JP2001114779A - 5-pyridyl-1-azole compound, method for producing the same and use thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To produce a compound having excellent antagonistic actions on adenosine A3 receptors, inhibitory actions on p38MAP kinases and TNF-α- inhibitory actions. SOLUTION: This compound is represented by the formula [R1 denotes hydrogen, a hydrocarbon, a heterocyclic ring, amino or an acyl; R2 denotes an aromatic group; R3 denotes hydrogen, pyridyl or an aromatic hydrocarbon; X denotes oxygen or sulfur which may be oxidized; Y denotes a direct bond, oxygen, sulfur which may be oxidized or a group represented by the formula NR4 (R4 denotes hydrogen, a hydrocarbon or an acyl); and Z denotes a direct bond or a bivalent chain hydrocarbon] or its salt.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD [0001] The present invention provides an excellent pharmaceutical action,
In particular, the present invention relates to a novel 5-pyridyl-1,3-azole compound having an adenosine A ₃ receptor antagonistic action, a p38 MAP kinase inhibitory action, a TNF-α production inhibitory action, etc., a method for producing the same, a pharmaceutical composition and the like.

[0002]

The subtype of the Related Art adenosine receptor, A _1, A _2a, the A _2b and A ₃ are known. Adenosine shows an airway constriction reaction in asthmatics, while theophylline, an asthma therapeutic, shows adenosine antagonism.
In addition, activation of A ₃ receptor in rats causes degranulation from mast cells [Journal of Biological Chemistry (Journal of Biological Chemistry)
Chemistry), 268, 16887-16890,
1993], A ₃ receptor is present in the peripheral blood eosinophils,
The stimulation activates phospholipase C (PLC) to increase intracellular calcium concentration [Blood
d), Vol. 88, pp. 3569-3574, 1996] and the like. In addition, cytokines such as TNF-α (tumor necrosis factor-α) and IL-1 (interleukin-1) are produced by various cells such as monocytes or macrophages in response to infection or other cellular stress. (Koji, A., Bio)
chim. Biophys. Acta, 1317, 84
-94 (1996)). Although these cytokines play an important role in the immune response when present in appropriate amounts, overproduction is believed to be involved in many inflammatory diseases (Dinarello, C .;
A. , Curr. Opin. Immunol. , 3,9
41-948 (1991)). P38MAP kinase, cloned as a homologue of MAP kinase, is involved in the regulation of production of these cytokines and in the signal transduction system coupled to the receptor, and inhibition of p38MAP kinase may be a therapeutic agent for inflammatory diseases. (Stein, B., Anderson, D., Ann
ual Report in Medical C
hemistry, Bristol, J. et al. A. (Edit), Academic Press, Volume 31, 289
-298, 1996). Conventionally, as compounds having selective antagonism to adenosine A ₃ receptor, xanthine derivatives include GB-A-2288733 and WO 95
/ 11681 and furthermore, Journal of Medicina Chemistry
l Chemistry), 40, 2596-2608, 19
In 1997, the following compound was reported.

Embedded image WO 97/33879 has the formula

Embedded image [In the formula, R represents hydrogen, chlorine, bromine, fluorine, iodine, hydroxy, C _1-4 alkyl, C _1-4 alkoxy or C _1-4 alkylcarboxy. Adenosine A ₃ receptor antagonist containing a compound represented by the formula (I) or a salt thereof, and specifically

Embedded image Is described. As a compound having a p38 MAP kinase inhibitory action, an imidazole derivative is disclosed in JP-T-7-50317 (WO 93/14081).
And oxazole derivatives are described in Japanese Patent Publication No. 9-505055 (WO 95/13067). On the other hand, the following compounds are known as thiazole compounds. 1) analgesic, antipyretic, anti-inflammatory, anti-ulcer, thromboxane A ₂
(TXA ₂ ) has synthase inhibitory activity and platelet aggregation inhibitory activity,
formula

Embedded image [In the formula, R ¹ is a cycloalkyl group, a cyclic amino group, an amino group optionally having one or two lower alkyl, phenyl, acetyl or lower alkoxycarbonylacetyl as a substituent, a hydroxyl, carboxyl or a substituent as a substituent. As an alkyl group or a substituent which may have a lower alkoxycarbonyl, carboxyl, 2-
A phenyl group optionally having carboxyethenyl or 2-carboxy-1-propenyl, R ² represents a pyridyl group optionally having lower alkyl as a substituent,
R ³ represents a phenyl group which may have lower alkoxy, lower alkyl, hydroxyl, halogen or methylenedioxy as a substituent. 1,3-thiazole derivative or a salt thereof (JP-A-60-58981). 2) analgesic, antipyretic, anti-inflammatory, anti-ulcer, TXA ₂ synthase inhibition,
Formula having platelet aggregation inhibitory action

Embedded image [Wherein, R ¹ is an alkyl group which may have a substituent,
An alkenyl group, an aryl group, an aralkyl group, a cycloalkyl group, a heterocyclic group having a carbon bond or an amino group,
R ² represents a pyridyl group which may be substituted with an alkyl group, and R ³ represents a phenyl group which may have a substituent. 1,3-thiazole derivatives or salts thereof (JP-A-61-10580). 3) analgesic, antipyretic, anti-inflammatory, anti-ulcer, TXA ² synthase inhibition,
Formula having platelet aggregation inhibitory action

Embedded image [Wherein, R ¹ is an alkyl group which may have a substituent,
An alkenyl group, an aryl group, an aralkyl group, a cycloalkyl group, a heterocyclic group having a carbon bond or an amino group,
R ² represents a pyridyl group which may be substituted with an alkyl group, and R ³ represents an aryl group which may have a substituent. 1,3-thiazole derivative or a salt thereof (USP 4,612,321). 4) As having an anticancer effect and a cytokine inhibitory effect,
formula

Embedded image And the following compounds are specifically described (WO97 / 12876).

Embedded image

[0003]

SUMMARY OF THE INVENTION Action, safety, (oral) absorption, (metabolism) as adenosine A ₃ antagonist, p38 MAP kinase inhibitor, TNF-α production inhibitor
No satisfactory adenosine A ₃ receptor-related disease, adenosine A ₃ receptor-related disease, adenosine A ₃ receptor antagonist excellent as an effective drug for the prevention and treatment of cytokine-mediated diseases, etc., a p38 MAP kinase inhibitor,
There is a strong need for the development of a TNF-α production inhibitor.

[0004]

The present inventors have conducted various studies and found that the formula

Embedded image [In the formula, X represents an oxygen atom or a sulfur atom which may be oxidized. An N-oxide having a chemical structural feature in that the 5-position of the ring represented by the formula is substituted with 4-pyridyl and that the pyridyl group has a side chain containing an aromatic group at the 2-position. Formula (I) which may be

Embedded image [Wherein, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group or an acyl group which may have a substituent. R ² represents an aromatic group which may have a substituent, R ³ represents a hydrogen atom,
A pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X is an oxygen atom or a sulfur atom which may be oxidized, Y is a bond, an oxygen atom A group represented by an optionally oxidized sulfur atom or a formula NR ⁴ (wherein R ⁴ represents a hydrogen atom, a hydrocarbon group which may have a substituent or an acyl group), and Z Represents a bond or a divalent chain hydrocarbon group which may have a substituent. And a salt thereof (hereinafter may be abbreviated as compound (I)) for the first time, and the compound (I) obtained is unexpectedly superior on the basis of its unique chemical structure. selective affinity and adenosine A ₃ receptor antagonism for adenosine A ₃ receptor, p3
Having a pharmaceutical action such as an 8MAP kinase inhibitory action;
Furthermore, they have excellent properties as pharmaceuticals such as stability and found that they are sufficiently satisfactory as pharmaceuticals, and based on these findings, completed the present invention.

That is, the present invention relates to (1) a compound of the formula

Embedded image [Wherein, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group or an acyl group which may have a substituent. R ² represents an aromatic group which may have a substituent, R ³ represents a hydrogen atom,
A pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X is an oxygen atom or a sulfur atom which may be oxidized, Y is a bond, an oxygen atom A group represented by an optionally oxidized sulfur atom or a formula NR ⁴ (wherein R ⁴ represents a hydrogen atom, a hydrocarbon group which may have a substituent or an acyl group), and Z Represents a bond or a divalent chain hydrocarbon group which may have a substituent. Or a salt thereof, (2) Z
Is a divalent chain hydrocarbon group which may have a substituent;

Embedded image [Wherein n represents 0 or 1, and the other symbols have the same meanings as in item (1)], or a compound thereof according to item (1), which is a salt thereof; R ¹ represents (i) a hydrogen atom, (ii) a C _1-6 alkyl group, a C _2-6 alkenyl group,
_2-6 alkynyl group, C _3-6 cycloalkyl group, C _6-14 aryl group or C _7-16 aralkyl group [these groups are oxo, halogen atom, C _1-3 alkylenedioxy, nitro, cyano, Optionally halogenated C _1-6 alkyl, optionally halogenated C _2-6 alkenyl, carboxy C _2-6 alkenyl, optionally halogenated C _2-6 alkynyl, halogenated _May be C _3-6
Cycloalkyl, C _6-14 aryl, optionally halogenated C _1-8 alkoxy, C _1-6 alkoxy-carbonyl-C _1-6 alkoxy, hydroxy, C _6-14 aryloxy, C _7-16 aralkyl Oxy, mercapto, optionally halogenated C _1-6 alkylthio, C _6-14 arylthio, C _7-16 aralkylthio, amino, mono-C _1-6
Alkylamino, mono-C _6-14 arylamino, di-C
_1-6 alkylamino, di -C _6-14 arylamino, formyl, carboxy, C _1-6 alkyl - carbonyl, C _3-6
Cycloalkyl-carbonyl, C _1-6 alkoxy-carbonyl, C _6-14 aryl-carbonyl, C _7-16 aralkyl-carbonyl, C _6-14 aryloxy-carbonyl,
C _7-16 aralkyloxy - carbonyl, 5- or 6-membered heterocyclic carbonyl, carbamoyl, thiocarbamoyl, mono--C _1-6 alkyl - carbamoyl, di -C _1-6 alkyl -
Carbamoyl, C _6-14 aryl-carbamoyl, 5- or 6-membered heterocyclic carbamoyl, C _1-6 alkylsulfonyl,
C _6-14 arylsulfonyl, C _1-6 alkylsulfinyl, C _6-14 arylsulfinyl, formylamino, C
_1-6 alkyl-carbonylamino, C _6-14 aryl-carbonylamino, C _1-6 alkoxy-carbonylamino, C _1-6 alkylsulfonylamino, C _6-14 arylsulfonylamino, C _1-6 alkyl-carbonyloxy C _6-14 aryl-carbonyloxy, C _1-6 alkoxy-carbonyloxy, mono-C _1-6 alkyl-carbamoyloxy, di-C _1-6 alkyl-carbamoyloxy, C _6-14 aryl-carbamoyloxy, Nicotinoyloxy, a 5- to 7-membered saturated cyclic amino which may contain 1 to 4 heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to one nitrogen atom and a carbon atom (This cyclic amino is C _1-6 alkyl,
C _6-14 aryl, C _1-6 alkyl-carbonyl, a 5- to 10-membered aromatic heterocyclic group and a substituent selected from the group consisting of oxo), nitrogen atom, sulfur A substituent selected from the group consisting of a 5- to 10-membered aromatic heterocyclic group containing 1 to 4 one or two heteroatoms selected from atoms and oxygen atoms, sulfo, sulfamoyl, sulfinamoyl and sulfenamoyl (substituent group A) And (iii) one selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to the carbon atom, which may have a substituent selected from substituent group A.
Or 5 to 14 containing 1 to 4 heteroatoms of 2 types
Heterocyclic group, (iv) Formula :-( C = O) -R ^5, in membered ^{- (C = O) -OR 5} , -
^{(C = O) -NR 5 R} 6, - (C = S) -NHR 5 or -S
O ₂ —R ⁷ (wherein, R ⁵ is a hydrogen atom, a C _1-6 alkyl group _optionally having a substituent selected from substituent group A, a C _2-6 alkenyl group, a C _2-6 alkynyl Group, a C _3-6 cycloalkyl group, a C _6-14 aryl group or a C _7-16 aralkyl group or a substituent selected from the group of substituents A,
R ⁶ is a hydrogen atom or a C _1-6 alkyl group; a 5- to 14-membered heterocyclic group containing 1 to 4 one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom other than a carbon atom; R ⁷ is a C _1-6 alkyl group which may have a substituent selected from substituent group A, a C _2-6 alkenyl group,
A carbon atom which may have a substituent selected from a C _2-6 alkynyl group, a C _3-6 cycloalkyl group, a C _6-14 aryl group or a C _7-16 aralkyl group or a substituent group A, An acyl group represented by a 5- to 14-membered heterocyclic group containing 1 to 4 one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom), (v) an amino group (this amino group The group may be a C _1-6 alkyl group, a C _2-6 alkenyl group, a C _2-6 alkynyl group, a C _3-6 cycloalkyl group, a C _1-6 alkyl group which may have a substituent selected from substituent group A.
_{A 6-14} aryl group or a C _7-16 aralkyl group, which may have a substituent selected from substituent group A, and other than a carbon atom, a group selected from a nitrogen atom, a sulfur atom and an oxygen atom
Or 5 to 14 containing 1 to 4 heteroatoms of 2 types
Membered heterocyclic group, the acyl group shown in the above (iv) and C _1-6 which may have a substituent selected from substituent group A
(Vi) may have a substituent selected from the group consisting of an alkylidene group), or (vi) in addition to one nitrogen atom and carbon atom, 1 nitrogen atom, sulfur atom and oxygen atom.
Or a 5- to 7-membered non-aromatic cyclic amino group optionally containing 1 to 4 heteroatoms (the cyclic amino group may be a C _1-6 alkyl, a C _6-14 aryl, a C _1-6 alkyl −
Carbonyl, which may have a substituent selected from the group consisting of a 5- to 10-membered aromatic heterocyclic group and oxo)
R ² represents a C _6-14 monocyclic or condensed polycyclic aromatic hydrocarbon group which may have a substituent selected from substituent group A or a substituent selected from substituent group A; has optionally a nitrogen atom in addition also be carbon atom, a sulfur atom and 1 or 2 kinds of the aromatic heterocyclic group having 5 containing 1 to 4 hetero atoms 14 members selected from oxygen atom; R ³ is hydrogen Atom, a pyridyl group optionally having a substituent selected from substituent group A or a C _6-14 monocyclic or condensed polycyclic _optionally having a substituent selected from substituent group A X is O, S, SO or SO ₂ ; Y is a bond, O, S, SO, SO ₂ or a formula NR ⁴ (wherein R ⁴ is a hydrogen atom, a substituent group A) A C _1-6 alkyl group, a C _2-6 alkenyl group which may have a substituent selected from
Z represents a group represented by _2-6 alkynyl group, C _3-6 cycloalkyl group, C _6-14 aryl group or C _7-16 aralkyl group or the acyl group shown in the above (iv)), C which may have a hand or a substituent selected from substituent group A
_1-15 alkylene group, C _2-16 alkenylene group or C _2-16
The compound according to item (1) or (3), which represents an alkynylene group; (5) the compound according to item ( ¹ ), wherein R ¹ is an amino group which may have a substituent; R ¹ represents (i) a C _1-6 alkyl group, (ii) a C _1-6 alkylthio,
_A C _6-14 aryl group which may be substituted with a substituent selected from _1-6 alkylsulfonyl and a halogen atom, or (iii) a formula — (C ＝ O) —R ^{5 ′} (where R ^{5 ′} is 1 or 2 selected from a nitrogen atom, a sulfur atom and an oxygen atom other than a _1-6 alkyl group, a C _6-14 aryl group or a carbon atom
A 5- to 14-membered heterocyclic group containing 1 to 4 heteroatoms), an amino group optionally having 1 or 2 acyl groups,
(7) R ¹ is-(C = O) -R ^{5 ″} (where R ^{5 ″} is C
_{A 6-14} aryl group or a 5- to 14-membered heterocyclic group containing 1 to 4 1 or 2 heteroatoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms)
A compound according to (1), which is an amino group optionally having one or two acyl groups represented by the formula: (8) a C _6-14 aryl group wherein R ² may have a substituent; (9) The compound according to the above (1), wherein R ² is a halogen atom or C _1-6
A C _6-14 aryl group optionally substituted with alkoxy,
Or the compound according to item (1), which is a 5- to 14-membered aromatic heterocyclic group containing 1 to 4 one or two heteroatoms selected from nitrogen, sulfur and oxygen other than carbon atoms, (10) R ² is a C _6-14 aryl group or a 5- to 14-membered heterocyclic group containing 1 to 4 one or two hetero atoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms. A compound according to item (1),
(11) The compound according to (1), wherein R ³ is a C _6-14 aryl group which may have a substituent, (12) R ³ is 1
Or the compound according to item (1), which is a C _6-14 aryl group optionally substituted with two C _1-6 alkyl or C _1-6 alkoxy, (13) X may be oxidized (14) The compound according to (1), wherein X is a sulfur atom, (15) Y is an oxygen atom or a compound of the formula NR ⁴ (where R ⁴ is (16) Y is an oxygen atom, an optionally oxidized sulfur atom, or a group represented by the formula NR ^{4 ′} (R ^{4 ′} represents a C _1-6 alkyl group)
(17) The compound according to (1), which is a group represented by the formula:
A compound according to item (1), wherein Y is O, NH or S,
(18) The compound according to (1), wherein Z is a lower alkylene group which may have a substituent, (19) C _1-6 alkylene group wherein Z may have a bond or oxo. The compound according to item (1), wherein (20) R ¹ is (i) C
_{A 1-6} alkyl group, (ii) a C _6-14 aryl group optionally substituted with a substituent selected from C _1-6 alkylthio, C _1-6 sulfonyl and a halogen atom, or (iii) a compound represented by the formula-(C
ＯO) -R ^{5 ′} (wherein R ^{5 ′} is a C _1-6 alkyl group,
_{A 6-14} aryl group or a 5- to 14-membered heterocyclic group containing 1 to 4 1 or 2 heteroatoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms)
An amino group optionally having 1 or 2 acyl groups represented by the formula: wherein R ² is a C _6-14 aryl group optionally substituted with a halogen atom or C _1-6 alkoxy, or a nitrogen atom other than a carbon atom. A 5- to 14-membered aromatic heterocyclic group containing 1 to 4 one or two heteroatoms selected from an atom, a sulfur atom and an oxygen atom; C _1-6 alkyl or C ₁ having 1 or 2 R ³ C _6-14 optionally substituted with _-6 alkoxy
An aryl group; X is a sulfur atom; Y is an oxygen atom, a sulfur atom which may be oxidized, or a group represented by the formula NR ^{4 ′} (R ^{4 ′} represents a C _1-6 alkyl group); C _1-6
A compound according to item (1), which is a C _1-6 alkylene group which may have alkyl or a bond, (21) wherein R ¹ is — (C ＝ O) —R ^{5 ″} (where R is ^{5 ″} represents a C _6-14 aryl group or a 5- to 14-membered heterocyclic group containing 1 to 4 one or two hetero atoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms) in acyl 1 or 2 having optionally may be an amino group represented; R ² is C
_{A 6-14} aryl group or a 5- to 14-membered aromatic heterocyclic group containing 1 to 4 one or two heteroatoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms; R
³ is a C _6-14 aryl group optionally substituted with 1 or 2 C _1-6 alkyl or C _1-6 alkoxy; X is a sulfur atom; Y is O, NH or S; (1) which is a C _1-6 alkylene group _optionally having oxo;
(22) N- [5- (2-benzoylamino)
-4-pyridyl) -4- (3,5-dimethylphenyl) -1,3-thiazol-2-yl] acetamide (Example compound 9), N-
[5- (2-benzylamino-4-pyridyl) -4- (3,5-dimethylphenyl) -1,3-thiazol-2-yl] acetamide (Example compound 10), N- [4- [4 -(4-Methoxyphenyl) -2-methyl-1,3-thiazol-5-yl] -2-pyridyl]
Benzamide (Example Compound 13), N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide ( Example compound 14), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide (Example compound 15-2) , N- [4-
[4- (3-methylphenyl) -2-propyl-1,3-thiazole
-5-yl] -2-pyridyl] phenylacetamide (Example compound 15-3), N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] 2-pyridyl] phenylacetamide (Example compound 15-4), N- [4-
[4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide (Example compound 15-6), N- [4- [2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Example compound 16-
1), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Example compound 16-2), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole -5-Ill]-
2-pyridyl] -3- (4-methoxyphenyl) propionamide (Example compound 16-3), N- [4- [2-ethyl-4-
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -4-phenylbutyramide (Example compound 16
-5), N- [4- [4- (3-methylphenyl) -2-propyl-
1,3-thiazol-5-yl] -2-pyridyl] benzamide (Example compound 16-7), N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazole- 5-yl] -2-pyridyl] -3-phenylpropionamide (Example compound 16
-8), N- [4- [2-butyl-4- (3-methylphenyl) -1,
3-thiazol-5-yl] -2-pyridyl] benzamide (Example compound 16-9), N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazole-5- Il] -2-pyridyl]-
3-phenylpropionamide (Example compound 16-1
0), N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Benzamide (Example compound 16-11), N- [4- [2-
(4-fluorophenyl) -4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Example compound 16-12), N- [4- [4-
(3-methylphenyl) -2- (4-methylthiophenyl) -1,
3-thiazol-5-yl] -2-pyridyl] benzamide (Example compound 16-15), N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3 -Thiazole-5-
Yl] -2-pyridyl] -3-phenylpropionamide (Example compound 16-16), N-benzyl-N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole -5-Ill]-
2-pyridyl] amine (Example compound 19-2), N- [4-
[2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridyl] -N- (2-phenylethyl) amine (Example compound 19-3), N- [4- [2-ethyl-4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Example compound 19-4), N-benzyl-N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] amine (Example compound 19-5), N- [4- [4- (3-
Methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine (Example compound 19-6), N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Example compound 19-7), N-benzyl-N -[4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Amine (Example compound 19-8), N- [4- [2-butyl-4
-(3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine (Example compound 19-9), N- [4- [2- Butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Example compound 19-10),
N-benzyl-N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine (Example compound 19- 17), N- [4- [4-
(3-methylphenyl) -2- (4-methylthiophenyl) -1,
3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine (Example compounds 19-18), N- [4-
[4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Example compound 19- 19),
N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Example compound 20), N- [4- [4-
(3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide (Example compound 21-1), N- [4- [4 -
(3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Example compound 21-2), N-benzyl -N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine (Example compound 21-5) , N- [4- [4-
(3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Example compound 21-6) , N-
[4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (2-phenylethyl) amine (Example compound 25-
1), N- (4-fluorobenzyl) -N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] amine (Example compound 25-2), (S) -N- [4- (3-methylphenyl) -5-
(2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] nicotinamide, (R) -N- [4- (3-
Methylphenyl) -5- (2- (1-phenylethylamino)-
4-pyridyl) -1,3-thiazol-2-yl] nicotinamide, (S) -N- [4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl ) -1,3-thiazole-2
-Yl] -2-methylnicotinamide, (R) -N- [4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-
Pyridyl) -1,3-thiazol-2-yl] -2-methylnicotinamide, (S) -N- [4- (3-methylphenyl) -5- (2-
(1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-chloronicotinamide, (R) -N- [4-
(3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-chloronicotinamide, (S) -N- [4 -(3-methylphenyl) -5
-(2- (1-Phenylethylamino) -4-pyridyl) -1,3-
Thiazol-2-yl] -2-methoxynicotinamide,
(R) -N- [4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-methoxynicotinamide N- [5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] nicotinamide, N- [5- (2-benzylamino- 4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] -2-methoxynicotinamide, N-
[5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] -2-chloronicotinamide, N- [5- (2-benzylamino) -4-pyridyl) -4-
(3-methylphenyl) -1,3-thiazol-2-yl] -2-methylnicotinamide, N- [5- (2-benzoylamino-4-)
Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
-Yl] nicotinamide, N- [5- (2-benzoylamino-
4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole
-2-yl] -2-methylnicotinamide, N- [5- (2-benzoylamino-4-pyridyl) -4- (3-methylphenyl) -1,3
-Thiazol-2-yl] -2-chloronicotinamide, N- [5
-(2-benzoylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] -2-methoxynicotinamide, (S) -N- (1-phenylethyl) -4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl]-
2-pyridylamine, (R) -N- (1-phenylethyl) -4-
[2-ethyl-4- (3-methylphenyl) -1,3-thiazole-5
-Yl] -2-pyridylamine, (S) -N- (1-phenylethyl) -4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2 -Pyridylamine, (R) -N- (1-phenylethyl) -4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridylamine, ( S)
-N- (1-phenylethyl) -4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (R) -N- (1 -Phenylethyl) -4- [2-butyl-4-
(3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (S) -N- (1-phenylethyl) -4- [4-
(3-methylphenyl) -2- (4-methylthiophenyl) -1,
3-thiazol-5-yl] -2-pyridylamine, (R) -N-
(1-phenylethyl) -4- [4- (3-methylphenyl) -2-
(4-methylthiophenyl) -1,3-thiazol-5-yl] -2
-Pyridylamine, (S) -N- (1-phenylethyl) -4-
[4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (R) -N- (1-phenylethyl) -4 -[4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (S) -N- (1-phenylethyl)- 4- [2- (4-fluorophenyl) -4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (R) -N- (1-phenylethyl) -4- [2- (4-
Fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine or a salt thereof, (2
3) a prodrug of the compound described in (1), (24)
(I) Formula

Embedded image [Wherein Hal represents a halogen atom, and the other symbols represent the (1)
Or a salt thereof, and a compound represented by the formula R ¹ -CSNH ₂ (VIII) wherein R ¹ has the same meaning as described in the above item (1). Or reacting with the salt

Embedded image Wherein each symbol is as defined in the item (1) or a salt thereof, or (ii)

Embedded image [Hal represents a halogen atom, and other symbols have the same meanings as described in item (1)] or a salt thereof and a compound represented by the formula R ² -Z-YH (XI) [wherein each symbol is Having the same meaning as described in item (1)] or a salt thereof.

Embedded image Wherein each symbol is as defined in the item (1) or a salt thereof, or (iii)

Embedded image [Wherein each symbol has the same meaning as described in the above item (1)] or a salt thereof and a compound represented by the formula R ² -ZL (XVIII) [wherein L represents a leaving group, and other symbols Has the same meaning as described in item (1)], or a salt thereof.

Embedded image Wherein each symbol is as defined in the item (1) or a salt thereof, or (iv)

Embedded image Wherein each symbol is as defined in the above item (1) or a salt thereof with a peracid, hydrogen peroxide or alkyl hydroperoxide.

Embedded image (Wherein each symbol is as defined in the item (1)) or a salt thereof, a process for producing the compound according to the item (1), wherein (25) A pharmaceutical composition comprising the compound according to item (1) or a prodrug thereof, (26) a composition according to item (25), which is an adenosine A ₃ receptor antagonist, and (27) adenosine. (25) which is a prophylactic / therapeutic agent for A ₃ receptor-related diseases
(28) The composition according to (25), which is a prophylactic / therapeutic agent for asthma or allergic disease, (29) The composition (25), which is a prophylactic / therapeutic agent for cerebral edema, cerebrovascular disorder or head injury. 25) The composition according to item (25), (30) the composition according to item (25), which is a p38 MAP kinase inhibitor, (31) T
The composition according to (25), which is an NF-α production inhibitor,
(32) No. (2) which is a preventive / therapeutic agent for cytokine-mediated diseases
The composition according to 5), and (33) inflammation, Addison's disease, autoimmune hemolytic anemia, Crohn's disease, psoriasis, rheumatism, spinal cord injury, cerebral edema, multiple sclerosis, Alzheimer's disease, Parkinson's disease, and muscle atrophy Lateral sclerosis, diabetes,
Arthritis, toxicemia, Crohn's disease, ulcerative colitis, chronic pneumonia, silicosis, pulmonary sarcoidosis, pulmonary tuberculosis, cachexia, arteriosclerosis, Creutzfeldt-Jakob disease, viral infection,
A preventive / therapeutic agent for atopic dermatitis, systemic erythematosus, AIDS encephalopathy, meningitis, angina pectoris, myocardial infarction, congestive heart failure, hepatitis, transplantation, dialysis hypotension or generalized intravascular coagulation syndrome A composition according to certain (25).

Further, according to the present invention, (34) R ¹ has the formula:-(C
^{= O) -R 5, - (} C = O) -OR 5, - (C = O) -NR 5 R
⁶ , one or two acyls represented by-(C = S) -NHR ⁵ or -SO ₂ -R ⁷ wherein each symbol is as defined in the item (4). (35) The compound according to (1), wherein R ¹ is a C _1-6 alkyl group which may have a substituent,
(36) The compound described in (1), wherein R ¹ is a C _6-14 aryl group optionally having a C _1-6 alkylsulfonyl group, and (37) R ^{5 ″} is a phenyl group or a pyridyl group. The compound according to item (7), which is: (38) R ² is one or two selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a C _6-14 aryl group which may have a substituent or a carbon atom which may have a substituent. 1 to 4 heteroatoms
(1) which is a 5- to 14-membered aromatic heterocyclic group containing
(39) The compound according to (1), wherein R ² is a phenyl group or a pyridyl group, and (40) R ³ is one or two C _1-6 alkyl or C _1-6 alkoxy. (41) The compound according to (1), which is an optionally substituted phenyl group, (41) a compound which may be N-oxidized with respect to a mammal.

Embedded image [Wherein, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group or an acyl group which may have a substituent. R ² represents an aromatic group which may have a substituent, R ³ represents a hydrogen atom,
A pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X is an oxygen atom or a sulfur atom which may be oxidized, Y is a bond, an oxygen atom A group represented by an optionally oxidized sulfur atom or a formula NR ⁴ (wherein R ⁴ represents a hydrogen atom, a hydrocarbon group which may have a substituent or an acyl group), and Z Represents a bond or a divalent chain hydrocarbon group which may have a substituent. Adenosine A ₃ receptor antagonism method comprising administering an effective amount of a compound represented by the formula (I) or a salt thereof or a prodrug thereof: (42) a method which may be N-oxidized with respect to a mammal;

Embedded image [Wherein, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group or an acyl group which may have a substituent. R ² represents an aromatic group which may have a substituent, R ³ represents a hydrogen atom,
A pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X is an oxygen atom or a sulfur atom which may be oxidized, Y is a bond, an oxygen atom A group represented by an optionally oxidized sulfur atom or a formula NR ⁴ (wherein R ⁴ represents a hydrogen atom, a hydrocarbon group which may have a substituent or an acyl group), and Z Represents a bond or a divalent chain hydrocarbon group which may have a substituent. P3 characterized by administering an effective amount of a compound represented by the formula (I) or a salt thereof or a prodrug thereof:
8MAP kinase inhibition method, (43) a formula which may be N-oxidized to a mammal

Embedded image[Wherein, R¹Is a hydrogen atom, a carbon which may have a substituent
Hydride group, heterocyclic group which may have a substituent, substituent
An amino group or an acyl group which may have^TwoIs
The aromatic group which may have a substituent is represented by R^ThreeIs a hydrogen atom,
Having a pyridyl group or a substituent which may have a substituent;
X represents an oxygen atom or an acid,
Y may be a bond, an oxygen atom
, An optionally oxidized sulfur atom or the formula NR^Four(formula
Medium, R ^FourIs a hydrogen atom or a hydrocarbon which may have a substituent
And Z represents a group represented by
Divalent chain hydrocarbons optionally having joints or substituents
Represents an elementary group. Or a salt thereof, or a compound thereof
Comprising administering an effective amount of a prodrug of
F-α production inhibition method, (44) N-
Formula which may be oxidized

Embedded image [Wherein, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group or an acyl group which may have a substituent. R ² represents an aromatic group which may have a substituent, R ³ represents a hydrogen atom,
A pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X is an oxygen atom or a sulfur atom which may be oxidized, Y is a bond, an oxygen atom A group represented by an optionally oxidized sulfur atom or a formula NR ⁴ (wherein R ⁴ represents a hydrogen atom, a hydrocarbon group which may have a substituent or an acyl group), and Z Represents a bond or a divalent chain hydrocarbon group which may have a substituent. Asthma, allergic diseases, inflammation, Addison's disease, autoimmune hemolytic anemia, Crohn's disease, psoriasis, rheumatism, cerebral hemorrhage, brain characterized by administering an effective amount of a compound represented by the formula (I) or a salt thereof or a prodrug thereof. Infarction, head trauma, spinal cord injury, brain edema, multiple sclerosis, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, diabetes, arthritis, toxicemia, Crohn's disease, ulcerative colitis, chronic pneumonia, Silicosis, pulmonary sarcoidosis, pulmonary tuberculosis, cachexia, arteriosclerosis, Creutzfeldt-Jakob disease, viral infection, atopic dermatitis, systemic lupus erythematosus, AIDS encephalopathy, meningitis, angina, myocardial infarction, congestion sex heart failure, hepatitis, transplantation, prevention and treatment methods of the dialysis hypotension or disseminated intravascular coagulation, (45) adenosine a ₃ receptor antagonists of for the preparation of N- Oki De of which may be the formula

Embedded image [Wherein, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group or an acyl group which may have a substituent. R ² represents an aromatic group which may have a substituent, R ³ represents a hydrogen atom,
A pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X is an oxygen atom or a sulfur atom which may be oxidized, Y is a bond, an oxygen atom A group represented by an optionally oxidized sulfur atom or a formula NR ⁴ (wherein R ⁴ represents a hydrogen atom, a hydrocarbon group which may have a substituent or an acyl group), and Z Represents a bond or a divalent chain hydrocarbon group which may have a substituent. (46) Use of a compound which may be N-oxidized for producing a p38 MAP kinase inhibitor,

Embedded image [Wherein, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group or an acyl group which may have a substituent. R ² represents an aromatic group which may have a substituent, R ³ represents a hydrogen atom,
A pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X is an oxygen atom or a sulfur atom which may be oxidized, Y is a bond, an oxygen atom A group represented by an optionally oxidized sulfur atom or a formula NR ⁴ (wherein R ⁴ represents a hydrogen atom, a hydrocarbon group which may have a substituent or an acyl group), and Z Represents a bond or a divalent chain hydrocarbon group which may have a substituent. (47) an optionally N-oxidized formula for producing a TNF-α production inhibitor;

Embedded image [Wherein, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group or an acyl group which may have a substituent. R ² represents an aromatic group which may have a substituent, R ³ represents a hydrogen atom,
A pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X is an oxygen atom or a sulfur atom which may be oxidized, Y is a bond, an oxygen atom A group represented by an optionally oxidized sulfur atom or a formula NR ⁴ (wherein R ⁴ represents a hydrogen atom, a hydrocarbon group which may have a substituent or an acyl group), and Z Represents a bond or a divalent chain hydrocarbon group which may have a substituent. And (48) asthma, allergic diseases, inflammation, Addison's disease, autoimmune hemolytic anemia, Crohn's disease, psoriasis, rheumatism, cerebral hemorrhage, cerebral infarction, and head. Head trauma, spinal cord injury, cerebral edema, multiple sclerosis, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, diabetes, arthritis, toxicemia, Crohn's disease, ulcerative colitis, chronic pneumonia,
Silicosis, pulmonary sarcoidosis, pulmonary tuberculosis, cachexia, arteriosclerosis, Creutzfeldt-Jakob disease, viral infection, atopic dermatitis, systemic erythematosus, AIDS encephalopathy,
Prevention of meningitis, angina pectoris, myocardial infarction, congestive heart failure, hepatitis, transplantation, dialysis hypotension or generalized intravascular coagulation
An optionally N-oxidized formula for producing a therapeutic agent

Embedded image [Wherein, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group or an acyl group which may have a substituent. R ² represents an aromatic group which may have a substituent, R ³ represents a hydrogen atom,
A pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X is an oxygen atom or a sulfur atom which may be oxidized, Y is a bond, an oxygen atom A group represented by an optionally oxidized sulfur atom or a formula NR ⁴ (wherein R ⁴ represents a hydrogen atom, a hydrocarbon group which may have a substituent or an acyl group), and Z Represents a bond or a divalent chain hydrocarbon group which may have a substituent. ] Or a salt thereof or a prodrug thereof.

In the above formula, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, and an amino group which may have a substituent Or an acyl group. As the “acyl group” represented by R ¹ , for example, a group represented by the formula: — (C ＝ O) —R ⁵ , — (C ＝ O) —OR ⁵ , and — (C =
^{O) -NR 5 R 6, -} (C = S) -NHR 5 or -SO ₂ -R
⁷ [In the formula, R ⁵ is a hydrogen atom, a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent, R ⁶
_{Represents a} hydrogen atom or a C _1-6 alkyl group, R ⁷ represents a hydrocarbon group which may have a substituent or a heterocyclic group which may have a substituent. No. In the above formula, examples of the “hydrocarbon group” of the “hydrocarbon group which may have a substituent” represented by R ⁵ include a chain or cyclic hydrocarbon group (eg, alkyl, alkenyl, alkynyl, Cycloalkyl, aryl, aralkyl and the like). Among them, a chain or cyclic hydrocarbon group having 1 to 16 carbon atoms is preferable. “Alkyl” includes, for example, C _1-6 alkyl (eg, methyl, ethyl,
Propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, etc.) and the like, particularly C _1-3 alkyl (eg, methyl, ethyl,
Propyl, isopropyl) are preferred. "Alkenyl"
As C _2-6 alkenyl (eg, vinyl,
Allyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl, 2-methyl-2-propenyl, 1-
Methyl-2-propenyl, 2-methyl-1-propenyl, etc.) and the like. “Alkynyl” includes, for example, C
_2-6 alkynyl (eg, ethynyl, propargyl, 1
-Butynyl, 2-butynyl, 3-butynyl, 1-hexynyl and the like) and the like. As “cycloalkyl”,
For example, C _3-6 cycloalkyl (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.) and the like are preferable. “Aryl” includes, for example, C
_6-14 aryl (eg, phenyl, 1-naphthyl, 2-
Naphthyl, 2-biphenylyl, 3-biphenylyl, 4-
Biphenylyl, 2-anthryl, etc.) and the like. As the “aralkyl”, for example, C _7-16 aralkyl (eg, benzyl, phenethyl, diphenylmethyl, 1-naphthylmethyl, 2-naphthylmethyl, 2,2-diphenylethyl, 3-phenylpropyl, 4-phenylbutyl, -Phenylpentyl and the like).

As the “substituent” of the “optionally substituted hydrocarbon group” for R ⁵ , for example, oxo,
Halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.),
C _1-3 alkylenedioxy (eg, methylenedioxy, ethylenedioxy, etc.), nitro, cyano, optionally halogenated C _1-6 alkyl, optionally halogenated C _2-6 alkenyl, Carboxy C _2-6 alkenyl (eg, 2-carboxyethenyl, 2-carboxy-2-
Methylethenyl, etc.), optionally halogenated C
_2-6 alkynyl, optionally halogenated C _3-6 cycloalkyl, C _6-14 aryl (eg, phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2 -Anthryl, etc.), optionally halogenated C _1-8 alkoxy, C _1-6 alkoxy-carbonyl-C _1-6 alkoxy (eg, ethoxycarbonylmethyloxy, etc.), hydroxy, C _6-14 aryloxy ( For example, phenyloxy, 1-naphthyloxy, 2
-Naphthyloxy, etc.), C _7-16 aralkyloxy (eg, benzyloxy, phenethyloxy, etc.), mercapto, optionally halogenated C _1-6 alkylthio,
C _6-14 arylthio (eg, phenylthio, 1-naphthylthio, 2-naphthylthio, etc.), C _7-16 aralkylthio (eg, benzylthio, phenethylthio, etc.), amino, mono-C _1-6 alkylamino (eg, methyl amino,
Ethyl-amino), mono-C _6-14 arylamino (eg,
Phenylamino, 1-naphthylamino, 2-naphthylamino, etc.), di-C _1-6 alkylamino (eg, dimethylamino, diethylamino, ethylmethylamino, etc.), di-
C _6-14 arylamino (eg, diphenylamino etc.), formyl, carboxy, C _1-6 alkyl-carbonyl (eg, acetyl, propionyl, etc.), C _3-6 cycloalkyl-carbonyl (eg, cyclopropylcarbonyl, cyclopentyl) Carbonyl, cyclohexylcarbonyl, etc.), C _1-6 alkoxy-carbonyl (eg, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl, tert-butoxycarbonyl, etc.), C _6-14 aryl-
Carbonyl (eg, benzoyl, 1-naphthoyl, 2-naphthoyl, etc.), C _7-16 aralkyl-carbonyl (eg, phenylacetyl, 3-phenylpropionyl, etc.), C
_6-14 aryloxy-carbonyl (eg, phenoxycarbonyl, etc.), C _7-16 aralkyloxy-carbonyl (eg, benzyloxycarbonyl, phenethyloxycarbonyl, etc.), 5- or 6-membered heterocyclic carbonyl (eg, nicotinoyl, isonicotinoyl, Thenoyl, furoyl, morpholinocarbonyl, thiomorpholinocarbonyl, piperazin-1-ylcarbonyl, pyrrolidin-1-ylcarbonyl, etc.), carbamoyl, thiocarbamoyl, mono-C _1-6 alkyl-carbamoyl (eg, methylcarbamoyl, ethylcarbamoyl, etc.) ), Di-C _1-6 alkyl-
Carbamoyl (eg, dimethylcarbamoyl, diethylcarbamoyl, ethylmethylcarbamoyl, etc.), C _6-14 aryl-carbamoyl (eg, phenylcarbamoyl, 1
-Naphthylcarbamoyl, 2-naphthylcarbamoyl, etc.) or 5- or 6-membered heterocyclic carbamoyl (eg, 2-pyridylcarbamoyl, 3-pyridylcarbamoyl, 4-pyridylcarbamoyl, 2-thienylcarbamoyl, 3-thienylcarbamoyl, etc.), C _{1 -6} alkylsulfonyl (eg, methylsulfonyl, ethylsulfonyl, etc.), C
_6-14 arylsulfonyl (eg, phenylsulfonyl, 1
-Naphthylsulfonyl, 2-naphthylsulfonyl, etc.),
C _1-6 alkylsulfinyl (eg, methylsulfinyl, ethylsulfinyl, etc.), C _6-14 arylsulfinyl (eg, phenylsulfinyl, 1-naphthylsulfinyl, 2-naphthylsulfinyl, etc.), formylamino, C _1-6 alkyl- Carbonylamino (eg, acetylamino, etc.), C _6-14 aryl-carbonylamino (eg,
Benzoylamino, naphthoylamino etc.), C _1-6 alkoxy - carbonyl amino (e.g., methoxycarbonylamino, ethoxycarbonylamino, propoxycarbonylamino, butoxycarbonylamino, etc.), C _1-6 alkylsulfonylamino (e.g., methylsulfonyl amino,
Ethylsulfonylamino, etc.), C _6-14 arylsulfonylamino (eg, phenylsulfonylamino, 2-naphthylsulfonylamino, 1-naphthylsulfonylamino, etc.), C _1-6 alkyl-carbonyloxy (eg, acetoxy, propionyloxy, etc.) ), C _6-14 aryl-carbonyloxy (eg, benzoyloxy, naphthylcarbonyloxy, etc.), C _1-6 alkoxy-carbonyloxy (eg, methoxycarbonyloxy, ethoxycarbonyloxy, propoxycarbonyloxy, butoxycarbonyloxy, etc.) Mono-C _1-6 alkyl-carbamoyloxy (eg, methylcarbamoyloxy, ethylcarbamoyloxy, etc.), di-C _1-6 alkyl-carbamoyloxy (eg, dimethylcarbamoyloxy, diethylcarbamoyloxy, etc.), C _{6 -14} aryl-carbamoyloxy (eg, phenylcarbamoyloxy, naphthylcarbamoyloxy, etc.), nicotinoyloxy, an optionally substituted 5- to 7-membered saturated cyclic amino, 5- to 10-membered aromatic heterocyclic group ( For example, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl,
-Quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl , 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl, 3-benzo [b] furanyl, etc.), sulfo, sulfamoyl, sulfinamoyl, sulfenamoyl and the like.

The "hydrocarbon group" may have, for example, 1 to 5, preferably 1 to 3 of the above substituents at substitutable positions, and when the number of the substituents is 2 or more,
Each substituent may be the same or different. Examples of the “optionally halogenated C _1-6 alkyl” include, for example, 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.). C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl,
tert-butyl, pentyl, hexyl, etc.). Specific examples include methyl, chloromethyl, difluoromethyl, trichloromethyl, trifluoromethyl, ethyl, 2-bromoethyl, 2,2,2-trifluoroethyl, pentafluoroethyl, propyl, 3,3,3-
Trifluoropropyl, isopropyl, butyl, 4,
4,4-trifluorobutyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, 5,5,5-trifluoropentyl, hexyl,
6,6,6-trifluorohexyl and the like. Examples of the “optionally halogenated C _2-6 alkenyl” include 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.)
C _2-6 alkenyl (eg, vinyl, propenyl, isopropenyl, 2-buten-1-yl, 4
-Penten-1-yl, 5-hexen-1-yl) and the like. The above-mentioned “optionally halogenated C _2-6
As the “alkynyl”, for example, C _2-6 alkynyl (eg, 2-butyne) optionally having 1 to 5, preferably 1 to 3 halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.) -1-yl, 4-pentyn-1-yl, 5-hexyn-1-yl and the like). The aforementioned “optionally halogenated C _3-6 cycloalkyl”
Is, for example, 1 to 5, preferably 1 to 3
And C _3-6 cycloalkyl (eg, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc.) which may have one halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.). Specific examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 4,4-dichlorocyclohexyl, 2,2,3,
3-tetrafluorocyclopentyl, 4-chlorocyclohexyl and the like. Examples of the “optionally halogenated C _1-8 alkoxy” include, for example, 1 to 5
Number, preferably 1 to 3 halogen atoms (e.g., fluorine, chlorine, bromine, iodine, etc.) optionally C _1-8 also have a
Alkoxy (eg, methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy, etc.). Specific examples include, for example, methoxy, difluoromethoxy, trifluoromethoxy, ethoxy, 2,2,2-
Trifluoroethoxy, propoxy, isopropoxy,
Butoxy, 4,4,4-trifluorobutoxy, isobutoxy, sec-butoxy, pentyloxy, hexyloxy and the like. Examples of the “optionally halogenated C _1-6 alkylthio” include 1 to 5,
Preferably one to three halogen atoms (eg, fluorine,
C _1-6 alkylthio optionally having chlorine, bromine, iodine, etc. (eg, methylthio, ethylthio, propylthio, isopropylthio, butylthio, sec-butylthio,
tert-butylthio, etc.). Specific examples include methylthio, difluoromethylthio, trifluoromethylthio, ethylthio, propylthio, isopropylthio, butylthio, 4,4,4-trifluorobutylthio, pentylthio, hexylthio and the like.

As the "5- to 7-membered saturated cyclic amino" of the "5- to 7-membered saturated cyclic amino optionally having substituent (s)", for example, in addition to one nitrogen atom and a carbon atom, a nitrogen atom , Which may contain 1 to 4 heteroatoms selected from the group consisting of sulfur atoms and oxygen atoms.
And 7-membered saturated cyclic amino, and specific examples include pyrrolidin-1-yl, piperidino, piperazine-
1-yl, morpholino, thiomorpholino, hexahydroazepin-1-yl and the like. Examples of the “substituent” of the “optionally substituted 5- to 7-membered saturated cyclic amino” include C _1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl,
sec-butyl, tert-butyl, pentyl, hexyl, etc.),
C _6-14 aryl (eg, phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl, 2-anthryl, etc.), C _1-6 alkyl-carbonyl (eg, acetyl, propionyl, etc.) ) 5- to 10-membered aromatic heterocyclic group (eg, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-
Quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl, 3-benzo [b] furanyl and the like, and 1 to 3 oxo.

The "heterocyclic group" of the "heterocyclic group optionally having substituent (s)" for R ⁵ includes, for example, one or more selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms. 5 to 1 containing 1 to 4 heteroatoms of 2 types
4-membered (monocyclic, bicyclic or tricyclic) heterocycles, preferably (i) 5- to 14-membered (preferably 5- to 10-membered, particularly preferably 5- to 6-membered) aromatic heterocycles; A 10-membered (preferably 5- to 6-membered) non-aromatic heterocyclic ring or (iii) a 7- to 10-membered bridged heterocyclic ring,
And a monovalent group formed by removing two hydrogen atoms. Examples of the above “5- to 14-membered (preferably 5- to 10-membered) aromatic heterocycle” include, for example, thiophene, benzo [b] thiophene, benzo [b] furan, benzimidazole, benzoxazole, benzothiazole, benziso Thiazole, naphtho [2,3-b] thiophene,
Furan, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indole,
Isoindole, 1H-indazole, purine, 4H-
Quinolidine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline,
Carbazole, β-carboline, phenanthridine, acridine, phenazine, thiazole, isothiazole,
An aromatic heterocyclic ring such as phenothiazine, isoxazole, furazane, phenoxazine, or one or more (preferably one or two) aromatic rings (preferably one or two) of these rings (preferably one or two); And a ring formed by condensation. The above “5- to 10-membered non-aromatic heterocycle”
Examples include pyrrolidine, imidazoline, pyrazolidine, pyrazoline, piperidine, piperazine, morpholine, thiomorpholine, dioxazole, oxadiazoline, thiadiazoline, triazoline, thiadiazole, dithiazole and the like. The above “7 to 10
As the "membered heterocyclic ring", for example, quinuclidine, 7-
Azabicyclo [2.2.1] heptane and the like.

The "heterocyclic group" is preferably a 5- to 14-membered (preferably 1 to 4 heteroatom selected from a nitrogen atom, a sulfur atom and an oxygen atom, other than a carbon atom, which preferably contains 1 to 4 heteroatoms). Is a 5- to 10-membered) (monocyclic or bicyclic) heterocyclic group. Specifically, for example, 2
-Thienyl, 3-thienyl, 2-furyl, 3-furyl,
2-pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 8
-Quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4
-Isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-
Pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2-
Imidazolyl, 3-pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1-indolyl, 2-indolyl, 3-indolyl, 2-benzothiazolyl, 2-
Benzo [b] thienyl, 3-benzo [b] thienyl, 2
Aromatic heterocyclic groups such as -benzo [b] furanyl and 3-benzo [b] furanyl; for example, 1-pyrrolidinyl, 2-pyrrolidinyl, 3-pyrrolidinyl, 2-imidazolinyl,
Non-aromatic heterocyclic groups such as -imidazolinyl, 2-pyrazolidinyl, 3-pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2-piperidyl, 3-piperidyl, 4-piperidyl, 1-piperazinyl, 2-piperazinyl, morpholino, thiomorpholino and the like; It is. Among them, for example, a 5- or 6-membered heterocyclic group containing 1 to 3 hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom is more preferable. Specifically, 2-thienyl, 3-
Thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-furyl, 3-furyl, pyrazinyl, 2-pyrimidinyl, 3-pyrrolyl, 3-pyridazinyl, 3-isothiazolyl, 3-isoxazolyl, 1-pyrrolidinyl,
2-pyrrolidinyl, 3-pyrrolidinyl, 2-imidazolinyl, 4-imidazolinyl, 2-pyrazolidinyl, 3-
Pyrazolidinyl, 4-pyrazolidinyl, piperidino, 2
-Piperidyl, 3-piperidyl, 4-piperidyl, 1-
Piperazinyl, 2-piperazinyl, morpholino, thiomorpholino and the like. As the "substituent" of the "heterocyclic group which may have a substituent", for example, the represented by R ⁵ in the "optionally substituted hydrocarbon group" as "substituent" The same thing is mentioned. The “heterocyclic group” may have, for example, 1 to 5, preferably 1 to 3 of the above substituents at substitutable positions. When the number of substituents is 2 or more, each substituent is They may be the same or different.

The "C _1-6 alkyl" represented by R ⁶ includes, for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl,
Pentyl, hexyl and the like can be mentioned. As "optionally substituted hydrocarbon group" and "optionally substituted heterocyclic group" represented by R ^7, for example wherein R
⁵ "optionally substituted hydrocarbon group"
And "heterocyclic group optionally having substituent (s)", respectively. As "substituent hydrocarbon group which may have a" and "an optionally substituted heterocyclic group" represented by R ^1, for example, a "substituent represented by R ⁵ A hydrocarbon group which may be substituted "and a" heterocyclic group which may have a substituent ". Examples of the “amino group optionally having substituent (s)” represented by R ¹ include (1) an amino group optionally having one or two substituents and (2) an amino group having one or more substituents. And a cyclic amino group which may be used. Examples of the “substituent” of the “amino group optionally having one or two substituents” in the above (1) include, for example, a hydrocarbon group optionally having a substituent, And an optionally substituted heterocyclic group, an acyl group, and an optionally substituted alkylidene group. Examples of the “optionally substituted hydrocarbon group” and the “optionally substituted heterocyclic group” include the “optionally substituted hydrocarbon group” for R ^5. The same groups as the "hydrogen group" and the "heterocyclic group optionally having substituent (s)" can be exemplified. As the “acyl group”, those similar to the “acyl group” for R ¹ can be mentioned. Examples of the “alkylidene group” of the “alkylidene group optionally having substituent (s)” include, for example, a C _1-6 alkylidene group (eg, methylidene, ethylidene, propylidene, etc.). Examples of the "substituent" of the "alkylidene group optionally having a substituent" represented by the above-described R ⁵ in "optionally substituted hydrocarbon group" similar to the "substituent" And 1 to 5, preferably 1 to 3. When the number of the “substituents” in the “amino group optionally having one or two substituents” is two, the respective substituents may be the same or different.

As the "cyclic amino group" of the "cyclic amino group optionally having substituent (s)" in the above (2), in addition to one nitrogen atom and carbon atom, nitrogen atom, sulfur atom and oxygen atom One or two heteroatoms selected from 1 to 4
And a 5- to 7-membered non-aromatic cyclic amino group which may be contained, and specific examples thereof include pyrrolidin-1-yl,
Piperidino, piperazin-1-yl, morpholino, thiomorpholino, hexahydroazepin-1-yl, imidazolidine-1-yl, 2,3-dihydro-1H-imidazol-1-yl, tetrahydro-1 (2H) -pyrimidinyl , 3,6-dihydro-1 (2H) -pyrimidinyl, 3,4-dihydro-1 (2H) -pyrimidinyl and the like. "Cyclic amino optionally having substituent (s)"
Examples of the “substituent” include, for example, the “substituent” of the “optionally substituted hydrocarbon group” represented by R ⁵
5 to 7 which may have a substituent
And the like as the “substituent” of the “membered saturated cyclic amino group”
Or three. Specific examples of the 5- to 7-membered non-aromatic cyclic amino group having one oxo include 2-oxoimidazolidin-1-yl, 2-oxo-2,3-dihydro-1H-imidazol-1-yl, 2-oxotetrahydro-1 (2H) -pyrimidinyl, 2-oxo-
3,6-dihydro-1 (2H) -pyrimidinyl, 2-oxo-3,4-dihydro-1 (2H) -pyrimidinyl,
2-oxopyrrolidin-1-yl, 2-oxopiperidino, 2-oxopiperazin-1-yl, 3-oxopiperazin-1-yl, 2-oxo-2,3,4,5,6,7-
Hexahydroazepin-1-yl and the like.

As R ¹ , an amino group which may have a substituent, an aryl group which may have a substituent, an alkyl group which may have a substituent and the like are preferable. More preferably as the "optionally substituted amino group", the formula ^{:-( C = O) -R 5,} - (C = O) -OR 5, -
^{(C = O) -NR 5 R} 6, - (C = S) -NHR 5 or -SO ₂
—R ⁷ is an amino group optionally having one or two acyl groups represented by the formula: wherein each symbol is as defined above. Particularly preferably, the formula :-( C = O) -R ⁵ or - (C
ＯO) —NR ⁵ R ⁶ [wherein each symbol has the same meaning as described above], and is an amino group which may have one or two acyl groups. The “aryl group optionally having substituent (s)” is preferably, for example, C _1-6 alkylthio, C
_6-14 arylthio, C _1-6 alkylsulfinyl, C
_6-14 arylsulfinyl, C _1-6 alkylsulfonyl, C _6-14 arylsulfonyl 1 substituent selected from sulfonyl and carboxyl like to five optionally having C _6-14 aryl group (preferably phenyl, etc.) And so on. As the `` alkyl group optionally having substituent (s) '', preferably,
For example, a halogen atom, C _1-6 alkoxy, hydroxy,
C-substituted and optionally substituted by 1 to 3 substituents selected from carboxy and C _1-6 alkoxy-carbonyl, etc.
_{A 1-6} alkyl group (eg, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, etc.) is preferred, and particularly a C such as methyl, ethyl, etc.
_1-3 alkyl groups are preferred. Above all, as R ¹ ,
(I) C _1-6 alkyl group (eg, C _1-4 alkyl group such as methyl, ethyl, propyl, butyl, etc.), (ii) C _1-6 alkylthio (eg, methylthio), C _1-6 alkylsulfonyl ( E.g., methylsulfonyl) and halogen atoms (e.g.,
A chlorine atom, a fluorine atom), a C _6-14 aryl group (eg, a phenyl group) which may be substituted with a substituent selected from the group _{consisting of:} (iii) a compound represented by the formula — (C ＝ O) —R ^{5 ′ 5 ′} is a C _1-6 alkyl group (eg, a C _1-3 alkyl group such as methyl);
_6-14 aryl group (eg, phenyl group) or 5- to 14-membered heterocyclic group containing 1 to 4 one or two hetero atoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atom (eg, And a 5- or 6-membered heterocyclic group containing one or two heteroatoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms such as pyridyl groups)]
And an amino group optionally having one or two acyl groups represented by As R ^{5 ′} and R ^{5 ″} , a phenyl group or a pyridyl group is preferable.

In the above formula, R ² represents an aromatic group which may have a substituent. The “aromatic group” of the “aromatic group optionally having substituent (s)” for R ² includes, for example, an aromatic hydrocarbon group and an aromatic heterocyclic group. Examples of the "aromatic hydrocarbon group" include a monocyclic or condensed polycyclic (bi- or tricyclic) aromatic hydrocarbon group having 6 to 14 carbon atoms. Specific examples thereof include C _6-14 aryl such as phenyl, 1-naphthyl, 2-naphthyl, 2-biphenylyl, 3-biphenylyl, 4-biphenylyl and 2-anthryl, and preferably C _6-10 aryl and the like (for example, Phenyl, 1-naphthyl, 2-naphthyl and the like, preferably phenyl and the like). The “aromatic heterocyclic group” is a 5- to 14-membered (preferably 5- to 10-membered) containing 1 to 4 one or two heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom. A) a monovalent group formed by removing any one hydrogen atom from an aromatic heterocyclic ring; Examples of the above “5- to 14-membered (preferably 5- to 10-membered) aromatic heterocycle” include, for example, thiophene, benzo [b] thiophene, benzo [b] furan, benzimidazole, benzoxazole, benzothiazole, benziso Thiazole, naphtho [2,3-b] thiophene, furan, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indole, isoindole, 1H
-Indazole, purine, 4H-quinolidine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline, carbazole, β-carboline, phenanthridine, acridine, phenazine, thiazole, isothiazole, phenothiazine, isoxazole, furazane, phenoxy A ring formed by condensing an aromatic heterocyclic ring such as sagin or the like (preferably a single ring) with one or more (preferably one or two) aromatic rings (eg, a benzene ring or the like) Is mentioned. The “aromatic heterocyclic group” is preferably one or two selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom.
5 to 14 (preferably 5 to 10 membered) (monocyclic or 2 ring) containing preferably 1 to 4 heteroatoms
Cyclic) aromatic heterocyclic group and the like, specifically, for example, 2-thienyl, 3-thienyl, 2-furyl, 3-furyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-quinolyl,
3-quinolyl, 4-quinolyl, 5-quinolyl, 8-quinolyl, 1-isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, pyrazinyl, 2-pyrimidinyl, 4-pyrimidinyl, 3-pyrrolyl, 2-imidazolyl, 3-pyridazinyl, 3-isothiazolyl, 3-
Isoxazolyl, 1-indolyl, 2-indolyl,
Examples include aromatic heterocyclic groups such as 3-indolyl, 2-benzothiazolyl, 2-benzo [b] thienyl, 3-benzo [b] thienyl, 2-benzo [b] furanyl, and 3-benzo [b] furanyl. As the "substituent" of the "aromatic group which may have a substituent", for example, the represented by R ⁵ in the "optionally substituted hydrocarbon group" as "substituent" 1 to 5, preferably 1
Or three. When the number of substituents is two or more, each substituent may be the same or different.

As R ² , other than (1) a C _6-14 aryl group which may have a substituent or (2) a carbon atom which may have a substituent, a nitrogen atom, a sulfur atom and an oxygen A 5- to 14-membered aromatic heterocyclic group containing 1 to 4 one or two hetero atoms selected from atoms is preferable, and among them, (1) a halogen atom (eg, a chlorine atom, a fluorine atom)
Or a C _6-14 aryl group (eg, phenyl group, naphthyl group) which may be substituted with C _1-6 alkoxy (eg, methoxy), (2) a nitrogen atom, sulfur atom and oxygen atom other than carbon atom A 5- to 14-membered aromatic heterocyclic group containing 1 to 4 selected one or two hetero atoms (eg, a nitrogen atom other than a carbon atom such as a pyridyl group and a thienyl group,
A 5- or 6-membered aromatic heterocyclic group containing 1 or 2 heteroatoms selected from a sulfur atom and an oxygen atom) are preferable, and a phenyl group and a pyridyl group are particularly preferable.

In the above formula, R ³ represents a hydrogen atom, a pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent. As the “substituent” of the “pyridyl group optionally having substituent (s)” for R ³ , for example, the “substituent” for the “hydrocarbon group optionally having substituent (s)” for the above-mentioned R ⁵ And the like. The “pyridyl group” may have, for example, 1 to 5, preferably 1 to 3 of the above substituents at substitutable positions. When the number of the substituents is 2 or more, each substituent is the same. Or it may be different. Further, the nitrogen atom in the ring of the “pyridyl group” may be N-oxidized. The “aromatic hydrocarbon group” of the “aromatic hydrocarbon group optionally having substituent (s)” for R ^{3 includes} the “aromatic hydrocarbon group optionally having substituent (s)” for R ² described above. And the like as the "aromatic hydrocarbon group" of the "group", and preferably, for example, phenyl, 1-naphthyl, 2-naphthyl, 2-
Biphenylyl, 3-biphenylyl, 4-biphenylyl,
C _6-14 aryl such as 2-anthryl and the like, more preferably C _6-10 aryl and the like (for example, phenyl, 1-naphthyl,
-Naphthyl and the like, preferably phenyl and the like). R ³
As the “substituent” of the “aromatic hydrocarbon group optionally having substituent (s)”, the substituent of the “aromatic group optionally having substituent (s)” represented by R ² described above And the same as the groups. R ³ is preferably a C _6-14 aryl group which may have a substituent, and among them, one or two C _1-6 alkyl (eg, methyl, ethyl, etc.)
Or a C _6-14 aryl group which may be substituted with C _1-6 alkoxy (eg, methoxy, ethoxy, etc.), and particularly preferably one or two C _1-6 alkyl or C _1-6
A phenyl group optionally substituted with alkoxy (eg, 3
-Methoxyphenyl, 2-methylphenyl, 2,4-dimethylphenyl, etc.) are preferred.

In the above formula, X represents an oxygen atom or a sulfur atom which may be oxidized. Examples of the “optionally oxidized sulfur atom” represented by X include S, SO, and SO ₂ . X is preferably a sulfur atom which may be oxidized. More preferably, it is S.

In the above formula, Y represents a bond, an oxygen atom, a sulfur atom which may be oxidized, or a compound of the formula NR ⁴ (wherein R ⁴ is a hydrogen atom, a hydrocarbon group which may have a substituent or An acyl group). Examples of the “optionally oxidized sulfur atom” represented by Y include S, SO, and SO ₂ . Examples of the “optionally substituted hydrocarbon group” for R ⁴ include the same as the “optionally substituted hydrocarbon group” for the aforementioned R ^5. Among them, a C _1-6 alkyl group such as methyl and ethyl, particularly a C _1-3 alkyl group such as methyl is preferable. R ⁴
In The "acyl group" represented include for example, those similar to the "acyl group" represented by R ^1. Y represents an oxygen atom, a sulfur atom which may be oxidized,
A group represented by NR ⁴ (wherein R ⁴ has the same meaning as described above) and the like are preferable, and among them, an oxygen atom, an optionally oxidized sulfur atom, and a compound of the formula NR ^{4 ′} (R ^{4 ′} is a hydrogen atom Or C _1-6
And the like, and more preferably an oxygen atom, S, SO ₂ , NH, N (CH ₃ ), and particularly preferably O or NH.

In the above formula, Z represents a bond or a divalent chain hydrocarbon group which may have a substituent. "A divalent chain hydrocarbon group which may have a substituent" represented by Z
Examples of the “divalent chain hydrocarbon group” include a C _1-15 alkylene group (eg, methylene, ethylene, propylene,
Butylene, pentamethylene, hexamethylene, heptamethylene, octamethylene and the like, preferably C _1-6 alkylene and the like, and a C _2-16 alkenylene group (for example, vinylene, propylene, 1-butenylene, 2-butenylene, 1-pentenylene, 2 -Pentenylene, 3-pentenylene, etc.), C
_2-16 alkynylene group (ethynylene, propynylene, 1-
Butynylene, 2-butynylene, 1-pentynylene, 2-
Pentynylene, 3-pentynylene, etc.), preferably a C _1-15 alkylene group, particularly preferably a C _1-6 alkylene group. The “substituent” of the “divalent chain hydrocarbon group optionally having substituent (s)” represented by Z is, for example, the “carbon group optionally having substituent (s)” for R ⁵ described above. And the same as the “substituent” for the “hydrogen group”. Z represents a lower alkylene group which may have a substituent such as C _1-3 alkyl (eg, methyl) and oxo (eg, a C _1-6 alkylene group such as methylene, ethylene, and propylene, particularly C _{1 -3} alkylene group) is preferable, and among them, a C _1-6 alkylene group which may have an oxo group (eg, a C _1-3 alkylene group such as methylene, ethylene and propylene, particularly methylene) is preferable. More specifically, the _{Z -CH 2 -, - (CH} 2) 2 -, - (C
_{H 2) 3 -, - CO} -, - CH 2 CO -, - (CH 2) 2 C
_{O -, - CH (CH 3} ) - and the like are used, in particular -CH ₂
-, -CO- and the like are preferable.

The nitrogen atom in compound (I) may be N-oxidized. For example, the expression

Embedded image [The symbols in the formula are as defined above. The nitrogen atom as a constituent atom of the 4-pyridyl group substituted at the 5-position of the ring represented by the formula (I) may be N-oxidized.

Embedded image [In the formula, n represents 0 or 1, and the other symbols have the same meanings as described above. Or a salt thereof, and the like.

As the compound (I), for example, the following compounds (A) to (F) are preferably used. (A) R ¹ is an amino group which may have a substituent, R ² is a C _6-14 aryl group which may have a substituent, and R ³ is a C _6-14 aryl group which may have a substituent. _{A 6-14} aryl group, X is a sulfur atom, Y is an oxygen atom, or a group represented by the formula NR ⁴ (wherein R ⁴ has the same meaning as described above), or (and) Z has a substituent. Compound (I) which is a lower alkylene group which may be substituted. (B) R ¹ is (i) a C _1-6 alkyl group (eg, a C _1-4 alkyl group such as methyl, ethyl, propyl, butyl, etc.);
i) C that may be substituted with a substituent selected from C _1-6 alkylthio (eg, methylthio), C _1-6 alkylsulfonyl (eg, methylsulfonyl) and halogen atom (eg, chlorine atom, fluorine atom) _6-14 aryl group (eg, phenyl group) or (iii) a compound of the formula-(C = O) -R5 ^{'
5 ′} is selected from a C _1-6 alkyl group (eg, a C _1-3 alkyl group such as methyl), a C _6-14 aryl group (eg, a phenyl group) or a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom. Containing 1 to 4 heteroatoms of 1 or 2 types
Or a 14-membered heterocyclic group (eg, a 5- or 6-membered heterocyclic group containing one or two heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom such as a pyridyl group)] An amino group optionally having one or two acyl groups represented by the formula: wherein R ² is a halogen atom (eg, a chlorine atom,
A C _6-14 aryl group (eg, phenyl group, naphthyl group) which may be substituted with a fluorine atom) or C _1-6 alkoxy (eg, methoxy), or a nitrogen atom, a sulfur atom, and an oxygen atom other than a carbon atom A 5- to 14-membered aromatic heterocyclic group containing 1 to 4 one or two hetero atoms selected from the group consisting of a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom such as a pyridyl group and a thienyl group; A 5- or 6-membered aromatic heterocyclic group containing 1 or 2 heteroatoms), wherein R ³ is 1 or 2 C _1-6 alkyl (eg, methyl) or C _1-6 alkoxy (eg, methoxy) ) optionally substituted C _6-14 aryl group (in particular the phenyl group); X is a sulfur atom; Y is an oxygen atom, sulfur atom which may be oxidized or formula NR 4 ^{'(R 4'} is hydrogen represented by atom or a C _1-6 alkyl group) (In particular, oxygen atom,
S, SO ₂ , NH, N (CH ₃ ), etc .; C _1-6 alkylene group in which Z may have oxo or C _1-6 alkyl (eg, C _1-3 alkyl such as methyl) ( Particularly, a compound (I) which is a C _1-3 alkylene group) or a bond.

(C) R ¹ is of the formula-(C = O) -R ^{5 ″}
R ^{5 ″} is a C _6-14 aryl group (eg, a phenyl group) or a carbon atom containing 1 to 4 heteroatoms selected from nitrogen, sulfur and oxygen atoms.
Or a 14-membered heterocyclic group (eg, a 5- or 6-membered heterocyclic group containing one or two heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom such as a pyridyl group)] An amino group optionally having one or two acyl groups represented by the formula: wherein R ² is selected from a C _6-14 aryl group (eg phenyl group) or a nitrogen atom, a sulfur atom and an oxygen atom other than a carbon atom A 5- to 14-membered aromatic heterocyclic group containing 1 to 4 heteroatoms of 1 or 2 (eg, 1 to 2 heteroatoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms such as pyridyl groups) 5 to heteroatom containing 6-membered aromatic heterocyclic group); R ³ is 1 or 2 C
_A C _6-14 aryl group (particularly, a phenyl group) optionally substituted with _1-6 alkyl (eg, methyl) or C _1-6 alkoxy (eg, methoxy); X is a sulfur atom; Y is O, N
H or S; a compound wherein Z is a bond or a C _1-6 alkylene group optionally having oxo (particularly, a C _1-3 alkylene group such as methylene or ethylene optionally having oxo) ( I).

(D) Compound (I) produced in Examples 1 to 79. (E) [4- (3,5-dimethylphenyl) -5- (2-phenylmethyloxy-4-pyridyl) -1,3-thiazol-2-yl] amine (Example compound 1), N- [ 4- [2-benzoylamino-4-
(4-methoxyphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] benzamide (Example compound 2), N- [4- (4
-Methoxyphenyl) -5- [2-[(3-pyridylcarbonylamino)]-4-pyridyl] -1,3-thiazol-2-yl] nicotinamide (Example compound 3), N- [4- [ 2-amino-4-
(4-methoxyphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] benzamide (Example compound 4), N- [4-
[2-amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Example compound 5), N- [4- [2-amino-4] -(3,5-dimethylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] benzylamine (Example Compound 6), N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-thiazole -5-yl] -2-pyridyl] benzamide hydrochloride (Example compound 7), N- [4-
[2-Amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzylamine dihydrochloride (Example compound 8). (F) N- [5- (2-benzoylamino-4-pyridyl) -4-
(3,5-dimethylphenyl) -1,3-thiazol-2-yl] acetamide (Example compound 9), N- [5- (2-benzylamino-4-pyridyl) -4- (3,5- Dimethylphenyl) -1,3-
Thiazol-2-yl] acetamide (Example compound 1
0), N- [4- [4- (4-methoxyphenyl) -2-methyl-1,
3-thiazol-5-yl] -2-pyridyl] benzamide (Example compound 13), N- [4- [2- (4-fluorophenyl)
-4- (3-Methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] phenylacetamide (Example compound 1
4), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] phenylacetamide (Example compound 15-2), N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl ] -2-Pyridyl] phenylacetamide (Example compound 15-
3), N- [4- [2-butyl-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] phenylacetamide (Example compound 15-4), N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3- Thiazole
-5-yl] -2-pyridyl] phenylacetamide (Example compound 15-6), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] 2-Pyridyl] benzamide (Example compound 16-1), N- [4- [2-ethyl]
-4- (3-Methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] -3-phenylpropionamide (Example compound 16-2), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl ] -3- (4-Methoxyphenyl) propionamide (Example compound 16
-3), N- [4- [2-ethyl-4- (3-methylphenyl) -1,
3-thiazol-5-yl] -2-pyridyl] -4-phenylbutyramide (Example compound 16-5), N- [4- [4- (3-methylphenyl) -2-propyl-1,3 -Thiazol-5-yl]-
2-pyridyl] benzamide (Example compound 16-7),
N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Example compound 16-8), N -[4- [2-butyl-4
-(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Example compound 16-9), N-
[4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Example compound 16-10), N- [ 4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazole
-5-yl] -2-pyridyl] benzamide (Example compound 1
6-11), N- [4- [2- (4-fluorophenyl) -4- (3
-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Example compound 16
-12), N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Example compound 16- 15), N-
[4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide (Example compound 16-16 ), N-
Benzyl-N- [4- [2-ethyl-4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridyl] amine (Example compound 19-2), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazole- 5-yl] -2-pyridyl] -N-
(2-phenylethyl) amine (Example compound 19-
3), N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Example compound 19-4), N-benzyl
-N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] amine (Example compound 19-5), N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine (Example compound 19-6), N-
[4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Example compound 19-7) , N-benzyl-N-
[4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine (Example compound 19-
8), N- [4- [2-butyl-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine (Example compound 19-9), N- [4- [2-butyl-4- (3-methylphenyl) -1] , 3-Thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Example compound 19-10), N-benzyl-N- [4- [4-
(3-methylphenyl) -2- (4-methylthiophenyl) -1,
3-thiazol-5-yl] -2-pyridyl] amine (Example compound 19-17), N- [4- [4- (3-methylphenyl) -2]
-(4-Methylthiophenyl) -1,3-thiazol-5-yl]-
2-pyridyl] -N- (2-phenylethyl) amine (Example compound 19-18), N- [4- [4- (3-methylphenyl)
2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine (Example compounds 19-19), N- [4- [ 4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (Example compound 20), N- [4- [4- (3-methylphenyl) -2- (4-
Methylsulfonylphenyl) -1,3-thiazol-5-yl]
2-Pyridyl] phenylacetamide (Example compound 2
1-1), N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2
-Pyridyl] -3-phenylpropionamide (Example compound 21-2), N-benzyl-N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3 -Thiazol-5-yl] -2-pyridyl] amine (Example compound 21
-5), N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] -N- (3-phenylpropyl) amine (Example compound 21-6), N- [4- [4- (3-methylphenyl) -2]
-(4-methylsulfonylphenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] -N- (2-phenylethyl) amine (Example compound 25-1), N- (4-fluorobenzyl)
-N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine (Example compound 25-2) , (S) -N- [4-
(3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] nicotinamide, (R) -N- [4- (3- Methylphenyl) -5- (2- (1
-Phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] nicotinamide, (S) -N- [4- (3-methylphenyl) -5- (2- (1-phenylethyl Amino) -4-pyridyl) -1,3-thiazol-2-yl] -2-methylnicotinamide, (R) -N- [4- (3-methylphenyl) -5- (2- (1-
Phenylethylamino) -4-pyridyl) -1,3-thiazole
-2-yl] -2-methylnicotinamide, (S) -N- [4- (3-
Methylphenyl) -5- (2- (1-phenylethylamino)-
4-pyridyl) -1,3-thiazol-2-yl] -2-chloronicotinamide, (R) -N- [4- (3-methylphenyl) -5- (2
-(1-Phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-chloronicotinamide, (S) -N-
[4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-methoxynicotinamide, (R) -N -[4- (3-Methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl)
-1,3-thiazol-2-yl] -2-methoxynicotinamide, N- [5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2 -Yl] nicotinamide, N- [5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] -2-methoxynicotinamide, N- [5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] -2-chloronicotinamide, N- [5- (2-benzylamino) -4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] -2-methylnicotinamide, N- [5- (2-
Benzoylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] nicotinamide, N- [5-
(2-benzoylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] -2-methylnicotinamide, N- [5- (2-benzoylamino-4- Pyridyl) -4-
(3-methylphenyl) -1,3-thiazol-2-yl] -2-chloronicotinamide, N- [5- (2-benzoylamino-4-)
Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
-Yl] -2-methoxynicotinamide, (S) -N- (1-phenylethyl) -4- [2-ethyl-4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridylamine, (R) -N-
(1-phenylethyl) -4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine,
(S) -N- (1-phenylethyl) -4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridylamine, (R) -N -(1-phenylethyl) -4- [4- (3-
Methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridylamine, (S) -N- (1-phenylethyl) -4- [2-butyl-4- (3-methyl Phenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (R) -N- (1-phenylethyl) -4- [2-butyl-4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridylamine, (S) -N-
(1-phenylethyl) -4- [4- (3-methylphenyl) -2-
(4-methylthiophenyl) -1,3-thiazol-5-yl] -2
-Pyridylamine, (R) -N- (1-phenylethyl) -4-
[4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridylamine,
(S) -N- (1-phenylethyl) -4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine , (R) -N- (1-phenylethyl) -4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl Amine, (S) -N- (1-phenylethyl) -4- [2-
(4-fluorophenyl) -4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridylamine, (R) -N- (1-
Phenylethyl) -4- [2- (4-fluorophenyl) -4-
(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine.

Examples of the salt of compound (I) include metal salts, ammonium salts, salts with organic bases, salts with inorganic acids,
Salts with organic acids, salts with basic or acidic amino acids and the like are included. Preferable examples of the metal salt include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt, magnesium salt and barium salt; aluminum salt and the like. Preferred examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine,
Salts with N, N'-dibenzylethylenediamine and the like can be mentioned. Preferred examples of the salt with an inorganic acid include, for example, salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, and the like. Suitable examples of salts with organic acids include, for example, formic acid,
Examples thereof include salts with acetic acid, trifluoroacetic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid, benzenesulfonic acid, p-toluenesulfonic acid and the like. Preferred examples of the salt with a basic amino acid include, for example, salts with arginine, lysine, ornithine and the like. Preferred examples of the salt with an acidic amino acid include, for example, salts with aspartic acid, glutamic acid, and the like. Can be Of these, pharmaceutically acceptable salts are preferred. For example, when the compound has an acidic functional group, inorganic salts such as alkali metal salts (eg, sodium salt, potassium salt, etc.), alkaline earth metal salts (eg, calcium salt, magnesium salt, barium salt, etc.), Ammonium salts and the like, and when the compound has a basic functional group, for example, salts with inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid, or acetic acid, phthalic acid, fumaric acid, and oxalic acid Examples thereof include salts with organic acids such as acid, tartaric acid, maleic acid, citric acid, succinic acid, methanesulfonic acid, and p-toluenesulfonic acid.

The method for producing the compound (I) is described below. Compound (Ia), (Ib), (Ic) or (Id) is a compound included in compound (I). Compound (I) can be obtained by a method represented by the following reaction formulas 1, 2, 4 and 5, or a method analogous thereto. Each symbol of the compounds in the following Reaction Formulas 1, 2, 4, and 5 has the same meaning as described above. The compounds in the reaction formulas include those forming salts, and examples of the salts include those similar to the salts of compound (I).

Reaction formula 1

Embedded image

Compounds (II), (III), (V), (VIII),
(XI), (XII), (XVII), (XVIII), (XIX), (XX),
When (XXI), (XXII), (XXVI) and (XXVII) are commercially available, commercially available products can be used as they are, or they can be produced according to a method known per se or a method analogous thereto. Compound (IV) is compound (II) and compound (III)
By condensation in the presence of a base. The amount of compound (III) to be used is about 0.5 to about 3 mol, preferably about 0.8 to about 2 mol, per 1 mol of compound (II).
Is a mole. The amount of the base to be used is about 1 to about 30 mol, preferably about 1 to about 1 mol, per 1 mol of compound (II).
0 mol. As the "base", for example, sodium carbonate, potassium carbonate, cesium carbonate, basic salts such as sodium acetate, sodium hydroxide, inorganic bases such as potassium hydroxide, pyridine, aromatic amines such as lutidine,
Tertiary amines such as triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, N-methylmorpholine, hydrogenation Alkali metal hydrides such as sodium and potassium hydride; metal amides such as sodium amide, lithium diisopropylamide and lithium hexamethyldisilazide; metal alkoxides such as sodium methoxide, sodium ethoxide and potassium tert-butoxide Is mentioned. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols, water, or a mixture of two or more thereof Are used. The reaction temperature is usually about -5 to about 200C, preferably about 5 to about 150C. The reaction time is usually about 5
Minutes to about 72 hours, preferably about 0.5 to about 20 hours.
Time. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (VI) is obtained by treating compound (IV) with a base.
After condensing compound (V)
You. In the compound (V), L represents a leaving group. Denoted by L
Examples of the “leaving group” include C_1-6Alkoxy
(Eg, methoxy, ethoxy, etc.), di-C_1-6Alkyl
Amino (eg, dimethylamino, diethylamino, etc.),
N-C_6-10Aryl-NC_1-6Alkylamino (eg,
N-phenyl-N-methylamino, etc.), C_6-10Ally
And / or C_1-6Optionally substituted with alkyl
3- to 7-membered cyclic amino (eg, pyrrolidino, morpholine
, Methylaziridin-1-yl etc.) N-C _1-6Al
Kill-NC_1-6Alkoxyamino (N-methoxy-N
-Methylamino) and the like. Further, denoted by L
Examples of the "leaving group" include hydroxy, halogen
(Eg, fluorine, chlorine, bromine, iodine, etc.), halogen
C which may be_1-5Alkylsulfonyloxy
(For example, methanesulfonyloxy, ethanesulfonyl
Oxy, trichloromethanesulfonyloxy, etc.), substitution
C optionally having a group_6-10Arylsulfonyloxy
And the like. "C optionally having substituent (s)_6-10A
Examples of “reilsulfonyloxy” include C_1-6Al
Kill, C_1-6Substituents selected from alkoxy and nitro
Which may have 1 to 3 of_6-10Arylsulfo
Nyloxy (eg, phenylsulfonyloxy, naphthyl
And the like, and specific examples thereof include:
Benzenesulfonyloxy, m-nitrobenzenesulfo
Nyloxy, p-toluenesulfonyloxy and the like.
It is. The amount of the base used is about 1 mol of compound (IV).
0.8 to about 3 moles, preferably about 1 to about 1.2
Is a mole. As the “base”, for example, sodium acetate
Amide, lithium diisopropylamide, lithium hexa
Metal amides such as methyldisilazide are used. Book
The reaction is performed without a solvent or in the presence of a solvent inert to the reaction.
Is advantageous. The solvent is particularly limited as long as the reaction proceeds.
Although not specified, for example, aliphatic hydrocarbons, aromatic hydrocarbons
Uses hydrogens, ethers or mixtures of two or more of these
Can be. The reaction temperature is usually about -78 to about 60 ° C,
Preferably it is from about -78 to about 20 ° C. Reaction time
Is usually about 5 minutes to about 24 hours, preferably about 0.5
Or about 3 hours. The product remains as a reaction solution or
Can be used as a crude product in the next reaction,
Can be isolated from the reaction mixture according to
Easy purification by separation means such as distillation and chromatography
Can be manufactured.

Compound (VII) can be obtained by treating compound (VI) with a halogen or a metal halide. This reaction is carried out in the presence of a base or a basic salt, if desired. The amount of the halogen or metal halide to be used is about 1 to about 5 mol, per 1 mol of compound (VI),
Preferably about 1 to about 2 moles. Examples of the "halogens" include bromine, chlorine, iodine and the like. Examples of the "metal halide" include copper (II) bromide, copper chloride (I
And copper halides such as I). The amount of base used is
The amount is about 1 to about 30 mol, preferably about 1 to about 10 mol, per 1 mol of compound (VI). Examples of the "base" include inorganic bases such as sodium hydroxide, potassium hydroxide and lithium hydroxide, basic salts such as sodium carbonate, potassium carbonate, cesium carbonate and sodium hydrogen carbonate, and aromatic salts such as pyridine and lutidine. Tertiary amines such as amines, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, N-methylmorpholine And the like. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction.
The solvent is not particularly limited as long as the reaction proceeds, for example, ethers, esters, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, sulfoxides, organic Acids, aromatic amines or a mixture of two or more thereof are used. The reaction temperature is about -20 to about 150C, preferably about 0 to about 100C. The reaction time is generally about 5 minutes to about 2 minutes.
4 hours, preferably about 10 minutes to about 5 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (Ia) is obtained by condensing compound (VII) and compound (VIII). The reaction is
Performed in the presence of a base, if desired. In compound (VII), H
al represents halogens. When the compound (VIII) is commercially available, a commercially available product may be used as it is, or it may be obtained by a method known per se or a method analogous thereto, or a method represented by the following reaction formula 3, or the like. Can be The amount of compound (VIII) to be used is about 0.5 to about 3 mol, preferably about 0.8 to about 2 mol, per 1 mol of compound (VII).
Is a mole. The amount of the base to be used is about 1 to about 30 mol, preferably about 1 to about 10 mol, per 1 mol of compound (VII). Examples of the "base" include alkali metals such as sodium hydroxide, potassium hydroxide and lithium hydroxide, basic salts such as sodium carbonate, potassium carbonate, cesium carbonate and sodium hydrogen carbonate, and aromatic salts such as pyridine and lutidine. Tertiary amines such as amines, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, N-methylmorpholine And the like. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols, nitriles or two or more thereof And the like are used. The reaction temperature is about -5 to about 200 ° C, preferably about 5 to about 150 ° C.
° C. The reaction time is generally about 5 minutes to about 72 hours,
Preferably, it is about 0.5 to about 30 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (IX) can be obtained by treating compound (Ia) with an acid. The amount of the acid used is the same as that of the compound (Ia)
It is about 1 to about 100 mol, preferably about 1 to about 30 mol, per 1 mol. Examples of the "acid" include mineral acids such as hydrochloric acid, hydrobromic acid, and sulfuric acid, and organic acids such as acetic acid, propionic acid, and trifluoroacetic acid. This reaction is performed in the presence of a solvent inert to the reaction. The solvent is
There is no particular limitation as long as the reaction proceeds. For example, water, a mixture of water and amides, a mixture of water and alcohols, and the like are used. The reaction temperature is usually about 20 to about 200
° C, preferably from about 60 to about 150 ° C. The reaction time is generally about 30 minutes to about 72 hours, preferably about 1 hour.
Or about 30 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do. Compound (X) is compound (I)
It is obtained by treating X) with a halogenating agent. The amount of the halogenating agent to be used is about 1 to about 10 mol, preferably about 1 to about 5 mol, per 1 mol of compound (IX). Examples of the "halogenating agent" include thionyl chloride, phosphorus pentachloride, phosphorus oxychloride and the like. The reaction is
It is advantageous to carry out the reaction in the absence of a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, sulfoxides, organic acids, aromatics Aromatic amines or a mixture of two or more thereof are used. The reaction temperature is about -20 to 150 ° C, preferably about 0 to 1
00 ° C. The reaction time is usually 5 minutes to 24 hours,
Preferably, it is 10 minutes to 5 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (Ib) comprises compound (X) and compound (X
It is obtained by condensing I). This reaction is carried out in the presence of a base, if desired. The amount of the base to be used is about 0.8 to about 30 mol, preferably about 1 to about 10 mol, per 1 mol of compound (X). Examples of the "base" include basic salts such as sodium carbonate, potassium carbonate and cesium carbonate; inorganic bases such as sodium hydroxide and potassium hydroxide; aromatic amines such as pyridine and lutidine; triethylamine and tripropyl. Amine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-
Tertiary amines such as methylpiperidine, N-methylpyrrolidine, N-methylmorpholine, alkali metal hydrides such as sodium hydride and potassium hydride, sodium amide, lithium diisopropylamide, lithium hexamethyldisilazide, etc. Examples thereof include metal amides, metal alkoxides such as sodium methoxide, sodium ethoxide, and potassium tert-butoxide. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, or a mixture of two or more thereof are used. The reaction temperature is usually about -78 to about 200 ° C,
Preferably it is from about room temperature to about 170 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 minutes.
Or about 24 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Reaction formula 2

Embedded image

Compound (XIII) can be obtained from compound (XII) by synthesis, pages 877-882, 1996, or Journal of Organic Chemistry, vol. 61, 4810.
-4811, 1996. Compound (XIV) can be obtained by treating compound (XIII) with a base and then condensing compound (V).
The amount of the base to be used is about 0.3 based on 1 mol of compound (XIII).
8 to about 5 moles, preferably about 2 to about 2.5 moles. Examples of the "base" include alkyllithiums such as n-butyllithium and metal amides such as sodium amide, lithium diisopropylamide and lithium hexamethyldisilazide. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, or a mixture of two or more thereof are used.
The reaction temperature is usually about -78 to about 60C, preferably about -78 to about 20C. The reaction time is usually about 5
Minutes to about 24 hours, preferably about 0.5 to about 3 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (XV) can be obtained by treating compound (XIV) with a halogen or a metal halide. This reaction is carried out in the presence of a base or a basic salt, if desired. The amount of the halogen or metal halide to be used is about 1 to about 5 mol, preferably about 1 to about 2 mol, per 1 mol of compound (XIV). Examples of the "halogens" include bromine, chlorine, iodine and the like. Examples of the “metal halide” include copper (II) bromide, copper (II) chloride
And the like. The amount of the base to be used is about 1 to about 10 mol, preferably about 1 to about 3 mol, per 1 mol of compound (XIV). Examples of the "base" include alkali metals such as sodium hydroxide, potassium hydroxide and lithium hydroxide, basic salts such as sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogencarbonate and sodium acetate, pyridine and lutidine. Aromatic amines, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-
Dimethylaminopyridine, N, N-dimethylaniline,
Tertiary amines such as N-methylpiperidine, N-methylpyrrolidine, N-methylmorpholine and the like can be mentioned. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, ethers, esters, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, sulfoxides, organic Acids, aromatic amines or a mixture of two or more thereof are used. The reaction temperature is about -20 to about 150C, preferably about 0 to about 100C. The reaction time is generally about 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method,
It can be easily purified by separation means such as chromatography. Compound (XVI) is obtained by condensing compound (XV) with compound (VIII). This reaction is performed in the presence of a base, if desired. Compound (XV)
In the formula, Hal represents a halogen. When the compound (VIII) is commercially available, a commercially available product may be used as it is, or it may be obtained by a method known per se or a method analogous thereto, or a method represented by the following reaction formula 3, or the like. Can be

The amount of compound (VIII) used is the same as that of compound (XV)
The amount is about 0.5 to about 3 mol, preferably about 0.8 to about 2 mol, per 1 mol. The amount of the base to be used is about 1 to about 30 mol, preferably about 1 to about 10 mol, per 1 mol of compound (XV). As the "base",
For example, sodium carbonate, potassium carbonate, cesium carbonate,
Basic salts such as sodium hydrogen carbonate and sodium acetate;
Aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, N-methylmorpholine And the like. Tertiary amines and the like. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction.
The solvent is not particularly limited as long as the reaction proceeds, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols,
Nitriles or a mixture of two or more thereof are used. The reaction temperature is about -5 to about 200C, preferably about 5 to about 150C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 30 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (XVII) can be obtained by deprotecting compound (XVI) using an acid or a base. The amount of the acid and the base to be used is about 0.1 to about 50 mol, preferably about 1 to about 20 mol, respectively, per 1 mol of compound (XVI). As the `` acid '', for example, hydrochloric acid, hydrobromic acid, mineral acids such as sulfuric acid, boron trichloride, Lewis acids such as boron tribromide, the combined use of Lewis acid and thiols or sulfides, trifluoroacetic acid, Organic acids such as p-toluenesulfonic acid and the like are used. As the "base",
For example, metal hydroxides such as sodium hydroxide, potassium hydroxide and barium hydroxide, basic salts such as sodium carbonate and potassium carbonate, metal alkoxides such as sodium methoxide, sodium ethoxide and potassium tert-butoxide, triethylamine And organic bases such as imidazole and formamidine. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, alcohols, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, halogenated hydrocarbons, sulfoxides, water or two or more of these A mixture or the like is used. The reaction time is generally about 10 minutes to about 50 hours, preferably about 30 minutes to about 12 hours. The reaction temperature is usually about 0 to about 200 ° C, preferably about 20 to about 120 ° C.

Compound (Ic) can be obtained by condensing compound (XVII) and compound (XVIII) in the presence of a base, if desired. The amount of compound (XVIII) used is
VII) The amount is about 0.8 to about 5 mol, preferably about 1 to about 3 mol, per 1 mol. The amount of the base to be used is about 0.1 to about 3 mol, preferably about 0.3 to about 1.2 mol, per 1 mol of compound (XVII). Examples of the “base” include sodium carbonate, potassium carbonate,
Cesium carbonate, basic salts such as sodium acetate, sodium hydroxide, inorganic bases such as potassium hydroxide, pyridine, aromatic amines such as lutidine, triethylamine,
Tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N,
Tertiary amines such as N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, N-methylmorpholine, alkali metal hydrides such as sodium hydride and potassium hydride, sodium amide, lithium diisopropylamide, lithium Metal amides such as hexamethyldisilazide, and metal alkoxides such as sodium methoxide, sodium ethoxide, and potassium tert-butoxide. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, but, for example, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, or a mixture of two or more thereof are used. The reaction temperature is usually about -78 to about 100C, preferably about -78 to about 70C. The reaction time is generally about 5 minutes to about 24 hours, preferably about 0.5 to about 20 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do. Thereafter, if desired, a compound in which R ⁴ is other than a hydrogen atom can be synthesized by performing alkylation, acylation, or the like.

Reaction formula 3

Embedded image

Compound (XX) is obtained by combining compound (XIX) with a compound of formula R ⁶
It is obtained by condensing an amine represented by H. R ⁶ represents the “amino which may have a substituent” represented by the above R ¹ . In compound (XIX), R ⁵ represents alkoxy. Examples of the “alkoxy” include C _1-6 alkoxy such as methoxy, ethoxy, propoxy, isopropoxy and butoxy. The "amines"
Is used in an amount of about 1 to about 30 mol, preferably about 1 to about 10 mol, per 1 mol of compound (XIX).
This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols, nitriles, ketones or these A mixture of two or more kinds is used. The reaction temperature is about -5
To about 200 ° C, preferably from about 5 to about 120 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 30 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (VIII) can be obtained by hydrolyzing compound (XX) using an acid or a base. The amount of the acid and base to be used is about 0.1 to about 50 mol, preferably about 1 to about 2 mol, per 1 mol of compound (XX), respectively.
0 mol. As the `` acid '', for example, hydrochloric acid, hydrobromic acid, mineral acids such as sulfuric acid, boron trichloride, Lewis acids such as boron tribromide, the combined use of Lewis acid and thiols or sulfides, trifluoroacetic acid, Organic acids such as p-toluenesulfonic acid and the like are used. Examples of the "base" include metal hydroxides such as sodium hydroxide, potassium hydroxide and barium hydroxide, basic salts such as sodium carbonate, potassium carbonate and sodium acetate, sodium methoxide, sodium ethoxide and potassium. Metal alkoxides such as tert-butoxide, organic bases such as triethylamine, imidazole, and formamidine are used. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, alcohols, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, halogenated hydrocarbons, sulfoxides, water or two or more of these A mixture or the like is used. The reaction time is generally about 10 minutes to about 50 hours, preferably about 30 minutes to about 12 hours. The reaction temperature is usually about 0 to about 200 ° C, preferably about 20 to about 120 ° C.

Compound (VIII) can also be obtained by treating compound (XXI) with hydrogen sulfide in the presence of a base. The amount of the hydrogen sulfide to be used is about 1 mol-about 30 mol per 1 mol of compound (XXI). The amount of the base to be used is about 1 to about 30 based on 1 mol of compound (XXI).
Mole, preferably about 1 to about 10 moles. Examples of the “base” include aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N
Tertiary amines such as -methylpiperidine, N-methylpyrrolidine, and N-methylmorpholine; and ammonia. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, aromatic amines or a mixture of two or more of these. Used. This reaction is carried out under normal pressure or under pressure. The reaction temperature is generally about -20 to about 80C, preferably about-
10 to about 30 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 30 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (VIII) can also be obtained by treating compound (XXII) with phosphorus pentasulfide or Lawesson's reagent. The amount of the phosphorus pentasulfide or Lawesson reagent to be used is about 0.5 to about 10 mol, preferably about 0.5 to about 3 mol, per 1 mol of compound (XXII). This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds. For example, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, halogenated hydrocarbons, or a mixture of two or more of these are used. The reaction time is generally about 10 minutes to about 50 hours, preferably about 30 minutes to about 12 hours. The reaction temperature is generally about 0 to about 150 ° C, preferably about 20 to about 120 ° C. The product (VIII) can be used in the next reaction as a reaction solution or as a crude product. It can be easily purified.

Compound (I) (compounds (Ia), (Ib), (I
When (c) is an acylamino form, the corresponding amine form can be subjected to an acylation reaction known per se to obtain the desired product. For example, in the compound (I), the compound in which R ¹ is an acylamino optionally having a substituent is obtained by reacting the corresponding 2-thiazolamine with an acylating agent in the presence of a base or an acid, if desired. It can be obtained by: The amount of the acylating agent to be used is about 1 to about 5 mol, preferably about 1 to about 2 mol, per 1 mol of the corresponding 2-thiazolamine. As the "acylating agent",
For example, a carboxylic acid or a reactive derivative thereof (eg, an acid halide, an acid anhydride, an ester, or the like) corresponding to the acyl group of the target substance, or the like can be given. The amount of the base or acid to be used is about 0.8 to about 5 mol, preferably about 1 to about 2 mol, per 1 mol of the corresponding 2-thiazolamine. Examples of the “base” include triethylamine, pyridine, 4-dimethylaminopyridine and the like. Examples of the “acid” include methanesulfonic acid, p-toluenesulfonic acid, camphorsulfonic acid and the like.
This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, sulfoxides, aromatic amines Alternatively, a mixture of two or more of these may be used. The reaction temperature is about -20 to about 150 ° C, preferably about 0 to about 1 ° C.
00 ° C. The reaction time is generally about 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (Id) can also be obtained by the method shown in Reaction Scheme 4 or a method analogous thereto. Reaction formula 4

Embedded image

Compound (Id) can be obtained by treating compound (I) with an organic peracid. The amount of the organic peracid to be used is about 0.8 to about 10 mol, per 1 mol of compound (I),
Preferably about 1 to about 3 moles. The "organic peracid"
Examples thereof include peracetic acid, pertrifluoroacetic acid, and metachloroperbenzoic acid. This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction.
The solvent is not particularly limited as long as the reaction proceeds, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, organic acids, ethers, amides, sulfoxides, alcohols, nitriles , Ketones or a mixture of two or more of these. The reaction temperature is
It is about -20 ° C to about 130 ° C, preferably about 0 ° C to about 100 ° C. The reaction time is usually about 5 minutes to about 7 minutes.
2 hours, preferably about 0.5 to about 12 hours.
Compound (Id) can also be obtained by treating compound (I) with hydrogen peroxide or an alkyl hydroperoxide, if desired, in the presence of a base, acid or metal oxide. The amount of hydrogen peroxide or alkyl hydroperoxide to be used is about 0.8 to about 1 to 1 mol of compound (I).
0 mol, preferably about 1 to about 3 mol. Examples of the “alkyl hydroperoxide” include tert-butyl hydroperoxide, cumene hydroperoxide and the like. The amount of the base, acid or metal oxide to be used is about 0.1 to about 30 mol, preferably about 0.8 to about 5 mol, per 1 mol of compound (I). Examples of the “base” include inorganic bases such as sodium hydroxide and potassium hydroxide, and basic salts such as sodium carbonate, potassium carbonate and sodium acetate. Examples of the "acid" include mineral acids such as hydrochloric acid, sulfuric acid and perchloric acid, Lewis acids such as boron trifluoride, aluminum chloride and titanium tetrachloride, and organic acids such as formic acid and acetic acid. Examples of the “metal oxide” include vanadium oxide (V ₂ O ₅ ),
Osmium tetroxide (OsO ₄ ), tungsten oxide (W
O ₃ ), molybdenum oxide (MoO ₃ ), selenium dioxide (S
eO ₂ ) and chromium oxide (CrO ₃ ). This reaction is advantageously performed without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, organic acids, ethers, amides, sulfoxides, alcohols, nitriles , Ketones or a mixture of two or more of these. The reaction temperature is about -20 ° C to about 130 ° C, preferably about 0 ° C to about 100 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 to about 12 hours. The product can be used in the next reaction as a reaction solution or as a crude product. it can.

Compound (Ic) can also be obtained by the method shown in Reaction Scheme 5 below. Reaction formula 5

Embedded image

Compound (XXIII) can be obtained by deprotecting compound (XIV) using an acid or a base. The amount of the acid and the base to be used is about 0.1 to about 50 mol, preferably about 1 to about 20 mol, respectively, per 1 mol of compound (XIV). As the `` acid '', for example, hydrochloric acid, hydrobromic acid, mineral acids such as sulfuric acid, boron trichloride, Lewis acids such as boron tribromide, the combined use of Lewis acid and thiols or sulfides, trifluoroacetic acid, Organic acids such as p-toluenesulfonic acid and the like are used. As the "base",
For example, metal hydroxides such as sodium hydroxide, potassium hydroxide and barium hydroxide, basic salts such as sodium carbonate and potassium carbonate, metal alkoxides such as sodium methoxide, sodium ethoxide and potassium tert-butoxide, triethylamine And organic bases such as imidazole and formamidine. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, alcohols, ethers, aromatic hydrocarbons, aliphatic hydrocarbons, halogenated hydrocarbons, sulfoxides, water or two or more of these A mixture or the like is used. The reaction time is generally about 10 minutes to about 50 hours, preferably about 30 minutes to about 12 hours. The reaction temperature is usually about 0 to about 200 ° C, preferably about 20 to about 120 ° C. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (XXIV) can be obtained by condensing compound (XXIII) and compound (XVIII) in the presence of a base, if desired. The amount of compound (XVIII) to be used is about 0.8 to about 5 mol, per 1 mol of compound (XXIII),
Preferably about 1 to about 3 moles. The amount of the base to be used is about 0.1 to about 3 mol, preferably about 0.3 to about 1.2 mol, per 1 mol of compound (XXIII). Examples of the `` base '' include basic salts such as sodium carbonate, potassium carbonate, cesium carbonate and sodium acetate, inorganic bases such as sodium hydroxide and potassium hydroxide, pyridine, aromatic amines such as lutidine, triethylamine, Tertiary amines such as tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline, N-methylpiperidine, N-methylpyrrolidine, N-methylmorpholine, sodium hydride, Alkali metal hydrides such as potassium hydride; metal amides such as sodium amide, lithium diisopropylamide and lithium hexamethyldisilazide; and metal alkoxides such as sodium methoxide, sodium ethoxide and potassium tert-butoxide. Be . This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds. For example, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, water, a mixture of two or more of these, and the like are used. The reaction temperature is usually about -78 to about 100C, preferably about -78 to about 70C. The reaction time is usually about 5
Minutes to about 24 hours, preferably about 0.5 to about 20 hours.
Time. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (XXV) can be obtained by treating compound (XXIV) with a halogen or a metal halide. This reaction is carried out in the presence of a base or a basic salt, if desired. The amount of the halogen or metal halide to be used is about 1 to about 5 mol, preferably about 1 to about 2 mol, per 1 mol of compound (XXIV). Examples of the "halogens" include bromine, chlorine, iodine and the like. Examples of the “metal halide” include copper (II) bromide, copper (II) chloride
And the like. The amount of the base to be used is about 1 to about 10 mol, preferably about 1 to about 3 mol, per 1 mol of compound (XXIV). Examples of the "base" include alkali metals such as sodium hydroxide, potassium hydroxide and lithium hydroxide, basic salts such as sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogencarbonate and atrium acetate, pyridine, lutidine and the like. Aromatic amines, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-
Dimethylaminopyridine, N, N-dimethylaniline,
Tertiary amines such as N-methylpiperidine, N-methylpyrrolidine, N-methylmorpholine and the like can be mentioned. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, ethers, esters, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, sulfoxides, organic Acids, aromatic amines or a mixture of two or more thereof are used. The reaction temperature is about -20 to about 150C, preferably about 0 to about 100C. The reaction time is generally about 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method,
It can be easily purified by separation means such as chromatography.

Compound (Ic) can be obtained by condensing compound (XXV) with compound (VIII). The reaction is
Performed in the presence of a base, if desired. In compound (XXV), H
al represents halogens. The amount of compound (VIII) used is
About 0.5 to about 3.0, per 1 mol of compound (XXV)
Mole, preferably about 0.8 to about 2 moles. The amount of the base to be used is about 1 to about 30 mol, preferably about 1 to about 10 mol, per 1 mol of compound (XXV).
Examples of the "base" include basic salts such as sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogencarbonate, and sodium acetate; aromatic amines such as pyridine and lutidine; triethylamine, tripropylamine, tributylamine and cyclohexyldimethyl. Amine, 4-dimethylaminopyridine, N, N-dimethylaniline, N
And tertiary amines such as -methylpiperidine, N-methylpyrrolidine, and N-methylmorpholine. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols, nitriles or two or more thereof And the like are used. The reaction temperature ranges from about -5 to about 20
0 ° C, preferably about 5 to about 150 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 hour.
5 to about 30 hours. The product can be used in the next reaction as a reaction solution or as a crude product,
It can be isolated from the reaction mixture according to a conventional method, and can be easily purified by separation means such as recrystallization, distillation, and chromatography. Thereafter, if desired, a compound in which R ⁴ is other than a hydrogen atom can be synthesized by performing alkylation, acylation, or the like.

Reaction formula 6

Embedded image

Compound (XXVII) is obtained by treating compound (XXVI) with a base and then condensing compound (V). In compound (XXVI), Hal 'is fluorine, chlorine,
Shows halogen atoms such as bromine and iodine. The amount of the base to be used is about 0.8 to about 5 based on 1 mol of compound (XXVI).
Mole, preferably about 1 to about 1.2 mole. Examples of the "base" include alkyllithiums such as n-butyllithium and metal amides such as sodium amide, lithium diisopropylamide and lithium hexamethyldisilazide. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example,
Aliphatic hydrocarbons, aromatic hydrocarbons, ethers, or a mixture of two or more thereof are used. The reaction temperature is
Usually, it is about -78 to about 60C, preferably about -78 to about 20C. The reaction time is generally about 5 minutes to about 2 minutes.
4 hours, preferably about 0.5 to about 3 hours. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (XXVIII) can be obtained by treating compound (XXVII) with a halogen or a metal halide. This reaction is carried out in the presence of a base or a basic salt, if desired. In the compound (XXVII), Hal 'represents a halogen atom such as fluorine, chlorine, bromine and iodine. The amount of the halogen or metal halide to be used is the same as the compound (XXVII)
The amount is about 1 to about 5 mol, preferably about 1 to about 2 mol, per 1 mol. Examples of the "halogens" include bromine, chlorine, iodine and the like. Examples of the "metal halide" include copper halides such as copper (II) bromide and copper (II) chloride. The amount of the base used is the same as that of the compound (XXVI
I) The amount is about 1 to about 10 mol, preferably about 1 to about 3 mol, per 1 mol. Examples of the "base" include alkali metals such as sodium hydroxide, potassium hydroxide, lithium hydroxide, sodium carbonate, potassium carbonate,
Basic salts such as cesium carbonate, sodium hydrogen carbonate and sodium acetate, aromatic amines such as pyridine and lutidine, triethylamine, tripropylamine, tributylamine, cyclohexyldimethylamine, 4-dimethylaminopyridine, N, N-dimethylaniline And tertiary amines such as N-methylpiperidine, N-methylpyrrolidine and N-methylmorpholine. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, ethers, esters, aromatic hydrocarbons, aliphatic hydrocarbons, amides, halogenated hydrocarbons, nitriles, sulfoxides, organic Acids,
Aromatic amines or a mixture of two or more thereof are used. The reaction temperature is about -20 to about 150C, preferably about 0 to about 100C. The reaction time is generally about 5 minutes to about 24 hours, preferably about 10 minutes to about 5 hours.
Time. The product can be used in the next reaction as a reaction solution or as a crude product, but it can also be isolated from the reaction mixture according to a conventional method, and easily purified by separation means such as recrystallization, distillation, and chromatography. can do.

Compound (X) can also be obtained by condensing compound (XXVIII) with compound (VIII). This reaction is performed in the presence of a base, if desired. Compound (XXVI
In II), Hal and Hal 'each represent a halogen atom such as fluorine, chlorine, bromine, and iodine. The amount of compound (VIII) used is
The amount is about 0.5 to about 3 mol, preferably about 0.8 to about 2 mol, per 1 mol of compound (XXVIII). The amount of the base to be used is about 1 to about 30 mol, preferably about 1 to about 10 mol, per 1 mol of compound (XXVIII).
Examples of the "base" include basic salts such as sodium carbonate, potassium carbonate, cesium carbonate, sodium hydrogencarbonate, and sodium acetate; aromatic amines such as pyridine and lutidine; triethylamine, tripropylamine, tributylamine and cyclohexyldimethyl. Amine, 4-dimethylaminopyridine, N, N-dimethylaniline, N
And tertiary amines such as -methylpiperidine, N-methylpyrrolidine, and N-methylmorpholine. This reaction is advantageously carried out without a solvent or in the presence of a solvent inert to the reaction. The solvent is not particularly limited as long as the reaction proceeds, for example, halogenated hydrocarbons, aliphatic hydrocarbons, aromatic hydrocarbons, ethers, amides, alcohols, nitriles or two or more thereof And the like are used. The reaction temperature ranges from about -5 to about 20
0 ° C, preferably about 5 to about 150 ° C. The reaction time is generally about 5 minutes to about 72 hours, preferably about 0.5 hour.
5 to about 30 hours. The product can be used in the next reaction as a reaction solution or as a crude product,
It can be isolated from the reaction mixture according to a conventional method, and can be easily purified by separation means such as recrystallization, distillation, and chromatography.

In each of the above reactions, when the starting compound has amino, carboxy, or hydroxy as a substituent,
These groups may be those into which a protecting group generally used in peptide chemistry or the like has been introduced, and the target compound can be obtained by removing the protecting group as necessary after the reaction. Examples of the amino-protecting group include formyl and C _1-6 alkyl-carbonyl (e.g., acetyl, propionyl, etc.) each having a substituent, phenylcarbonyl, C _1-6 alkoxy-carbonyl (e.g., methoxy Carbonyl, ethoxycarbonyl and the like), phenyloxycarbonyl, _C7-10 aralkyloxy-carbonyl (for example, benzyloxycarbonyl and the like), trityl, phthaloyl and the like are used. As these substituents, halogen atoms (eg, fluorine, chlorine, bromine, iodine, etc.), C _1-6 alkyl-carbonyl (eg, acetyl, propionyl, valeryl, etc.), nitro and the like are used. Is one to three.
As the carboxy protecting group, for example, C _1-6 alkyl which may have a substituent (eg, methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.), phenyl, trityl, silyl and the like are used. Can be These substituents include a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), formyl, C _1-6 alkyl-carbonyl (eg, acetyl, propionyl, butylcarbonyl, etc.), nitro, C _1-6 alkyl (Eg, methyl, ethyl, tert-butyl, etc.), C _6-10 aryl (eg, phenyl, naphthyl, etc.) and the like, and the number of substituents is 1 to 3. Examples of the hydroxy-protecting group include, for example, C
_1-6 alkyl (eg, methyl, ethyl, propyl, isopropyl, butyl, tert-butyl, etc.), phenyl, C
_7-11 aralkyl (eg benzyl etc.), formyl, C
_1-6 alkyl-carbonyl (eg, acetyl, propionyl, etc.), phenyloxycarbonyl, C _7-11 aralkyloxy-carbonyl (eg, benzyloxycarbonyl, etc.), tetrahydropyranyl, tetrahydrofuranyl, silyl and the like are used. Examples of these substituents include a halogen atom (eg, fluorine, chlorine, bromine, iodine, etc.), C _1-6 alkyl (eg, methyl, ethyl, ter
t-butyl, etc., C _7-11 aralkyl (eg, benzyl, etc.), C _6-10 aryl (eg, phenyl, naphthyl, etc.), nitro and the like, and the number of substituents is 1 to 4.

As a method for removing the protecting group, a method known per se or a method analogous thereto is used.
A method of treating with ultraviolet light, hydrazine, phenylhydrazine, sodium N-methyldithiocarbamate, tetrabutylammonium fluoride, palladium acetate or the like, or a reduction reaction is used. In any case, if desired, a known deprotection reaction, acylation reaction, alkylation reaction, hydrogenation reaction, oxidation reaction, reduction reaction, carbon chain extension reaction, and substituent exchange reaction may be used alone or in combination with each other. Compound (I) can be synthesized by performing a combination of two or more. For these reactions, for example, a method described in New Experimental Chemistry Course 14, 15, 1977 (Maruzen Publishing) or the like is adopted. Examples of the “alcohols” include methanol, ethanol, propanol, isopropanol, tert-butanol and the like. Examples of the “ethers” include diethyl ether, diisopropyl ether, diphenyl ether, tetrahydrofuran, dioxane, 1,2-dimethoxyethane, and the like. As the “halogenated hydrocarbons”,
For example, dichloromethane, chloroform, 1,2-dichloroethane, carbon tetrachloride and the like can be mentioned. As the "aliphatic hydrocarbons", for example, hexane, pentane,
Cyclohexane and the like. Examples of the “aromatic hydrocarbons” include benzene, toluene, xylene, chlorobenzene and the like. Examples of the “aromatic amines” include pyridine, lutidine, quinoline and the like. Examples of the “amides” include N, N-dimethylformamide, N, N-dimethylacetamide, hexamethylphosphoric triamide and the like. Examples of the “ketones” include acetone, methyl ethyl ketone, and the like. Examples of the “sulfoxides” include dimethyl sulfoxide. Examples of the “nitrile” include acetonitrile, propionitrile and the like. Examples of the “organic acids” include acetic acid, propionic acid, trifluoroacetic acid and the like.

When the desired product is obtained in a free state by the above reaction, it may be converted to a salt according to a conventional method, and when the desired product is obtained as a salt, it may be converted into a free form or another salt according to a conventional method. It can also be converted. Compound (I) thus obtained can be prepared by a known method such as phase transfer, concentration, solvent extraction,
It can be isolated and purified from the reaction solution by fractionation, crystallization, recrystallization, chromatography and the like. When the compound (I), (Ia), (Ib), (Ic) or (Id) exists as a configurational isomer (configuration isomer), diastereomer, conformer or the like, if desired, Each can be isolated by means of separation and purification. Compounds (I), (I
When a), (Ib), (Ic) or (Id) is a racemate, it can be separated into an S-form and an R-form by ordinary optical resolution means. When the compound (I), (Ia), (Ib), (Ic) or (Id) has a stereoisomer, the isomer alone and a mixture thereof are also included in the present invention. . Compound (I), (Ia), (Ib), (Ic) or
(Id) may be a hydrate or a non-hydrate. Compound (I) may be labeled with an isotope (eg, ³ H, ¹⁴ C, ³⁵ S) or the like.

A prodrug of compound (I) is a compound which is converted into compound (I) by a reaction with an enzyme or stomach acid under physiological conditions in a living body, ie, enzymatic oxidation, reduction,
A compound which undergoes hydrolysis or the like to change to compound (I),
It refers to a compound that undergoes hydrolysis or the like by stomach acid or the like to be converted into compound (I). As a prodrug of compound (I), the amino group of compound (I) is acylated, alkylated,
A phosphorylated compound (e.g., the amino group of compound (I) is eicosanoylated, alanylated, pentylaminocarbonylated, (5-methyl-2-oxo-1,3-dioxolen-4-yl) methoxycarbonylated, Compounds in which the hydroxyl group of compound (I) is acylated, alkylated, phosphorylated, or borated (eg, tetrahydrofuranylation, pyrrolidylmethylation, pivaloyloxymethylation, tert-butylated compound, etc.) A compound in which the hydroxyl group of compound (I) is acetylated, palmitoylated, propanoylated, pivaloyylated, succinylated, fumalylated, alanylated, dimethylaminomethylcarbonylated, etc.); the carboxyl group of compound (I) is esterified, Amidated compounds (eg, carboxyl group of compound (I) is converted to ethyl ester, phenyl Sterilization, carboxymethyl esterification, dimethylaminomethyl esterification, pivaloyloxymethyl esterification, ethoxycarbonyloxyethyl esterification, phthalidyl esterification, (5-methyl-2-oxo-1,3-dioxolen-4 -Yl) methyl esterification, cyclohexyloxycarbonylethyl esterification, methyl amidated compound, etc.); These compounds can be produced from compound (I) by a method known per se. Further, prodrugs of compound (I) can be prepared under the physiological conditions as described in Hirokawa Shoten, 1990, “Development of Pharmaceuticals”, Vol. 7, Molecular Design, pp. 163 to 198, under physiological conditions. (I
b), (Ic) or (Id).

[0062] Compound (I) of the present invention, adenosine receptor, in particular show a high affinity for the A ₃ receptor, also has low toxicity, and, because fewer side effects, are useful as a safe medicament. The pharmaceutical composition of the present invention containing compound (I) is excellent in adenosine A against mammals (eg, mouse, rat, hamster, rabbit, cat, dog, cow, sheep, monkey, human, etc.). _It exhibits ₃ receptor antagonism and is excellent in (oral) absorbability, (metabolism) stability, etc., and therefore has adenosine A ₃ receptor-related diseases such as asthma, allergic disease, inflammation, and Addisons diseas.
e), autoimmune hemolytic anemia, Crohn's disease
ase), psoriasis, rheumatism, central nervous system disorders (eg, cerebrovascular disorders such as cerebral hemorrhage and cerebral infarction, head trauma, spinal cord injury,
It can be used as a prophylactic or therapeutic agent for brain edema, multiple sclerosis, etc.), neurodegenerative diseases (eg, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS)), diabetes and the like. Preferably, it is a preventive or therapeutic agent for central nervous system diseases, asthma, allergic diseases and the like. The compound (I) of the present invention
In addition, excellent p38 MAP kinase inhibitory action, TNF-α
It exhibits an inhibitory action (TNF-α production inhibitory action, TNF-α action inhibitory action) and is also useful as a safe pharmaceutical based on this action. For example, the pharmaceutical composition of the present invention containing the compound (I) may be a mammal (eg, mouse, rat, hamster, rabbit, cat, dog, cow, sheep,
P38 MAP kinase-related diseases and TNF-α-related diseases, such as arthritis (eg, rheumatoid arthritis, osteoarthritis, rheumatoid spondylitis, gouty arthritis, synovitis), and venom Disease (eg, sepsis, septic shock, endotoxin shock, Gram-negative sepsis, toxic shock syndrome), inflammatory bowel disease (eg, Crohn's disease, ulcerative colitis), inflammatory lung disease (eg, chronic pneumonia, Silicosis, pulmonary sarcoidosis, pulmonary tuberculosis), or cachexia (eg, cachexia due to infection, cancer cachexia, cachexia due to acquired immunodeficiency syndrome (AIDS)), arteriosclerosis, Creutzfeldt-Jakob disease, Viral infections (eg, viral infections such as cytomegalovirus, influenza virus, herpes virus), atopic dermatitis, systemic lupus erythematosus, AIDS encephalopathy Meningitis, angina, myocardial infarction, congestive heart failure, hepatitis, transplantation, can also be used as a dialysis hypotension, preventive therapeutic agent such as disseminated intravascular coagulation.
Preferably, it is used as a prophylactic or therapeutic agent for rheumatism and the like.

The preparations of the present invention containing compound (I) have low toxicity, and can be prepared by treating compound (I) as it is or pharmacologically according to a method known per se which is generally used in the production of pharmaceutical preparations. Mixed with an acceptable carrier such as tablets (including sugar-coated tablets, film-coated tablets), powders, granules, capsules, (including soft capsules),
It can be safely administered orally or parenterally (eg, topically, rectally, intravenously, etc.) as a pharmaceutical preparation such as a solution, injection, suppository, sustained release agent and the like. The content of compound (I) in the preparation of the present invention is about 0.01 to about 100% by weight of the whole preparation. The dose varies depending on the administration subject, administration route, disease, etc., but as an adenosine A ₃ receptor antagonist,
For example, for an asthmatic patient (body weight about 60 kg), as an oral preparation, about 0.1 to about 30 mg / kg body weight as an active ingredient (compound (I)) per day, preferably about 1 to 2 mg / day.
0 mg / kg body weight may be administered once or several times a day.

The pharmacologically acceptable carriers that may be used in the production of the preparation of the present invention include various organic or inorganic carrier substances commonly used as preparation materials, such as excipients and lubricants in solid preparations. Sachets, binders and disintegrants, or solvents in liquid formulations, solubilizers, suspending agents,
Examples include tonicity agents, buffers, and soothing agents. Further, if necessary, normal preservatives, antioxidants, coloring agents, sweeteners,
Additives such as adsorbents and wetting agents can be used in appropriate amounts as appropriate. Excipients include, for example, lactose, sucrose, D-mannitol, starch, corn starch, crystalline cellulose,
And light anhydrous silicic acid. Examples of the lubricant include magnesium stearate, calcium stearate, talc, colloidal silica and the like. Examples of the binder include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, starch, sucrose, gelatin, methylcellulose, sodium carboxymethylcellulose and the like. Disintegrators include, for example, starch, carboxymethyl cellulose, carboxymethyl cellulose calcium, carboxymethyl starch sodium, L-hydroxypropyl cellulose and the like. Examples of the solvent include water for injection, alcohol, propylene glycol, macrogol, sesame oil, corn oil, olive oil and the like. Examples of the solubilizer include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate and the like. Examples of the suspending agent include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, and glycerin monostearate;
For example, polyvinyl alcohol, polyvinyl pyrrolidone,
Examples include hydrophilic polymers such as sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, and hydroxypropylcellulose. Examples of the tonicity agent include glucose, D-sorbitol, sodium chloride, glycerin, D-mannitol and the like. Examples of the buffer include buffers such as phosphate, acetate, carbonate, and citrate. Examples of the soothing agent include benzyl alcohol and the like. As preservatives, for example, paraoxybenzoates, chlorobutanol,
Examples include benzyl alcohol, phenethyl alcohol, dehydroacetic acid, and sorbic acid. As antioxidants,
For example, sulfite, ascorbic acid, α-tocopherol and the like can be mentioned.

[0065]

BEST MODE FOR CARRYING OUT THE INVENTION The present invention is further described in detail by the following Reference Examples, Examples, Formulation Examples and Experimental Examples.
These examples are merely implementations, do not limit the present invention, and may be changed without departing from the scope of the present invention. “Room temperature” in the following Reference Examples and Examples usually indicates about 10 ° C. to about 35 ° C. “%” Indicates percent by weight unless otherwise specified. However, the yield indicates mol / mol%. Abbreviations used in other texts have the following meanings. s: singlet d: doublet t: triplet q: quartet dd: double doublet ddd: double double double
t) dt: double triplet br: broad J: coupling constant Hz: Hertz CDCl ₃ : deuterated chloroform ¹ H-NMR: proton nuclear magnetic resonance Me: methyl

[0066]

Example Reference Example 1 2-phenylmethyloxy-4-methylpyridine sodium hydride (60% paraffin dispersion, 5.0 g, 120 g
mmol) was washed twice with hexane (5 mL) and suspended in tetrahydrofuran (200 mL). To this suspension was added benzyl alcohol (14 g, 120 mmol) in tetrahydrofuran (50 m
L) The solution was added dropwise at 0 ° C., the temperature was raised to room temperature, and the mixture was stirred for 15 minutes. To this solution was added 2-bromo-4-methylpyridine (19.5 mL,
A solution of (110 mmol) in tetrahydrofuran (50 mL) was added, and the mixture was heated under reflux for 14 hours. Water (200 mL) in the reaction mixture
And extracted with ethyl acetate. The extract was dried and the solvent was distilled off. The crude product was distilled under reduced pressure to give the title compound 1
3 g (67 mmol, 67% yield) were obtained. Boiling point 116-118 ° C (400 Pa). ¹ H-NMR (CDCl ₃ ) δ: 2.30 (3H, s), 5.37 (2H, s), 6.63
(1H, s), 6.72 (1H, d, J = 5.1Hz), 7.29-7.50 (5H,
m), 8.03 (1H, d, J = 5.1 Hz). Reference Example 2 N- (3,5-dimethylbenzoyl) propyleneimine 3,5-dimethylbenzoic acid (25 g, 0.17 mol) and N, N-dimethyl Formamide (0.1 mL) at 0 ° C with thionyl chloride (50 mL)
Added. The mixture was heated at reflux for 2 hours. Excess thionyl chloride was distilled off under reduced pressure, and toluene (50 mL) was added to the residue.
Was added. The toluene was distilled off under reduced pressure to obtain oily 3,5-dimethylbenzoyl chloride. Propyleneimine (14
mL, 0.18 mol) in tetrahydrofuran (160 mL) was added to a 1N aqueous sodium hydroxide solution (180 mL). 3,5-Dimethylbenzoyl chloride was added dropwise to the mixture at 0 ° C. After completion of the dropwise addition, the mixture was further stirred for 30 minutes. The reaction mixture was extracted with ethyl acetate. The extract was dried and the solvent was distilled off to obtain 31 g (0.16 mol, yield 99%) of the title compound. Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5 Hz), 2.13
(1H, d, J = 3.7 Hz), 2.37 (6H, s), 2.47-2.62 (2H,
m), 7.19 (1H, s), 7.64 (2H, s).

Reference Example 3 1- (3,5-dimethylphenyl) -2-
Cool a solution of (2-phenylmethyloxy-4-pyridyl) ethanone diisopropylamine (9.6 mL, 69 mmol) in anhydrous tetrahydrofuran (60 mL) to -50 ° C, and stir with a 1.6 M n-butyllithium hexane solution (43 mL). ,
69 mmol) was added dropwise. Stir for 10 minutes after completion of the dropwise addition, and then add 2-phenylmethyloxy-4-methylpyridine (12 g,
62 mmol) in anhydrous tetrahydrofuran (12 mL).
It was added dropwise at -30 ° C. After stirring for 1 hour, a solution of N- (3,5-dimethylbenzoyl) propyleneimine (12 g, 62 mmol) in anhydrous tetrahydrofuran (12 mL) was added dropwise at -30 ° C. After completion of the dropwise addition, the temperature was gradually raised to room temperature, and the mixture was stirred for 2 hours. Water (60 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. After the extract was washed with water and dried, the solvent was distilled off. The residue was purified by silica gel column chromatography (hexane-ethyl acetate, 5: 1) to give the title compound (9.1 g, 27 mmol,
Yield 44%). Oil. ¹ H-NMR (CDCl ₃ ) δ: 2.37 (6H, s), 4.20 (2H, s), 5.3
7 (2H, s), 6.72 (1H, s), 6.81 (1H, d, J = 5.1Hz), 7.2
2 (1H, s), 7.30-7.49 (5H, m), 7.59 (2H, s), 8.12
(1H, d, J = 5.1Hz). Reference Example 4 2-bromo-1- (3,5-dimethylphenyl) -2- (2-
Phenylmethyloxy-4-pyridyl) ethanone hydrobromide 1- (3,5-dimethylphenyl) -2- (2-phenylmethyloxy
-4-pyridyl) ethanone (3.3 g, 10 mmol) in acetic acid (10 m
L), and bromine (0.51 mL, 10 mmol) was added thereto, followed by stirring at room temperature for 30 minutes. The precipitated crude crystals were collected by filtration and washed with diethyl ether to give the title compound (4.8 g, 9.8 mmol, yield 9).
8%). 88-90 ° C. Reference Example 5 N- (4-methoxybenzoyl) propyleneimine A solution of propyleneimine (25 mL, 0.36 mol) in tetrahydrofuran (200 mL) was treated with a 2N aqueous sodium hydroxide solution (180 m
L). At 0 ° C, 4-methoxybenzoyl chloride (51 g, 0.30 mol) in tetrahydrofuran (100 m
L) The solution was added dropwise. After completion of the dropwise addition, the mixture was further stirred for 30 minutes. The reaction mixture was extracted with ethyl acetate. The extract was dried, the solvent was distilled off, and 49 g of the title compound (0.26 mol, yield 8
6%). Oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.6 Hz), 2.11
(1H, d, J = 3.0 Hz), 2.51-2.57 (2H, m), 3.87 (3H,
s), 6.94 (2H, d, J = 8.8 Hz), 8.00 (2H, d, J = 8.8 H
z).

Reference Example 6 1- (4-methoxyphenyl) -2- (2-
tert-butoxycarbonylamino-4-pyridyl) ethanone 2-tert-butoxycarbonylamino-4-methylpyridine (2
(0 g, 97 mmol) in anhydrous tetrahydrofuran (300 mL) was cooled to −78 ° C., and a 1.6 M n-butyllithium hexane solution (140 mL, 0.22 mol) was added dropwise with stirring. After the addition, the mixture was stirred at room temperature for 30 minutes, and then cooled to -78 ° C. N
-(4-Methoxybenzoyl) propyleneimine (25 g, 0.13
mol) in anhydrous tetrahydrofuran (50 mL). After completion of the dropwise addition, the mixture was stirred at room temperature for 2 hours. Water (100 mL) and diisopropyl ether (300 mL) were added to the reaction mixture, and the obtained crude crystals were collected by filtration. The crude crystals were recrystallized from tetrahydrofuran-hexane to give the title compound (23 g, 67 mmol, yield 69%). Melting point 187-190 ° C. Reference Example 7 4- [2-amino-4- (4-methoxyphenyl) -1,
3-thiazol-5-yl] -2-pyridylamine 1- (4-methoxyphenyl) -2- (2-tert-butoxycarbonylamino-4-pyridyl) ethanone (4.5 g, 13 mmol) in acetic acid (100 mL) ) Add bromine (0.68 mL, 13 mmol) to the solution,
The mixture was stirred at room temperature for 30 minutes. The reaction mixture was concentrated. The residue was dissolved in acetonitrile (40 mL), thiourea (1.1 g, 14 mmol) and triethylamine (1.9 mL, 14 mmol) were added to the solution, and the mixture was stirred at 80 ° C for 2 hours. After cooling the reaction mixture to room temperature, it was concentrated. A saturated aqueous sodium hydrogen carbonate solution (200 mL) was added to the residue, and the obtained solid was collected by filtration and washed with water. 2N to this solid
-Hydrochloric acid (35 mL) was added and the mixture was stirred at 100 ° C for 45 minutes. After cooling the reaction mixture to room temperature, an aqueous 8N-sodium hydroxide solution (10 mL) and a saturated aqueous sodium hydrogen carbonate solution (100 mL) were added. The obtained crude crystals are collected by filtration,
Washed with water. The crude crystals were recrystallized from ethanol to give 2.7 g (9.1 mmol, yield 69%) of the title compound. 251-254 ° C.

Reference Example 8 2- (2-amino-4-pyridyl) -1- (4
-Methoxyphenyl) ethanone 1- (4-methoxyphenyl) -2- (2-tert-butoxycarbonylamino-4-pyridyl) ethanone (6.1 g, 18 mmol)
N-hydrochloric acid (30 mL) was added and the mixture was stirred at 100 ° C. for 2 hours. After the reaction mixture was cooled to room temperature, 8N-sodium hydroxide aqueous solution (10 mL) was added. The obtained crude crystals were collected by filtration and washed with water. This crude crystal is treated with tetrahydrofuran-
Recrystallization from hexane gave 4.0 g of the title compound (1
6 mmol, 92% yield). 170-174 ° C. Reference Example 9 2- (2-benzoylamino-4-pyridyl) -1- (4-
Methoxyphenyl) ethanone N, N-dimethylacetamide of 2- (2-amino-4-pyridyl) -1- (4-methoxyphenyl) ethanone (3.8 g, 16 mmol)
(80 mL) solution, benzoyl chloride (4.4 g, 31 mmol),
4-Dimethylaminopyridine (0.57 g, 4.7 mmol) was added and the mixture was stirred at 70 ° C. for 12 hours. After cooling the reaction mixture to room temperature, water (50 mL) was added. The mixture was extracted with ethyl acetate, and the organic layer was washed with saturated saline. The extract was dried over magnesium sulfate, filtered and concentrated. The residue was dissolved in a mixed solvent of tetrahydrofuran (80 mL) and methanol (20 mL), and a 1N aqueous sodium hydroxide solution (50 mL) was added. The mixture was stirred at room temperature for 3 hours. Concentrate the reaction mixture,
Water (100 mL) was added. The mixture was extracted with ethyl acetate, and the organic layer was washed with saturated saline. The extract was dried over magnesium sulfate, filtered and concentrated. The residue was recrystallized from ethyl acetate-hexane to give 3.1 g (8.9 mmol, yield 57) of the title compound.
%). 136-139 ° C. Reference Example 10 1- (3,5-dimethylphenyl) -2- (2-tert-butoxycarbonylamino-4-pyridyl) ethanone 2-tert-butoxycarbonylamino-4-methylpyridine (17 g, 82 mmol) Anhydrous tetrahydrofuran (250 m
L) The solution was cooled to -78 ° C, and a 1.6 M n-butyllithium hexane solution (120 mL, 0.19 mol) was added dropwise with stirring. After the addition, the mixture was stirred at 0 ° C for 30 minutes, and then cooled to -78 ° C. N- (3,5-dimethylbenzoyl) propyleneimine (21 g, 0.11 mol) in anhydrous tetrahydrofuran (50 m
L) The solution was added dropwise. After completion of the dropwise addition, the mixture was stirred at room temperature for 2 hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The organic layer was washed with brine, dried over magnesium sulfate, filtered, and concentrated. The residue is tetrahydrofuran
13 g of the title compound (3 g
7 mmol, 46% yield). 133-136 ° C.

Reference Example 11 2- (2-amino-4-pyridyl) -1-
(3,5-dimethylphenyl) ethanone 1- (3,5-dimethylphenyl) -2- (2-tert-butoxycarbonylamino-4-pyridyl) ethanone (12 g, 36 mmol)
To the mixture was added 2N-hydrochloric acid (50 mL), and the mixture was stirred at 100 ° C. for 1 hour. After the reaction mixture was cooled to room temperature, an 8N aqueous solution of sodium hydroxide (15 mL) was added, and the mixture was extracted with ethyl acetate. The organic layer was washed with brine, dried over magnesium sulfate, filtered, and concentrated. The residue was recrystallized from ethyl acetate to give 6.8 g (28 mmol, yield 77) of the title compound.
%). 123-126 ° C. Reference Example 12 2- (2-benzoylamino-4-pyridyl) -1-
(3,5-Dimethylphenyl) ethanone N, N-dimethylacetamide (100 mL) of 2- (2-amino-4-pyridyl) -1- (3,5-dimethylphenyl) ethanone (6.4 g, 27 mmol) Add benzoyl chloride (7.5g, 53
mmol), 4-dimethylaminopyridine (1.0 g, 8.3 mmol)
Was added and the mixture was stirred at 70 ° C. for 12 hours. After cooling the reaction mixture to room temperature, water (50 mL) was added. The mixture was extracted with ethyl acetate, and the organic layer was washed with saturated saline. The extract was dried over magnesium sulfate, filtered and concentrated. The residue was dissolved in a mixed solvent of tetrahydrofuran (150 mL) and methanol (40 mL), and a 1N aqueous sodium hydroxide solution (50 mL) was added. The mixture was stirred at room temperature for 3 hours. The reaction mixture was concentrated, water (100 mL) was added, and the mixture was neutralized with 2N hydrochloric acid and a saturated aqueous solution of sodium hydrogen carbonate. The mixture was extracted with ethyl acetate, and the organic layer was washed with saturated saline. The extract was dried over magnesium sulfate, filtered and concentrated. The residue was purified by silica gel column chromatography (hexane-ethyl acetate, 2: 1) to obtain 6.4 g (19 mmol, yield 70%) of the title compound. Oil. ¹ H-NMR (CDCI ₃ ) δ: 2.39 (6H, s), 4.33 (2H, s), 6.98-
7.01 (1H, m), 7.23 (1H, s), 7.45-7.58 (3H, m), 7.63
(2H, s), 7.89-7-94 (2H, m), 8.21 (1H, d, J = 5.2 Hz),
8.36 (1H, s), 8.71 (1H, br).

Reference Example 13 The following Reference Example Compounds 13-1 and 13-2 were prepared according to Reference Example 5 using 3-methylbenzoyl chloride and 3-methoxybenzoyl chloride instead of 4-methoxybenzoyl chloride. Synthesized. Reference Example Compound 13-1: N- (3-methylbenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.39 (3H, d, J = 5.5 Hz), 2.14
(1H, d, J = 3.3 Hz), 2.41 (3H, s), 2.51-2.66 (2H,
m), 7.32-7.39 (2H, m), 7.79-7.87 (2H, m). Reference Example Compound 13-2: N- (3-methoxybenzoyl) propyleneimine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.40 (3H, d, J = 5.9 Hz), 2.14
(1H, d, J = 2.9 Hz), 2.52-2.65 (2H, m), 3.86 (3H,
s), 7.10 (1H, ddd, J = 8.4, 2.6, 1.1 Hz), 7.37 (1H,
dd, J = 8.4, 7.3 Hz), 7.55 (1H, dd, J = 2.6, 1.5 H
z), 7.63 (1H, ddd, J = 7.3, 1.5, 1.1 Hz). Reference Example 14 According to Reference Example 6, N- (3-methylbenzoyl) was used instead of N- (4-methoxybenzoyl) propyleneimine. The following Reference Example Compound 14 was synthesized using propylene imine. Reference Example Compound 14: 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone Melting point 144-146 ° C. Reference Example 15 4- (Methylthio) thiobenzamide 4-Methylthiobenzonitrile (12 g) was dissolved in a 4N solution of hydrogen chloride in ethyl acetate (130 mL). To this solution was added O, O-diethyl dithiophosphate (15 mL) and the mixture was stirred at room temperature for 22 hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. After filtering the insoluble matter, the filtrate was washed with saturated saline and dried, and then the solvent was distilled off. The residue was recrystallized from ethyl acetate to give the title compound (10 g).
(67% yield). 176-178 ° C.

Reference Example 16 In accordance with Reference Example 15, 4-fluorobenzonitrile, 2-chlorobenzonitrile, butyronitrile and valeronitrile were used in place of 4-methylthiobenzonitrile, and the following Reference Example Compound 16-1 was used. ~ 16-4 were synthesized. Reference example compound 16-1: 4-fluorothiobenzamide Melting point: 156-157 ° C. Reference Example Compound 16-2: 2-chlorothiobenzamide melting point 58-59 ° C. Reference example compound 16-3: thiobutylamide oil. ¹ H-NMR (CDCl ₃ ) δ: 0.99 (3H, t, J = 7.6 Hz), 1.72-
1.93 (2H, m), 2.64 (2H, t, J = 7.6 Hz), 7.02 (1H, b
rs), 7.77 (1H, brs). Reference Example Compound 16-4: Thiovaleramide Oil. ¹ H-NMR (CDCl ₃ ) δ: 0.94 (3H, t, J = 7.3 Hz), 1.31-
1.49 (2H, m), 1.68-1.83 (2H, m), 2.67 (2H, t, J =
7.7 Hz), 6.92 (1H, br s), 7.73 (1H, br s). Reference Example 17 4- [2-methyl-4- (3-methylphenyl) -1,
3-thiazol-5-yl] -2-pyridylamine 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1
To a solution of-(3-methylphenyl) ethanone (6.0 g, 18 mmol) in acetic acid (50 mL) was added bromine (1.0 mL, 18 mmol).
The mixture was stirred at room temperature for 30 minutes. The reaction mixture was concentrated. The residue was dissolved in N, N-dimethylformamide (50 mL), thioacetamide (1.4 g, 19 mmol) was added to the solution, and the mixture was stirred at room temperature for 20 hours. To the reaction mixture was added a saturated aqueous sodium hydrogen carbonate solution (200 mL), and the mixture was extracted with ethyl acetate. The extract was dried and the solvent was distilled off.
To the obtained solid was added 2N-hydrochloric acid (30 mL), and the mixture was added to 100 mL.
Stirred at ℃ for 1 hour. After the reaction mixture was cooled to room temperature, it was made basic with a 2N aqueous sodium hydroxide solution (200 mL) and a saturated aqueous sodium hydrogen carbonate solution. The obtained mixture was extracted with ethyl acetate, and the extract was washed with water. The extract was dried and concentrated. The residue was purified by silica gel column chromatography (ethyl acetate) to give the title compound (2.8 g).
(54% yield). 152-153 ° C.

Reference Example 18 The following Reference Example Compounds 18-1 and 18-2 were synthesized according to Reference Example 17 using thiopropionamide and 4- (methylthio) thiobenzamide, respectively, instead of thioacetamide. Reference Example Compound 18-1: 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine Melting point: 144-146 ° C. Reference Example Compound 18-2: 4- [4- (3-methylphenyl) -2
-(4-Methylthiophenyl) -1,3-thiazol-5-yl]-
2-pyridylamine mp 181-183 ° C. Reference Example 19 According to Reference Example 17, 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone was used instead of 1- (4-methoxyphenyl) -2- ( The following Reference Example Compound 19 was synthesized using 2-tert-butoxycarbonylamino-4-pyridyl) ethanone. Reference Example Compound 19: 4- [4- (4-methoxyphenyl) -2-
Methyl-1,3-thiazol-5-yl] -2-pyridylamine mp 140-141 ° C. Reference Example 20 According to Reference Example 8, 1- (4-methoxyphenyl) -2- (2-ter
Instead of t-butoxycarbonylamino-4-pyridyl) ethanone, use 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1- (3-methylphenyl) ethanone,
The following Reference Example Compound 20 was synthesized. Reference Example Compound 20: 2- (2-amino-4-pyridyl) -1- (3-
Methylphenyl) ethanone melting point 119-120 ° C. Reference Example 21 2- (2-amino-4-pyridyl) -2-bromo-1-
(3-methylphenyl) ethanone hydrobromide 2- (2-tert-butoxycarbonylamino-4-pyridyl) -1
To a solution of-(3-methylphenyl) ethanone (20 g, 61 mmol) in acetic acid (60 mL) was added bromine (3.2 mL, 62 mol), and the mixture was stirred at 80 ° C for 2 hours. After cooling the reaction mixture to room temperature, the obtained solid was collected by filtration to give the title compound (19 g).
(81% yield). 182-185 ° C.

Reference Example 22 According to Reference Example 9, 2- (2-amino-4-pyridyl) -1- (4-methoxyphenyl) ethanone was replaced with 2- (2-amino-4
The following Reference Example Compound 22 was synthesized using -pyridyl) -1- (3-methylphenyl) ethanone. Reference Example Compound 22: N- [4- [2- (3-methylphenyl) -2
-Oxoethyl] -2-pyridyl] benzamide Melting point 67-69 ° C. Reference Example 23 4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine 2- (2-amino-4-pyridyl) 2-bromo-1- (3-methylphenyl) ethanone hydrobromide (5.0 g, 13 mmol) with N,
After dissolving in N-dimethylformamide (40 mL), 4-fluorothiobenzamide (2.1 g, 13 mmol) was added to the solution, and the mixture was stirred at room temperature for 16 hours. To the reaction mixture was added a saturated aqueous sodium hydrogen carbonate solution (200 mL), and the mixture was extracted with ethyl acetate. The extract was dried and the solvent was distilled off. The title compound was obtained by recrystallizing the residue from ethanol.
3.9 g (11 mmol, yield 83%) were obtained. 160-162 ° C. Reference Example 24 Following Reference Example 23, the following Reference Example Compounds 24-1 to 24-3 were synthesized using 2-chlorothiobenzamide, thiobutylamide and thiovaleramide, respectively, instead of 4-fluorothiobenzamide. did. Reference Example Compound 24-1: 4- [2- (2-chlorophenyl) -4
-(3-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine mp 175-177 ° C. Reference Example Compound 24-2: 4- [4- (3-methylphenyl) -2
-Propyl-1,3-thiazol-5-yl] -2-pyridylamine mp 113-115 ° C. Reference Example Compound 24-3: 4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine oil. ¹ H-NMR (CDCl ₃ ) δ: 0.98 (3H, t, J = 7.3 Hz), 1.39-
1.59 (2H, m), 1.74-1.92 (2H, m), 2.34 (3H, s), 3.0
4 (2H, t, J = 7.4 Hz), 4.14 (2H, br s), 6.44 (1H,
s), 6.56 (1H, dd, J = 5.1, 1.5 Hz), 7.09-7.26 (3H,
m), 7.41 (1H, s), 7.96 (1H, d, J = 5.4 Hz).

Reference Example 25 2-Fluoro-4-methylpyridine Journal of Medicinal Chemistry (J
ownnal of Medicinal Chemis
try), 33, pp. 1667-1675, 1990. Boiling point 82-86 ° C (10kPa). Reference Example 26 2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl) ethanone Diisopropylamine (44 mL, 0.3
1 mol) in anhydrous tetrahydrofuran (300 mL)
After cooling to ℃, stirring, a 1.6 M n-butyllithium hexane solution (190 mL, 0.31 mol) was added dropwise. After completion of the dropwise addition, the mixture was stirred for 10 minutes, and then 2-fluoro-4-methylpyridine (34.5 g, 0.31 mol) in anhydrous tetrahydrofuran (30 ml) was added.
mL) solution was added. The reaction mixture was stirred at −10 ° C. for 30 minutes. The reaction solution was cooled to -78 ° C, and a solution of N- (3-methylbenzoyl) propyleneimine (52 g, 0.30 mol) in anhydrous tetrahydrofuran (30 mL) was added dropwise. After completion of the dropwise addition, the mixture was stirred at room temperature for 2 hours. Water (100 mL) was added to the reaction mixture, and the mixture was extracted with ethyl acetate. After the extract is washed with water and dried,
The solvent was distilled off. The residue was recrystallized from isopropyl ether to give the title compound (35 g, yield 52%). Mp 66-67 ° C. Reference Example 27 Following Reference Example 26, the following Reference Example Compound 27 was synthesized using N- (3-methoxybenzoyl) propyleneimine instead of N- (3-methylbenzoyl) propyleneimine. Reference Example Compound 27: 2- (2-fluoro-4-pyridyl) -1-
(3-methoxyphenyl) ethanone oil. ¹ H-NMR (CDCl ₃ ) δ: 3.86 (3H, s), 4.31 (2H, s), 6.
86 (1H, s), 7.03-7.19 (2H, m), 7.31-7.59 (3H, m),
8.18 (1H, d, J = 5.6 Hz).

Reference Example 28 [5- (2-Fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl]
Amine 2- (2-fluoro-4-pyridyl) -1- (3-methylphenyl)
Bromine (1.9 mL, 37 mmol) was added to a solution of ethanone (8.5 g, 37 mmol) in acetic acid (50 mL), and the mixture was stirred at room temperature for 1 hour.
The reaction mixture was concentrated. This residue and thiourea (3.0 g, 4
Triethylamine (5.2 mL, 37 mmol) was added to a mixture of 0 mmol) of acetonitrile (50 mL), and the mixture was stirred at 80 ° C for 2 hours. A saturated aqueous sodium hydrogen carbonate solution (50 mL) was poured into the reaction mixture, and the precipitated solid was collected by filtration. The obtained solid was washed with water and dried. The crude crystals were recrystallized from ethanol to give the title compound (3.7 g, yield 35%). Melting point 214-218 ° C. Reference Example 29 According to Reference Example 28, 2- (2-fluoro-4-pyridyl) -1-
The following Reference Example Compound 29 was synthesized using 2- (2-fluoro-4-pyridyl) -1- (3-methoxyphenyl) ethanone instead of (3-methylphenyl) ethanone. Reference Example Compound 29: [5- (2-fluoro-4-pyridyl) -4-
(3-Methoxyphenyl) -1,3-thiazol-2-yl] amine mp 190-191 ° C.

Reference Example 30 5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole 2- (2-fluoro-4- Pyridyl) -1- (3-methylphenyl)
Bromine (2.7 mL, 52 mmol) was added to a solution of ethanone (12 g, 53 mmol) in acetic acid (90 mL), and the mixture was stirred at room temperature for 2 hours.
The reaction mixture was concentrated. This residue was dissolved in N, N-dimethylformamide (60 mL), 4- (methylthio) thiobenzamide (9.6 g, 52 mmol) was added, and the mixture was stirred at room temperature for 15 hours. A saturated aqueous solution of sodium hydrogen carbonate (100 mL) was poured into the reaction mixture, and the mixture was extracted with ethyl acetate. After the extract was washed with water and dried, the solvent was distilled off. The residue is subjected to silica gel column chromatography (hexane: ethyl acetate, 4: 1)
Then, 4.7 g (yield 23%) of the title compound was obtained. 97-100 ° C. Reference Example 31 5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-
Thiazole 5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl)
-2- (4-methylthiophenyl) -1,3-thiazole (2.7 g,
M-Chloroperbenzoic acid (3.3 g, 14 mmol) was added to a solution of 6.9 mmol) in N, N-dimethylformamide (60 mL), and the mixture was stirred at room temperature for 1 hour. An 8N aqueous sodium hydroxide solution was added to the reaction mixture, and the obtained solid was collected by filtration. The solid was recrystallized from ethanol to give the title compound (2.5 g).
(85% yield). Mp 196-199 ° C.

Example 1 [4- (3,5-dimethylphenyl) -5-
(2-phenylmethyloxy-4-pyridyl) -1,3-thiazole
-2-yl] amine 2-bromo-1- (3,5-dimethylphenyl) -2- (2-phenylmethyloxy-4-pyridyl) ethanone hydrobromide (4.8 g,
9.8 mmol) and thiourea (0.77 g, 11 mmol) in acetonitrile (40 mL) were added to triethylamine (1.4 mL, 1
0 mmol) was added dropwise and the mixture was stirred at room temperature for 3 hours. The solvent was concentrated under reduced pressure, a saturated aqueous sodium hydrogen carbonate solution was added to the residue, and the mixture was extracted with ethyl acetate. The organic layer was washed with water, dried, and the solvent was distilled off. The obtained crude crystals were recrystallized from ethyl acetate to give 2.0 g (5.2 mmol, yield 53%) of the title compound.
I got 141-143 ° C. Example 2 N- [4- [2-benzoylamino-4- (4-methoxyphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide 4- [2-amino-4- (4 -Methoxyphenyl) -1,3-thiazol-5-yl] -2-pyridylamine (0.42 g, 1.4 mmol)
To a solution of N, N-dimethylacetamide (10 mL) were added benzoyl chloride (0.59 g, 4.2 mmol) and 4-dimethylaminopyridine (0.05 g, 0.4 mmol).
Stir for hours. After the reaction mixture was cooled to room temperature, a saturated aqueous sodium hydrogen carbonate solution (50 mL) was added. The obtained crude crystals were collected by filtration and washed with water. The crude compound was recrystallized from ethanol to give the title compound 0.26 g (0.51 m
mol, yield 37%). 230-233 ° C. Example 3 N- [4- (4-methoxyphenyl) -5- [2-[(3-
Pyridylcarbonylamino)]-4-pyridyl] -1,3-thiazol-2-yl] nicotinamide 4- [2-amino-4- (4-methoxyphenyl) -1,3-thiazol-5-yl]- 2-pyridylamine (0.41 g, 1.4 mmol)
To a solution of N, N-dimethylacetamide (10 mL) were added nicotinic acid chloride hydrochloride (0.72 g, 4.1 mmol) and 4-dimethylaminopyridine (0.05 g, 0.4 mmol), and the mixture was added.
Stir at 70 ° C. for 19 hours. After the reaction mixture was cooled to room temperature, a saturated aqueous sodium hydrogen carbonate solution (50 mL) was added. The obtained crude crystals were collected by filtration and washed with water. The crude compound was recrystallized from ethanol to give the title compound 0.23
g (0.44 mmol, yield 33%) was obtained. 229-232 ° C.

Example 4 N- [4- [2-amino-4- (4-methoxyphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide 2- (2-benzoylamino-4 To a solution of -pyridyl) -1- (4-methoxyphenyl) ethanone (0.72 g, 2.1 mmol) in acetic acid (20 mL) was added bromine (0.11 mL, 2.1 mmol) at 0 ° C, and the mixture was stirred at room temperature for 1 hour. . The reaction mixture was concentrated. The residue was dissolved in acetonitrile (20 mL), and thiourea (0.17 g, 2.2 mmol) and triethylamine (0.3
5 mL, 2.5 mmol) was added and the mixture was stirred at 80 ° C. for 5 hours. After cooling the reaction mixture to room temperature, a saturated aqueous sodium hydrogen carbonate solution (200 mL) was added, and the obtained solid was collected by filtration and washed with water. The obtained crude crystals were collected by filtration and washed with water.
The crude crystals were recrystallized from ethanol to give 0.17 g (0.43 mmol, 21% yield) of the title compound. 221-224 ° C. Example 5 N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide 2- (2-benzoylamino-4- Pyridyl) -1- (3,5-dimethylphenyl) ethanone (6.4 g, 19 mmol) in acetic acid (80 m
L) Bromine (1.0 mL, 19 mmol) was added to the solution at 0 ° C and the mixture was stirred at room temperature for 1 hour. The reaction mixture was concentrated.
The residue was dissolved in acetonitrile (100 mL), and thiourea (1.5 g, 19 mmol) and triethylamine (2.8
mL, 20 mmol) was added and the mixture was stirred at 80 ° C. for 3 hours. After cooling the reaction mixture to room temperature, a saturated aqueous sodium hydrogen carbonate solution (200 mL) was added, and the obtained solid was collected by filtration and washed with water. The obtained crude crystals were collected by filtration and washed with water. The crude crystals were recrystallized from ethanol to give 5.0 g (13 mmol, yield 68%) of the title compound. 120-123 ° C. Example 6 N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzylamine aluminum chloride (0.55 g, 4.1 mmol) Lithium aluminum hydride (0.16 g, 4.1 mmol) was added to a suspension of anhydrous tetrahydrofuran (30 mL) and stirred at room temperature for 15 minutes. To the solution, N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (0.40 g, 1.0 mmol) in anhydrous tetrahydrofuran (10 mL) solution was added and the mixture was heated at reflux for 2 hours. After cooling the reaction mixture to room temperature, water was added and extracted with ethyl acetate. The organic layer was washed with brine, dried over magnesium sulfate, filtered, and concentrated. The residue is ethyl acetate
0.20 g of the title compound by recrystallization from -hexane
(0.51 mmol, 51% yield). Mp 99-102 ° C.

Example 7 N- [4- [2-Amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide hydrochloride N- [4- [2-Amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (0.45 g
, 1.1 mmol) in methanol (30 mL), 10% hydrogen chloride in methanol (10 mL) was added and the mixture was stirred at room temperature for 30 minutes. The solvent was distilled off, and the residue was recrystallized from methanol to give the title compound (0.36 g, 0.83 m
mol, yield 73%). 202-207 ° C. Example 8 N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzylamine dihydrochloride N- [4- [ 2-amino-4- (3,5-dimethylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] benzylamine (0.
80 g, 2.1 mmol) in methanol (50 mL).
A solution of 10% hydrogen chloride in methanol (10 mL) was added and the mixture was stirred at room temperature for 5 hours. The solvent was distilled off, and the residue was recrystallized from methanol-ethyl acetate to obtain 0.73 g (1.6 mmol, yield 76%) of the title compound. 161-163 ° C.

The structural formulas of the compounds obtained in Examples 1 to 6 are shown below. Example 1

Embedded image

Embodiment 2

Embedded image

Embodiment 3

Embedded image

Embodiment 4

Embedded image

Embodiment 5

Embedded image

Embodiment 6

Embedded image

Example 9 N- [5- (2-benzoylamino-4)
-Pyridyl) -4- (3,5-dimethylphenyl) -1,3-thiazol-2-yl] acetamide N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3 -Thiazol-5-yl] -2-pyridyl] benzamide (0.96
g, 2.4 mmol) in N, N-dimethylacetamide (20 mL), acetyl chloride (0.26 mL, 3.7 mmol) and 4-dimethylaminopyridine (0.09 g, 0.76 mmol) were added, and the mixture was heated at 70 ° C. for 16 hours. Stirred. After the reaction mixture was cooled to room temperature, a saturated aqueous sodium hydrogen carbonate solution (50 mL) was added. The obtained crude crystals were collected by filtration and washed with water. The crude compound was recrystallized from ethyl acetate to give the title compound.
0.32 g (30% yield) was obtained. 238-241 ° C. Example 10 According to Example 9, instead of N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, Using N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-benzylamine, the following example compounds 10 was synthesized. Example compound 10: N- [5- (2-benzylamino-4-pyridyl) -4- (3,5-dimethylphenyl) -1,3-thiazole-2
-Yl] acetamide mp 217-219 ° C. Example 11 The following Example compound 11 was synthesized according to Example 4, using N-methylthiourea instead of thiourea. Example compound 11: N- [4- [4- (4-methoxyphenyl)
2-Methylamino-1,3-thiazol-5-yl] -2-pyridyl] benzamide mp 237-241 ° C.

Example 12 According to Example 4, N- (2-benzoylamino-4-pyridyl) -1- (4-methoxyphenyl) ethanone was replaced by N
-[4- [2- (3-methylphenyl) -2-oxoethyl] -2-
The following Example Compound 12 was synthesized using [pyridyl] benzamide. Example compound 12: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide Melting point 216-217 ° C. Example 13 N- [4- [4- (4-methoxyphenyl) -2-methyl-1,3-thiazol-5-yl] -2-pyridyl] benzamide 2- (2-benzoylamino-4-pyridyl) Acetic acid (10 m) of -1- (4-methoxyphenyl) ethanone (1.2 g, 3.4 mmol)
L) Bromine (0.18 mL, 3.5 mmol) was added to the solution and the mixture was stirred at room temperature for 30 minutes. The reaction mixture was concentrated. The residue was dissolved in N, N-dimethylformamide (20 mL), and thioacetamide (0.30 g, 19 mmol) was added to the solution.
The mixture was stirred at room temperature for 20 hours. A saturated aqueous sodium hydrogen carbonate solution (20 mL) was added to the reaction mixture, and the resulting mixture was extracted with ethyl acetate, and the extract was washed with water. The extract was dried and concentrated. The residue was purified by silica gel column chromatography (hexane: ethyl acetate, 1: 1) to give the title compound (0.68 g, yield 50%). 134-135 ° C. Example 14 N- [4- [2- (4-fluorophenyl) -4- (3
-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide 4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazole-5 -Yl] -2-pyridylamine (0.8
To a solution of 1 g (2.2 mmol) in tetrahydrofuran (20 mL) were added phenylacetyl chloride (0.33 mL, 2.5 mmol) and triethylamine (0.31 mL, 2.2 mmol), and the mixture was stirred at room temperature for 13 hours. A saturated aqueous sodium hydrogen carbonate solution (20 mL) was added to the reaction mixture, and the resulting mixture was extracted with ethyl acetate, and the extract was washed with water. The extract was dried and concentrated. The residue was purified by silica gel column chromatography (hexane: ethyl acetate, 2: 1) to give the title compound (0.86 g, yield 80%). Melting point 187-190 ° C.

Example 15 According to Example 14, 4- [2- (4-fluorophenyl) -4-
Instead of (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (4-methoxyphenyl) -2-methyl-1,3-thiazole-5- Yl] -2-pyridylamine, 4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, 4- [4- (3-methylphenyl) ) -2-Propyl-1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-butyl-4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridylamine, 4- [2-
(2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine and 4- [4- (3-
The following Example compounds 15-1 to 15-6 were synthesized using methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridylamine, respectively. Example compound 15-1: N- [4- [4- (4-methoxyphenyl) -2-methyl-1,3-thiazol-5-yl] -2-pyridyl]
Phenylacetamide mp 118-120 ° C. Example compound 15-2: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Phenylacetamide mp 107-108 ° C. Example compound 15-3: N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide mp 109-111 ° C. Example compound 15-4: N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Phenylacetamide mp 92-93 ° C. Example compound 15-5: N- [4- [2- (2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide Melting point 141- 142 ° C. Example compound 15-6: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] phenylacetamide melting point 205-206 ° C.

Example 16 According to Examples 14 and 15, instead of phenylacetyl chloride, benzoyl chloride, 3-phenylpropionyl chloride, 3- (4-methoxyphenyl) propionyl chloride,
Using 3- (4-fluorophenyl) propionyl chloride, 4-phenylbutyryl chloride, 5-phenylvaleryl chloride, 2-thiophenecarbonyl chloride and 2-naphthoyl chloride, the following Example compounds 16-1 to 16-1 were used. 16-1
8 was synthesized. Example compound 16-1: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Benzamide mp 113-114 ° C. Example compound 16-2: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
3-phenylpropionamide melting point 126-127 ° C. Example compound 16-3: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
3- (4-methoxyphenyl) propionamide melting point 137-138 ° C. Example compound 16-4: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
3- (4-fluorophenyl) propionamide melting point 116-117 ° C. Example compound 16-5: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
4-Phenylbutyramide Melting point 92-93 ° C. Example compound 16-6: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
5-phenylvaleramide melting point 86-87 ° C. Example compound 16-7: N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] benzamide amorphous powder. ¹ H-NMR (CDCl ₃ ) δ: 1.08 (3H, t, J = 7.1 Hz), 1.80-
1.99 (2H, m), 2.34 (3H, s), 3.04 (2H, t, J = 7.7 H
z), 6.88 (1H, dd, J = 5.2, 1.7 Hz), 7.15-7.63 (7H,
m), 7.90-7.95 (2H, m), 8.11 (1H, d, J = 5.2 Hz), 8.
Example Compound 16-8: N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl 51 (1H, s), 8.61 (1H, br s). ] -2-Pyridyl] -3-phenylpropionamide mp 103-104 ° C. Example compound 16-9: N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Benzamide Amorphous powder. ¹ H-NMR (CDCl ₃ ) δ: 0.99 (3H, t, J = 7.2 Hz), 1.40-
1.60 (2H, m), 1.76-1.93 (2H, m), 2.34 (3H, s), 3.0
6 (2H, t, J = 7.7 Hz), 6.88 (1H, dd, J = 5.0, 1.7 H
z), 7.10-7.26 (3H, m), 7.41 (1H, s), 7.46-7.61 (3
H, m), 7.94 (2H, dd, J = 8.1, 1.5 Hz), 8.10 (1H, d,
J = 5.0 Hz), 8.52 (1H, s), 8.71 (1H, br s). Example compound 16-10: N- [4- [2-butyl-4- (3-methylphenyl) -1,3 -Thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide mp 77-78 ° C. Example compound 16-11: N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide mp 126- 128 ° C. Example compound 16-12: N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropyi Onamide mp 169-171 ° C. Example compound 16-13: N- [4- [2- (2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide Melting point 138-140 ° C. Example compound 16-14: N- [4- [2- (2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropion Amide mp 156-158 ° C. Example compound 16-15: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] benzamide melting point 180-182 ° C. Example compound 16-16: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] -3-phenylpropionamide mp 174-175 ° C. Example compound 16-17: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] -2-thiophenecarboxamide melting point 145-147 ° C. Example compound 16-18: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] -2-naphthamide mp 184-186 ° C.

Example 17 N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-methylphenylacetamide N- [4 -[2-Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide (0.
50 g, 1.2 mmol) in a solution of dimethyl sulfoxide (5 mL) in sodium hydride (60% paraffin dispersion, 58 mg,
1.5 mmol) and stirred at room temperature for 1 hour. Methyl iodide (0.09 mL, 1.5 mmol) was added to the reaction solution, and the mixture was stirred at room temperature for 1 hour. A 10% aqueous ammonium chloride solution was added to the reaction mixture, and the mixture was extracted with ethyl acetate. The extract was washed with saturated saline, dried and concentrated. The residue was subjected to silica gel column chromatography (hexane: ethyl acetate,
Purify 7: 1 → 4: 1) and wash with hexane to give the title compound
0.18 g (35% yield) was obtained. 75-76 ° C. Example 18 According to Example 17, N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide was replaced with N -[4- [2-ethyl-4- (3
Example Compound 18 shown below was synthesized using -methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide. Example compound 18: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-methyl-3-phenylpropionamide oil object. ¹ H-NMR (CDCl ₃ ) δ: 1.46 (3H, t, J = 7.5 Hz), 2.32
(3H, s), 2.51 (2H, t, J = 7.9 Hz), 2.93 (2H, t, J =
7.9 Hz), 3.10 (2H, q, J = 7.5 Hz), 3.22 (3H, s), 6.
98 (1H, s), 7.03-7.29 (9H, m), 7.37 (1H, s), 8.37
(1H, d, J = 3.6Hz).

Example 19 According to Example 6, N- [4- [2-amino-4- (3,5-dimethylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide N- [4- [4- (4-methoxyphenyl) -2-methyl-1,3-thiazol-5-yl] -2-pyridyl] instead
Benzamide, N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] phenylacetamide, N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3 -Phenylpropionamide, N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [4- ( 3-methylphenyl) -2-propyl-1,3-
Thiazol-5-yl] -2-pyridyl] phenylacetamide, N- [4- [4- (3-methylphenyl) -2-propyl-1,3-
Thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide, N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2- Pyridyl] benzamide, N- [4- [2-butyl-4- (3-methylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] phenylacetamide, N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3 -Phenylpropionamide, N- [4- [2- (4-fluorophenyl) -4- (3-
Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [2- (4-fluorophenyl)
-4- (3-Methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] phenylacetamide, N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide N- [4- [2- (2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [2- ( 2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N- [4- [2- (2-chlorophenyl) -4- (3 -Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide, N-
[4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [4- (3- Methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N- [4- [4- (3-methylphenyl) -2- (4 -Methylthiophenyl) -1,3-thiazole-5
-Yl] -2-pyridyl] -3-phenylpropionamide and N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl]- 2-pyridyl]-
The following Example compounds 19-1 to 19-20 were synthesized using 2-naphthamide, respectively.

Example compound 19-1: N-benzyl-N- [4
-[4- (4-Methoxyphenyl) -2-methyl-1,3-thiazol-5-yl] -2-pyridyl] amine mp 132-133 ° C. Example compound 19-2: N-benzyl-N- [4- [2-ethyl-
4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] amine mp 106-107 ° C. Example compound 19-3: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (2-phenylethyl) amine mp 97-98 ° C. Example compound 19-4: N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (3-phenylpropyl) amine Melting point 52-53 ° C Example compound 19-5: N-benzyl-N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazole- 5-yl]-
2-Pyridyl] amine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.06 (3H, t, J = 7.4 Hz), 1.77-
1.96 (2H, m), 2.33 (3H, s), 3.00 (2H, t, J = 7.7 H
z), 4.38 (2H, d, J = 5.4 Hz), 4.83 (1H, brt), 6.32
(1H, s), 6.53 (1H, dd, J = 5.4, 1.6 Hz), 7.10-7.40
(9H, m), 8.01 (1H, d, J = 5.4 Hz). Example compound 19-6: N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazole- 5-yl] -2-pyridyl] -N- (2-phenylethyl) amine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.08 (3H, t, J = 7.5 Hz), 1.78-
1.93 (2H, m), 2.32 (3H, s), 2.81 (2H, t, J = 7.0 H
z), 3.01 (2H, t, J = 7.7 Hz), 3.42 (2H, dt, J = 6.2,
7.0 Hz), 4.52 (1H, br t), 6.30 (1H, s), 6.51 (1H, d
d, J = 5.2, 1.5Hz), 7.11-7.34 (8H, m), 7.43 (1H,
s), 8.00 (1H, d, J = 5.2 Hz). Example compound 19-7: N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl ] -2-Pyridyl] -N- (3-phenylpropyl) amine oil. ¹ H-NMR (CDCl ₃ ) δ: 1.08 (3H, t, J = 7.4 Hz), 1.78-
1.93 (4H, m), 2.32 (3H, s), 2.66 (2H, t, J = 7.2 H
z), 3.01 (2H, t, J = 7.7 Hz), 3.16 (2H, dt, J = 6.2,
7.2 Hz), 4.52 (1H, br s), 6.26 (1H, s), 6.49 (1H, d
d, J = 5.2, 1.5Hz), 7.07-7.32 (8H, m), 7.42 (1H,
Example compound 19-8: N-benzyl-N- [4- [2-butyl-s), 7.98 (1H, d, J = 5.2 Hz).
4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] amine oil. ¹ H-NMR (CDCl ₃ ) δ: 0.97 (3H, t, J = 7.3 Hz), 1.38-
1.59 (2H, m), 1.73-1.90 (2H, m), 2.33 (3H, s), 3.0
2 (2H, t, J = 7.7 Hz), 4.37 (2H, d, J = 5.7 Hz), 4.83
(1H, t, J = 7.3 Hz), 6.31 (1H, s), 6.52 (1H, d, J =
5.5 Hz), 7.09-7.43 (9H, m), 8.00 (1H, d, J = 5.5 H
z). Example compound 19-9: N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (2-phenylethyl) amine oil. ¹ H-NMR (CDCl ₃ ) δ: 0.98 (3H, t, J = 7.3 Hz), 1.39-
1.59 (2H, m), 1.74-1.92 (2H, m), 2.32 (3H, s), 2.8
1 (2H, t, J = 7.0 Hz), 3.04 (2H, t, J = 7.7 Hz), 3.41
(2H, dt, J = 6.1, 7.0 Hz), 4.55 (1H, t, J = 6.1 H
z), 6.30 (1H, s), 6.51 (1H, d, J = 5.1 Hz), 7.06-7.1
9 (3H, m), 7.20-7.38 (5H, m), 7.43 (1H, s), 7.99
(1H, d, J = 5.1 Hz). Example compound 19-10: N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2- Pyridyl] -N- (3-phenylpropyl) amine oil. ¹ H-NMR (CDCl ₃ ) δ: 0.98 (3H, t, J = 7.1 Hz), 1.39-
1.57 (2H, m), 1.75-1.98 (4H, m), 2.32 (3H, s), 2.67
(2H, t, J = 7.8 Hz), 3.04 (2H, t, J = 7.7 Hz), 3.16
(2H, dt, J = 5.9, 6.2 Hz), 4.52 (1H, t, J = 5.9 H
z), 6.26 (1H, s), 6.49 (1H, d, J = 5.1 Hz), 7.06-7.38
(8H, m), 7.42 (1H, s), 7.97 (1H, d, J = 5.1 Hz). Example Compound 19-11: N-benzyl-N- [4- [2- (4-
Fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine mp 143-146 ° C. Example compound 19-12: N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- ( 2-phenylethyl) amine mp 97-98 ° C. Example compound 19-13: N- [4- [2- (4-fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- ( 3-phenylpropyl) amine mp 110-112 ° C. Example compound 19-14: N-benzyl-N- [4- [2- (2-
Chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine mp 84-86 ° C. Example compound 19-15: N- [4- [2- (2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2 -Phenylethyl) amine mp 113-114 ° C. Example compound 19-16: N- [4- [2- (2-chlorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3 -Phenylpropyl) amine mp 101-102 ° C. Example compound 19-17: N-benzyl-N- [4- [4- (3-
Methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine mp 134-136 ° C. Example compound 19-18: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] -N- (2-phenylethyl) amine mp 137-139 ° C. Example compound 19-19: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] -N- (3-phenylpropyl) amine mp 106-107 ° C. Example compound 19-20: N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] -N- (2-naphthylmethyl) amine mp 144-145 ° C.

Example 20 N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide N- [ N, N-dimethyl of 4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide (0.50 g, 1.0 mmol) To a formamide (5 mL) solution was added m-chloroperbenzoic acid (0.55 g, 2.2
mmol) and stirred at room temperature for 1 hour. 8 in the reaction mixture
An aqueous solution of N-sodium hydroxide was added, and the obtained solid was collected by filtration. The solid was recrystallized from ethanol to give the title compound (0.29 g, yield 54%). 212-214 ° C.

Example 21 According to Example 20, N- [4- [4- (3-methylphenyl) -2
-(4-Methylthiophenyl) -1,3-thiazol-5-yl]-
N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide instead of 2-pyridyl] benzamide
N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide, N- [4 -[4- (3-Methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] -2-thiophenecarboxamide, N-
[4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] -2-naphthamide, N-benzyl-N- [4 -[4- (3-Methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole-5-
Yl] -2-pyridyl] amine, N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole
-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine and N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazole The following Example Compounds 21-1 to 21-7 were synthesized using -5-yl] -2-pyridyl] -N- (2-naphthylmethyl) amine, respectively.

Example compound 21-1: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,
3-thiazol-5-yl] -2-pyridyl] phenylacetamide mp 244-245 ° C. Example compound 21-2: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3- Phenylpropionamide melting point 236-237 ° C. Example compound 21-3: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -2- Thiophenecarboxamide melting point 199-201 ° C. Example compound 21-4: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -2- Naphthamide melting point 231-233 ° C. Example compound 21-5: N-benzyl-N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,
3-thiazol-5-yl] -2-pyridyl] amine mp 148-150 ° C. Example compound 21-6: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl)
Amine mp 167-168 ° C. Example compound 21-7: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-Naphthylmethyl) amine mp 167-168 ° C.

Example 22 N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-benzylamine [5- (2 -Fluoro-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] amine (0.29 g, 1.0 mmo
l) and benzylamine (1.2 mL, 11 mmol) in 15
Stir at 0 ° C. for 3 hours. After cooling the reaction mixture to room temperature, a saturated aqueous sodium hydrogen carbonate solution (20 mL) was added,
The obtained mixture was extracted with ethyl acetate, and the extract was washed with water. The extract was dried and concentrated. The residue was subjected to silica gel column chromatography (hexane: ethyl acetate,
Purification by 1: 1) afforded 0.16 g (41% yield) of the title compound. 178-179 ° C.

Example 23 According to Example 22, instead of benzylamine, 4-methoxybenzylamine, 3-methoxybenzylamine, 2-methoxybenzylamine, 4-chlorobenzylamine, 3-chlorobenzylamine, (R ) -1-phenylethylamine,
Example Compound 23 shown below was prepared using (S) -1-phenylethylamine and N-benzyl-N-methylamine, respectively.
-1 to 23-8 were synthesized. Example compound 23-1: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (4-methoxybenzyl) amine mp 183-184 ° C. Example compound 23-2: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (3-methoxybenzyl) amine mp 152-154 ° C. Example compound 23-3: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (2-methoxybenzyl) amine mp 158-159 ° C. Example compound 23-4: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (4-chlorobenzyl) amine mp 182-183 ° C. Example compound 23-5: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (3-chlorobenzyl) amine melting point 180-181 ° C. Example compound 23-6: (R) -N- [4- [2-amino-4- (3
-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (1-phenylethyl) amine mp 94-98 ° C. Example compound 23-7: (S) -N- [4- [2-amino-4- (3
-Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (1-phenylethyl) amine mp 93-96 ° C. Example compound 23-8: N- [4- [2-amino-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N-benzyl-N-methylamine mp 138-140 ° C.

Example 24 According to Example 22, [5- (2-fluoro-4-pyridyl) -4-
Instead of (3-methylphenyl) -1,3-thiazol-2-yl] amine, [5- (2-fluoro-4-pyridyl) -4- (3-methoxyphenyl) -1,3-thiazol- The following example compound 22 was synthesized using [2-yl] amine. Example compound 24: N- [4- [2-amino-4- (3-methoxyphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N-
Benzylamine mp 217-218 ° C. Example 25 According to Example 22, [5- (2-fluoro-4-pyridyl) -4-
Instead of (3-methylphenyl) -1,3-thiazol-2-yl] amine, 5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -2- (4-methylsulfonyl Phenyl) -1,3-
Thiazole is replaced by 2-phenylethylamine, 4-fluorobenzylamine, N-benzyl instead of benzylamine
The following example compounds 25-1 to 25-5 were synthesized using -N-methylamine, N-methyl-2-phenylethylamine and 2-thienylmethylamine, respectively. Example compound 25-1: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine mp 174-176 ° C. Example compound 25-2: N- (4-fluorobenzyl) -N-
[4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Amine mp 155-158 ° C. Example compound 25-3: N-benzyl-N-methyl-N- [4-
[4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine mp 165-166 ° C. Example compound 25-4: N-methyl-N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine mp 116-117 ° C. Example compound 25-5: N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-thienylmethyl) amine melting point 107-109 ° C.

Example 26 4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -5- (2-phenylthio-4-pyridyl) -1,3-thiazole 5- (2-fluoro-4 -Pyridyl) -4- (3-methylphenyl)
2- (4-methylsulfonylphenyl) -1,3-thiazole (0.40 g, 0.94 mmol) and thiophenol (1.0 mL, 9.7
mmol) was stirred at 150 ° C. for 10 hours. After cooling the reaction mixture to room temperature, a saturated aqueous solution of sodium hydrogen carbonate was added, the resulting mixture was extracted with ethyl acetate, and the extract was washed with water. The extract was dried and concentrated. The residue was purified by silica gel column chromatography (hexane: ethyl acetate, 1: 1) and recrystallized from ethanol to give 0.34 g (yield 70%) of the title compound. 116-118 ° C. Example 27 5- (2-benzylthio-4-pyridyl) -4- (3-
Methylphenyl) -2- (4-methylsulfonylphenyl)-
1,3-thiazole sodium hydride (60% paraffin dispersion, 0.13 g, 3.
2 mmol) was washed twice with hexane, and then suspended in N, N-dimethylformamide (15 mL). Phenylmethanethiol (0.35 mL, 3.0 mmol) was added to the suspension, and the mixture was stirred for 10 minutes. To this mixture was added N, N of 5- (2-fluoro-4-pyridyl) -4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazole (0.49 g, 1.2 mmol).
-Dimethylformamide (5 mL) solution was added, and the mixture was further stirred for 1 hour. An 8N aqueous solution of sodium hydroxide was added to the reaction mixture, and the obtained mixture was extracted with ethyl acetate, and the extract was washed with water. The extract was dried and concentrated. The residue was purified by silica gel column chromatography (hexane: ethyl acetate, 2: 1) to give 0.48 g of the title compound (yield 79
%). 182-185 ° C.

Example 28 4- (3-methylphenyl) -2-
(4-methylsulfonylphenyl) -5- (2-phenylsulfonyl-4-pyridyl) -1,3-thiazole 4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -5- (2- To a solution of phenylthio-4-pyridyl) -1,3-thiazole (0.48 g, 0.93 mmol) in N, N-dimethylformamide (10 mL) was added m-chloroperbenzoic acid (0.51 g, 2.4 mm).
ol) and stirred at room temperature for 1 hour. 8N- to the reaction mixture
An aqueous sodium hydroxide solution was added, and the obtained solid was collected by filtration. The solid was recrystallized from ethanol to obtain 0.42 g (yield 82%) of the title compound. 126-128 ° C. The compounds prepared in Examples 9 to 28 are shown in Tables 1 to 6.
Shown in

[0102]

[Table 1]

[0103]

[Table 2]

[0104]

[Table 3]

[0105]

[Table 4]

[0106]

[Table 5]

[0107]

[Table 6]

Formulation Example 1 (1) Compound of Example 1 50 mg (2) Lactose 34 mg (3) Corn starch 10.6 mg (4) Corn starch (paste-like) 5 mg (5) Magnesium stearate 0.4 mg (6) Carboxymethylcellulose calcium 20 mg Total 120 mg The above (1) to (6) were mixed according to a conventional method, and tabletted with a tableting machine to obtain tablets.

Formulation Example 2 (1) Example compound 16-1 10.0 mg (2) Lactose 60.0 mg (3) Corn starch 35.0 mg (4) Gelatin 3.0 mg (5) Magnesium stearate 2.0 mg A mixture of 10.0 mg of compound 16-1, 60.0 mg of lactose and 35.0 mg of corn starch was treated with 0.03 ml of a 10% aqueous gelatin solution (3.0 mg as gelatin) to give 1
After granulation through a sieve of mm mesh, dry at 40 ° C. and sieved again. The granules thus obtained are mixed with 2.0 mg of magnesium stearate and compressed. The resulting core tablets are coated with a sugar coating in aqueous suspension of sucrose, titanium dioxide, talc and acacia. The coated tablets are polished with beeswax to obtain coated tablets.

Formulation Example 3 (1) Example compound 16-1 10.0 mg (2) Lactose 70.0 mg (3) Corn starch 50.0 mg (4) Soluble starch 7.0 mg (5) Magnesium stearate 3.0 mg Example Compound 16-1 10.0 mg and magnesium stearate 3.0 mg in an aqueous solution of soluble starch 0.07 ml
(7.0 mg as soluble starch), dry and mix with 70.0 mg lactose and 50.0 mg corn starch. The mixture is compressed to give tablets.

Formulation Example 4 (1) 5.0 mg of Example Compound 18 (2) 20.0 mg of common salt (3) Distilled water (total volume: 2 ml) 5.0 mg of Example Compound 18 and 20.0 mg of common salt were dissolved in distilled water. And water to make a total volume of 2.0 ml. The solution is filtered and filled under aseptic conditions into 2 ml ampules. After sterilizing the ampoule, seal it to obtain a solution for injection.

EXPERIMENTAL EXAMPLE 1 Genetic manipulation was performed by molecular cloning (Cold S
Spring Harbor Laboratory, 1989) or according to the protocol attached to the reagent. 1) it was cloned adenosine A ₃ receptor gene by the PCR method from the cloning human brain cDNA for human adenosine A ₃ receptors. Using 1 ng of brain cDNA (Toyobo, QUICK-Clone cDNA) as a template, Salvatore et al. (Proc. Natl. Acad. Sci. USA, 90: 10365-10369,199
3) to the primer set was produced adenosine A ₃ receptor gene base sequence reference is 5'-CGCCTCTAGACAAGATGCCC
AACAACAGCACTGC-3 '[SEQ ID NO: 1] and 5'-CGGGGTCGACACT
ACTCAGAATTCTTCTCAATGC-3 '[SEQ ID NO: 2] was added in an amount of 50 pmol each, and TaKaRa LA PCR Kit Ver. 2 was added.
(Takara Shuzo), PCR reaction was performed in DNA Thermal Cycler 480 (Perkin Elmer) (reaction conditions: 1 minute at 95 ° C, 1 minute at 66 ° C, 2 minutes at 75 ° C).
35 cycles per minute). The obtained PCR product was subjected to agarose gel electrophoresis, and a DNA fragment of 1.0 kb was recovered. Then, using Original TA Cloninng Kit (Funakoshi),
It was cloned adenosine A ₃ receptor gene. Next, the obtained plasmid was digested with a restriction enzyme XbaI (Takara Shuzo), blunt-ended by treatment with T4 DNA polymerase (Takara Shuzo), further digested with SalI (Takara Shuzo) to obtain a fragment of the adenosine A ₃ receptor gene. I got

2) Preparation of plasmid for expressing human adenosine A ₃ receptor pTB1411 described in JP-A-5-076385
Promoter derived from BglII (Takara Shuzo)
Digested with EcoRI (Takara Shuzo) and added to pCI vector (Promega) digested with EcoRI (Takara Shuzo).
(Takara Shuzo) to produce pCI-SRα. Next, this pCI-SRα was digested with ClaI (Takara Shuzo) and blunt-ended by T4 DNA polymerase (Takara Shuzo) treatment. On the other hand, after digesting pGFP-C1 (Toyobo) with Bsu36I (Daiichi Pure Chemicals),
4 The end was blunted by DNA polymerase (Takara Shuzo) treatment to obtain a 1.63 kb DNA fragment.
The plasmid pMSRαneo was obtained by ligation with an igation kit (Takara Shuzo) and transformation of competent cells of Escherichia coli JM109 (Takara Shuzo). Next, pMSRαne
o after digestion with EcoRI (Takara Shuzo), T4 DNA
5.4 kb obtained by blunt-ending by polymerase (Takara Shuzo) treatment and further digesting with SalI (Takara Shuzo)
The DNA fragment and the fragment of the adenosine A ₃ receptor gene obtained in 1) above were mixed, and a DNA Ligation kit (Takara Shuzo) was used.
And transformed into competent cells of Escherichia coli JM109 (Takara Shuzo) to obtain plasmid pA ₃ SRα.

[0114] 3) of the human adenosine A ₃ receptor expression plasmid for CHO (dhfr-) tissue culture flask 750mL in the introduction and expression 10% fetal bovine serum to a cell (ham, including the Life Tech Oriental) F12 medium (Nihon Pharmaceutical) CHO (dhfr-) cells grown in (Becton Dickinson) were detached with 0.5 g / L trypsin-0.2 g / L EDTA (Lifetech Oriental), and the cells were washed with PBS (Lifetech Oriental). Centrifugation (1000 rpm, 5 minutes)
And suspended in PBS. Next, DNA was introduced into the cells using Gene Pulser (Bio-Rad) under the following conditions. That is, 8 × 10 ⁶ cells and 10 μg of human adenosine A ₃ were placed in a 0.4 cm gap cuvette.
The plasmid pA ₃ SRα for receptor expression was added and 0.8 m
L capacity, voltage 0.25kV, capacitance 960μ
Electroporated under F. Then, remove the cells
Transfer to Ham's F12 medium containing 0% fetal calf serum, culture for 24 hours, detach cells again and centrifuge, then add Geneticin (Lifetech Oriental) at 500 μg / m
L was suspended in Ham F12 medium containing 10% fetal calf serum, diluted to 10 ⁴ cells / mL, and seeded on a 96-well plate (Becton Dickinson) to obtain a geneticin-resistant strain. Was. Then, after incubation with the resulting Geneticin-resistant strain 24-well plates (Becton Dickinson), were selected adenosine A ₃ receptor-expressing cells from the resistant strains. That is, 50 pM
Assay buffer I (0.1% BS) with ¹²⁵ I-AB-MECA (Amersham) added as ligand
A, HBSS containing 0.25 mM PMSF, 1 μg / mL pepstatin and 20 μg / mL leupeptin
(Wako Pure Chemical Industries, Ltd.)) for 1 hour, wash with assay buffer I, and measure radioactivity with a γ counter to determine ligand-specifically bound cells, A ₃ AR / C
The HO strain was selected.

4) Preparation of Cell Membrane Fraction of Adenosine A ₃ Receptor Expressing Cell The A ₃ AR / CHO strain obtained in the above 3) was cultured in Ham's F12 medium containing 10% fetal bovine serum for 2 days.
Peel off with PBS containing 0.02% EDTA, collect cells by centrifugation, and assay buffer II (50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 10 mM
Magnesium chloride, 0.25 mM PMSF, 1 μg
/ ML pepstatin, 20 μg / mL leupeptin) and a polytron homogenizer (Model PT
-3000, KINEMATICAAG)
The cells were disrupted by treatment at 00 rpm three times for 20 seconds. After cell disruption, the mixture was centrifuged at 2,000 rpm for 10 minutes to obtain a supernatant containing a membrane fraction. The supernatant was centrifuged at 30,000 rpm for 1 hour in an ultracentrifuge (model L8-70M, rotor 70Ti, Beckman) to obtain a precipitate containing a membrane fraction. Next, the precipitate was washed at 2 unit /
Suspension in assay buffer II containing mL adenosine deaminase (Boehringer Mannheim)
, And centrifuged again in the same manner as above to obtain a precipitate containing a membrane fraction. 5) Adenosine A ₃ receptor binding experiment In a 96-well microplate, 1
[ ³ H] as a ligand was added to assay buffer II containing a membrane fraction of 00 μg / mL and a test compound at each concentration.
-NECA (Amersham) was added to 10 nM and reacted at room temperature for 1 hour. Next, the membrane fraction was transferred to Unifilter GF / C (Packard) by filtering the reaction solution using a cell harvester (Packard), and cooled to 50 mM Tris buffer (pH 7.5).
And washed three times. After drying the filter, micro scintillation 0 (Packard) was added to the filter, the radioactivity was measured with a top counter (Packard), and [ ³ H] -NEC was measured.
The concentration (IC ₅₀ ) of the test compound required to reduce the amount of A bound to the membrane fraction to 50% was calculated using PRISM 2.01 (Graph Pad Software). as a result,
The compound of Example 1 had an IC ₅₀ value of 11.6 nM.
Compound (I) is found to have an affinity for excellent adenosine A ₃ receptor.

Experimental Example 2 The genetic manipulation method described below was performed according to the method described in
ry, 1989) or according to the protocol attached to the reagent. (1) Cloning of Human p38 MAP Kinase Gene and Preparation of Recombinant Baculovirus The cloning of the human p38 MAP kinase gene was performed using kidney cDNA (Toyobo, QUICK-Clone cDNA) as a template.
Anr et al. (Science 265 (5173), 808-811 (1994)) Primer set P38-U: 5'-ACCACTC prepared with reference to the nucleotide sequence of the p38 MAP kinase gene
GAGATGGACTACAAGGGACGACGATG
ACAAGTCTCAGGAGAGGCCCACGTT
CTACC-3 '[SEQ ID NO: 3] and PAG-L: 5'-
ACCCGGTACCCACCAGGTGCTCAGGA
P using CTCCATCTCT-3 ′ [SEQ ID NO: 4]
Performed by the CR method. PCR reaction is AmpliWax
Hot St using PCR Gem 100 (Takara Shuzo)
Performed by the art method. 10xLA PC as lower layer mixture
2 μL of R Buffer, 3 μL of a 2.5 mM dNTP solution, 2.5 μL each of a 12.5 μM primer solution, and 10 μL of sterilized distilled water were mixed. As the upper layer mixture, 1 μL of human heart cDNA (1 ng / mL) was used as a template.
0xLA PCR Buffer 3 μL, 2.5 mM
1 μL of dNTP solution, TaKaRa LA Taq DN
0.5 μL of Apoylmerase (Takara Shuzo) and 24.5 μL of sterilized distilled water were mixed. Add A to the prepared lower layer mixture.
MpliWax PCR Gem 100 (Takara Shuzo)
After adding each of them, the mixture was treated at 70 ° C. for 5 minutes and in ice for 5 minutes, and the upper layer mixture was added to prepare a PCR reaction solution. The tube containing the reaction solution was set in a thermal cycler (PerkinElmer) and treated at 95 ° C. for 2 minutes. In addition, a cycle of 95 ° C. for 15 seconds and 68 ° C. for 2 minutes is repeated for 3 cycles.
After repeating 5 times, it was treated at 72 ° C. for 8 minutes. The obtained PCR product was subjected to agarose gel (1%) electrophoresis, and p3
After recovering a 1.1 kb DNA fragment containing the 8MAP kinase gene from the gel, pT7Blue-T vector
or (Takara Shuzo) to insert the plasmid pHP
38 were produced. Plasmid pFASTBAC1 (CI
4.8 kb XhoI-KpnI fragment of BCOBRL) and 1.1 kb XhoI-
The resulting plasmid was ligated with the Kpn fragment to prepare a plasmid pFBHP38. Plasmids pFBHP38 and BAC-TO-
BAC Baculovirus Expressisio
nSystem (GIBCOBRL) using recombinant baculovirus virus stock BAC-HP38
Was prepared.

(2) Cloning of Human MKK3 Gene and Preparation of Recombinant Baculovirus
(Toyobo, QUICK-Clone cDNA) as a template, Derijard, B.
M of their report (Science 267 (5198), 682-685 (1995))
Primer set prepared with reference to the base sequence of KK3 gene MKK-U: 5'-ACAAGAATTCATAAA
CATATGGCTCATCATCATCATCATC
ATTCCAAGCCACCCGCACCCAA-3 '
[SEQ ID NO: 5] and MKK-L: 5′-TCCCGTC
TAGACTATGAGTCTTCTCCCAGGAT
-3 '[SEQ ID NO: 6].
The PCR reaction was AmpliWax PCR Gem 100
(Takara Shuzo) was carried out by the Hot Start method. As a lower layer mixture, 10 × LA PCR Buffer 2
μl, 2.5 mM dNTP solution 3 μL, 12.5 μM
2.5 μL of each primer solution and 10 μL of sterilized distilled water were mixed. As the upper layer mixture, human kidney cDN was used as a template.
A (1 ng / mL) in 1 μL, 10 × LA PCR B
buffer 3μL, 2.5mM dNTP solution 1μ
L, TaKaRa LA Taq DNA polymer
case (Takara Shuzo) 0.5 μL, sterilized distilled water 24.5 μL
Was mixed. Add AmpliWax P to the prepared lower layer mixture.
One CR Gem 100 (Takara Shuzo) was added, and the mixture was treated at 70 ° C. for 5 minutes and on ice for 5 minutes, and the upper layer mixture was added to prepare a PCR reaction solution. After setting the tube containing the reaction solution in a thermal cycler (PerkinElmer),
Treated at 5 ° C for 2 minutes. Further, at 95 ° C. for 15 seconds, 6
After repeating a cycle of 2 minutes at 8 ° C. 35 times, 72 ° C.
For 8 minutes. The obtained PCR product was subjected to agarose gel (1%) electrophoresis, and a 1.0 k
After recovering the DNA fragment of b from the gel, pT7Blue
-Insert into Tvector (Takara Shuzo) and add plasmid pH
MKK3 was obtained. Primer set SER-U: 5′-G to mutate MKK3 into a constitutively active form (Ser 189th is Glu and Thr 193 is Glu)
GCTACTTGGTGGACGAGGTGGCCAA
GGAGATGGGATGCCGGCTGC-3 ′ [SEQ ID NO: 7] and SER-L: 5′-GCAGCCGGCA
TCCATCTCCTTGGCCACCTCGTCCA
Using CCAAGTAGCC-3 ′ [SEQ ID NO: 8],
QuikChange Site-Directed
Mutagenesis Kit (Stratagen
The mutation was introduced by e) to obtain pcaMKK3. 3. Plasmid pFASTBAC1 (CIBCOBRL)
The 8 kb EcoRI-XbaI fragment and the plasmid p
A 1.0 kb EcoRI-XbaI fragment of caMKK3 was ligated to prepare a plasmid pFBcaMKK3.
Plasmids pFBcaMKK3 and BAC-TO-BAC
Baculovirus Expression Sy
A virus stock BAC-caMKK3 of the recombinant baculovirus was prepared using stem (GIBCOBRL).

(3) Preparation of Activated p38 MAP Kinase Sf-21 cells were adjusted to 1 × 10 ⁶ cells / mL in 100 ml Sf-900II SFM medium (GI
(BCOBRL), and cultured at 27 ° C. for 24 hours. Virus stock BAC of recombinant baculovirus
-HP38 and BAC-caMKK3 each 0.2 m
After adding L, the cells were further cultured for 48 hours. After the cells were separated from the culture solution by centrifugation (3000 rpm, 10 min), the cells were washed twice with PBS. 10 cells
mL Lysis buffer (25 mM HEPE
S (pH 7.5), 1% Triton X, 130 mM
NaCl, 1 mM EDTA, 1 mM DTT, 25 m
M β-glycerophosphate, 20 mM
leuptin, 1 mM APMSF, 1 mM
After suspending in Sodium orthovanadate), the suspension was homogenized with a homogenizer (POLYTRON).
The cells were disrupted by performing the treatment twice at 0 rpm for 2 minutes. Anti-FLAG M2 Affinity was obtained from the supernatant obtained by centrifugation (40000 rpm, 45 minutes).
Activated p38 MAP kinase was purified using Gel (Eastman Chemical). (4) Measurement of p38 MAP kinase inhibitory activity Including 260 ng of active p38 MAP kinase and 1 μg of Myelin Basic Protein
5 μL reaction solution (25 mM HEPES (pH 7.
5), 10 mM Magnesium Acetat
After adding 2.5 μL of the test compound dissolved in DMSO to e), the mixture was kept at 30 ° C. for 5 minutes. ATP solution (2.5
μM ATP, 0.1 μCi [g- ³² P] ATP)
The reaction was started by adding 0 μL. 6 at 30 ° C
After reacting for 0 minutes, the reaction was stopped by adding 50 μL of a 20% TCA solution. After leaving the reaction solution at 0 ° C. for 20 minutes, Cell Harvester (Packard Japan)
The acid-insoluble fraction was transferred to GF / C filter (Packard Japan) using 250 mM H
Washed with ₃ PO ₄ . After drying at 45 ° C. for 60 minutes, M
40 microscint 0 (Packard Japan)
μL was added, and the radioactivity was measured with TopCount (Packard Japan). The concentration of the test compound required to inhibit the incorporation of ³² P into the acid-insoluble fraction by 50% (IC
₅₀ values) were calculated using PRISM 2.01 (Graph Pad Software). Table 7 shows the results.

[0119]

[Table 7] This indicates that compound (I) has excellent p38 MAP kinase inhibitory activity.

Experimental Example 3 Measurement of TNF-α Production Inhibitory Activity 1% Inactivated Fetal Bovine Serum (Life Technology (Li
fe Technologies, Inc. ), Country name: USA) and 10 mM HEPES (pH7.
5) containing PRMI1640 medium (Life Technologies, Inc.)
THP-1 cells cultured in the above method were seeded in a 96-well plate at 1 × 10 ⁵ cells / well, and 1 μL of a test compound dissolved in DMSO was added.
After culturing in a carbon dioxide gas incubator at 37 ° C. for 1 hour, LPS (Wako Pure Chemical Industries) was added to a final concentration of 5 μg / mL. After culturing at 37 ° C. for 4 hours in a carbon dioxide gas incubator, a supernatant was obtained by centrifugation. The TNFα concentration in the supernatant was determined by ELISA (R & D System).
Quantitative Kit). The concentration (IC ₅₀ value) of the test compound required to inhibit TNFα production by 50% was calculated by PRISM 2.01 (GraphPad Software). Table 8 shows the results.

[0121]

[Table 8] This indicates that compound (I) has an excellent TNF-α production inhibitory activity.

[0122]

The compound (I) or a salt thereof has excellent adenosine A ₃ receptor antagonism and can be used as a preventive or therapeutic agent for adenosine A ₃ receptor-related diseases. Further, the compound (I) or a salt thereof exhibits excellent p38 MAP kinase inhibitory activity and TNF-α inhibitory activity,
It can also be used as a preventive or therapeutic agent for AP kinase-related diseases and TNF-α-related diseases.

[0123]

[Sequence List] <110> Takeda Chemical Industries, Ltd. <120> 5-Pyridyl-1,3-azole Compounds and Their Use <130> B00084 <150> JP 11-116686 <151> 1999-04-23 <150 > JP 11-224650 <151> 1999-08-06 <160> 8 <210> 1 <211> 34 <212> DNA <213> Artificial Sequence <400> 1 CGCCTCTAGA CAAGATGCCC AACAACAGCA CTGC 34 <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <400> 2 CGGGGTCGAC ACTACTCAGA ATTCTTCTCA ATGC 34 <210> 3 <211> 62 <212> DNA <213> Artificial Sequence <400> 3 ACCACTCGAG ATGGACTACGA AGGACGACGA TGA
CAAGTCCT CAGGAGAGGC CCACGTTCTA 60 CC
62 <210> 4 <211> 35 <212> DNA <213> Artificial Sequence <400> 4 ACCCGGTACC ACCAGGGTGCT CAGGACTCCA TCT
CT 35 <210> 5 <211> 61 <212> DNA <213> Artificial Sequence <400> 5 ACAAGAATTC ATAACATATG GCTCATCATC ATC
ATCATCA TTCCAAGCCA CCCGCACCCA 60 A
61 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <400> 6 TCCCGTCTAG ACTATGAGTC TTCTCCCCAGG AT
32 <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <400> 7 GGCACTTGG TGGACGAGGGT GGCCAAGGAG ATG
GATCCG GCTGC 45 <210> 8 <211> 45 <212> DNA <213> Artificial Sequence <400> 8 GCAGCCGGCA TCCATCTCCT TGGCCACCTC GTC
ACCCAAG TAGCC 45

Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat II (reference) A61P 9/10 A61P 9/10 11/00 11/00 11/06 11/06 17/00 17/00 17/06 17 / 06 19/02 19/02 21/00 21/00 25/16 25/16 25/28 25/28 29/00 29/00 31/12 31/12 37/00 37/00 37/08 37/08 43/00 111 43/00 111 C07D 417/14 C07D 417/14 // C07D 213/64 213/64 F-term (reference) 4C055 AA01 BA02 BA42 BB01 BB02 CA01 DA18 FA06 4C063 AA01 AA03 AA05 BB01 BB09 CC62 DD12 EE01 4C0A AA02 AA03 AA04 BC82 GA04 GA08 GA10 MA01 MA04 NA14 ZA02 ZA15 ZA16 ZA36 ZA45 ZA89 ZB11 ZB13 ZB15 ZB26 ZB33 ZC20 ZC21 ZC42 ZC55

Claims (33)

[Claims] (1) a compound which may be N-oxidized: [Wherein, R ¹ is a hydrogen atom, a hydrocarbon group which may have a substituent, a heterocyclic group which may have a substituent, an amino group or an acyl group which may have a substituent. R ² represents an aromatic group which may have a substituent, R ³ represents a hydrogen atom,
A pyridyl group which may have a substituent or an aromatic hydrocarbon group which may have a substituent, X is an oxygen atom or a sulfur atom which may be oxidized, Y is a bond, an oxygen atom A group represented by an optionally oxidized sulfur atom or a formula NR ⁴ (wherein R ⁴ represents a hydrogen atom, a hydrocarbon group which may have a substituent or an acyl group), and Z Represents a bond or a divalent chain hydrocarbon group which may have a substituent. Or a salt thereof. 2. The compound according to claim 1, wherein Z is a divalent chain hydrocarbon group which may have a substituent. 3. A compound of the formula [Wherein, n represents 0 or 1, and other symbols have the same meanings as in claim 1] or a salt thereof. 4. R ¹ is (i) hydrogen atom, (ii) C _1-6 alkyl group, C _2-6 alkenyl group, C _2-6 alkynyl group, C _3-6
A cycloalkyl group, a C _6-14 aryl group or a C _7-16 aralkyl group [these groups are oxo, halogen atom,
_1-3 alkylenedioxy, nitro, cyano, optionally halogenated C _1-6 alkyl, optionally halogenated C _2-6 alkenyl, carboxy C _2-6 alkenyl, optionally halogenated Good C _2-6 alkynyl, optionally halogenated C _3-6 cycloalkyl, C
_6-14 aryl, optionally halogenated C _1-8 alkoxy, C _1-6 alkoxy-carbonyl-C _1-6 alkoxy, hydroxy, C _6-14 aryloxy, C _7-16 aralkyloxy, mercapto, Optionally halogenated C _1-6 alkylthio, C _6-14 arylthio, C _7-16 aralkylthio, amino, mono-C _1-6 alkylamino, mono-C _6-14 arylamino, di-C _{1 -6} alkylamino, di -C _6-14 arylamino, formyl, carboxy, C _1-6 alkyl - carbonyl, C _3-6 cycloalkyl - carbonyl, C _1-6 alkoxy - carbonyl, C _6-14
Aryl-carbonyl, C _7-16 aralkyl-carbonyl, C _6-14 aryloxy-carbonyl, C _7-16 aralkyloxy-carbonyl, 5- or 6-membered heterocyclic carbonyl, carbamoyl, thiocarbamoyl, mono-C _1-6 alkyl Carbamoyl, di-C _1-6 alkyl-carbamoyl, C _6-14 aryl-carbamoyl, 5- or 6-membered heterocyclic carbamoyl, C _1-6 alkylsulfonyl, C _6-14 arylsulfonyl, C _1-6 alkylsulfinyl, C
_6-14 arylsulfinyl, formylamino, C _1-6 alkyl - carbonylamino, C _6-14 aryl - carbonyl amino, C _1-6 alkoxy - carbonyl amino, C _1-6
Alkylsulfonylamino, C _6-14 arylsulfonylamino, C _1-6 alkyl-carbonyloxy, C _6-14 aryl-carbonyloxy, C _1-6 alkoxy-carbonyloxy, mono-C _1-6 alkyl-carbamoyloxy, Di-C _1-6 alkyl-carbamoyloxy, C _6-14
Aryl-carbamoyloxy, nicotinoyloxy,
In addition to one nitrogen atom and one carbon atom, one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom
Or a 5- to 7-membered saturated cyclic amino optionally containing 4 to 4 carbon atoms (the cyclic amino is a C _1-6 alkyl, C _6-14 aryl, C _1-6 alkyl-carbonyl, or a 5- to 10-membered aromatic heterocyclic group 5 to 10 containing 1 to 4 heteroatoms selected from the group consisting of nitrogen, sulfur and oxygen in addition to carbon. A substituent selected from the group consisting of a membered aromatic heterocyclic group, sulfo, sulfamoyl, sulfinamoyl and sulfenamoyl (substituent group A)), and (iii) a substituent selected from substituent group A. A 5- to 14-membered heterocyclic group containing 1 to 4 one or two heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom other than a carbon atom which may be present, (iv) a formula:- (C = O) ^{R 5, - (C = O} ) -OR 5, -
^{(C = O) -NR 5 R} 6, - (C = S) -NHR 5 or -S
O ₂ —R ⁷ (wherein, R ⁵ is a hydrogen atom, a C _1-6 alkyl group _optionally having a substituent selected from substituent group A, a C _2-6 alkenyl group, a C _2-6 alkynyl A group, a C _3-6 cycloalkyl group, a C _6-14 aryl group or a C _7-16 aralkyl group or a heterocyclic group which may have a substituent selected from substituent group A, and R ⁶ is a hydrogen atom Or a C _1-6 alkyl group represented by R ⁷
Is a C _1-6 alkyl group, a C _2-6 alkenyl group, a C _2-6 alkynyl group, a C _3-6 cycloalkyl group, a C _6-14 which may have a substituent selected from substituent group A An acyl group represented by an aryl group or a C _7-16 aralkyl group or a heterocyclic group which may have a substituent selected from substituent group A), (v) an amino group (this amino group is Substituent A
A C _1-6 alkyl group which may have a substituent selected from the group, a C _2-6 alkenyl group, a C _2-6 alkynyl group, a C _3-6
A cycloalkyl group, a C _6-14 aryl group or a C _7-16 aralkyl group, a heterocyclic group which may have a substituent selected from substituent group A, an acyl group and a substituent shown in the above (iv) (Vi) may have a substituent selected from the group consisting of a C _1-6 alkylidene group which may have a substituent selected from Group A), or (vi) other than one nitrogen atom and carbon atom A 5- to 7-membered non-aromatic cyclic amino group optionally containing 1 to 4 one or two hetero atoms selected from a nitrogen atom, a sulfur atom and an oxygen atom (this cyclic amino group is a C _1- R ² may be substituted with a substituent selected from the group consisting of ₆ alkyl, C _6-14 aryl, C _1-6 alkyl-carbonyl, 5- to 10-membered aromatic heterocyclic group and oxo). which may have a substituent selected from group a C _6-14 monocyclic or condensed One or two heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to a carbon atom which may have a substituent selected from a polycyclic aromatic hydrocarbon group or a substituent group A; Or 4
R ³ has a hydrogen atom, a pyridyl group which may have a substituent selected from substituent group A, or a substituent selected from substituent group A; X represents O, S, SO or SO ₂ ; a C _6-14 monocyclic or condensed polycyclic aromatic hydrocarbon group;
Is a bond, O, S, SO, SO ₂ or a formula NR ⁴ (wherein,
R ⁴ is a hydrogen atom, a C _1-6 alkyl group, a C _2-6 alkenyl group, a C _2-6 alkynyl group, a C _3-6 cycloalkyl group which may have a substituent selected from substituent group A , C
_6-14 aryl group or _C7-16 aralkyl group or above
Z represents a bond or a C _1-15 alkylene group which may have a substituent selected from the group of substituents A, and C _2-16 An alkenylene group or a _C2-16 alkynylene group.
A compound as described. 5. The compound according to claim 1, wherein R ¹ is an amino group which may have a substituent. (6) R ¹ is (i) a C _1-6 alkyl group, (ii) C
C- ₆ which may be substituted with a substituent selected from _1-6 alkylthio, C _1-6 alkylsulfonyl and a halogen atom
_6-14 aryl group or (iii) _Formula- (C = O) -R ^{5 ′} (wherein, R ^{5 ′} is a nitrogen atom, sulfur other than a C _1-6 alkyl group, a C _6-14 aryl group or a carbon atom. And a 5- to 14-membered heterocyclic group containing 1 to 4 heteroatoms selected from an atom and an oxygen atom, which may have 1 or 2 acyl groups. Certain claim 1
A compound as described. (7) R ¹ is — (C ＝ O) —R ^{5 ″} (where R ^{5 ″} is a C _6-14 aryl group or a nitrogen atom other than a carbon atom;
Which is a 5- to 14-membered heterocyclic group containing 1 to 4 heteroatoms selected from a sulfur atom and an oxygen atom, which may have 1 or 2 acyl groups which may have 1 or 2 acyl groups The compound according to claim 1, which is 8. The compound according to claim 1, wherein R ² is an optionally substituted C _6-14 aryl group. 9. R ¹ is a C _6-14 aryl group optionally substituted with a halogen atom or C _1-6 alkoxy, or one or two selected from a nitrogen atom, a sulfur atom and an oxygen atom other than a carbon atom. 2. The compound according to claim 1, which is a 5- to 14-membered aromatic heterocyclic group containing 1 to 4 heteroatoms. 10. 1 R ² is a nitrogen atom other than the C _6-14 aryl group or a carbon atom, selected from sulfur atom and an oxygen atom
Or 5 to 14 containing 1 to 4 heteroatoms of 2 types
The compound according to claim 1, which is a membered heterocyclic group. 11. C _6-14 wherein R ³ may have a substituent.
The compound according to claim 1, which is an aryl group. 12. The compound according to claim 1, wherein R ³ is a C _6-14 aryl group optionally substituted with one or two C _1-6 alkyl or C _1-6 alkoxy. 13. The compound according to claim 1, wherein X is a sulfur atom which may be oxidized. 14. The compound according to claim 1, wherein X is a sulfur atom. 15. Y is an oxygen atom or a group represented by the formula NR ⁴ (wherein R ⁴
Is a group represented by the formula (1). 16. The compound according to claim 1, wherein Y is an oxygen atom, a sulfur atom which may be oxidized, or a group represented by the formula NR ^{4 ′} (R ^{4 ′} represents a C _1-6 alkyl group). . 17. The compound according to claim 1, wherein Y is O, NH or S. 18. The compound according to claim 1, wherein Z is a lower alkylene group which may have a substituent. 19. The compound according to claim 1, wherein Z is a bond or a C _1-6 alkylene group optionally having oxo. 20. R ¹ is (i) a C _1-6 alkyl group, (ii) C
_A C _6-14 aryl group optionally substituted with a substituent selected from _1-6 alkylthio, C _1-6 sulfonyl and a halogen atom, or (iii) a formula — (C−O) —R ^{5 ′} (wherein R ^{5 '}
Is a 5- to 14-membered heterocyclic ring containing 1 to 4 one or two hetero atoms selected from nitrogen, sulfur and oxygen atoms in addition to C _1-6 alkyl group, C _6-14 aryl group or carbon atom acyl represented by a group) one or two which may have an amino group; optionally R ² is substituted with a halogen atom or a C _1-6 alkoxy C _6-14
One or two heteroatoms selected from a nitrogen atom, a sulfur atom and an oxygen atom in addition to an aryl group or a carbon atom;
To 5 comprising four to 14-membered aromatic heterocyclic group; R ³
Is a C _6-14 aryl group optionally substituted with one or two C _1-6 alkyl or C _1-6 alkoxy; X is a sulfur atom; Y is an oxygen atom, an optionally oxidized sulfur atom or A group represented by the formula NR ^{4 ′} (R ^{4 ′} represents a C _1-6 alkyl group); Z is a C _1-6 alkylene group optionally having oxo or C _1-6 alkyl or a bond A compound according to claim 1. 21. A method wherein R ¹ is-(C = O) -R ^{5 ″} (wherein R ^{5 ″}
_{Represents a} C _6-14 aryl group or a 5- to 14-membered heterocyclic group containing 1 to 4 one or two hetero atoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atoms) An amino group optionally having one or two acyl groups; R ² is a C _6-14 aryl group or one or two heteroatoms selected from nitrogen, sulfur and oxygen atoms in addition to carbon atom; A 5- to 14-membered aromatic heterocyclic group containing 1 to 4 carbon atoms; C _{6-14 wherein} R ³ is optionally substituted with 1 or 2 C _1-6 alkyl or C _1-6 alkoxy.
Aryl group; X is a sulfur atom; Y is O, NH or S; Z
Is a C _1-6 alkylene group which may have a bond or oxo. 22. N- [5- (2-benzoylamino-4-pyridyl) -4- (3,5-dimethylphenyl) -1,3-thiazole-2-
Yl] acetamide, N- [5- (2-benzylamino-4-pyridyl) -4- (3,5-dimethylphenyl) -1,3-thiazole
-2-yl] acetamide, N- [4- [4- (4-methoxyphenyl) -2-methyl-1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [2 -(4-fluorophenyl)
-4- (3-Methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] phenylacetamide, N- [4- [2-ethyl-4
-(3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazole -5-yl] -2-pyridyl] phenylacetamide, N- [4- [2-butyl-4-
(3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1 , 3-Thiazol-5-yl] -2-pyridyl] phenylacetamide, N-
[4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [2-ethyl-4- (3-methyl Phenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide, N-
[4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3- (4-methoxyphenyl)
Propionamide, N- [4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -4-phenylbutylamide, N- [4- [ 4- (3-methylphenyl)
-2-propyl-1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl ] -2-Pyridyl] -3-phenylpropionamide, N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, N -[4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide, N- [4- [2- (4 -Fluorophenyl) -4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] benzamide, N- [4- [2- (4-fluorophenyl) -4- (3 -Methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide, N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl]
Benzamide, N- [4- [4- (3-methylphenyl) -2- (4
-Methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] -3-phenylpropionamide, N-benzyl-N-
[4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine, N- [4- [2-ethyl-4
-(3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine, N- [4- [2-
Ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine,
N-benzyl-N- [4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] amine, N-
[4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl)
Amine, N- [4- [4- (3-methylphenyl) -2-propyl-
1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine, N-benzyl-N- [4- [2-butyl-4-
(3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine, N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazole-5 -Yl] -2-pyridyl] -N- (2-
Phenylethyl) amine, N- [4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] -N- (3-phenylpropyl) amine, N-benzyl-N-
[4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine, N- [4- [4- (3- Methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (2-phenylethyl) amine, N- [4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridyl]- N- (3-phenylpropyl)
Amine, N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-
Pyridyl] benzamide, N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] phenylacetamide, N-
[4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
3-phenylpropionamide, N-benzyl-N- [4- [4-
(3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine, N
-[4- [4- (3-Methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl]-
N- (3-phenylpropyl) amine, N- [4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-
Thiazol-5-yl] -2-pyridyl] -N- (2-phenylethyl) amine, N- (4-fluorobenzyl) -N- [4- [4-
(3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-thiazol-5-yl] -2-pyridyl] amine,
(S) -N- [4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] nicotinamide, (R) -N- [4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl)
-1,3-thiazol-2-yl] nicotinamide, (S) -N-
[4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-methylnicotinamide, (R) -N -[4- (3-Methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl)
-1,3-thiazol-2-yl] -2-methylnicotinamide,
(S) -N- [4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-chloronicotinamide , (R) -N- [4- (3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-chloronicotine Amide, (S) -N- [4- (3-methylphenyl) -5- (2- (1
-Phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-methoxynicotinamide, (R) -N- [4-
(3-methylphenyl) -5- (2- (1-phenylethylamino) -4-pyridyl) -1,3-thiazol-2-yl] -2-methoxynicotinamide, N- [5- (2- Benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] nicotinamide, N- [5- (2-benzylamino-4-pyridyl) -4- (3 -Methylphenyl) -1,3-thiazole-2-
Yl] -2-methoxynicotinamide, N- [5- (2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] -2-chloronicotinamide, N- [5-
(2-benzylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-thiazol-2-yl] -2-methylnicotinamide, N- [5- (2-benzoylamino-4- Pyridyl) -4- (3-
Methylphenyl) -1,3-thiazol-2-yl] nicotinamide, N- [5- (2-benzoylamino-4-pyridyl) -4-
(3-methylphenyl) -1,3-thiazol-2-yl] -2-methylnicotinamide, N- [5- (2-benzoylamino-4-)
Pyridyl) -4- (3-methylphenyl) -1,3-thiazole-2
-Yl] -2-chloronicotinamide, N- [5- (2-benzoylamino-4-pyridyl) -4- (3-methylphenyl) -1,3-
Thiazol-2-yl] -2-methoxynicotinamide,
(S) -N- (1-phenylethyl) -4- [2-ethyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (R) -N -(1-phenylethyl) -4- [2-ethyl-
4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridylamine, (S) -N- (1-phenylethyl) -4- [4
-(3-methylphenyl) -2-propyl-1,3-thiazole-5-
Yl] -2-pyridylamine, (R) -N- (1-phenylethyl) -4- [4- (3-methylphenyl) -2-propyl-1,3-thiazol-5-yl] -2- Pyridylamine, (S) -N- (1-phenylethyl) -4- [2-butyl-4- (3-methylphenyl)
-1,3-thiazol-5-yl] -2-pyridylamine, (R) -N
-(1-phenylethyl) -4- [2-butyl-4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (S) -N- (1-phenyl Ethyl) -4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (R) -N- (1-phenyl Ethyl) -4- [4- (3-methylphenyl) -2- (4-methylthiophenyl) -1,3-thiazol-5-yl] -2-pyridylamine, (S) -N- (1-phenyl Ethyl) -4- [4- (3-methylphenyl) -2- (4-methylsulfonylphenyl) -1,3-
Thiazol-5-yl] -2-pyridylamine, (R) -N- (1-
Phenylethyl) -4- [4- (3-methylphenyl) -2- (4-
Methylsulfonylphenyl) -1,3-thiazol-5-yl]
2-pyridylamine, (S) -N- (1-phenylethyl) -4-
[2- (4-fluorophenyl) -4- (3-methylphenyl)-
1,3-thiazol-5-yl] -2-pyridylamine, (R) -N-
(1-phenylethyl) -4- [2- (4-fluorophenyl)-
4- (3-methylphenyl) -1,3-thiazol-5-yl] -2-
Pyridylamine or a salt thereof. (23) a prodrug of the compound according to the above (1); (I) Formula (3) [In the formula, Hal represents a halogen atom, and the other symbols are as defined in claim 1.
Or a salt thereof, and a compound represented by the formula R ¹ —CSNH ₂ (VIII) wherein R ¹ has the same meaning as in claim 1 or a salt thereof. And reacting with the formula Wherein each symbol is as defined in claim 1, or a salt thereof, or (ii) a compound of the formula [Hal is a halogen atom, and other symbols have the same meanings as in claim 1.] or a salt thereof and a compound represented by the formula R ² -Z-YH (XI) [wherein each symbol is claim 1 Which has the same significance as described above] or a salt thereof, Wherein each symbol is as defined in claim 1, or a salt thereof, or (iii) a compound of the formula Wherein each symbol is as defined in claim 1, or a salt thereof and a compound of the formula R ² -ZL (XVIII) wherein L is a leaving group, Having the same meaning as described in [1], or a salt thereof; Wherein each symbol is as defined in claim 1, or a salt thereof, or (iv) a compound represented by the formula: Wherein each symbol is as defined in claim 1, or a salt thereof is reacted with a peracid, hydrogen peroxide or an alkyl hydroperoxide to form a compound represented by the formula: (Wherein each symbol is as defined in claim 1) or a salt thereof is produced. 25. A pharmaceutical composition comprising the compound according to claim 1 or a prodrug thereof. 26. The composition according to claim 25, which is an adenosine A ₃ receptor antagonist. 27. Adenosine A ₃ is a prophylactic therapeutic agent for receptor-related diseases according to claim 25 composition. (28) The composition according to the above (25), which is an agent for preventing or treating asthma or allergic diseases. (29) The composition according to the above (25), which is a prophylactic / therapeutic agent for cerebral edema, cerebrovascular disorder or head injury. 30. The composition according to claim 25, which is a p38 MAP kinase inhibitor. (31) the agent which is a TNF-α production inhibitor;
A composition as described. (32) The composition according to the above (25), which is an agent for preventing or treating a cytokine-mediated disease. 33. Inflammation, Addison's disease, autoimmune hemolytic anemia, Crohn's disease, psoriasis, rheumatism, spinal cord injury, cerebral edema, multiple sclerosis, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, diabetes , Arthritis, toxicemia, Crohn's disease, ulcerative colitis, chronic pneumonia, silicosis, pulmonary sarcoidosis, pulmonary tuberculosis, cachexia, arteriosclerosis, Creutzfeldt-Jakob disease, viral infection, atopic dermatitis, systemic erythritis Matodes, AIDS encephalopathy, meningitis, angina,
26. The composition according to claim 25, which is an agent for preventing or treating myocardial infarction, congestive heart failure, hepatitis, transplantation, dialysis hypotension, or general intravascular coagulation syndrome.