JP2001061479A - Modified blood coagulation factor vii - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new (activated) modified blood coagulation factor VII which has a modification at a specific site of an amino acid sequence, has an enhanced enzyme activity, and is useful as a medicine effective for treating a hemophilia inhibitor patient or the like. SOLUTION: This is a new (activated) modified blood coagulation factor VII (FVII) which has at least one modification(s) selected from a group comprising cleaving the disulfide bond (159Cys-164Cys) consisting of 159th cysteine (159Cys) and 164th cysteine (164Cys) in blood coagulation factor VII, substituting, adding, or deleting at least a part of the amino acid sequence constituting the loop structure consisting of the amino acid sequence from 233rd threonine (233Thr) to 240th asparagine (240Asp) in FVII, and substituting, adding, or deleting at least a part of the amino acid sequence constituting the intervening sequence consisting from 304th arginine (304Arg) to 329th cysteine (329Cys) in FVII, and has an enhanced enzyme activity.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a blood coagulation factor VII (hereinafter sometimes referred to as FVII) and / or an activated blood coagulation factor VII (hereinafter referred to as FVIIa) having enhanced enzyme activity. A)). Specifically, the present invention provides a modified FVII / FVIIa having enhanced activity by substituting or deleting an amino acid sequence unique to FVII, a pharmaceutical composition containing the modified as an active ingredient, and the pharmaceutical. The present invention relates to an agent comprising a composition, which is effective for treating a hemophilia inhibitor patient.

[0002]

2. Description of the Related Art It is widely known that FVII is a vitamin K-dependent blood coagulation factor and is an initiator of extrinsic blood coagulation. Other vitamin K
As in the case of the dependent coagulation factor, 10 gamma-carboxyglutamic acids (hereinafter, referred to as "gamma-carboxyglutamic acid")
Gla region) (Proc. Natl. Acad. Sci. USA,
vol. 83, p. 2412-2416, 1986). FV
II is activated blood coagulation factor X (hereinafter sometimes referred to as FXa), activated blood coagulation factor IX (hereinafter sometimes referred to as FIXa) or thrombin (hereinafter referred to as FIIa) in vitro. Is sometimes hydrolyzed to convert it into active FVII or FVIIa composed of H and L chains cross-linked by one SS bond (J). .Biol.Chem., Vol.
251, p. 4797-4802, 1976).

[0003] The enzyme activity of FVIIa itself is extremely weak.
It increases dramatically when it binds to tissue factor (TF), a coenzyme (Komiyama et al., Biochemistry, 29 (40), pp. 94).
18-25 (1990)). The primary structures of FVIIa and TF, the crystal structure of the complex, and the binding site between the two molecules have been elucidated at the amino acid residue level. Details of the catalytic activity amplification mechanism (steric structure change due to TF binding) Is still unknown (Banner et al.,, Et al., Nature 380 (6569):
pp.41-6 (1996)).

As replacement therapy for patients with hemophilia A and hemophilia B, blood coagulation factor VIII (hereinafter sometimes referred to as FVIII) and blood coagulation factor IX (hereinafter FIX)
(Sometimes referred to as). However, the appearance of neutralizing antibodies against FVIII and FIX (sometimes called inhibitors) has been regarded as a problem with the treatment.

[0005] As coping therapy for hemophilia patients who have produced such inhibitors, (1) excessive administration of FVIII factor, (2)
Administration of porcine FVIII factor, (3) FII, FVII, FIX
And FX, and (4) administration of an FVIIa preparation. However, in these methods, (1) the symptom deterioration due to induction of higher titer inhibitors, (2) shock due to antigenicity, (3) thrombosis / DIC induction, (4) ) Suffers from problems such as insufficient therapeutic effect and high cost due to large dose and frequent administration. Among them, the most efficient one is the administration of the FVIIa preparation (4), considering the balance between effects and risks. However, due to its weak activity, FVIIa preparations require large doses and frequent doses as described above in order to exhibit a hemostatic effect, which greatly increases the treatment cost. Also,
The therapeutic effect is not enough compared with the conventional replacement therapy for hemophilia patients.

As a means for solving this problem, production of a variant of FVII having an increased enzymatic activity can be mentioned, but this is generally known to be difficult (structure of protein). Introductory, supervised by Katsube Katsube, published by Kyoikusha, 1992). In particular, it is considered difficult to enhance the activity of blood coagulation factors by modification for the following reasons.

[0007] Hemophilia is an abnormality of a blood coagulation factor, and is classified into two types: a decrease in activity due to a quantitative defect and a decrease in activity due to a qualitative abnormality. Most of the qualitative abnormalities (points)
Mutation is known, and as a result of analysis of a patient with hemophilia B having FIX abnormality, FI
It is clear that there is a molecular abnormality throughout the structure of X, and in many cases, only one amino acid is replaced, and the activity becomes 1% or less. Therefore, it is clear that even if the blood coagulation factor is modified unnecessarily, the activity is reduced.

Also, information obtained by Alanine Scannning (Dickinson et al., Proc. Natl. Acad. Sci. USA, 93
(25), pp. 14379-84 (1996)).
Of the two Alanine substitutions, only one of them has increased enzyme activity, and the regularity has not been found.

In another attempt, Hopfner et al.
Using a method of deleting / substituting a structural unit consisting of several amino acid residues of a part of the domain constituting X, a modified FIX fragment having an increased synthetic substrate activity was prepared (EMBO J, 16 (22) , pp.6626-35 (1997)). However, this is not an intact FIX, but a fragment of FIX expressed in Escherichia coli and only observes the synthetic substrate activity. It is. Furthermore, this is related to FIX, and does not suggest anything about FVII, which is another substance having a completely different structure and specificity, and no report has been made on a variant having an enhanced enzyme activity of FVII. Absent.

[0010] As described above, it has been considered that the production of a variant having a strong enzyme activity is particularly difficult for a blood coagulation factor. In FIX, attempts have been made to increase the synthetic substrate activity of partial fragments thereof, but there have been no reports on modified blood coagulation factors having high enzymatic activity as intact molecules.

[0011] Accordingly, an object of the present invention is to provide FVII and / or FVIIa having a strong activity which is effective for treating hemophilia inhibitor patients in a situation where it is generally considered that the modification of blood coagulation factors is difficult. Production and provision.

[0012]

Under the circumstances described above, the present inventors have developed an FV having a high enzymatic activity by itself.
As a result of intensive studies and various investigations for producing II, the present invention was completed. The present invention is based on FVI
By comparing the amino acid sequence structure of I with various serine proteases, clarifying the amino acid sequence site specific to FVII, and deleting / substituting the specific site to obtain a modified FVII and / or FVIIa variant having enhanced activity It has been successfully manufactured.

[0013]

DETAILED DESCRIPTION OF THE INVENTION The basic structure of a group of serine proteases belonging to the trypsin family consists of about 250 residues and is roughly divided on the amino acid sequence into two domains, the first half and the second half (FIG. 1). In each domain, there are 6 β-strands, and a total of 12 β-strands
It is formed with a structure having strands (FIG. 2). These 12 β-strands have a so-called serine protease skeletal structure, and a loop or helical region connecting the strands has a protease activity such as its substrate specificity and reactivity with cofactors. It is considered. Examples of serine proteases include:
There are various blood coagulation factors such as FII, FVII, FVIII, FIX, and FX, thrombolytic enzymes such as plasmin, and digestive enzymes such as trypsin, chymotrypsin, and elastase. Therefore, the amino acid sequence structures of various serine proteases including FVII were compared, and FVII was compared.
(FIG. 3). Then, these sites were used as targets for modification, and the amino acid sequence of FVII was deleted / substituted with reference to the structures of other serine proteases to prepare modified FVII having high enzyme activity. These variants will be described in detail.

(A) Modified product in which 159 Cys-164 Cys bond has been cleaved (a-) By replacing 159 Cys and 164 Cys with an amino acid residue other than Cys, the 159 Cys-1
A variant (VII-5) in which 64 Cys has been cleaved. As a specific example of this variant, Cys is alanine (Al
The substitution of a) is described in SEQ ID NO: 3 or 4 in the Sequence Listing. Here, Ala was selected as an example of an amino acid residue other than Cys used for substitution.
Any amino acid can be selected as long as it does not cause a major obstacle such as inactivating the enzyme activity other than cleaving the ys-Cys bond.

(A-) By substituting 164 Cys with an amino acid residue other than Cys and substituting Valin (299 Val) at position 299 with Cys, 159 Cy is obtained.
s-164Cys is truncated, and 159Cys and 299Cys
Disulfide bond between (159Cys-299Cys)
Is formed (VII-6). As a specific example of this variant, the amino acid residue other than Cys substituted with Ala is described in SEQ ID NO: 5 or 6 in the Sequence Listing. Here, as for amino acid residues other than Cys used for substitution, 159 Cys-164 Cy
Other amino acids other than Ala can be selected as long as they do not cause a major obstacle such as inactivating the enzyme activity other than breaking the s bond.

(B) Threonine 233 (233 Thr) to Asparagine 240 (240) in FVII
Loop structure consisting of the amino acid sequence of Asn) (hereinafter, 9)
9-loop) or a variant in which the amino acid sequence or a part thereof is substituted, added or deleted. This region contains an amino acid sequence interposed between β-strand 5 and β-strand 6, which are commonly present in serine proteases, as shown in FIG. This region is preferably replaced with an amino acid sequence corresponding to the structure of another trypsin serine protease. One suitable example of a trypsin family serine protease is human trypsin. Further, as a specific example, 9 of FVII
The amino acid sequence from the 235th valine (235Val) to the 239th threonine (239Thr) in 9-loop is Asp-A which is in the loop structure of trypsin.
variant substituted with rg-Lys-Thr-Leu (V
II-30). This variant is described in SEQ ID NO: 7 or 8 in the Sequence Listing.

(C) In FVII, arginine at position 304 (304Arg) to cysteine at position 329 (329C
A variant in which the amino acid sequence constituting the intervening amino acid sequence of ys) or a part thereof is substituted, added or deleted. In particular, as shown in FIG. 3, in the amino acid sequence interposed between β-strand 8 and β-strand 9 which are commonly present in serine proteases, FVII is longer by several amino acid residues than other serine proteases. It is presumed that it can be a suitable target in FVII modification. This region is preferably replaced with an amino acid sequence corresponding to the structure of another trypsin family serine protease. One suitable example of a trypsin family serine protease is human trypsin. Further, a preferable region which can be substituted, added or deleted in FVII is a cysteine at position 310 (310C).
ys) or an amino acid sequence constituting a loop structure (sometimes referred to as 170-loop) consisting of the amino acid sequence of the cysteine at position 329 (329Cys) from position 329. Further, as a specific example, 17 of FVII
Leucine at position 311 in 0-loop (311Leu)
Is the amino acid sequence from asparagine to 322nd asparagine (322Asn) in the loop structure of human trypsin.
lu-Ala-Ser-Tyr-Pro-Gly-Ly
s-substituted variant (VII-31).
This variant is described in SEQ ID NO: 9 or 10 in the Sequence Listing.

Further, the above modifications (a) to (c) can be appropriately combined. As a specific example,
For example, the combination of (b) and (c), that is, FV
Valine at position 235 in the 99-loop of II (235 V
al) to the 239th threonine (239Thr) are substituted with Asp-Arg-Lys-Thr-Leu in the loop structure of human trypsin, and the 311th leucine (311Leu) in 170-loop. ) From the 322nd asparagine (322As
The amino acid sequence up to n) is Glu-Ala-Ser-Tyr-Pro-Gl within the loop structure of trypsin.
Variant (VII-39) substituted with y-Lys. This variant is described in SEQ ID NO: 11 or 12 in the Sequence Listing.

The above-mentioned variants can be obtained by using a gene recombination method. Eukaryotic cells such as animal cells are preferred as expression hosts. The variants of the present invention are obtained by incorporating the cDNA encoding the amino acid sequence of each of the variants into an appropriate expression vector, transfecting the cells into host cells, cloning the cells expressing the gene of interest, and obtaining the stable It is obtained by culturing and purifying the expression strain.

The modified FVII of the present invention is subjected to various chemical treatments and the like, and can be used as an activated FVII (FVIIa) modified.

The FVII / FVIIa variants of the present invention can be formulated into pharmaceutical preparations for therapeutic, diagnostic or other uses. For preparations for intravenous administration, the compositions will usually comprise a physiologically compatible substance such as sodium chloride, glycine, etc., and have a buffered pH compatible with physiological conditions. Dissolves in aqueous solution. In addition, from the viewpoint of ensuring long-term stability, it may be considered to take the form of a freeze-dried preparation as the final dosage form. The guidelines for compositions administered intravenously are established by government regulations, for example, the “Biological Standards”. Specific uses of the pharmaceutical composition comprising the modified FVII / FVIIa of the present invention include FV
Treatment of hemophilia inhibitor patients who have produced inhibitors against the blood clotting factor by III or FIX replacement therapy.

[0022]

EXAMPLES The present invention will be illustrated by examples, but these examples do not limit the present invention. The invention of the present application will be illustrated in a specific embodiment with reference to the accompanying drawings.
In the examples, the variants were expressed in the culture supernatant of animal cells (CHO-K1). Unless otherwise specified, reagents related to genetic recombination used products manufactured by Takara Shuzo, Toyobo and Perkin Elmer Applied New England Biolabs.

Embodiment 1 Cloning of FVII cDNA >> A human liver cDNA library (Takara Shuzo) was purchased, and the literature (Molecular Basis of Thrombosia and Hemo) was purchased.
FVII synthetic DNA sense primer (VII-PWN; GGGGTCGACATGGTCTCCCAGGCCC) to which a SalI site is added based on a known cDNA sequence (described in SEQ ID NO: 1 in the Sequence Listing)
TCAGGCTCCTCTGCCTTCTG) and an antisense primer with a BamHI site added (VII-PWC; CCCGGATCCCTAGGGAA)
PCR was performed using ATGGGGCTCGCAGGAGGACTCCTGGGCG) and a commercially available cloning vector pCRII (Invitrogen
Was cloned. At this time, a DNA sequence is performed by a conventional method, and a sequence (Hagen FS et.
al, PNAS 1986; 83; 2412-6).

<< Embodiment 2. Preparation of FVII Expression Vector >> Expression vector pCAGn (Japanese Patent No. 2824434) is digested with SalI and BamHI, and the DNA fragment prepared in Example 1 containing the FVII-encoding sequence is cut with SalI and BamHI. And transformed into E. coli JM105, L containing ampicillin
After culturing on a B agar medium, transformed E. coli was selected. The appeared colonies were cultured overnight in a commercially available medium, and the desired expression plasmid was extracted and purified to prepare "pVII-W". DNA sequencing of this expression vector confirmed that it had the desired gene sequence.

Embodiment 3 Preparation of variant expression vector >>
Each FVII variant having the amino acid sequence shown in FIG.
Created by the following method. Note that FIG.
Only the amino acid sequence at the C-terminal side from the isoleucine at the second position is shown, and the amino acid at the N-terminal side from the arginine at the 152nd position is the same as the wild type without any modification. Using the synthetic DNA primer shown in FIG.
PCR is performed using the VII gene as a template to obtain respective amplified fragments. Each amplified fragment and the expression vector pCAGn were
And cut with BamHI, ligated, transformed into E. coli JM105, and cultured on LB agar medium containing ampicillin to select transformed E. coli. The appearing colonies were cultured overnight in a commercially available medium, and the desired expression plasmid was extracted and purified, and the `` pVII-5 '', `` pVII-30 '', and `` pVII-
31 "was prepared (FIG. 6). Further, “pVII-6” was obtained by using the gene obtained using the primers and the primers shown in FIG. 5 as a template and further performing PCR using the primers and the like. Also, "pVII-39"
Was obtained by using the gene obtained using the primer and (10) as a template, and further performing PCR using primers (11) and (12). Further, DNA sequencing was carried out, and it was confirmed that these plasmids had the desired sequence.

<< Embodiment 4. Expression and purification of each variant in culture supernatant >> The above expression vector was transduced into CHO cells with a commercially available lipofectin reagent, and G418 (1 mg /
ml), and cells expressing the target gene were cloned by the ultradilution method. The expression of the FVII variant was confirmed using a commercially available ELISA kit for FVII (Acerachrome FVII; Diagnostica Strago). The obtained stable expression strain was cultured in a serum-free medium (ASF104, Ajinomoto, penicillin, streptomycin, 20 μg / ml vitamin K, 1 mM butyric acid), and purified with an anti-human FVII monoclonal antibody column (Japanese Patent No. 2842430). Equilibration, washing and elution were performed using the equilibration and washing buffer (50 mM Tris, pH 7.2, 0.1 M NaCl, 50 mM Benzamidine
-HCl, 2mM Ca ²⁺ ), elution buffer (50mM Tris, pH
7.2, 0.1 M NaCl, 50 mM Benzamidine-HCl, 10 mM EDTA). The purified variant is subjected to SDS-PAGE,
Alternatively, Western blotting was performed using a commercially available antibody against FVII, and it was confirmed that the antibody was a modified FVII.

Embodiment 5 FIG. Measurement of coagulation activity of each variant >>
The coagulation activity of each variant was measured by a coagulation method using FVII-deficient plasma according to a conventional method. 50-5 ng of each purified variant
/ ml, mixed with an equal amount of FVII deficiency, heated at 37 ° C for 3 minutes, and then added with an equal amount of re-lipidated TF (thromboplastin; Dade) to allow the coagulation reaction to proceed. Started. The coagulation time was measured, and the coagulation activity was determined from the standard curve and the dilution ratio. The results obtained by converting the coagulation activity per protein concentration (measured by the Bradford method) to determine the specific activity are shown in Table 1.
As a result, the modified FVII of the present invention has a plasma-derived FVI
It was found to have 2-6 times higher clotting activity compared to I and wild type recombinant FVII.

[0028]

[Table 1]

Embodiment 6 FIG. Preparation of Each Activated Variant >> Purified each variant was subjected to 50 mM Tris, pH 7.45, 0.1 MN
dialyzed against aCl, added FXa 1/100 (molar ratio), and added 50 mM Tri
s, pH 7.45, 0.1 M NaCl, 0.1% PEG 8000, 100 μg / mL phospholipid (Platerin® Organotecnica), 10 m
The cells were incubated and activated under conditions of M Ca ²⁺ and 37 ° C. for 1 to 60 minutes. After activation, the reaction was stopped by adding 50 mM Benzamidine-HCl, and purified with an anti-human FVII monoclonal antibody column (the same method as in Example 4). Each purified activated variant was dialyzed against TBS pH 8.0 (containing 0.1% PEG 8000) and stored frozen at -80 ° C. The degree of activation is SD
Confirmed by S-PAGE.

Embodiment 7 Measurement of Water-degrading Activity of Each Activated Variant on Synthetic Substrate >> The activated variant VIIa-31 according to Example 6 was reduced to 50 mM Tris-
HCl, 100 mM NaCl, 10 mM Ca ²⁺ , 0.1% PEG 8000, diluted with pH 8.0, various synthetic substrates were added thereto to a final concentration of 1.0 mM, the final volume was 200 μl, and reacted at 30 ° C. The amount of substrate hydrolysis per minute was observed. Microplate reader Spectra max plus (Molecular
pNA release was measured as the degree of color development at 405 nm. Table 2 shows the results. VIIa-31, one of the variants of the present invention, showed higher hydrolytic activity than wild-type (VIIa-W) for any of the synthetic substrates, and the range was 2 to 23 times.

[0031]

[Table 2]

[0032]

The FV obtained by the present invention as described above
II and / or FVIIa variants are wild-type FV
It has a significantly higher enzyme activity than II. Therefore, the variant of the present invention can be a very effective drug as replacement therapy for hemophilia inhibitor patients.

[Sequence List] SEQUENCE LISTING <110> The Chemo-Sero-Therapeutic Research Institute <120> Recombinant mutants of blood coagulation factor VII <160> 12 <210> 1 <211> 1221 <212> DNA <213> blood coagulation factor VII <400> 1 GCC AAC GCG TTC CTG GAG GAG CTG CGG CCG GGC TCC CTG GAG AGG GAG 48 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 TGC AAG GAG GAG CAG TGC TCC TTC GAG GAG GCC CGG GAG ATC TTC AAG 96 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 GAC GCG GAG AGG ACG AAG CTG TTC TGG ATT TCT TAC AGT GAT GGG GAC 144 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 CAG TGT GCC TCA AGT CCA TGC CAG AAT GGG GGC TCC TGC AAG GAC CAG 192 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 CTC CAG TCC TAT ATC TGC TTC TGC CTC CCT GCC TTC GAG GGC CGG AAC 240 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 TGT GAG ACG CAC AAG GAT GAC CAG CTG ATC TGT GTG AAC GAG AAC GGC 288 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 GGC TGT GAG CAG TAC TGC AGT GAC CAC ACG GGC ACC AAG CGC TCC TGT 336 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 CGG TGC CAC GAG GGG TAC TCT CTG CTG GCA GAC GGG GTG TCC TGC ACA 384 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 CCC ACA GTT GAA TAT CCA TGT GGA AAA ATA CCT ATT CTA GAA AAA AGA 432 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 AAT GCC AGC AAA CCC CAA GGC CGA ATT GTG GGG GGC AAG GTG TGC CCC 480 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Cys Pro 145 150 155 160 AAA GGG GAG TGT CCA TGG CAG GTC CTG TTG TTG GTG AAT GGA GCT CAG 528 Lys Gly Glu Cys Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 TTG TGT GGG GGG ACC CTG ATC AAC ACC ATC TGG GTG GTC TCC GCG GCC 576 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 CAC TGT TTC GAC AAA ATC AAG AAC TGG AGG AAC CTG ATC GCG GTG CTG 624 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 GGC GAG CAC GAC CTC AGC GAG CAC GAC GGG GAT GAG CAG AGC CGG CGG 672 Gly Glu His Asp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg 210 215 220 GTG GCG CAG GTC ATC ATC CCC AGC ACG TAC GTC CCG GGC ACC ACC AAC 720 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn 225 230 235 240 CAC GAC ATC GCG CTG CTC CGC CTG CAC CAG CCC GTG GTC CTC ACT GAC 768 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 CAT GTG GTG CCC CTC TGC CTG CCC GAA CGG ACG TTC TCT GAG AGG ACG 816 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 CTG GCC TTC GTG CGC TTC TCA TTG GTC AGC GGC TGG GGC CAG CTG CTG 864 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 285 GAC CGT GGC GCC ACG GCC CTG GAG CTC ATG GTG CTC AAC GTG CCC CGG 912 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg 290 295 300 CTG ATG ACC CAG GAC TGC CTG CAG CAG TCA CGG AAG GTG GGA GAC TCC 960 Leu Met Thr Gln Asp Cys Leu Gln Gln Ser Arg Lys Val Gly Asp Ser 305 310 315 320 CCA AAT ATC ACG GAG TAC ATG TTC TGT GCC GGC TAC TCG GAT GGC AGC 1008 Pro Asn Ile Thr Glu Tyr Met Phe Cys Ala Gly Ty r Ser Asp Gly Ser 325 330 335 AAG GAC TCC TGC AAG GGG GAC AGT GGA GGC CCA CAT GCC ACC CAC TAC 1056 Lys Asp Ser Cys Lys Gly Asp Ser Gly Gly Gly Pro His Ala Thr His Tyr 340 345 350 350 CGG GGC ACG TGG TAC CTG ACG GGC ATC GTC AGC TGG GGC CAG GGC TGC 1104 Arg Gly Thr Trp Tyr Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys 355 360 365 GCA ACC GTG GGC CAC TTT GGG GTG TAC ACC ACC AGG GTC TCC CAG TAC ATC 1152 Ala Thr Val Gly His Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile 370 375 380 GAG TGG CTG CAA AAG CTC ATG CGC TCA GAG CCA CGC CCA GGA GTC CTC 1200 Glu Trp Leu Gln Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu 385 390 395 400 CTG CGA GCC CCA TTT CCC TAG 1221 Leu Arg Ala Pro Phe Pro 405 <210> 2 <211> 406 <212> PRT <213> blood coagulation factor VII <400> 2 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Cys Pro 145 150 155 160 Lys Gly Glu Cys Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 Gly Glu His A sp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg 210 215 220 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn 225 230 235 240 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg 290 295 300 Leu Met Thr Gln Asp Cys Leu Gln Gln Ser Arg Lys Val Gly Asp Ser 305 310 315 320 Pro Asn Ile Thr Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser 325 330 335 Lys Asp Ser Cys Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr 340 345 350 Arg Gly Thr Trp Tyr Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys 355 360 365 Ala Thr Val Gly His Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile 370 375 380 Glu Trp Leu Gln Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu 385 390 395 400 Leu Arg Ala Pro Phe Pro 405 <210> 3 <211> 1221 <212> DNA <213> artificial sequence <220> <223> Amino acid sequence of recombinant mutant of blood coagulation fac tor VII in which both of the 159th Cysteine and the 164th Cysteine are r eplaced with Alanine, and cDNA sequence coding there. <400> 3 GCC AAC GCG TTC CTG GAG GAG CTG CGG CCG GGC TCC CTG GAG AGG GAG 48 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 TGC AAG GAG GAG CAG TGC TCC TTC GAG GAG GCC CGG GAG ATC TTC AAG 96 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 GAC GCG GAG AGG ACG AAG CTG TTC TGG ATT TCT TAC AGT GAT GGG GAC 144 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 CAG TGT GCC TCA AGT CCA TGC CAG AAT GGG GGC TCC TGC AAG GAC CAG 192 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 CTC CAG TCC TAT ATC TGC TTC TGC CTC CCT GCC TTC GAG GGC CGG AAC 240 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 TGT GAG ACG CAC AAG GAT GAC CAG CTG ATC TGT GTG AAC GAG AAC GGC 288 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 GGC TGT GAG CAG TAC TGC AGT GAC CAC ACG GGC ACC AAG CGC TCC TGT 336 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 CGG TGC CAC GAG GGG TAC TCT CTG CTG GCA GAC GGG GTG TCC TGC ACA 384 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 CCC ACA GTT GAA TAT CCA TGT GGA AAA ATA CCT ATT CTA GAA AAA AGA 432 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 AAT GCC AGC AAA CCC CAA GGC CGA ATT GTG GGG GGC AAG GTG GCC CCC 480 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Ala Pro 145 150 155 160 AAA GGG GAG GCC CCA TGG CAG GTC CTG TTG TTG GTG AAT GGA GCT CAG 528 Lys Gly Glu Ala Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 TTG TGT GGG GGG ACC CTG ATC AAC ACC ATC TGG GTG GTC TCC GCG GCC 576 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 CAC TGT TTC GAC AAA ATC AAG AAC TGG AGG AAC CTG ATC GCG GTG CTG 624 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 GGC GAG CAC GAC CTC AGC GAG CAC GAC GGG GAT GAG CAG AGC CGG CGG 672 Gly Glu His Asp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg210 215 220 GTG GCG CAG GTC ATC ATC CCC AGC ACG TAC GTC CCG GGC ACC ACC AAC 720 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn 225 230 235 240 CAC GAC ATC GCG CTG CTC CGC CTG CAC CAG CCC GTG GTC CTC ACT GAC 768 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 CAT GTG GTG CCC CTC TGC CTG CCC GAA CGG ACG TTC TCT GAG AGG ACG 816 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 CTG GCC TTC GTG CGC TTC TCA TTG GTC AGC GGC TGG GGC CAG CTG CTG 864 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 285 GAC CGT GGC GCC ACG GCC CTG GAG CTC ATG GTG CTC AAC GTG CCC CGG 912 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg 290 295 300 CTG ATG ACC CAG GAC TGC CTG CAG CAG TCA CGG AAG GTG GGA GAC TCC 960 Leu Met Thr Gln Asp Cys Leu Gln Gln Ser Arg Lys Val Gly Asp Ser 305 310 315 320 CCA AAT ATC ACG GAG TAC ATG TTC TGT GCC GGC TAC TCG GAT GGC AGC 1008 Pro Asn Ile Thr Glu Tyr Met Phe Cys Ala Gly Ty r Ser Asp Gly Ser 325 330 335 AAG GAC TCC TGC AAG GGG GAC AGT GGA GGC CCA CAT GCC ACC CAC TAC 1056 Lys Asp Ser Cys Lys Gly Asp Ser Gly Gly Gly Pro His Ala Thr His Tyr 340 345 350 350 CGG GGC ACG TGG TAC CTG ACG GGC ATC GTC AGC TGG GGC CAG GGC TGC 1104 Arg Gly Thr Trp Tyr Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys 355 360 365 GCA ACC GTG GGC CAC TTT GGG GTG TAC ACC ACC AGG GTC TCC CAG TAC ATC 1152 Ala Thr Val Gly His Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile 370 375 380 GAG TGG CTG CAA AAG CTC ATG CGC TCA GAG CCA CGC CCA GGA GTC CTC 1200 Glu Trp Leu Gln Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu 385 390 395 400 CTG CGA GCC CCA TTT CCC TAG 1221 Leu Arg Ala Pro Phe Pro 405 <210> 4 <211> 406 <212> PRT <213> artificail sequence <220> <223> Amino acid sequence of recombinant mutant of blood coagulation fac tor VII in which both of the 159th Cysteine and the 164th Cysteine are r eplaced with Alanine. <400> 4 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Ala Pro 145 150 155 160 Lys Gly Glu Ala Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 Gly Glu His A sp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg 210 215 220 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn 225 230 235 240 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg 290 295 300 Leu Met Thr Gln Asp Cys Leu Gln Gln Ser Arg Lys Val Gly Asp Ser 305 310 315 320 Pro Asn Ile Thr Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser 325 330 335 Lys Asp Ser Cys Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr 340 345 350 Arg Gly Thr Trp Tyr Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys 355 360 365 Ala Thr Val Gly His Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile 370 375 380 Glu Trp Leu Gln Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu 385 390 395 400 Leu Arg Ala Pro Phe Pro 405 <210> 5 <211> 1221 <212> DNA <213> artificial sequence <220> <223> Amino acid sequence of recombinant mutant of blood coagulation factor VII in which the 164th Cysteine is replaced with Alanine and the 299 Valine is replaced with Cysteine, and cDNA sequence coding there. <400> 5 GCC AAC GCG TTC CTG GAG GAG CTG CGG CCG GGC TCC CTG GAG AGG GAG 48 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 TGC AAG GAG GAG CAG TGC TCC TTC GAG GAG GCC CGG GAG ATC TTC AAG 96 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 GAC GCG GAG AGG ACG AAG CTG TTC TGG ATT TCT TAC AGT GAT GGG GAC 144 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 CAG TGT GCC TCA AGT CCA TGC CAG AAT GGG GGC TCC TGC AAG GAC CAG 192 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 CTC CAG TCC TAT ATC TGC TTC TGC CTC CCT GCC TTC GAG GGC CGG AAC 240 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 TGT GAG ACG CAC AAG GAT GAC CAG CTG ATC TGT GTG AAC GAG AAC GGC 288 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 GGC TGT GAG CAG TAC TGC AGT GAC CAC ACG GGC ACC AAG CGC TCC TGT 336 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 CGG TGC CAC GAG GGG TAC TCT CTG CTG GCA GAC GGG GTG TCC TGC ACA 384 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 CCC ACA GTT GAA TAT CCA TGT GGA AAA ATA CCT ATT CTA GAA AAA AGA 432 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 AAT GCC AGC AAA CCC CAA GGC CGA ATT GTG GGG GGC AAG GTG TGC CCC 480 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Cys Pro 145 150 155 160 AAA GGG GAG GCC CCA TGG CAG GTC CTG TTG TTG GTG AAT GGA GCT CAG 528 Lys Gly Glu Ala Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 TTG TGT GGG GGG ACC CTG ATC AAC ACC ATC TGG GTG GTC TCC GCG GCC 576 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 CAC TGT TTC GAC AAA ATC AAG AAC TGG AGG AAC CTG ATC GCG GTG CTG 624 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 GGC GAG CAC GAC CTC AGC GAG CAC GAC GGG GAT GAG CAG AGC CGG CGG 672 Gly Glu His Asp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg210 215 220 GTG GCG CAG GTC ATC ATC CCC AGC ACG TAC GTC CCG GGC ACC ACC AAC 720 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn 225 230 235 240 CAC GAC ATC GCG CTG CTC CGC CTG CAC CAG CCC GTG GTC CTC ACT GAC 768 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 CAT GTG GTG CCC CTC TGC CTG CCC GAA CGG ACG TTC TCT GAG AGG ACG 816 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 CTG GCC TTC GTG CGC TTC TCA TTG GTC AGC GGC TGG GGC CAG CTG CTG 864 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 285 GAC CGT GGC GCC ACG GCC CTG GAG CTC ATG TGC CTC AAC GTG CCC CGG 912 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Cys Leu Asn Val Pro Arg 290 295 300 CTG ATG ACC CAG GAC TGC CTG CAG CAG TCA CGG AAG GTG GGA GAC TCC 960 Leu Met Thr Gln Asp Cys Leu Gln Gln Ser Arg Lys Val Gly Asp Ser 305 310 315 320 CCA AAT ATC ACG GAG TAC ATG TTC TGT GCC GGC TAC TCG GAT GGC AGC 1008 Pro Asn Ile Thr Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser 325 330 335 AAG GAC TCC TGC AAG GGG GAC AGT GGA GGC CCA CAT GCC ACC CAC TAC 1056 Lys Asp Ser Cys Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr 340 345 350 CGG GGC ACG TGG TAC CTG ACG GGC ATC GTC AGC TGG GGC CAG GGC TGC 1104 Arg Gly Thr Trp Tyr Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys 355 360 365 GCA ACC GTG GGC CAC TTT GGG GTG TAC ACC AGG GTC TCC CAG TAC ATC 1152 Ala Thr Val Gly His Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile 370 375 380 GAG TGG CTG CAA AAG CTC ATG CGC TCA GAG CCA CGC CCA GGA GTC CTC 1200 Glu Trp Leu Gln Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu 385 390 395 400 CTG CGA GCC CCA TTT CCC TAG 1221 Leu Arg Ala Pro Phe Pro 405 <210> 6 <211> 406 <212> PRT <213> artificial sequence <220> <223> Amino acid sequence of recombinant mutant of blood coagulation fac tor VII in which the 164th Cysteine is replaced with Alanine and the 299 Valine is replaced with Cysteine. <400> 6 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Cys Pro 145 150 155 160 Lys Gly Glu Ala Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 Gly Glu His A sp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg 210 215 220 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn 225 230 235 240 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Cys Leu Asn Val Pro Arg 290 295 300 Leu Met Thr Gln Asp Cys Leu Gln Gln Ser Arg Lys Val Gly Asp Ser 305 310 315 320 Pro Asn Ile Thr Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser 325 330 335 Lys Asp Ser Cys Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr 340 345 350 Arg Gly Thr Trp Tyr Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys 355 360 365 Ala Thr Val Gly His Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile 370 375 380 Glu Trp Leu Gln Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu 385 390 395 400 Leu Arg Ala Pro Phe Pro 405 <210> 7 <211> 1221 <212> DNA <213> artificial sequence <220> <223> Amino acid sequence of recombinant mutant of blood coagulation factor VII in which the 5 amino acid residues from the 235th Valine to 239t h threonine are replaced with Asp-Arg-Lys-Thr-Leu, and cDNA sequence codi ng there. <400> 7 GCC AAC GCG TTC CTG GAG GAG CTG CGG CCG GGC TCC CTG GAG AGG GAG 48 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 TGC AAG GAG GAG CAG TGC TCC TTC GAG GAG GCC CGG GAG ATC TTC AAG 96 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 GAC GCG GAG AGG ACG AAG CTG TTC TGG ATT TCT TAC AGT GAT GGG GAC 144 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 CAG TGT GCC TCA AGT CCA TGC CAG AAT GGG GGC TCC TGC AAG GAC CAG 192 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 CTC CAG TCC TAT ATC TGC TTC TGC CTC CCT GCC TTC GAG GGC CGG AAC 240 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 TGT GAG ACG CAC AAG GAT GAC CAG CTG ATC TGT GTG AAC GAG AAC GGC 288 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 GGC TGT GAG CAG TAC TGC AGT GAC CAC ACG GGC ACC AAG CGC TCC TGT 336 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 CGG TGC CAC GAG GGG TAC TCT CTG CTG GCA GAC GGG GTG TCC TGC ACA 384 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 CCC ACA GTT GAA TAT CCA TGT GGA AAA ATA CCT ATT CTA GAA AAA AGA 432 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 AAT GCC AGC AAA CCC CAA GGC CGA ATT GTG GGG GGC AAG GTG TGC CCC 480 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Cys Pro 145 150 155 160 AAA GGG GAG TGT CCA TGG CAG GTC CTG TTG TTG GTG AAT GGA GCT CAG 528 Lys Gly Glu Cys Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 TTG TGT GGG GGG ACC CTG ATC AAC ACC ATC TGG GTG GTC TCC GCG GCC 576 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 CAC TGT TTC GAC AAA ATC AAG AAC TGG AGG AAC CTG ATC GCG GTG CTG 624 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 GGC GAG CAC GAC CTC AGC GAG CAC GAC GGG GAT GAG CAG AGC CGG CGG 672 Gly Glu His Asp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg210 215 220 GTG GCG CAG GTC ATC ATC CCC AGC ACG TAC GAC AGG AAG ACT CTG AAC 720 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Asp Arg Lys Thr Leu Asn 225 230 235 240 CAC GAC ATC GCG CTG CTC CGC CTG CAC CAG CCC GTG GTC CTC ACT GAC 768 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 CAT GTG GTG CCC CTC TGC CTG CCC GAA CGG ACG TTC TCT GAG AGG ACG 816 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 CTG GCC TTC GTG CGC TTC TCA TTG GTC AGC GGC TGG GGC CAG CTG CTG 864 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 285 GAC CGT GGC GCC ACG GCC CTG GAG CTC ATG GTG CTC AAC GTG CCC CGG 912 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg 290 295 300 CTG ATG ACC CAG GAC TGC CTG CAG CAG TCA CGG AAG GTG GGA GAC TCC 960 Leu Met Thr Gln Asp Cys Leu Gln Gln Ser Arg Lys Val Gly Asp Ser 305 310 315 320 CCA AAT ATC ACG GAG TAC ATG TTC TGT GCC GGC TAC TCG GAT GGC AGC 1008 Pro Asn Ile Thr Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser 325 330 335 AAG GAC TCC TGC AAG GGG GAC AGT GGA GGC CCA CAT GCC ACC CAC TAC 1056 Lys Asp Ser Cys Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr 340 345 350 CGG GGC ACG TGG TAC CTG ACG GGC ATC GTC AGC TGG GGC CAG GGC TGC 1104 Arg Gly Thr Trp Tyr Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys 355 360 365 GCA ACC GTG GGC CAC TTT GGG GTG TAC ACC AGG GTC TCC CAG TAC ATC 1152 Ala Thr Val Gly His Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile 370 375 380 GAG TGG CTG CAA AAG CTC ATG CGC TCA GAG CCA CGC CCA GGA GTC CTC 1200 Glu Trp Leu Gln Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu 385 390 395 400 CTG CGA GCC CCA TTT CCC TAG 1221 Leu Arg Ala Pro Phe Pro 405 <210> 8 <211> 406 <212> PRT <213> artificial sequence <220> <223> Amino acid sequence of recombinant mutant of blood coagulation factor VII in which the 5 amino acid residues from the 235th Valine to 239t h threonine are replaced with Asp-Arg-Lys-Thr-Leu. <400> 8 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Cys Pro 145 150 155 160 Lys Gly Glu Cys Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 Gly Glu His A sp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg 210 215 220 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Asp Arg Lys Thr Leu Asn 225 230 235 240 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg 290 295 300 Leu Met Thr Gln Asp Cys Leu Gln Gln Ser Arg Lys Val Gly Asp Ser 305 310 315 320 Pro Asn Ile Thr Glu Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser 325 330 335 Lys Asp Ser Cys Lys Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr 340 345 350 Arg Gly Thr Trp Tyr Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys 355 360 365 Ala Thr Val Gly His Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile 370 375 380 Glu Trp Leu Gln Lys Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu 385 390 395 400 Leu Arg Ala Pro Phe Pro 405 <210> 9 <211> 1206 <212> DNA <213> artificial sequence <220> <223> Amino acid sequence of recombinant mutant of blood coagulation factor VII in which the 12 amino acid residues from the 311th leucine to 32 2th asparagine are replaced with Glu-Ala-Ser-Tyr-Pro-Gly-Lys, and cDNA se quence coding there. <400> 9 GCC AAC GCG TTC CTG GAG GAG CTG CGG CCG GGC TCC CTG GAG AGG GAG 48 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 TGC AAG GAG GAG CAG TGC TCC TTC GAG GAG GCC CGG GAG ATC TTC AAG 96 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 GAC GCG GAG AGG ACG AAG CTG TTC TGG ATT TCT TAC AGT GAT GGG GAC 144 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 CAG TGT GCC TCA AGT CCA TGC CAG AAT GGG GGC TCC TGC AAG GAC CAG 192 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 CTC CAG TCC TAT ATC TGC TTC TGC CTC CCT GCC TTC GAG GGC CGG AAC 240 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 TGT GAG ACG CAC AAG GAT GAC CAG CTG ATC TGT GTG AAC GAG AAC GGC 288 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 GGC TGT GAG CAG TAC TGC AGT GAC CAC ACG GGC ACC AAG CGC TCC TGT 336 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 CGG TGC CAC GAG GGG TAC TCT CTG CTG GCA GAC GGG GTG TCC TGC ACA 384 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 CCC ACA GTT GAA TAT CCA TGT GGA AAA ATA CCT ATT CTA GAA AAA AGA 432 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 AAT GCC AGC AAA CCC CAA GGC CGA ATT GTG GGG GGC AAG GTG TGC CCC 480 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Cys Pro 145 150 155 160 AAA GGG GAG TGT CCA TGG CAG GTC CTG TTG TTG GTG AAT GGA GCT CAG 528 Lys Gly Glu Cys Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 TTG TGT GGG GGG ACC CTG ATC AAC ACC ATC TGG GTG GTC TCC GCG GCC 576 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 CAC TGT TTC GAC AAA ATC AAG AAC TGG AGG AAC CTG ATC GCG GTG CTG 624 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 GGC GAG CAC GAC CTC AGC GAG CAC GAC GGG GAT GAG CAG AGC CGG CGG 672 Gly Glu His Asp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg210 215 220 GTG GCG CAG GTC ATC ATC CCC AGC ACG TAC GTC CCG GGC ACC ACC AAC 720 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn 225 230 235 240 CAC GAC ATC GCG CTG CTC CGC CTG CAC CAG CCC GTG GTC CTC ACT GAC 768 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 CAT GTG GTG CCC CTC TGC CTG CCC GAA CGG ACG TTC TCT GAG AGG ACG 816 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 CTG GCC TTC GTG CGC TTC TCA TTG GTC AGC GGC TGG GGC CAG CTG CTG 864 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 285 GAC CGT GGC GCC ACG GCC CTG GAG CTC ATG GTG CTC AAC GTG CCC CGG 912 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg 290 295 300 CTG ATG ACC CAG GAC TGC GAA GCC TCC TAC CCT GGA AAG ATC ACG GAG 960 Leu Met Thr Gln Asp Cys Glu Ala Ser Tyr Pro Gly Lys Ile Thr Glu 305 310 315 320 TAC ATG TTC TGT GCC GGC TAC TCG GAT GGC AGC AAG GAC TCC TGC AAG 1008 Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys Lys 325 330 335 GGG GAC AGT GGA GGC CCA CAT GCC ACC CAC TAC CGG GGC ACG TGG TAC 1056 Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp Tyr 340 345 350 CTG ACG GGC ATC GTC AGC TGG GGC CAG GGC TGC GCA ACC GTG GGC CAC 1104 Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys Ala Thr Val Gly His 355 360 365 TTT GGG GTG TAC ACC AGG GTC TCC CAG TAC ATC GAG TGG CTG CAA AAG 1152 Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile Glu Trp Leu Gln Lys 370 375 380 CTC ATG CGC TCA GAG CCA CGC CCA GGA GTC CTC CTG CGA GCC CCA TTT 1200 Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro Phe 385 390 395 400 CCC TAG 1206 Pro <210> 10 <211> 401 <212> PRT <213> artificial sequence <220> <223> Amino acid sequence of recombinant mutant of blood coagulation factor VII in which the 12 amino acid residues from the 311th leucine to 32 2th asparagine are replaced with Glu-Ala-Ser-Tyr-Pro-Gly-Lys. <400> 10 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Cys Pro 145 150 155 160 Lys Gly Glu Cys Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 Gly Glu His Asp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg 210 215 220 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Val Pro Gly Thr Thr Asn 225 230 235 240 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg 290 295 300 Leu Met Thr Gln Asp Cys Glu Ala Ser Tyr Pro Gly Lys Ile Thr Glu 305 310 315 320 Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys Lys 325 330 335 Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp Tyr 340 345 350 Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys Ala Thr Val Gly His 355 360 365 Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile Glu Trp Leu Gln Lys 370 375 380 Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro Phe 385 390 395 400 Pro <210> 11 <211> 1206 <212> DNA <213> artificial sequence <220> <223> Amino acid sequence of recombinant mutant of blood coagulation fac tor VII in which the 5 amino acid residues from the 235th Valine to 239t h threonine are replaced with Asp-Arg-Lys-Thr-Leu and the 12 amino acid residues from the 311th leucine to 322th asparagine are replaced with Glu-Ala-Ser-Tyr-Pro-Gly-Lys, and cDNA sequence coding there. <400> 11 GCC AAC GCG TTC CTG GAG GAG CTG CGG CCG GGC TCC CTG GAG AGG GAG 48 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 TGC AAG GAG GAG CAG TGC TCC TTC GAG GAG GCC CGG GAG ATC TTC AAG 96 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 GAC GCG GAG AGG ACG AAG CTG TTC TGG ATT TCT TAC AGT GAT GGG GAC 144 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 CAG TGT GCC TCA AGT CCA TGC CAG AAT GGG GGC TCC TGC AAG GAC CAG 192 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 CTC CAG TCC TAT ATC TGC TTC TGC CTC CCT GCC TTC GAG GGC CGG AAC 240 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 TGT GAG ACG CAC AAG GAT GAC CAG CTG ATC TGT GTG AAC GAG AAC GGC 288 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 GGC TGT GAG CAG TAC TGC AGT GAC CAC ACG GGC ACC AAG CGC TCC TGT 336 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 CGG TGC CAC GAG GGG TAC TCT CTG CTG GCA GAC GGG GTG TCC TGC ACA 384 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 CCC ACA GTT GAA TAT CCA TGT GGA AAA ATA CCT ATT CTA GAA AAA AGA 432 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 AAT GCC AGC AAA CCC CAA GGC CGA ATT GTG GGG GGC AAG GTG TGC CCC 480 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Cys Pro 145 150 155 160 AAA GGG GAG TGT CCA TGG CAG GTC CTG TTG TTG GTG AAT GGA GCT CAG 528 Lys Gly Glu Cys Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 TTG TGT GGG GGG ACC CTG ATC AAC ACC ATC TGG GTG GTC TCC GCG GCC 576 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 CAC TGT TTC GAC AAA ATC AAG AAC TGG AGG AAC CTG ATC GCG GTG CTG 624 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 GGC GAG CAC GAC CTC AGC GAG CAC GAC GGG GAT GAG CAG AGC CGG CGG 672 Gly Glu His Asp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg 210 215 220 GTG GCG CAG GTC ATC ATC CCC AGC ACG TAC GAC AGG AAG ACT CTG AAC 720 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Asp Arg Lys Thr Leu Asn 225 230 235 240 CAC GAC ATC GCG CTG CTC CGC CTG CAC CAG CCC GTG GTC CTC ACT GAC 768 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 CAT GTG GTG CCC CTC TGC CTG CCC GAA CGG ACG TTC TCT GAG AGG ACG 816 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 CTG GCC TTC GTG CGC TTC TCA TTG GTC AGC GGC TGG GGC CAG CTG CTG 864 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 285 GAC CGT GGC GCC ACG GCC CTG GAG CTC ATG GTG CTC AAC GTG CCC CGG 912 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg 290 295 300 CTG ATG ACC CAG GAC TGC GAA GCC TCC TAC CCT GGA AAG ATC ACG GAG 960 Leu Met Thr Gln Asp Cys Glu Ala Ser Tyr Pro Gly Lys Ile Thr Glu 305 310 315 320 TAC ATG TTC TGT GCC GGC TAC TCG GAT GGC AGC AAG GAC TCC TGC AAG 1008 Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser L ys Asp Ser Cys Lys 325 330 335 GGG GAC AGT GGA GGC CCA CAT GCC ACC CAC TAC CGG GGC ACG TGG TAC 1056 Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp Tyr 340 345 350 CTG ACG GGC ATC GTC AGC TGG GGC CAG GGC TGC GCA ACC GTG GGC CAC 1104 Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys Ala Thr Val Gly His 355 360 365 TTT GGG GTG TAC ACC AGG GTC TCC CAG TAC ATC GAG TGG CTG CAA AAG 1152 Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile Glu Trp Leu Gln Lys 370 375 380 CTC ATG CGC TCA GAG CCA CGC CCA GGA GTC CTC CTG CGA GCC CCA TTT 1200 Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro Phe 385 390 395 400 CCC TAG 1206 Pro <210> 12 <211> 401 <212> PRT <213> artificial sequence <220> <223> Amino acid sequence of recombinant mutant of blood coagulation fac tor VII in which the 5 amino acid residues from the 235th Valine to 239t h threonine are replaced with Asp-Arg-Lys-Thr-Leu and the 12 amino acid residues from the 311th leucine to 322th asparagine are replaced with Glu-Ala-Ser-Tyr-Pro-Gly-Lys. <400> 12 Ala Asn Ala Phe Leu Glu Glu Leu Arg Pro Gly Ser Leu Glu Arg Glu 1 5 10 15 Cys Lys Glu Glu Gln Cys Ser Phe Glu Glu Ala Arg Glu Ile Phe Lys 20 25 30 Asp Ala Glu Arg Thr Lys Leu Phe Trp Ile Ser Tyr Ser Asp Gly Asp 35 40 45 Gln Cys Ala Ser Ser Pro Cys Gln Asn Gly Gly Ser Cys Lys Asp Gln 50 55 60 Leu Gln Ser Tyr Ile Cys Phe Cys Leu Pro Ala Phe Glu Gly Arg Asn 65 70 75 80 Cys Glu Thr His Lys Asp Asp Gln Leu Ile Cys Val Asn Glu Asn Gly 85 90 95 Gly Cys Glu Gln Tyr Cys Ser Asp His Thr Gly Thr Lys Arg Ser Cys 100 105 110 Arg Cys His Glu Gly Tyr Ser Leu Leu Ala Asp Gly Val Ser Cys Thr 115 120 125 Pro Thr Val Glu Tyr Pro Cys Gly Lys Ile Pro Ile Leu Glu Lys Arg 130 135 140 Asn Ala Ser Lys Pro Gln Gly Arg Ile Val Gly Gly Lys Val Cys Pro 145 150 155 160 Lys Gly Glu Cys Pro Trp Gln Val Leu Leu Leu Val Asn Gly Ala Gln 165 170 175 Leu Cys Gly Gly Thr Leu Ile Asn Thr Ile Trp Val Val Ser Ala Ala 180 185 190 His Cys Phe Asp Lys Ile Lys Asn Trp Arg Asn Leu Ile Ala Val Leu 195 200 205 Gly Glu His Asp Leu Ser Glu His Asp Gly Asp Glu Gln Ser Arg Arg 210 215 220 Val Ala Gln Val Ile Ile Pro Ser Thr Tyr Asp Arg Lys Thr Leu Asn 225 230 235 240 His Asp Ile Ala Leu Leu Arg Leu His Gln Pro Val Val Leu Thr Asp 245 250 255 His Val Val Pro Leu Cys Leu Pro Glu Arg Thr Phe Ser Glu Arg Thr 260 265 270 Leu Ala Phe Val Arg Phe Ser Leu Val Ser Gly Trp Gly Gln Leu Leu 275 280 285 Asp Arg Gly Ala Thr Ala Leu Glu Leu Met Val Leu Asn Val Pro Arg 290 295 300 Leu Met Thr Gln Asp Cys Glu Ala Ser Tyr Pro Gly Lys Ile Thr Glu 305 310 315 320 Tyr Met Phe Cys Ala Gly Tyr Ser Asp Gly Ser Lys Asp Ser Cys Lys 325 330 335 Gly Asp Ser Gly Gly Pro His Ala Thr His Tyr Arg Gly Thr Trp Tyr 340 345 350 Leu Thr Gly Ile Val Ser Trp Gly Gln Gly Cys Ala Thr Val Gly His 355 360 365 Phe Gly Val Tyr Thr Arg Val Ser Gln Tyr Ile Glu Trp Leu Gln Lys 370 375 380 Leu Met Arg Ser Glu Pro Arg Pro Gly Val Leu Leu Arg Ala Pro Phe 385 390 395 400 Pro

[Brief description of the drawings]

FIG. 1 is a diagram showing the primary structure and modification site (star) of FVII.

FIG. 2 shows the basic structure of a serine protease based on the amino acid sequence of the protease domain of FVII.

FIG. 3 is a view showing 3D multi-alignment between various trypsin family serine proteases whose X-ray three-dimensional structure is known.

FIG. 4 is a view showing a part of the amino acid sequence of wild-type FVII (FVII-Wild) and various FVII variants. This figure shows only the amino acid sequence at the C-terminal side from the 153rd isoleucine of FVII, and the amino acid sequence at the N-terminal side from the 152nd arginine is the same as the wild type without any modification.

FIG. 5 is a view showing a primer sequence for preparing an FVII variant.

FIG. 6 shows a method for constructing an FVII variant expression vector.

 ────────────────────────────────────────────────── ─── Continuing on the front page (72) Inventor Sadaaki Iwanaga 2-34-16 Mizutani, Higashi-ku, Fukuoka F-term (reference) 4B024 AA01 BA11 CA04 DA02 DA06 EA04 GA11 GA13 GA18 HA01 HA04 HA06 4B050 CC04 CC06 DD11 FF14E HH01 LL01 4C084 AA02 AA07 BA01 BA08 BA22 CA18 CA53 DC14 NA05 ZA532 ZC542 4H045 AA10 AA30 BA10 BA12 BA13 DA76 EA50 EA55 FA20 FA58 GA26

Claims (18)

[Claims] 1. A variant of blood coagulation factor VII (hereinafter, FVII) or activated blood coagulation factor VII (hereinafter, FVIIa), comprising at least one modification selected from the following. (A) Cysteine at position 159 in FVII (159C
ys) and the 164th cysteine (164Cys) to cleave a disulfide bond (159Cys-164Cys). (B) Threonine at position 233 in FVII (233T
hr) A loop structure consisting of the amino acid sequence of asparagine (240Asn) at position 240 (hereinafter referred to as 99-loop)
(sometimes referred to as p) or a part thereof is substituted, added or deleted. (C) Arginine at position 304 (304A) in FVII
(rg) The amino acid sequence constituting the intervening amino acid sequence of the cysteine at position 329 (329Cys) or a part thereof is substituted, added or deleted. 2. The 159 Cys and 164 Cys are substituted by an amino acid residue other than Cys,
The variant according to claim 1, wherein Cys-164Cys is cleaved. 3. The variant according to claim 1, comprising the amino acid sequence of SEQ ID NO: 4 in the sequence listing. 4. The 164 Cys is substituted by an amino acid residue other than Cys, and the 299th valine (299 Va) is substituted.
By substituting l) for Cys, 159Cys-164C
2. The variant according to claim 1, wherein ys is cleaved and a disulfide bond (159Cys-299Cys) is formed between 159Cys and 299Cys. 5. The variant according to claim 1, which comprises the amino acid sequence of SEQ ID NO: 6 in the sequence listing. 6. The variant according to claim 1, wherein the amino acid sequence of 99-loop of FVII is substituted with an amino acid sequence corresponding to the structure of another trypsin serine protease. 7. The variant according to claim 1, wherein the other trypsin serine protease is human trypsin. 8. The Asp-Arg- sequence in which the amino acid sequence from the 235th valine (235Val) to the 239th threonine (239Thr) in the 99-loop of FVII is located in a loop corresponding to the structure of human trypsin.
The variant according to claim 1, 6 or 7, wherein the variant is substituted with Lys-Thr-Leu. 9. The variant according to claim 1, which comprises the amino acid sequence of SEQ ID NO: 8 in the sequence listing. 10. The arginine at position 304 (304Arg) to the cysteine at position 329 (329Cy) in FVII.
The variant according to claim 1, wherein the amino acid sequence constituting the intervening amino acid sequence of s) or a part thereof is substituted with an amino acid sequence corresponding to the structure of another trypsin serine protease. 11. The variant according to claim 1, wherein the other trypsin family serine protease is human trypsin. 12. The cysteine at position 310 (310Cys) to the cysteine at position 329 (329Cy) in FVII.
The variant according to claim 1, 10 or 11, wherein the amino acid sequence constituting the intervening amino acid sequence of s) (hereinafter, also referred to as 170-loop) or a part thereof is substituted, added or deleted. 13. 31 in 170-loop of FVII
The amino acid sequence from the 1st leucine (311Leu) to the 322nd asparagine (322Asn) has a Glu-amino acid sequence in the loop corresponding to the structure of human trypsin.
13. Substituted with Ala-Ser-Tyr-Pro-Gly-Lys.
A variant according to any one of the above. 14. The variant according to claim 1, which comprises the amino acid sequence of SEQ ID NO: 10 in the Sequence Listing. 15. 235 within 99-loop of FVII
The amino acid sequence from the valine (235 Val) to the threonine (239 Thr) at position 239 is Asp-Arg in the corresponding loop structure of human trypsin.
-Substituted with Lys-Thr-Leu, and 170-
The amino acid sequence from the 311th leucine (311Leu) to the 322nd asparagine (322Asn) in the loop is Glu-Ala-Ser-Tyr-Pro-G in the loop structure corresponding to the structure of human trypsin.
The variant according to claim 1, wherein the variant is substituted with ly-Lys. 16. The variant according to claim 1, comprising the amino acid sequence of SEQ ID NO: 12 in the sequence listing. A pharmaceutical composition comprising the variant according to any one of claims 1 to 16 as an active ingredient. 18. An agent comprising the pharmaceutical composition of claim 17, which is effective for treating a hemophilia inhibitor patient.