JP2001078764A - Monoclonal antibody to bovine il-6 - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject antibody not crossing over to human IL (interleukin)-6 and mouse IL-6, capable of detecting and determining bovine IL-6 in good accuracy and useful for diagnosis of bovine systemic inflammatory reaction syndrome or the like by specifically reacting with a bovine-derived IL-6. SOLUTION: This antibody specifically reacts with bovine-derived IL-6. The monoclonal antibody is produced by a hybridoma having the accession number of FERM P-17426 or FERM P-17427. The bovine-derived IL-6 in a sample is determined by using the monoclonal antibody, and used for diagnosis of bovine systemic inflammatory reaction syndrome, because the excess expression of the IL-6 is the characteristics of the pathological development of the inflammatory disease.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a monoclonal antibody specifically reacting with bovine interleukin-6 (hereinafter referred to as "bovine IL-6"), a hybridoma producing the monoclonal antibody, and the monoclonal antibody. And a method for quantifying bovine IL-6.

[0002]

2. Description of the Related Art Interleukin-6 (IL-6) was discovered as a B cell differentiation factor, and has been produced from various cells through subsequent studies, and has been implicated in regulating immune responses and host defense. Is known. The biological activity of IL-6 is B
Cell differentiation, activation of T cells, proliferation of hybridomas and plasma cells, proliferation of blood stem cells, induction of acute phase reactions of hepatocytes, and so on. Overexpression of IL-6 is an important feature of the pathogenesis of inflammatory diseases and is a good diagnostic marker for systemic inflammatory response syndrome and can be used for prognosis. Therefore, a method that can specifically measure IL-6 in a biological component (eg, serum, cerebrospinal fluid) of a target animal is very useful.

[0003] As a specific method for measuring IL-6, there is a method using a mouse IL-6-dependent cell line, 7TD1 cell, but a specific method for measuring bovine IL-6 in a biological component is as follows. Not developed. Therefore, for the prevention of bovine disease, the prognosis at the stage of production, and the development of immunological research, the establishment of a specific assay method for bovine IL-6 is eagerly desired. Bovine IL-6
An antibody specific for bovine IL-6 can be considered as one of the methods for specific measurement of bovine IL-6.An antibody that specifically reacts with bovine IL-6, which can be used for immunoassay until now, has been developed. It has not been.

[0004] The reason is that IL-6 itself has a function of differentiating B cells into antibody-producing cells.
When used as an immunogen, B cells are more likely to proliferate and induce non-specific antibody-producing cells, and IL-6
It may be difficult to produce a monoclonal antibody that specifically reacts with On the other hand, the nucleotide sequence of the IL-6 structural gene is poorly conserved among mammals, and is highly specific to animal species. Bovine IL-6 has only 53% homology at the amino acid level with humans and 42% with mice. Therefore, antibodies against human IL-6 and mouse IL-6 are
And cannot specifically measure bovine IL-6 using antibodies against human IL-6 or mouse IL-6.
Therefore, production of an antibody having high specificity for bovine IL-6, particularly a monoclonal antibody excellent in specificity and reproducibility, has been eagerly desired.

[0005]

DISCLOSURE OF THE INVENTION The present invention relates to a monoclonal antibody that specifically reacts with bovine IL-6, a hybridoma that produces the monoclonal antibody, and a specific measurement of bovine IL-6 using the monoclonal antibody. The purpose is to provide a way to:

[0006]

Means for Solving the Problems The present inventors have made intensive studies to solve the above-mentioned problems, and as a result, they specifically react with bovine IL-6 by using bovine IL-6 as an antigen. The inventors succeeded in producing a monoclonal antibody, and succeeded in specifically measuring bovine IL-6 using the monoclonal antibody, thereby completing the present invention.

That is, the present invention includes the following inventions. (1) A monoclonal antibody that specifically reacts with bovine interleukin-6. (2) The monoclonal antibody according to (1), which is produced by a hybridoma having a deposit number of FERM P-17426. (3) The monoclonal antibody according to (1), which is produced by a hybridoma having a deposit number of FERM P-17427. (4) A hybridoma that produces the monoclonal antibody according to any of (1) to (3). (5) A method for quantifying bovine interleukin-6, which comprises quantifying bovine interleukin-6 in a sample using the monoclonal antibody according to any one of (1) to (3). . Hereinafter, the present invention will be described in detail.

[0008]

BEST MODE FOR CARRYING OUT THE INVENTION 1. Monoclonal Antibodies of the Present Invention The monoclonal antibodies of the present invention include all monoclonal antibodies capable of specifically reacting with bovine IL-6. Among them, a monoclonal antibody that specifically reacts with bovine IL-6 and does not react with human IL-6 and mouse IL-6 can be exemplified as a preferable example, and a monoclonal antibody produced by a hybridoma whose accession number is FERM P-17426 can be exemplified. A more preferred example is an antibody and a monoclonal antibody produced by a hybridoma whose accession number is FERM P-17427.

2. Preparation of Monoclonal Antibody of the Present Invention The monoclonal antibody of the present invention that specifically reacts with bovine IL-6 can be prepared, for example, by the following steps. (1) Preparation of antigen (2) Collection of immune and antibody-producing cells (3) Cell fusion (4) Selection and cloning of hybridoma (5) Collection of monoclonal antibody Each step will be described below.

(1) Preparation of Antigen The preparation of bovine IL-6 as an antigen is not limited to a particular method, but bovine IL-6 as an antigen is prepared using DNA encoding bovine IL-6. Is preferred. The amino acid sequence of bovine IL-6 is as shown in SEQ ID NO: 2, and as the DNA encoding bovine IL-6, for example, a DNA having the nucleotide sequence of SEQ ID NO: 1 can be used. D encoding bovine IL-6
NA can be chemically synthesized according to a conventional method. Also,
DNA encoding bovine IL-6 can also be amplified using RT-PCR after extracting mRNA from bovine Kupffer cells stimulated with LPS (lipopolysaccharide). At this time, the RT-PCR method can be performed according to a conventional method, and primers can be designed based on the nucleotide sequence of SEQ ID NO: 1. As the primer, for example, those consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4 can be used.

[0011] Bovine IL-6 from DNA encoding bovine IL-6
For example, a recombinant vector containing DNA encoding bovine IL-6 is prepared, a suitable host cell is transformed with the vector, and the transformant is cultured in a suitable medium. The culture can be performed by purifying the resulting culture. The recombinant vector and the host cell are not particularly limited, and any known cells may be used. In particular, it is preferable to use a recombinant baculovirus and an insect cell (eg, Sf21AE cell, Tn5 cell). . Culture of the transformant and purification of the culture can be performed according to a conventional method. As the bovine IL-6 as an antigen, bovine IL-6 purified from a culture of the transformant may be used, or a culture of the transformant may be used without purification.

(2) Collection of Immunization and Antibody-Producing Cells The bovine IL-6 obtained as described above is administered as an immunogen together with an adjuvant to mammals, birds and the like. Here, examples of the adjuvant include commercially available Freund's complete adjuvant, Freund's incomplete adjuvant, BCG, Hunters, Titer Mac, keyhole limpet hemocyanin-containing oil, and the like, and these may be used alone. And two or more of these may be used in combination. Mammals include horses, monkeys, dogs, pigs, goats,
Sheep, rabbits, guinea pigs, hamsters, mice and the like can be used, and birds such as pigeons and chickens can be used, but mice and hamsters are particularly preferable.

As the method of administration, any known method may be used, for example, intravenous administration, subcutaneous administration, or intraperitoneal administration. Antigen immunity 1 mouse at a time
It is usually 10 to 400 μg, preferably 40 to 100 μg per animal. The interval between immunizations is usually 3 to 5 weeks, preferably 2 to 4 weeks, and the number of immunizations is usually 1 to 5 times, preferably 2 to 3 times. The antibody-producing cells are collected 3 to 5 days, preferably 3 days after the last immunization. The antibody-producing cells to be collected include lymph node cells, spleen cells and the like, and preferably spleen cells.

(3) Cell fusion As the myeloma cells to be fused with the antibody-producing cells, cell lines derived from various animals such as mice, rats, and humans and generally available to those skilled in the art can be used. As a cell line to be used, a cell line having drug resistance, having a property that it cannot survive in a selection medium (for example, HAT medium) in an unfused state and can survive in a selection medium only in a state fused with an antibody-producing cell, preferable. Generally, 8-azaguanine resistant strains can be used. This cell line, hypoxanthine - deficient in guanine phosphoribosyl Bo transferase (HGPRT ^-), can not grow in HAT medium.

[0015] Such myeloma cells include P3X6
3Ag8U1, P3-X63Ag8, P3 / NS1 / 1-Ag4-1, P3X63Ag8.653, S
Mouse myeloma cell lines such as p2 / O-Ag14, Sp2 / O / FO-2, 2
10. Rat myeloma cell line such as RCY.Ag1.2.3, SKO-007
And other human myeloma cell lines. Cell fusion involves, for example, mixing the myeloma cells with the antibody-producing cells.
It can be performed by bringing the cells into contact with each other for 1 to 7 minutes at room temperature in the presence of a fusion promoter in a medium such as RPMI1640 medium at a ratio of 1:10 to 1: 5. At this time, as the fusion accelerator, polyethylene glycol, polyvinyl alcohol, or the like having an average molecular weight of 1500 to 6000 can be used. Further, a fusion virus such as Sendai virus may be used.

(4) Selection, screening and cloning of hybridomas After cell fusion, hybridomas are selected. The method for selecting a hybridoma may be a conventional method, and is not particularly limited. Hybridomas can be selected, for example, by culturing the hybridomas in a selection medium (eg, HAT medium). The culture at this time may be in accordance with a conventional method, and is not particularly limited. Usually, culture may be performed at 30 to 37 ° C for 10 to 14 days.

The screening of a hybridoma producing the desired monoclonal antibody can be carried out, for example, by the following method. After adsorbing bovine IL-6 to each well of the microplate, it is blocked with Block Ace (Dainippon Pharmaceutical) or the like. The culture supernatant of the hybridoma is added to each well of the microplate, and left at 25 to 37 ° C for 1 to 2 hours. After washing with physiological saline, an appropriately diluted alkaline phosphatase-conjugated goat anti-immunoglobulin is added. After washing with physiological saline, the activity of alkaline phosphatase is measured using ALP Rose (Sinotest), and the wells having a color of alkaline phosphatase containing cells producing antibodies specific for bovine IL-6 Wells. Thereby, the desired hybridoma can be screened. The method for cloning the desired hybridoma from this well may be a conventional method, and is not particularly limited. The cloning of the hybridoma can be performed by, for example, a limiting dilution method, a soft agar method, a fibrin gel method, a fluorescence excitation cell sorter method, or the like.

(5) Collection of Monoclonal Antibody As a method of collecting a monoclonal antibody from the obtained hybridoma, a usual cell culture method, ascites formation method, or the like can be used. In the cell culture method, for example,
The hybridoma is calf serum-containing RPMI1640 medium, MEM medium, E-RDF medium or animal cell medium such as serum-free medium,
The cells are cultured under ordinary culture conditions (for example, 37 ° C., 5% CO ₂ concentration) for 3 to 4 days, and the desired monoclonal antibody can be obtained from the culture supernatant. In the ascites formation method, for example, a mineral oil such as pristane (2,6,10,14-tetramethylpentadecane) is administered intraperitoneally to an animal of the same species as a mammal derived from a myeloma cell, and then, hybridoma 1 × 10 ⁶ to 1 × 1
0 ^7, preferably administered ^six 1 × 10 intraperitoneally. After breeding the administered mammal for 1 to 2 weeks, preferably 1 week, the target monoclonal antibody can be obtained by collecting ascites or serum.

In the above-mentioned method for collecting antibodies, when purification of antibodies is required, sulfate analysis, ion exchange chromatography using an anion exchanger such as DEAE-cellulose, protein A sepharose, etc. are used. A known method such as affinity chromatography, molecular sieve chromatography that sifts according to molecular weight or structure, etc. is appropriately selected, and purification can be performed by using these alone or in combination. Confirmation that the collected monoclonal antibody is the desired monoclonal antibody can be performed by, for example, Western blotting against bovine IL-6.

3. Use of the monoclonal antibody of the present invention The monoclonal antibody of the present invention is used for, for example, separation and purification of bovine IL-6 from a sample containing bovine IL-6, detection and quantification of bovine IL-6 contained in the sample, and the like. it can. Separation and purification of bovine IL-6 from a sample containing bovine IL-6 can be performed, for example, by affinity chromatography using a support on which the monoclonal antibody of the present invention is immobilized. The sample containing bovine IL-6 used at this time was bovine IL.
The sample is not particularly limited as long as it contains -6, and may be any sample. The detection and quantification of bovine IL-6 contained in the sample can be performed, for example, as follows by an ELISA method using the monoclonal antibody of the present invention.

First, the monoclonal antibody of the present invention is immobilized on a solid phase. Although the solid phase on which the monoclonal antibody of the present invention is immobilized is not particularly limited, a commercially available ELISA plate (for example, a 96-well ELISA plate for fluorescence (FluoroNun
c, Nunc)) is convenient. The monoclonal antibody of the present invention can be immobilized on a solid phase by a conventional method, and can be immobilized on a solid phase by, for example, physical adsorption, covalent bonding, crosslinking, or the like. For example, when using a 96-well ELISA plate for fluorescence, the monoclonal antibody of the present invention is diluted with a carbonate buffer (pH 9.6) (for example, 20 μg / ml), and
The monoclonal antibody of the present invention can be immobilized on a solid phase by allowing to stand overnight at ° C.

After immobilizing the monoclonal antibody of the present invention on a solid phase, the solid phase on which the monoclonal antibody of the present invention is not immobilized is blocked with a protein that cannot bind to bovine IL-6. For blocking, a commercially available blocking agent (for example, Block Ace (Dainippon Pharmaceutical))
Etc. can be used. If the blocked solid phase is not used immediately, for example, add PBS containing 30% sucrose to the solid phase and let stand at 25 ° C for 1 hour, then discard the solution, seal and store at 4 ° C . Then, this solid phase is washed several times (for example, three times) with a washing solution (for example, PBS containing 0.05% Tween) immediately before use, and used.

Next, a sample is added to the solid phase. The sample may be any. For example, bovine biological components (eg, serum, cerebrospinal fluid) can be used as the sample. When the sample is added to the solid phase, bovine IL-6 contained in the sample reacts with the monoclonal antibody of the present invention immobilized on the solid phase to form an antigen-antibody complex. On the other hand, when bovine IL-6 is not contained in the sample, such an antigen-antibody complex is not formed. The reaction between bovine IL-6 and the monoclonal antibody of the present invention is preferably carried out sufficiently, for example, by incubating at 25 ° C. for 2 hours to allow sufficient reaction. Next, the solid phase is washed. For washing the solid phase, for example, a phosphate buffer (PBS) can be used. The solid phase is preferably washed sufficiently, and is usually washed 3 to 5 times.

Next, the antigen-antibody complex on the solid phase is detected. Detection of the antigen-antibody complex on the solid phase can be performed according to a conventional method. For example, an antigen-antibody complex on a solid phase can be detected using a labeled anti-bovine IL-6 polyclonal antibody. An anti-bovine IL-6 polyclonal antibody can be prepared according to a conventional method using the bovine IL-6 prepared as described above. For example, animals immunized with bovine IL-6 (eg,
It can be prepared from serum immunoglobulins of rabbits, goats, horses, chickens, etc.) using an antigen affinity column. The label is not particularly limited as long as the antigen-antibody complex can be detected. As such a label, for example, an enzyme, a fluorescent dye, biotin and the like can be used. Examples of enzymes include horseradish peroxidase, β
-Galactosidase, alkaline phosphatase and the like, and examples of the fluorescent dye include fluorescein isothiocyanate (FITC), tetramethylrhodamine isothiocyanate (TRITC) and the like. Detection of the antigen-antibody complex can be performed according to a conventional method, depending on the type of the label. For example, when using an enzyme as a label, after binding an enzyme-labeled anti-bovine IL-6 polyclonal antibody and an antigen-antibody complex, a substrate for the enzyme is added, and the reaction product develops color and changes in absorbance before and after the reaction. Can be used to detect the antigen-antibody complex. When a fluorescent dye is used as the label, the antigen-antibody complex is detected by binding the fluorescent-labeled anti-bovine IL-6 polyclonal antibody and the antigen-antibody complex and observing the fluorescence with a fluorescence microscope or the like. can do. When using biotin as a label, after binding the biotin-labeled anti-bovine IL-6 polyclonal antibody and the antigen-antibody complex, an enzyme-labeled avidin is added, and then an enzyme substrate is added. The antigen-antibody complex can be detected on the basis of color change or change in absorbance before and after the reaction. When detecting the antigen-antibody complex, it is preferable to sufficiently remove unreacted labeled anti-bovine IL-6 polyclonal antibody. Since overexpression of IL-6 is a feature of the pathogenesis of inflammatory diseases, detection and quantification of bovine IL-6 in a sample is useful in the diagnosis of bovine systemic inflammatory response syndrome, etc. It is also useful in

[0025]

The present invention will now be described more specifically with reference to examples. However, the present invention is not limited to these examples. [Example 1] Preparation of monoclonal antibody (1) Preparation of antigen (recombinant bovine IL-6) First, DNA encoding bovine IL-6 (SEQ ID NO: 2) was
After amplification by RT-PCR using mRNA extracted from bovine Kupffer cells stimulated with PS as a template, the baculovirus vector pVL1392 (Baculogold Linearized Baculovirus D
NA (Pharmingen)). The specific procedure is as follows.

The bovine Kupffer cells were isolated from M. Yoshioka et al.,
Vet. Immunol. Immunopathol., 58: 155-163 (1997). That is, bovine Kupffer cells were separated from the hepatic caudate lobe of Holstein by collagenase / pronase perfusion, and the separated cells were purified by Nycodenz density gradient and elutriation. The resulting bovine Kupffer cells were 20% fetal calf serum, 100 U / ml penicillin,
37 in RPMI1640 medium containing 100 μg / ml streptomycin.
Cultivation was performed under the conditions of ° C and 5% CO ₂ . 4 bovine Kupffer cells
After culturing for 8 hours, 3 μg / ml LPS (E. coli O111: B4)
After stimulation for an hour, mRNA Purification kit (Pharmacia PL B
mRNA was extracted from bovine Kupffer cells by extracting poly (A) ⁺ RNA using iochemicals).

Using mRNA extracted from bovine Kupffer cells as a template, RT-PCR was performed using the following primers. Sense primer: 5'-tccg gaattc gaacagctatgaactccc
gctt -3 '(SEQ ID NO: 3) Antisense primer: 5'-tgta cctagg atgcccaggaac
taccacaatc -3 '(SEQ ID NO: 4) Here, the nucleotide sequence of genomic DNA encoding bovine IL-6 is as shown in SEQ ID NO: 1, and the portion of the sense primer represented by "gaacagctatgaactcccgctt" is represented by SEQ ID NO: In the base sequence described in No. 1, the base sequence is the same as the region from the 35th base to the 56th base, and the portion represented by "atgcccaggaactaccacaatc" in the antisense primer is the base sequence described in SEQ ID NO: 1. Of these, the nucleotide sequence is complementary to the region from the 704th base to the 683rd base. In the base sequence of the sense primer, the underlined portion is an EcoRI recognition sequence, and in the base sequence of the antisense primer, the underlined portion is a BamHI recognition sequence.

The RT reaction was performed at 50 ng / ml Poly (A) ⁺ RNA, 1x PCR.
buffer (10 mM Tris-HCl (pH 8.3), 50 mM KCl, 5 mM MgC
l ₂ ), 1 mM dNTPs, 1 U / ml RNAse inhibitor, 2.5 μM Ra
ndom9mers, and 2.5 U / ml Avian Myeloblastosis Virus
In a reaction solution containing reverse transcriptase, at 42 ° C
One cycle of 30 minutes and 5 minutes at 99 ° C. was performed. P
The CR reaction was performed using 1x PCR buffer, 0.1 μM sense primer and antisense primer, 25 U / ml taq polymerase,
And 1 min at 95 ° C in a reaction solution containing 1 mM dNTPs.
30 cycles of 1 minute at 72 ° C and 1 minute at 72 ° C were performed. DN encoding bovine IL-6 amplified by RT-PCR
A was transformed with the baculovirus vector pVL1392 (Baculogold L
inearized Baculovirus DNA (Pharmingen)). Hereinafter, this recombinant virus is referred to as “AcBoIL
-6 ".

Next, recombinant virus AcBoIL-6 was
Insect cells (Spondoptera frugiperda from Noctuidae (Sf21AE)
Cells), 75cm^TwoThe Sf21AE fine in a flask
Cell 1 × 10 ⁷Add cells and Sf900 medium (Gibco) (total volume 20m
l) and cultured at 27 ° C for 3-4 days. After the culture, the culture supernatant is
The cells were collected and centrifuged at 600 × g for 10 minutes at 4 ° C. So
After that, perform ultracentrifugation at 40,000 xg for 1 hour.
The obtained culture supernatant was passed through a 300 kDa ultrafiltration membrane (Sartorius).
After removing the virus in the culture supernatant by filtration using
It was concentrated using a kDa ultrafiltration membrane.

When the molecular weight of the protein contained in this concentrate was measured, it was 23.8 kDa. At this time, the molecular weight of the protein was determined by electrophoresis of the protein together with a molecular weight marker by SDS-PAGE, followed by staining with Coomassie brilliant blue, and calculating the mobility in the gel and the log ₁₀ molecular weight. This protein is anti-sheep IL
-6 Rabbit serum (Serotec Ltd, UK), and had the biological activity of stimulating the synthesis of bovine hepatocyte acute phase protein, confirming that the protein obtained was bovine IL-6. Was. Therefore, this recombinant bovine IL-6 was used as an immunogen in the following experiments.

(2) Immunization and collection of antibody-producing cells Immunization The above-mentioned (1) was intraperitoneally injected into male BALB / C mice (10 weeks old).
The culture supernatant concentrate containing recombinant bovine IL-6 prepared in (1) (100 μg of recombinant bovine IL-6 per mouse) was initially immunized with complete Freund's adjuvant. After the first immunization,
Booster immunization was performed at 2 weeks and final immunization was performed at 3 weeks.

Measurement of antibody titer After the final immunization, blood was collected from the ear vein of the mouse, and serum and antigen (recombinant bovine IL-6) were collected by Western blotting.
And the antibody titer was measured. Cell fusion and selection of hybridoma Spleen cells of a mouse in which an increase in antibody titer was confirmed were taken out, and the spleen cells and myeloma cells P3X63Ag8U1 were mixed at 10: 1.
(G. Kohler and C. Milshtein: Nature, 25)
6,495 (1975)). After cell fusion, 200μ in 96-well plate
The mixture was dispensed in l increments, cultured in a HAT medium (at 37 ° C. for 14 days), and hybridomas were selected.

Screening and cloning of antibody-producing hybridoma The recombinant bovine IL-6 prepared in (1) above was adsorbed, and 50 μl of the culture supernatant of the hybridoma was added to each well of the microplate that had been blocked with Block Ace (Dainippon Pharmaceutical). Was added and reacted at 37 ° C. for 1 hour. After washing with saline,
50 μl of appropriately diluted alkaline phosphatase-conjugated goat anti-mouse immunoglobulin was added and reacted at 37 ° C. for 1 hour. After washing with saline, ALP Rose (Sinotest)
Was used to measure the activity of alkaline phosphatase.
Alkaline phosphatase is colored with bovine IL.
A well containing an antibody-producing cell specific to -6 was obtained. Cloning of the antibody-producing cells was performed by subjecting the selected hybridomas to limiting dilution three times using mouse intraperitoneal macrophages as feeder cells.

The hybridoma clones established as described above were named BOIL-6-7H6 and BOIL-6-10B7, and these hybridoma clones were transferred to FERM P-17426 and FERM P-17426, respectively, at the Institute of Biotechnology and Industrial Technology, respectively. FERM P-17427
(Deposit date: June 15, 1999). Hereinafter, the monoclonal antibody produced by hybridoma BOIL-6-7H6 is referred to as "monoclonal antibody 7H6", and the monoclonal antibody produced by hybridoma BOIL-6-10B7 is referred to as "monoclonal antibody 10B7".

Collection of Monoclonal Antibody The above hybridoma was injected into the abdominal cavity of a BALB / C mouse previously injected intraperitoneally with pristane (2,6,10,14-tetramethylpentadecan). When the injected mice were bred for 2 weeks, ascites due to the hybridoma was formed in the mice and a high concentration of antibody was produced in the ascites, and the ascites of the mice was collected. The collected antibody was purified using a DEAE-Sephacel column (Pharmacia) after fractionation with 50% saturated ammonium sulfate.

Western Blotting The recombinant bovine IL prepared in (1) above was used as a primary antibody using the culture supernatant of hybridoma BOIL-6-7H6 and BOIL-6-10B7.
-6 was subjected to Western blotting. As shown in FIG. 1, the monoclonal antibodies produced by each hybridoma reacted with the recombinant IL-6. FIG.
Among them, lane 1 shows the results using monoclonal antibody 10B7, lane 2 shows the results using monoclonal antibody 10B7 in 10 times the amount of lane 1, lane 3 shows the results using monoclonal antibody 7H6, and lane 4 Shows the results obtained when 10 times the amount of the monoclonal antibody 7H6 in Lane 3 was used.

Example 2 ELISA Using Monoclonal Antibody Against Bovine IL-6 Monoclonal antibody 10B7 was diluted with a carbonate buffer (pH 9.6) (20 μg / ml), and a 96-well ELISA plate for fluorescence (Fluoro
Nunc, Nunc) and then left at 4 ° C. overnight to immobilize the monoclonal antibody on the plate. Then, add PBS containing 2% Block Ace (Dainippon Pharmaceutical) to the plate.
The plate was blocked by dispensing 100 μl / well and leaving at 25 ° C. for 2 hours. Then on the plate
Dispense 100 μl / well of PBS containing 30% sucrose, 25 ℃
, And the solution was discarded, sealed, and stored at 4 ° C.

The plate was washed immediately before use with a washing solution (0.05% Tween).
Washed 3 times with PBS containing recombinant bovine IL-6 (2000, 100
100 μl of a sample containing 0, 800, 400, 200, 100, 50 pg / ml) and 50 μl of assay buffer (0.05% Tween, 2% Block Ace, PBS) were simultaneously added to the plate, and incubated at 25 ° C. for 2 hours, followed by 350 μl And washed three times. The recombinant bovine IL-6 used in the ELISA was prepared in Example 1.
The culture supernatant concentrate containing the recombinant bovine IL-6 prepared in (1) is further fractionated by gel filtration chromatography, and purified by an affinity column on which the monoclonal antibody 10B7 is immobilized.

Next, a biotin-labeled anti-bovine IL-6 polyclonal antibody (5 μg / ml) diluted in assay buffer was added.
After dispensing 100 μl / well, the mixture was allowed to stand at 25 ° C. for 2 hours, and then washed with a washing solution. The anti-bovine IL-6 polyclonal antibody was prepared as follows. The anti-bovine IL-6 polyclonal antibody was injected into rabbit muscle or subcutaneously with a 500 μg / ml bovine IL-6 emulsion mixed with Freund's complete adjuvant, and the serum titer was increased by Western blotting. confirmed. Booster immunization was performed twice every two weeks, and whole blood was collected two weeks after the final injection to obtain an antiserum having a high antibody titer. The antibody is DEAE Affi-Gel BlueGel (B
io-Rad).

Next, 100 μl / well of alkaline phosphatase-labeled avidin (Sigma, × 10,000) was dispensed, left at 25 ° C. for 1 hour, and washed with a washing solution. Finally, 50 μl / well of chemiluminescent substrate Lumidiphos Plus (Dainippon Pharmaceutical) was dispensed,
About one hour later, the amount of chemiluminescence was measured with a chemiluminescence measuring device luminometer. As a result, as shown in FIG. 2, the bovine IL-6 content in the sample could be accurately quantified in the range of 50 pg / ml to 20,000 pg / ml. In particular, by simultaneously reacting 100 μl of a sample containing recombinant bovine IL-6 with 50 μl of assay buffer (0.05% Tween, 2% Block Ace, PBS), the background was reduced, and bovine IL in the sample was reduced.
-6 content could be accurately quantified (FIG. 2).

Example 3 Cross-Reactivity of Monoclonal Antibody Against Bovine IL-6 with Human IL-6 and Mouse IL-6 In the same manner as in Example 2, human IL-6 or mouse IL-6 (10 ng) was used.
/ ml) to examine the cross-reactivity of monoclonal antibody 10B7 against bovine IL-6 against human IL-6 and mouse IL-6. The results are shown in Table 1 below. Table 1 also shows the reactivity of monoclonal antibody 10B7 with bovine IL-6.

[0042]

[Table 1]

In Table 1, as the amount of chemiluminescence increases,
Since the amount of reaction between the monoclonal antibody and IL-6 is large, the monoclonal antibody 10B7
The reaction amount for IL-6 (10 ng / ml) was bovine IL-6 (50 pg / m
It became clear that the reaction amount was smaller than that for l). The amount of human IL-6 and mouse IL-6 used (10 ng / ml)
Despite being 200 times the amount of bovine IL-6 used (50 pg / ml), the amount of reaction to human IL-6 and mouse IL-6 (10 ng / ml) was comparable to that of bovine IL-6 (50 pg / ml). Since the amount was smaller than the reaction amount, it was revealed that the monoclonal antibody 10B7 did not cross-react with human IL-6 and mouse IL-6, but specifically reacted only with bovine IL-6.

[0044]

According to the present invention, a monoclonal antibody specifically reacting with bovine IL-6 is provided. The monoclonal antibody of the present invention does not cross human IL-6 or mouse IL-6, reacts only with bovine IL-6, and has high specificity for bovine IL-6.
Therefore, bovine IL-6 can be accurately detected and quantified by the ELISA method, immunohistochemical staining method, Western blotting method, or the like using the monoclonal antibody of the present invention. By detecting and quantifying bovine IL-6, research on IL-6, which is important not only in the prognosis of bovine infectious disease but also in relation to endocrine, immune and nervous systems, has taken a leap forward, and a new disease prevention method has been developed. Can be established.

[0045]

[Sequence List] SEQUENCE LISTING <110> National Institute of Animal Health <120> Monoclonal antibody directed to Bovine IL-6 <130> P99-0347 <160> 4 <210> 1 <211> 1108 <212> DNA <213> Bovine <220> <221> CDS <222> (43) .. (669) <400> 1 ccaggaacga aagagagctc catctgccct ccaggaacag ct atg aac tcc cgc 54 Met Asn Ser Arg ttc aca agc gcc ttc act cca ttc gct gtc tcc ctg ctg ctc ctg 102 Phe Thr Ser Ala Phe Thr Pro Phe Ala Val Ser Leu Gly Leu Leu Leu 5 10 15 20 gtg atg act tct gct ttc cct acc ccg ggt ccc ctg gga gaa gat ttc 150 Val Met Thr Ser Ala Phe Pro Thr Pro Gly Pro Leu Gly Glu Asp Phe 25 30 35 aaa aat gac acc acc cca ggc aga cta ctt ctg acc act cca gag aaa 198 Lys Asn Asp Thr Thr Pro Gly Arg Leu Leu Leu Thr Thr Pro Glu Lys 40 45 50 acc gaa gct ctc att aag cgc atg gtc gac aaa atc tct gca atg aga 246 Thr Glu Ala Leu Ile Lys Arg Met Val Asp Lys Ile Ser Ala Met Arg 55 60 65 aag gag ata tgt gag aag aat gat gag tgt gaa agc agc aag gag aca 294 Glu Ile Cys Glu Lys Asn Asp Glu Cys Glu Ser Ser Lys Glu Thr 70 75 80 ctg gca gaa aat aag ctg aat ctt cca aaa atg gag gaa aag gac gga 342 Leu Ala Glu Asn Lys Leu Asn Leu Pro Lys Met Glu Glu Lys Asp Gly 85 90 95 100 tgc ttc caa tct ggg ttcat cag gcg att tgc ttg atc aga acc act 390 Cys Phe Gln Ser Gly Phe Asn Gln Ala Ile Cys Leu Ile Arg Thr Thr 105 110 115 gct ggt ctt ctg gag tat cag ata tac ctg gac tac ctc cag aac gag 438 Ala Gly Leu Leu Glu Tyr Gln Ile Tyr Leu Asp Tyr Leu Gln Asn Glu 120 125 130 tat gag gga aat cag gaa aat gtc agg gat ttg agg aaa aat atc aga 486 Tyr Glu Gly Asn Gln Glu Asn Val Arg Asp Leu Arg Lys Asn Ile Arg 135 140 145 aca ctg atc cag atc ctg aag caa aag atc gca gat cta ata acc act 534 Thr Leu Ile Gln Ile Leu Lys Gln Lys Ile Ala Asp Leu Ile Thr Thr 150 155 160 cca gcc aca aac act gac ctg ctg gag aag atg cag tct tca aac gag 582 Pro Ala Thr Asn Thr Asp Leu Leu Glu Lys Met Gln Ser Ser Asn Glu 165 170 175 180 tgg gta aag aac gca aag att atc ctc atc ctg aga aac ctt gag aat 630 Trp Val Lys Asn Ala Lys Ile Ile Leu Ile L eu Arg Asn Leu Glu Asn 185 190 195 ttc ctg cag ttc agc ctg aga gct att cgg atg aag tag ctggggctcc 679 Phe Leu Gln Phe Ser Leu Arg Ala Ile Arg Met Lys 200 205 catgattg gtagttcg cctcg gccattgc ctg cg ctcat gc ctg ctattttatc 799 tttaatttat tgatatttaa atatgtgatt ttgagttaat ttatatacat gataagtatt 859 tatattttta tgaagtgcca cttgaaatat tttatgtatt tggtttgaaa aagtaacgta 919 aaaatggcta tgtggcttga atgtccttat tgttttggag acaaatcatt tcttgaaatg 979 tgtaggctta cctcaaaaaa tttgctaact tatgcatatt tttaaaggca tatttatatt 1039 gtatttatat aatgtttagg ctgtttttat aacaataaac ttctttttta aagaaaaaaa 1099 aaaaaaaaa 1108 <210> 2 <211> 208 <212> PRT <213> Bovine <400> 2 Met Asn Ser Arg Phe Thr Ser Ala Phe Thr Pro Phe Ala Val Ser Leu 1 5 10 15 Gly Leu Leu Leu Val Met Thr Ser Ala Phe Pro Thr Pro Gly Pro Leu 20 25 30 Gly Glu Asp Phe Lys Asn Asp Thr Thr Pro Gly Arg Leu Leu Leu Thr 35 40 45 Thr Pro Glu Lys Thr Glu Ala Leu Ile Lys Arg Met Val Asp Lys Ile 5 0 55 60 Ser Ala Met Arg Lys Glu Ile Cys Glu Lys Asn Asp Glu Cys Glu Ser 65 70 75 80 Ser Lys Glu Thr Leu Ala Glu Asn Lys Leu Asn Leu Pro Lys Met Glu 85 90 95 Glu Lys Asp Gly Cys Phe Gln Ser Gly Phe Asn Gln Ala Ile Cys Leu 100 105 110 Ile Arg Thr Thr Ala Gly Leu Leu Glu Tyr Gln Ile Tyr Leu Asp Tyr 115 120 125 Leu Gln Asn Glu Tyr Glu Gly Asn Gln Glu Asn Val Arg Asp Leu Arg 130 135 140 Lys Asn Ile Arg Thr Leu Ile Gln Ile Leu Lys Gln Lys Ile Ala Asp 145 150 155 160 Leu Ile Thr Thr Pro Ala Thr Asn Thr Asp Leu Leu Glu Lys Met Gln 165 170 175 Ser Ser Asn Glu Trp Val Lys Asn Ala Lys Ile Ile Leu Ile Leu Arg 180 185 190 Asn Leu Glu Asn Phe Leu Gln Phe Ser Leu Arg Ala Ile Arg Met Lys 195 200 205 <210> 3 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> sense primer for RT-PCR <400> 3 tccggaattc gaacagctat gaactcccgc tt 32 <210> 4 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> antisense primer for RT-PCR <400> 4 tgtacctagg atgcccagga actaccacca tc 32

[Brief description of the drawings]

FIG. 1 shows the results of Western blotting on bovine IL-6 using monoclonal antibodies produced by hybridomas BOIL-6-7H6 and BOIL-6-10B7.

FIG. 2. Bovine IL- in a sample was determined by ELISA using a monoclonal antibody produced by hybridoma BOIL-6-10B7.
FIG. 6 is a view showing the result of quantifying 6;

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) // C12P 21/08 C12N 5/00 B (C12P 21/08 C12R 1:91) F-term (Reference) 4B024 AA11 BA43 BA61 DA02 GA03 GA27 HA03 HA15 4B064 AG27 CA10 CA20 CC24 CE04 CE11 DA13 4B065 AA92X AB05 CA25 CA46 4H045 AA11 AA20 CA40 DA75 DA76 EA50 FA71 FA72 FA74 GA06 GA23 GA26

Claims (5)

[Claims] 1. A monoclonal antibody which specifically reacts with bovine interleukin-6. 2. The monoclonal antibody according to claim 1, which is produced by a hybridoma having an accession number of FERM P-17426. 3. The monoclonal antibody according to claim 1, which is produced by a hybridoma having an accession number of FERM P-17427. 4. A hybridoma that produces the monoclonal antibody according to claim 1. 5. A method for quantifying bovine interleukin-6 in a sample, using the monoclonal antibody according to claim 1.