coralliilyticus, V. ichthyoenteri and V. aestuarianus. (2) By comparison, the base sequence common to Vibrio parahaemolyticus and the base sequence of the same region of 16S rRNA of each of the above bacterial species used for multiple alignment were compared. Those having large and few mismatches against Vibrio parahaemolyticus were selected as Vibrio parahaemolyticus-specific probe candidates. This operation can be verified by an on-line probemer (http://probemer.cs.loyola.edu/). (3) Next, Vibrio parahaemolyticus and Vibrio parahaemolyticus were actually assayed by the FISH method using Vibrio parahaemolyticus probe candidates. Fluorescence is detected from most of the Vibrio parahaemolyticus strain samples, and a probe for which no fluorescence is observed in FISH without adding a probe can be used as a Vibrio parahaemolyticus detection probe.

  Specifically, (b) actacactac cttcctcacg actgaaa (SEQ ID NO: 5, probe name Vpa437 probe) (27 bases) or a sequence in the vicinity thereof, (b) tgcaattccg aggttgagcc ccgg (SEQ ID NO: 6 probe name Vpa612) (24 (Base) or a sequence including the sequence in the vicinity thereof, or (c) cactttcgca agttggctgcc cc (SEQ ID NO: 7 probe name Vpa1255 probe) (22 bases) or a sequence including the sequence in the vicinity thereof. Although complementary sequences of these sequences can also be used, actacactac cttcctcacg actgaaa (SEQ ID NO: 5, probe name Vpa437 probe) (27 bases), tgcaattccg aggttgagcc ccgg (SEQ ID NO: 6 probe name Vpa612) (24 bases), and cactttcgca agttggctgc cc (SEQ ID NO: 7 probe name Vpa1255 probe) (22 bases) is preferred.

1-3-5 Salmonella enterica
The procedure was basically the same as that for bacteria belonging to the genus Aeromonas.
Specifically, (1) Bacteria of strains closely related to Salmonella, specifically 16S rRNA base sequences of bacteria belonging to Salmonella, Enterobacter, Citrobacter, Pantoea and Kluyvera are collected, and bases common to Salmonella The sequence is searched for about 20 to 30 bases which are mismatched with bacterial strains of closely related strains, specifically Salmonella bongori, Enterobacter sakazaki, Citorbacer koseri, Pantoea agglomerans and the like. (2) By searching, the base sequence common to Salmonella and the base sequence of the same region of 16S rRNA of each of the above-mentioned bacterial species used for multiple alignment were compared, and the number of mismatches was relatively large for species other than Salmonella. Those having few mismatches with Salmonella were selected as candidate Salmonella-specific probes. This operation can be verified by an on-line probemer (http://probemer.cs.loyola.edu/). (3) Next, Salmonella and non-Salmonella were actually assayed by the FISH method using Salmonella probe candidates. A probe that detects fluorescence from most of the Salmonella sample and does not detect fluorescence in FISH without the addition of a probe can be used as a probe for detecting Salmonella.

  Specific examples include gctgcggtta ttaaccacaa caccccttc (SEQ ID NO: 8 probe name Sal453) (29 bases) or a sequence containing the sequence in the vicinity thereof. Although complementary sequences of these sequences can also be used, gctgcggtta ttaaccacaa caccccttc (SEQ ID NO: 8 probe name Sal453) (29 bases) is preferred.

1-3-6 Enteropathogenic Escherichia coli
The procedure was basically the same as that for bacteria belonging to the genus Aeromonas.
Specifically, (1) Bacteria from strains closely related to pathogenic E. coli, specifically 16S rRNA base sequences of bacteria belonging to Escherichia, Salmonella, Enterobacter, Citrobacter, Pantoea and Kluyvera are collected and pathogenicity is collected. Searches for a base sequence of about 20-30 bases that is common to Escherichia coli and that is mismatched with closely related strains of bacteria, specifically Enterobacter sakazaki, Citorbacer koseri, Pantoea agglomerans, etc. . (2) By comparing the base sequence common to pathogenic E. coli and the base sequence of the same region of 16S rRNA of each of the above strains used for multiple alignment, Those having a large number of mismatches and few mismatches against pathogenic E. coli were selected as pathogenic E. coli-specific probe candidates. This operation can be verified by an on-line probemer (http://probemer.cs.loyola.edu/). (3) Next, pathogenic E. coli and non-pathogenic E. coli were actually assayed by the FISH method using pathogenic E. coli probe candidates. A probe that detects fluorescence from most of the pathogenic E. coli samples and does not detect fluorescence in FISH without adding a probe can be used as a probe for detecting Salmonella.

  Specific examples include gaagcaagct tcttcctgtt accg (SEQ ID NO: 9 probe name Eco67) (24 bases) or a sequence in the vicinity thereof. Although complementary sequences of these sequences can also be used, gaagcaagct tcttcctgtt accg (SEQ ID NO: 9 probe name Eco67) (24 bases) is preferred.

1-4. Labeling of the probe of the present invention The probe prepared in 1-3 above can be labeled with a detectable label, for example, a fluorescent label, an isotope label, an enzyme label such as alkaline phosphatase, or a biotin label. Preferably, fluorescent labeling is performed, specifically, for example, labeling with TAMRA (N, N, N ′, N′-Tetramethyl-6-carboxyrhodamine), FITC (Fluorescein isothiocyanate) or various types of Alexa Fluor (Molecular probe) can do.

2. 2. Establishment of culture combined in situ hybridization method using novel probe 2-1. Examination of culture conditions 2-1-1 Eromonas spp., Closely related to the genus Eromonas spp., And a specific probe may produce false positives, Vibrio spp., Photobacterium spp., Pseudoalteromonas spp., And Arteromonas bacteria require salts for growth. On the other hand, Aeromonas bacteria can grow without the presence of salts. Therefore, the specificity for the genus Aeromonas can be given by growing on a normal agar medium. As the culture time and temperature, for example, the culture can be performed at 25 to 36 ° C. for 1 to 10 hours, and preferably for 4 to 8 hours.

2-1-2 Listeria monocytogenes is closely related to Listeria monocytogenes, and specific probes may produce false positives. The genus Bacillus and Staphylococcus are polymyxin B, acriflavine hydrochloride, ceftazidime, etc. Sensitive to antibiotics. On the other hand, Listeria monocytogenes is resistant to antibiotics such as polymyxin B, acriflavine hydrochloride, and ceftazidime. Therefore, the specificity for Listeria monocytogenes can be increased by growing in a medium to which antibiotics such as polymyxin B, acriflavine hydrochloride, and ceftazidime are added, specifically, a palcum selective medium. As the culture time and temperature, for example, the culture can be performed at 25 to 36 ° C. for 1 to 10 hours, and preferably for 4 to 8 hours.

2-1-3 Clostridium perfringens As culture | cultivation time and temperature, it can culture | cultivate at 25 degreeC-36 degreeC for 1 to 10 hours, for example, Preferably it can culture | cultivate for 4 to 8 hours.
Although Clostridium perfringens forms thermostable spores and can grow under anaerobic conditions at a high temperature of 46 ° C., it is closely related to Clostridium perfringens, and a specific probe may cause false positives. Bacillus, Staphylococcus, and Gram-negative bacteria do not form stronger thermostable spores than C. perfringens and few species grow under anaerobic conditions at 46 ° C. Therefore, after heat treatment for leaving heat-resistant spores of Clostridium perfringens, preferably at 75 ° C. for 20 minutes, it is grown at 46 ° C. under anaerobic conditions, preferably for 1 to 6 hours. The specificity for Clostridium perfringens can also be increased.

2-1-4 Vibrio parahaemolyticus is one bacterial species belonging to the genus Vibrio. Vibrio parahaemolyticus does not grow on normal agar medium, but grows well with the addition of 2-3% salt. The optimal growth temperature is 30-37 ° C, and growth is possible up to 42 ° C. The growth rate at 37-42 degrees differs from many Vibrio species where specific probes can produce false positives. As the culture time and temperature, for example, the culture can be performed at 30 to 42 ° C for 1 to 10 hours, and preferably at 40 to 43 ° C for 4 to 10 hours.

2-1-5 Salmonella Salmonella is closely related to bacteria belonging to the family Enterobacteriaceae, and specific probes may produce false positives. Escherichia coli, Enterobacter, and Citrobacter are biochemical properties and serum. Can be distinguished by reaction. As the culture time and temperature, for example, the culture can be performed at 30 ° C to 43 ° C for 1 to 10 hours, and preferably for 4 to 8 hours.

2-1-6 Pathogenic Escherichia coli Pathogenic Escherichia coli is the same species as Escherichia coli resident in the intestines of humans and warm-blooded animals, and it is difficult to distinguish both from the biochemical properties. Escherichia coli, where a specific probe can produce false positives, requires serotype and toxin type testing. In addition, Manheimia bacteria whose specific probe may cause false positive growth on an ordinary nutrient agar medium at 37 ° C. can be distinguished by this culture condition. As the culture time and temperature, for example, the culture can be performed at 30 to 44 ° C. for 1 to 10 hours, and preferably for 4 to 8 hours.

2-2. Examination of hybridization conditions For each probe, the hybridization temperature and formamide concentration were varied to confirm the specificity of the probe. For example, as the hybridization temperature, the formamide concentration can be changed from 20% to 45% at a temperature between 45 ° C. and 60 ° C. to determine the hybridization conditions showing the target specificity.

  For example, for the Aeromonas spp. Specific probes GCAAGCTACTTTCCCGCTGCCGCT (SEQ ID NO: 1 probe name AER-mrf) (24 bases) and GCTAGCTTGCAGCCCTCTGTACGC (SEQ ID NO: 2 probe name AER-mmr) (24 bases), the hybridization conditions are examined as follows: did.

  First, microorganisms having 16S rRNA with few mismatches with the AER-mrf sequence and the AER-mmr sequence were extracted from the database, and these microorganisms were fluorescently labeled AER-mrf or under the hybridization conditions described above. Confirm with AER-mmr whether it hybridizes with AER-mmr, and AER-mrf and AER-mmr are hybridized only with or without Aeromonas spp. The conditions were examined and decided.

  The AER-mrf probe showed high specificity when reacted at 60 ° C. using a reaction solution having a formamide concentration of 27.5% to 45%.

  The AER-mrr probe was reacted at 60 ° C. using a reaction solution having a formamide concentration of 27.5% to 45%, or reacted at 46 ° C. using a reaction solution having a formamide concentration of 45%. It showed high specificity other than phosphoreum.

  Similarly, the probe LIS1400 does not hybridize to species belonging to the Listeria genus and related strains of bacteria, specifically Bacillus, Staphylococcus, Enterococcus, Brochothrix, and Lactobacillus. As conditions for reliably hybridizing, conditions where the formamide concentration is 20 to 35% at 46 ° C. and the formamide is 10 to 15% at 60 ° C. can be adopted.

  As for the probe CLP180, for C. perfringens, conditions of a formamide concentration of 20 to 30% at 46 ° C. and a formamide concentration of 0 to 15% at 60 ° C. can be adopted.

  The probe Vpa437 also does not hybridize to closely related species of the genus Vibrio, specifically Vibrio pelagius, V. ordalii, V. gazogenes, Photobacterium damselae, and as a condition to reliably hybridize to Vibrio parahaemolyticus at 46 ° C. A formamide 10-40% condition can be employed.

  Probe Vpa612 also does not hybridize to related species of the genus Vibrio, specifically Vibrio metchnikovii, V. cholerae, V. mimicus, Shewanella algae, etc. The condition where the formamide concentration is 30 to 40% can be adopted.

  Probe Vpa1255 does not hybridize to Vibrio related species, specifically Vibrio campbellii, V. rotiferianus, metchnikovii, V. vulnificus, V. proteolyticus, V. harveyi, etc. As a condition for hybridization, a condition where the formamide concentration is 25 to 40% at 46 ° C. can be adopted.

  The probe Sal453 also does not hybridize to closely related species of the genus Salmonella, specifically Enterobacter intermedius, Citrobacter koseri, Pantoea agglomerans, etc., and the formamide concentration is 10 to 10 at 46 ° C. as a condition to reliably hybridize with Salmonella. A 40% condition and a condition where the formamide concentration is 20% at 60 ° C. can be adopted.

  The probe Eco67 does not hybridize to closely related pathogenic E. coli species, specifically Salmonella bongori, Citrobacter koseri, Klebsiella planticola, Enterobacter sakazakii, Salmonella enterica, etc. As mentioned above, it is possible to employ a condition where the formamide concentration is 10 to 40% at 46 ° C. and the formamide concentration is 20% at 60 ° C.

  The conditions under which each probe hybridizes can also be expressed using the following hybrid eigenvalue ranges.

Hybridization eigenvalues are defined as follows:
[Equation 1]
Hybridization eigenvalue (K) (° C) = hybridization temperature (° C) + 0.7 (° C) X formamide concentration (%)

  For the AER-mrf probe, hybridization eigenvalues in the range of 60 (° C.) + 0.7 (° C.) X 27.5 or more and 60 (° C.) + 0.7 (° C.) X 45 (%) or less can be adopted.

  For AER-mrr probes, hybridization specific values are 60 (° C) + 0.7 (° C) X27.5 or higher, 60 (° C) + 0.7 (° C) X45 (%) or lower, or 46 (° C) + 0.7 A range of (° C) X45 (%) can be used.

  For probe LIS1400, hybridization specific values are 60 (° C) + 0.7 (° C) X10 (%) or more, 60 (° C) + 0.7 (° C) X20 (%) or less, or 46 (° C) + 0.7 ( C)) X20 (%) or more and 46 (C) + 0.7 (C) X35 (%) or less.

  For probe CLP180, the hybridization specific value is 60 (° C.) or more and 60 (° C.) + 0.7 (° C.) X 15 (%) or less, or 46 (° C.) + 0.7 (° C.) X 20 (%) or more, 46 (° C. ) +0.7 (℃) X30 (%) or less can be used.

  For the Vpa437 probe, a hybridization specific value in the range of 46 (° C.) + 0.7 (° C.) × 10 or more and 46 (° C.) + 0.7 (° C.) × 40 (%) or less can be adopted.

  For the Vpa612 probe, the hybridization specific value can be in the range of 46 (° C.) + 0.7 (° C.) × 30 or more and 46 (° C.) + 0.7 (° C.) × 40 (%) or less.

  For the Vpa1255 probe, a hybridization specific value in the range of 46 (° C.) + 0.7 (° C.) X25 or more and 46 (° C.) + 0.7 (° C.) X 40 (%) or less can be adopted.

  For Sal453 probe, hybridization specific values range from 46 (° C) + 0.7 (° C) X10 or higher, 46 (° C) + 0.7 (° C) X40 (%) or lower, or 60 (° C) + 0.7 (° C ) X20 (%) can be used.

  For Eco67 probes, hybridization specific values range from 46 (° C) + 0.7 (° C) X10 or higher, 46 (° C) + 0.7 (° C) X40 (%) or lower, or 60 (° C) + 0.7 (° C ) X20 (%) can be used.

  The conditions for the AER-mrf probe, AER-mrr probe, LIS1400 probe, probe name CLP180, Vpa437 probe, Vpa612 probe, Vpa1255 probe, Sal453 probe, and Eco67 probe described above are the standard hybridization buffers (except for formamide) ( 0.9M NaCl, 20 mM Tris-HCl, 0.01% SDS, pH 7.4), but other buffer conditions based on the above hybridization range can be used by those skilled in the art. It can be easily determined.

2-3. Detection of target bacteria and measurement of the number of bacteria and kit for the same Immobilize bacteria on a sample collector such as a cultured filter. Preferably, it is fixed with ethanol at room temperature. The filter is then placed on a permeable filter fixing support. When measuring with a fluorescence microscope, a glass slide can be used as the fixed support, but when measuring with another label measuring device, it can be attached to the label measuring device and can be measured. Any fixed support can be used if present. The filter fixed to the support is dried. Preferably, it is dried with a dryer at 80 ° C. for 10 minutes.

  A hybridization buffer is applied to a fixed support such as a dried slide glass. Examples of the hybridization buffer include a hybridization solution consisting of 0.9 M NaCl, 20% formamide, 20 mM Tris-HCl, 0.01% SDS (pH 7.4). After preincubation with hybridization buffer for 1-5 minutes, labeled specific probes and are added. Hybridization with the probe can be performed for 5 minutes to 1 hour. After hybridization, the fixed support on which the filter is placed is washed with a buffer. As the washing buffer solution, for example, a washing solution containing 20 mmol / l Tris-HCl, 180 mmol / l NaCl, 0.01% SDS (pH 7.4) can be used. After washing with buffer, wash with distilled water.

  When the labeled probe is used, hybridization and washing can be performed at 46 ° C. or 60 ° C. for 5 minutes to 1 hour, and washing can be performed at 48 ° C. or 62 ° C. for 20 minutes, respectively. .

  After washing, drying, immersion, and microcolony can be observed and counted with an apparatus that observes or measures a label such as a fluorescence microscope using fluorescence.

  (Kit) A reagent or the like for identification and / or counting by a culture combined in situ hybridization method can be used as a kit.

  (A) In the base sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2, a probe specific to the genus Aeromonas comprising a base sequence represented by at least 18 consecutive bases or a complementary sequence thereof, a hybridization buffer and a washing solution are included. A kit for detecting and / or counting bacteria belonging to the genus Aeromonas by in-situ hybridization combined with culture; (b) a base sequence represented by at least 18 or more consecutive bases in the base sequence represented by SEQ ID NO: 3 or its A kit for detecting and / or counting bacteria belonging to the genus Listeria by in-situ hybridization using culture, comprising a Listeria species-specific probe containing a complementary sequence, a hybridization buffer and a washing solution; (c) SEQ ID NO: 4 Less consecutive in the indicated base sequence A kit for detecting and / or counting Clostridium perfringens by a culture combined in situ hybridization method, comprising a Welsh bacillus-specific probe comprising a base sequence represented by 18 or more bases or a complementary sequence thereof, a hybridization buffer and a washing solution Can be mentioned. These kits can further contain either a membrane filter or a medium, or a combination thereof. As the hybridization buffer, the washing solution, and the medium, those described above can be used.

1. Detection and enumeration of bacteria of the genus Aeromonas by in situ hybridization combined with culture using a probe specific to the genus of Aeromonas. Preparation of probe GCAAGCTACTTTCCCGCTGCCGCT (SEQ ID NO: 1 probe name AER-mrf) (24 bases) and GCTAGCTTGCAGCCCTCTGTACGC (SEQ ID NO: 2 probe name AER-mmr) were used as probes. The probe was fluorescently labeled with FITC through an amino group attached to the 5 ′ end.

1-1. Preliminary confirmation of probe specificity
The specificity of the sequences of the AER-mrf and AER-mrr probes was determined by (i) the probe check program of the ribosome database project (RDP) and (ii) the specificity test for the actual strain.

  First, the RDP probe check program selected bacteria having 0 to 3 base differences in sequence from each probe sequence (Table 1). With this online program, the specificity of each probe can be preliminarily determined, and based on this result, positive and negative control strains for actual probe specific reactions shown in Table 2-3 were set.

  The actual probe specificity is that, in AER-mrf, A.hydrophila and A.veronii are positive strains that do not differ from the probe (0 base mismatch), and S.baltica and S.hanedai are 2 and 3 bases, respectively. As a negative control strain with a difference, in AER-mrr, A.hydrophila is a positive strain with no difference from the probe (0 base mismatch) and V.fischeri is a negative target strain with a difference of 1 base, V. Anguillarum and P. phosphoreum were designated as negative control strains having 2 base differences, and V. metchnikovii was designated as a negative control strain having 3 base differences.

2. In situ hybridization on a slide glass 1) Cells obtained by overnight pre-culture (30 ° C) of the various bacterial strains described above in Tryptic Soya Broth (Difco) were collected by centrifugation, and then collected into cells. 300 μl of 4% paraformaldehyde-phosphate buffer (PBS) was added and fixed at 4 ° C. for 1-3 hours.
2) 3 μl of the fixed bacterial cells were placed on a slide glass, air-dried, and then dehydrated by sequentially immersing in 50, 80 and 100% ethanol for 3 minutes.
3) Hybridization solution (0.9 M NaCl, 20 mM Tris-HCl, 0.01% SDS, pH 7.4, previously heated to 46 ° C. or 60 ° C. on fixed bacterial cells on a slide glass. 8 μl was added, and after prehybridization at 46 ° C. or 60 ° C. for 5 minutes, 1 μl of 5 pmol / μl probe solution was added. Hybridization was performed at 60 ° C. for 1 hour.
4) After hybridization, the slide glass was preheated at 48 ° C. and 62 ° C. (when it was hybridized at 46 ° C., it was washed at 48 ° C., and when it was hybridized at 60 ° C., it was washed at 62 ° C.) After immersing in 20 mM Tris-HCl, 40 to 220 mM NaCl, 0.01% SDS, pH 7.4) for 20 minutes, the remaining washing solution was washed away with sterile distilled water.
5) After air-drying the slide glass, the bacterial cells on the glass were observed with a fluorescence microscope, and the specificity of both probes was determined from the fluorescence state of the bacterial cells.

3. Setting of Specific Culture Conditions The culture conditions for improving the specificity of the probe for which the above specificity was evaluated were intensively set by the culture combined FISH method.
1) Positive bacteria and negative bacteria used for the probe specificity determination test on a slide glass were cultured in a medium excellent in microcolony formation of the probe positive bacteria, and the presence or absence or strength of the negative bacteria was determined.
2) After collecting probe-positive bacteria and negative bacteria on the filter, they were cultured for 4 to 8 hours to form microcolonies. The colonies on the filter were fixed with ethanol, and then FISH reaction was performed in the same manner as in situ hybridization on a slide glass.

Results The results are shown in Table 2-3.
The specificity of AER-mrf was confirmed by reacting at 60 ° C. in a reaction solution to which formamide having a concentration of 27.5% or more and 45% or less was added, and the Aeromonas bacterium was specifically detected.

  AER-mmr also reacted specifically, except Vibrio fischeri and Photobacterium phosphorium, when reacted at 60 ° C in a reaction solution to which formamide with a concentration of 27.5% to 45% was added.

  Aeromonas does not require salt for growth, whereas Vibrio fischeri and Photobacterium phosphorium require 3% sodium chloride for growth, so there is no salt in the medium used to form microcolonies. Specific detection was possible by the in-situ hybridization method combined with culture using an added medium. The result is shown in FIG.

Detection and enumeration of Listeria monocytogenes by in situ hybridization combined with culture using a Listeria monocytogene-specific probe Preparation of Listeria Probe CGC ACA TTT CCA TTC GTG CGA TTC C (SEQ ID NO: 3 probe name LIS1400) (25 bases) was used as the probe sequence. The LIS1400 probe was labeled with Alexa Fluor 594 via the amino group introduced at the 5 ′ end of the probe.

1-2. Preliminary confirmation of probe specificity
It was discriminated by homology search of the sequence of LIS1400 probe (BLAST program) and (ii) specificity test for the actual strain.

  First, a bacterium having a sequence difference from 0 to 3 bases from the LIS1400 probe sequence was selected by the BLAST program. With this online program, the specificity of each probe can be preliminarily determined, and based on the results, the strains listed in Table 4-5 were set as positive and negative control strains for actual probe-specific reactions.

2. Detection and counting of Listeria monocytogenes by in situ hybridization method 1) Centrifugation of cells previously cultured (30 ° C) overnight in Tryptic Soya Broth (Difco) with various bacterial strains listed in Table 4-5 above After collecting by separation, 300 μl of 4% paraformaldehyde-phosphate buffer (PBS) was added to the cells and fixed at 4 ° C. for 1 to 3 hours.
2) 3 μl of the fixed bacterial cells were placed on a slide glass, air-dried, and then dehydrated by sequentially immersing in 50, 80 and 100% ethanol for 3 minutes.
3) Hybridization solution (0.9 M NaCl, 20 mM Tris-HCl, 0.01% SDS, pH 7.4, previously heated to 46 ° C. or 60 ° C. on fixed bacterial cells on a slide glass. -35%) was added, and prehybridization was performed at 46 ° C. or 60 ° C. for 5 minutes, and then 1 μl of 5 pmol / μl probe solution was added. Alternatively, hybridization was performed at 60 ° C. for 1 hour.
4) After hybridization, the slide glass was preheated at 48 ° C. and 62 ° C. (when it was hybridized at 46 ° C., it was washed at 48 ° C., and when it was hybridized at 60 ° C., it was washed at 62 ° C.) After immersing in 20 mM Tris-HCl, 100 to 180 mM NaCl, 0.01% SDS, pH 7.4) for 20 minutes, the remaining cleaning solution was washed away with sterile distilled water.
5) After air-drying the slide glass, the bacterial cells on the glass were observed with a fluorescence microscope, and the specificity of both probes was determined from the fluorescence state of the bacterial cells.

3. Confirmation of counting accuracy by culture combined FISH method The above-described specificity of the probe was used to confirm the counting accuracy of the combined culture FISH method compared to known plate culture methods.
1) Positive bacteria and negative bacteria used for the probe specificity determination test on a slide glass were cultured in a medium excellent in microcolony formation of the probe positive bacteria, and the presence or absence or strength of the negative bacteria was determined.
2) After collecting probe-positive bacteria and negative bacteria on the filter, they were cultured for 8 hours to form microcolonies. The colonies on the filter were fixed with ethanol, and then FISH reaction was performed in the same manner as in situ hybridization on a slide glass.

Results The results are shown in Table 4-5. In the table, ++ indicates that strong fluorescence was detected, + indicates that fluorescence was detected,-indicates that fluorescence was not detected, and from Table 4-5, this probe LIS1400 As a condition that does not hybridize to Listeria species and related strains of bacteria, but to hybridize reliably to Listeria species, the formamide concentration is 20-35% at 46 ° C and the formamide concentration at 60 ° C. A condition of 10-15% was found.

  An example of the results (S. aureus) is shown in FIG. Specific hybridization to Listeria was demonstrated, and no hybridization was performed on DNA or RNA of non-Listeria. Therefore, the above 1. It was shown that the probe LIS1400 invented in 1) is effective for specific detection and identification of Listeria bacteria.

Further, the Listeria monocytogenes collected on the filter was cultured on a yeast extract-added tryptone soya agar (TSAYE) medium for 8 hours, and then the number of micro colonies was counted by the FISH method combined with culture using the LIS1400 probe. On the other hand, the bacterial samples were counted by a plate culture method using TSAYE medium or Listeria selective medium (PALCAM). The count is (2.4 ± 0.2) × 10 ⁹ CFU / ml for the FISH method with culture, (2.3 ± 0.1) × 10 ⁹ CFU / ml for the TSAYE plate method, and (2.2 ± 0.1) × 10 ⁹ CFU / ml for the PALCAM plate method. ± 0.3) × 10 ⁹ CFU / ml, and no significant difference was observed between them.

Detection and counting of C. perfringens by in situ hybridization using C. perfringens probes Preparation of Clostridium perfringens probe As a probe, AAT GAT GAT GCC ATC TTT CAA CA (SEQ ID NO: 4: probe name CLP180) (23 bases) was used. The CLP180 probe was labeled with Alexa Fluor 594 via an amino group introduced at the 5 ′ end of the probe.

1-1. Preliminary confirmation of probe specificity Next, (i) the probe check program of the ribosome database project (RDP) and (ii) the specificity test for the actual strain were performed.

  First, the RDP probe check program selected the most recent sequence difference between 0 and 3 bases. This online program allows preliminary determination of the specificity of each probe. The results are shown in Table 6.

  From this result, positive and negative control strains for actual probe specific reactions in Table 7-9 were set.

2. Detection and counting of Clostridium perfringens by in-situ hybridization with culture 1) Various bacterial strains listed in Table 7-8 were pre-cultured overnight (37 ° C, anaerobic culture) in GAM Broth and collected by centrifugation. Thereafter, 300 μl of 4% paraformaldehyde-phosphate buffer (PBS) was added to the cells and fixed at 4 ° C. for 1 to 3 hours.
2) 3 μl of the fixed bacterial cells were placed on a slide glass, air-dried, and then dehydrated by sequentially immersing in 50, 80 and 100% ethanol for 3 minutes.
3) Hybridization solution (0.9 M NaCl, 20 mM Tris-HCl, 0.01% SDS, pH 7.4 formamide is 0-60% previously heated to 46 ° C. or 60 ° C. on fixed bacterial cells on a slide glass. 8 μl was added, prehybridized at 46 ° C. or 60 ° C. for 5 minutes, 1 μl of 5 pmol / μl probe solution was added, and both probes were at 46 ° C. or 60 ° C. Hybridization was performed for 1 hour.
4) After hybridization, the slide glass was preheated at 48 ° C. and 62 ° C. (when it was hybridized at 46 ° C., it was washed at 48 ° C., and when it was hybridized at 60 ° C., it was washed at 62 ° C.) After immersing in 20 mM Tris-HCl, 40 to 220 mM NaCl, 0.01% SDS, pH 7.4) for 20 minutes, the remaining washing solution was washed away with sterile distilled water.
5) After air-drying the slide glass, the bacterial cells on the glass were observed with a fluorescence microscope, and the specificity of both probes was determined from the fluorescence state of the bacterial cells.

3. Confirmation of counting accuracy by culture combined FISH method The above-described specificity of the probe was used to confirm the counting accuracy of the combined culture FISH method compared to known plate culture methods.
1) Positive bacteria and negative bacteria used for the probe specificity determination test on a slide glass were cultured in a medium excellent in microcolony formation of the probe positive bacteria, and the presence or absence or strength of the negative bacteria was determined.
2) After collecting probe-positive bacteria and negative bacteria on the filter, the cells were cultured for 5 hours to form microcolonies. The colonies on the filter were fixed with ethanol, and then FISH reaction was performed in the same manner as in situ hybridization on a slide glass.

B. Results The results are shown in Tables 7, 8 and 9.

As hybridization conditions with high specificity of the probe CLP180, conditions were found in which the formamide concentration was 20-30% at 46 ° C. and the formamide concentration was 0-15% at 60 ° C.
An example of the results (Botulinum botulinum) is shown in FIG.

  The probe CLP180 was shown to hybridize specifically to Clostridium perfringens and not hybridize to DNA or RNA of non-St. Therefore, it was shown that CLP180 is also effective for specific detection and identification of Clostridium perfringens.

Furthermore, after culturing the C. perfringens collected on the filter on the GAM medium for 5 hours, the number of micro colonies was counted by the FISH method combined with culture using the CLP180 probe. On the other hand, the bacterial samples were counted by a plate culture method using a GAM agar medium or a CW agar medium supplemented with kanamycin. The count value in the cultivation combination FISH method, (2.3 ± 1.2) X 10 6 CFU / ml, the GAM plate culture method, (2.3 ± 1.1) is X 10 ⁶ CFU / ml, kanamycin pressurized CW agar plate culture method In (2.4 ± 1.7) × 10 ⁶ CFU / ml, there was no significant difference between them.

Preparation of Vibrio parahaemolyticus, Salmonella and pathogenic Escherichia coli probes (1) Gene probe specifically detecting Vibrio parahaemolyticus A gene probe specifically detecting Vibrio parahaemolyticus was found from the 16S rRNA gene sequence. The sequences are actacactaccttcctcacgactgaaa (probe name Vpa437) (27 bases), tgcaattccgaggttgagccccgg (probe name Vpa612) (24 bases), and cactttcgcaagttggctgccc (probe name Vpa1255) (22 bases). These probes have Gibbs free energy calculations (Safak et al., 2004) and have been sequenced to be most reactive with the specific region of the target rRNA while maintaining the probe specificity. (Table 10).
Safak et al. 2004. Appl. Environ. Microbiol. 70: 7126-7139.

(2) Gene Probe for Specific Detection of Salmonella The gene probe for specific detection of Salmonella is an improvement of the previously reported 16S-I (Lin & Tsen, 1995). This sequence is found in the 16S rRNA gene sequence and performs Gibbs free energy calculation (Safak et al., 2004) and is most reactive with the specific region of the target rRNA while maintaining the probe specificity. The arrangement was adjusted as follows (Table 10). The sequence is gctgcggttattaaccacaacaccccttc (SEQ ID NO: 8 probe name Sal453) (29 bases).
Lin & Tsen, 1995. JAB, 78: 507-520.

(3) Gene probe specifically detecting pathogenic E. coli A gene probe specifically detecting pathogenic E. coli was found from the 16S rRNA gene sequence. The sequence is gaagcaagcttcttcctgttaccg (SEQ ID NO: 9 probe name Eco67) (24 bases). These probes have Gibbs free energy calculations (Safak et al., 2004) and have been sequenced to be most reactive with the specific region of the target rRNA while maintaining the probe specificity. (Table 10).

Detection and enumeration of Vibrio parahaemolyticus by in situ hybridization combined with culture using Vibrio parahaemolyticus-specific probes Vibrio parahaemolyticus has been considered difficult to specifically detect by distinguishing it from other closely related strains. In this example, the region where mutations were found in the sequences of Vibrio parahaemolyticus and other related species was scrutinized and the following three types of probes (Vpa437, Vpa612 and Vpa1255) were found. Strains that react to all these probes are highly specific and can be detected as Vibrio parahaemolyticus (Figure 4).

(1) Comparison with sequences registered in the database
In addition to V. parahaemolyticus, the Vpa437 probe had no mismatch with V. campbellii, V. rotiferianus, V. harveyi, V. natriegens, V. proteolyticus, and V. alginolyticus (Table 11).

  In addition to V. parahaemolyticus, the Vpa612 probe has no mismatch with V. campbellii, V. rotiferianus, V. scopthalmi, V. tubiashii, V. furnisii, V. fluvialis, V. orientalis, V. coralliilyticus, and V. ichthyoenteri (Table 11).

  Furthermore, the Vpa1255 probe had no mismatch with V. aestuarianus, V. furnisii, V. orientalis, and V. alginolyticus in addition to V. parahaemolyticus (Table 11). , V. parahaemolyticus only.

(2) Specificity evaluation method of Vibrio parahaemolyticus probe
1) To 100 μl of cell suspension in which Vibrio parahaemolyticus LMG2850 ^T strain was pre-cultured overnight (25 ° C.) in marine broth (Difco), fixed by adding 3 volumes of 4% paraformaldehyde (PFA), 300 μl The cells were washed 3 times with PBS. Thereafter, 100 μl of ice-cooled 99% ethanol was added to prepare PFA-fixed cells.
2) 3 microliters of the fixed cells were placed on a slide glass, air-dried, and dehydrated by sequentially immersing in 50, 80 and 100% ethanol for 3 minutes.
3) Hybridization solution (0.9M NaCl, 20mM Tris-HCl, 0.01% SDS, 0-40% formamide (changed appropriately according to reaction conditions), pH 7.4) onto bacterial cells fixed on a slide glass 8 μl was added, and 1 μl of 25 nmol / μl probe was further added, and hybridization was performed at 46 ° C. in a humid box for 2 hours.
4) After hybridization, the slide glass is preliminarily heated at 48 ° C in a washing solution (20 mM Tris-HCl, 40 to 900 mM NaCl (changed appropriately depending on the reacted formamide concentration), 0.01% SDS, pH 7.4). After soaking for 15 minutes, the remaining cleaning solution was washed away with sterile distilled water.
5) After air-drying the slide glass, the bacterial cells on the glass were observed with a fluorescence microscope, and the specificity of the Vibrio parahaemolyticus probe was determined based on whether or not the characteristic fluorescence was observed in the bacterial cells reacted with the fluorescent probe.

Results Evaluation of reactivity to cultured bacterial cells
The Vpa437 probe reacted with V. anguillarum in addition to V. parahaemolyticus and Vibrio species with no mismatch in this probe by reacting at 46 ° C. using a reaction solution having a formamide concentration of 10 to 40% (Table 12). ).

  The Vpa612 probe reacted with Vibrio species having no mismatch with this probe in addition to V. parahaemolyticus by reacting at 46 ° C. using a reaction solution having a formamide concentration of 30 to 40% (Table 12).

  Furthermore, the Vpa1255 probe reacted with V. parahaemolyticus and Vibrio species having no mismatch with this probe by reacting at 46 ° C. using a reaction solution having a formamide concentration of 25 to 40% (Table 12).

  As described above, the three probes can be simultaneously subjected to FISH reaction in a reaction solution at 46 ° C. and a formamide concentration of 30 to 40%. By reacting the above three types of probes under these conditions, specific detection by V. parahaemolyticus FISH method became possible (FIG. 4).

  The fluorescent substance labeled on the probe is preferably a dye characterized by green, red and near infrared fluorescence. Specifically, FITC, TAMRA, and Cy5.

  In addition, these three probes reacted to each strain of V. parahaemolyticus (HO5, LMG16874, IFO12711 (clinical), VPY01 (clinical, O3K6, tdh +), VPY20 (clinical, O4K68, tdh +), 704B1, CHT201). .

(3) Optimizing conditions for forming small settlements
The culture medium of V. parahaemolyticus LMG2850 ^T strain was collected on a nuclepore filter and then attached to a marine agar medium (Difco) and cultured at 37 ° C. for 2, 4, 6, and 8 hours. The Vibrio parahaemolyticus microcolon was reacted with the Vibrio parahaemolyticus probe in a reaction solution containing 46% at 30 ° C. formamide and FISH detection of the microcolonies was performed. Observed under a fluorescence microscope, the growth of the microcolonies was observed over time.

  In addition, by combining the Vpa437 and Vpa612 probes, it is possible to narrow down from 80 kinds of vibrio to V. rotiferianus and V. campbellii in addition to V. parahaemolyticus. For V. parahaemolyticus, growth and salt tolerance at high temperatures (40 ° C) were examined as culture conditions in which V. rotiferianus and V. campbellii were not detected.

Results Formation of Vibrio parahaemolyticus microcolonies Vibrio parahaemolyticus colonies grew with time, and after 6 hours of culture, they grew into colonies that could be observed with a 40 to 100x lens of about 80 μm. When cultured for 8 hours, Vibrio parahaemolyticus colonies grew rapidly and became larger than 600 μm (FIG. 5).

  In addition, by combining the Vpa437 and Vpa612 probes, it is possible to narrow down from 80 kinds of vibrio to V. rotiferianus and V. campbellii in addition to V. parahaemolyticus. For V. parahaemolyticus, we examined the culture conditions that did not detect V. rotiferianus and V. campbellii.These were cultured at 40 ° C using marine agar medium (Difco) or agar medium (7% sodium chloride) Culture conditions using yeast extract 0.1%, 7% sodium chloride, agar 1.5%, pH 7.5) were found (Table 13).

  Therefore, Vibrio parahaemolyticus collected on the filter is cultured at 40 ° C using marine agar medium (Difco) or using an agar medium supplemented with 7% sodium chloride, and two probes, Vpa437 and Vpa612, are used. The specific detection of Vibrio parahaemolyticus was also made possible by the specific detection with.

When the Vibrio parahaemolyticus LMG2850 ^T strain was cultured on marine agar at 40 ° C., the microcolonies grew into colonies that could be observed with a 40-100 × lens of about 50 μm after culturing for 8 hours. When cultured for more than 10 hours, the small colonies of Vibrio parahaemolyticus became larger than 200 μm (FIG. 6). Under these conditions, V. rotiferianus and V. campbellii did not grow until they formed a visible microcolonization.

(4) Vibrio parahaemolyticus detection using 3 probes of Vpa437, Vpa612 probe and Vpa1255 probe
Vpa437 was labeled with FITC, the Vpa612 probe was labeled with TAMRA, and the Vpa1255 probe was labeled with Cy5.
After culturing V. parahaemolyticus LMG2850 ^T strain in marine agar medium for 6 hours, the grown microcolonies were mixed with the above three probes in a hybridization solution with a formamide concentration of 30% (~ 40%) and reacted at 46 ° C. I let you.

  As shown in FIG. 4, Vibrio parahaemolyticus reacts with all three types of probes and can be detected separately from closely related species V. rotiferianus and V. campbellii.

Detection and enumeration of Salmonella by in situ hybridization combined with culture using Salmonella-specific probes (1) Comparison with sequences registered in the database
The Sal453 probe had no mismatch with Enterobacter sakazakii and Pantoea agglomerans other than S. enterica (Table 14). It was the same as the reported 16S-I probe.

(2) Method for evaluating the specificity of Salmonella probes
1) It was performed in the same manner as Vibrio parahaemolyticus. Salmonella enterica Typhimurium ATCC13311T strain was pre-cultured overnight (37 ° C.) in bouillon medium.

Results Evaluation of reactivity to cultured bacterial cells
The Sal453 probe reacted with S. enterica and E. sakazakii using a reaction solution with a formamide concentration of 10-40% at 46 ° C, but did not react with P. agglomerans (Table 15). . Therefore, this probe is a probe for detecting E. sakazakii in addition to S. enterica.

(3) Optimization of micro village formation conditions
The Salmonella enterica Typhimurium ATCC13311T strain culture solution is collected on a Nuclepore filter, pasted on a standard agar medium, and cultured at 37 ° C for 2-12 hours, similar to the optimization of Vibrio parahaemolyticus formation conditions Experimented with the method.

Results Formation of Salmonella microcolonies Salmonella microcolonies grew with time, and after 8 hours of culture, they grew into colonies that could be observed with a 40-100x lens of about 80 micrometers. After culturing for 12 hours, the Salmonella microcolonies exceeded 400 micrometers (FIG. 7).

Detection and enumeration of pathogenic E. coli by in situ hybridization combined with culture using pathogenic E. coli specific probe (1) Comparison with sequences registered in database
The Eco67 probe was a probe with no mismatch only in E. coli (Table 16).

(2) Method for evaluating the specificity of pathogenic E. coli probes
1) It was performed in the same manner as Vibrio parahaemolyticus. Escherichia coli O157: H7 strain was precultured overnight (37 ° C.) in bouillon medium.

Results Evaluation of reactivity to cultured bacterial cells
The Eco67 probe reacted with Mannheimia varigena and M. ruminalis in addition to E. coli by reacting at 46 ° C. using a reaction solution having a formamide concentration of 10 to 40% (Table 17). In addition, this probe is an E.coli strain such as EHEC RIMD05091055, EHEC RIMD05091056, EHEC RIMD05091151 (0-157), EHEC RIMD0509952 (0-157), EPEC RIMD0509829, EIEC RIMD05091045, ETEC RIMD0509356, ETEC RIMD0509335, etc. Strains were detected (Table 18).

(3) Optimizing conditions for forming small settlements
The E. coli O157: H7 strain culture solution is collected on a Nuclepore filter and then affixed to a standard agar medium and cultured at 37 ° C for 2 to 10 hours to optimize the conditions for formation of Vibrio parahaemolyticus microcolonies. The experiment was conducted in the same manner.

Results Formation of pathogenic E. coli microcolonies Micropathic colonies of pathogenic E. coli grew with time, and after 6 hours of culture, they grew into colonies that could be observed with a 40 to 100 lens of about 80 micrometers. After 8 hours of culture, the Salmonella microcolonies exceeded 100 micrometers (Figure 8).

  The present invention can be used, for example, in the food processing field.

The specificity of AER-mrr when culture conditions are specific is shown. Fluorescence photograph showing the specificity of probe LIS-1400. Fluorescence photograph showing the specificity of the probe CLP-180. The figure which shows that Vibrio parahaemolyticus can be specifically detected by using three types of probes. Changes in the size of microcolonies of Vibrio parahaemolyticus over time (ZoBell medium, 37 ° C). Change in size of Vibrio parahaemolyticus over time (ZoBell medium, 40 ° C). Temporal change in the size of a small colony of Salmonella (standard agar medium, 37 ° C). Temporal change in the size of microcolonies of pathogenic E. coli (standard agar medium, 37 ° C).

Claims (36)

  For specifically detecting, identifying, and / or measuring an Aeromonas genus including a base sequence represented by at least 18 consecutive bases or a complementary sequence thereof in the base sequence represented by SEQ ID NO: 1 or 2 probe.   A probe for specifically detecting, identifying, and / or measuring Listeria belonging to a base sequence represented by at least 18 or more consecutive bases in the base sequence represented by SEQ ID NO: 3 or a complementary sequence thereof.   A probe for specifically detecting, identifying, and / or measuring Clostridium perfringens comprising a base sequence represented by at least 18 or more consecutive bases in the base sequence represented by SEQ ID NO: 4 or a complementary sequence thereof.   The probe according to claim 1, for specifically detecting, identifying, and / or measuring a genus Aeromonas that is labeled on a nucleic acid consisting of a base sequence consisting of SEQ ID NO: 1 or SEQ ID NO: 2 or a complementary sequence thereof.   The probe according to claim 2, for specifically detecting, identifying and / or measuring a Listeria spp. Labeled with a nucleic acid comprising the base sequence represented by SEQ ID NO: 3 or a complementary sequence thereof.   The probe according to claim 3, for specifically detecting, identifying, and / or measuring a Clostridium perfringens labeled with a nucleic acid comprising the base sequence represented by SEQ ID NO: 4 or a complementary sequence thereof.   A method for detecting and / or counting bacteria belonging to the genus Aeromonas by in situ hybridization using a probe specific to the bacteria belonging to the genus Aeromonas according to claim 1, wherein a microorganism sample is cultured to form a microcolony.   The method according to claim 7, wherein the sample microorganism is cultured in a medium having a salt concentration of 0.15% or less.   A microorganism sample is cultured to form bacterial microcolonies, and the bacteria belonging to Listeria are detected and / or counted by in situ hybridization using the probe specific to the bacteria belonging to Listeria according to claim 2. Method.   The method according to claim 9, wherein the microorganism sample is cultured in a medium to which one or more antibiotics selected from polymyxin B, acriflavine hydrochloride and ceftazidime are added.   The method according to claim 9, wherein the hybridization conditions are within a range where the hybridization temperature is 46 ° C to 60 ° C, the formamide concentration is 20% to 35% at 46 ° C, and 10% to 15% at 60 ° C.   A method for detecting and / or counting C. perfringens by in situ hybridization using a probe specific for C. perfringens according to claim 3 by culturing a microorganism sample to form microcolonies.   The method according to claim 12, wherein the microorganism sample is cultured at 70 to 80 ° C for 10 to 30 minutes and then anaerobically cultured at 40 to 50 ° C.   The method according to claim 12, wherein the hybridization conditions are such that the hybridization temperature is 46 ° C to 60 ° C, the formamide concentration is 20% to 35% at 46 ° C, and 0% to 15% at 60 ° C.   A kit for detecting and / or counting bacteria belonging to the genus Aeromonas by a culture combined in situ hybridization method, comprising the probe according to claim 1, a hybridization buffer, and a washing solution.   A kit for detecting and / or counting bacteria belonging to the genus Listeria by a culture combined in situ hybridization method comprising the probe according to claim 2, a hybridization buffer, and a washing solution.   A kit for detecting and / or counting C. perfringens by a culture combined in situ hybridization method, comprising the probe according to claim 3, a hybridization buffer, and a washing solution.   Vibrio parahaemolyticus specifically including, or complementary to, a base sequence represented by at least 18 or more consecutive bases in the base sequence represented by SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7, and / or Probe for measuring.   A probe for specifically detecting, identifying and / or measuring Salmonella containing a base sequence represented by at least 18 or more consecutive bases in the base sequence represented by SEQ ID NO: 8 or a complementary sequence thereof.   A probe for specifically detecting, identifying, and / or measuring pathogenic E. coli comprising a base sequence represented by at least 18 or more consecutive bases in the base sequence represented by SEQ ID NO: 9 or a complementary sequence thereof.   19. The method according to claim 18, for specifically detecting, identifying and / or measuring Vibrio parahaemolyticus labeled with a nucleic acid comprising the nucleotide sequence of SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 7 or a complementary sequence thereof. probe.   The probe according to claim 19, for specifically detecting, identifying and / or measuring Salmonella labeled with a nucleic acid comprising the base sequence represented by SEQ ID NO: 8 or a complementary sequence thereof.   21. The probe according to claim 20, for specifically detecting, identifying and / or measuring pathogenic E. coli having a label attached to a nucleic acid comprising the base sequence represented by SEQ ID NO: 9 or a complementary sequence thereof.   A method for detecting and / or counting a bacterium belonging to the genus Vibrio parahaemolyticus by in situ hybridization using a probe specific to the bacterium belonging to Vibrio parahaemolyticus according to claim 18 by culturing a microorganism sample to form a microcolony. .   The method according to claim 24, wherein the sample microorganism is cultured in a medium having a salt concentration of 1% or more at 37 to 43 ° C for 4 to 10 hours.   A method for detecting and / or counting bacteria belonging to Salmonella by in situ hybridization using a probe specific to bacteria belonging to Salmonella according to claim 19 by culturing a microorganism sample to form microcolonies of bacteria.   27. The method of claim 26, wherein the microbial sample is cultured at 30-43 [deg.] C. for 4-10 hours.   27. The method of claim 26, wherein the hybridization conditions are such that the hybridization temperature is 46 ° C., the formamide concentration is 25-40%, and the formamide concentration is 60% at 60 ° C.   A method for detecting and / or counting pathogenic E. coli by in situ hybridization using a probe specific to pathogenic E. coli according to claim 20, wherein a microorganism sample is cultured to form a microcolony.   30. The method of claim 29, wherein the microbial sample is cultured at 30-44 [deg.] C. for 4-8 hours.   30. The method of claim 29, wherein the hybridization conditions are in the range where the hybridization temperature is 10% to 40% at 46 [deg.] C and the formamide concentration is 20% at 60 [deg.] C.   A kit for detecting and / or counting bacteria belonging to Vibrio parahaemolyticus by an in-situ hybridization method combined with culture, comprising the probe according to claim 18, a hybridization buffer, and a washing solution.   A kit for detecting and / or counting Salmonella by a culture combined in situ hybridization method comprising the probe according to claim 19, a hybridization buffer, and a washing solution.   A kit for detecting and / or counting pathogenic Escherichia coli by a culture combined in situ hybridization method comprising the probe according to claim 20, a hybridization buffer, and a washing solution.   A microorganism sample is cultured to form a microcolony, the Vibrio parahaemolyticus probe in which the nucleic acid represented by SEQ ID NO: 5 is labeled, the Vibrio parahaemolyticus probe in which the nucleic acid represented by SEQ ID NO: 6 is labeled, and SEQ ID NO: A method for detecting and / or counting bacteria belonging to the genus Vibrio parahaemolyticus by in situ hybridization using a Vibrio parahaemolyticus probe in which the nucleic acid represented by 7 is labeled.   A microorganism sample is cultured to form a microcolony, and a food poisoning bacterium is obtained by an in situ hybridization method using the probe specific for the food poisoning bacterium according to any one of claims 1, 2, 3, 18, 19 or 20. How to detect and / or count.

Images