JP2001037483A - Linked glucose dehydrogenase - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new enzyme which is obtained by linking water-soluble glucose dehydrogenase subunits via a linker peptide, requires pyrrolo-quinoline quinone as a coenzyme, has good thermal stability, and can be used for quantitatively determining glucose and the like. SOLUTION: This is a new enzyme (fused protein) which is obtained by linking two water-soluble glucose dehydrogenase (GDH) subunits via the linker peptide having an amino acid sequence, for example, shown by the formula, requires pyrrolo-quinoline quinone (PQQ) as a coenzyme, has improved thermal stability, and is useful for quantitativery determining glucose in clinical diagnosis, food analysis, and so on. This enzyme is obtained by preparing two fragments by PCR using two pairs of primers so as to contain a desired restriction enzyme site using a natural pyrrolo-quinoline quinone glucose dehydrogenase (PQQGDH) gene derived from Acinetobacter calcoaceticum as a template, followed by incorporating both into a vector to express in a host cell.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a glucose dehydrogenase (G) having pyrroloquinoline quinone (PQQ) as a coenzyme.
DH) relates to a linked dimer GDH in which two subunits are linked in tandem. Connected PQQGD of the present invention
H is useful for quantifying glucose in clinical tests, food analysis, and the like.

[0002]

2. Description of the Related Art PQQGDH is a glucose dehydrogenase using pyrroloquinoline quinone as a coenzyme, and catalyzes a reaction of oxidizing glucose to produce gluconolactone.

[0003] It is known that PQQGDH includes a membrane-bound enzyme and a water-soluble enzyme. Membrane-bound PQQGDH
Is a single peptide protein having a molecular weight of about 87 kDa, and is widely found in various Gram-negative bacteria. On the other hand, water-soluble PQQGDH is Acinetobac.
Its presence has been confirmed in several strains of ter calcoaceticus (Biosci. Bi).
otech. Biochem. (1995), 59
(8), 1548-1555), and its structural gene has been cloned and its amino acid sequence has been determined (Mo).
l. Gen. Genet. (1989), 217: 43.
0-436). A. Calcoaceticus-derived water-soluble PQQGDH is a homodimer composed of two identical subunits having a molecular weight of about 50 kDa and localized in the periplasm. It has been reported that PQQGDH activity is expressed only when a homodimer enzyme is formed, and that the subunit alone does not show PQQGDH activity. The physiological role of water-soluble PQQGDH has not yet been elucidated.

[0004] Blood glucose concentration is a very important indicator in clinical diagnosis as an important marker of diabetes. In addition, quantification of glucose concentration in fermentation production using microorganisms is an important item in process monitoring. Conventionally, glucose is glucose oxidase (GOD) or glucose 6-phosphate dehydrogenase (G
6PDH) by the enzymatic method. However, in the method using GOD, it was necessary to add catalase or peroxidase to the assay system in order to quantify hydrogen peroxide generated by the glucose oxidation reaction. Biosensors using GOD have also been developed, but the reaction is not suitable for high-concentration glucose samples because the reaction depends on the dissolved oxygen concentration in the aqueous solution.
Alternatively, there was a possibility that an error occurred in the measured value depending on the dissolved oxygen concentration. On the other hand, G6PDH has been used for glucose quantification based on a spectroscopic technique, but has the trouble that NAD (P) as a coenzyme must be added to the reaction system. Therefore, as a new enzyme replacing the enzyme used in the conventional glucose enzyme determination method, P
Applications of QQGDH are receiving attention. Since PQQGDH has a high oxidizing activity on glucose, and since PQQGDH is a coenzyme-linked enzyme and does not require oxygen as an electron acceptor, it can be used for assays such as glucose sensor recognition elements. The application to the field is expected. However, PQQGDH has G
There was a problem that the thermal stability was lower than OD.

[0005]

Accordingly, the present invention provides a modified water-soluble PQQG having improved thermal stability.
The purpose is to provide DH.

[0006]

Means for Solving the Problems The present inventors have found that the formation of a fusion protein in which two water-soluble PQQGDH subunits are linked in tandem can stabilize the homodimer structure of the enzyme. Was completed.

That is, the present invention provides a fusion protein containing two water-soluble PQQGDH subunits linked via a linker peptide. Preferably, the linker peptide is at least 5 amino acids in length.

[0008] The present invention also provides a gene encoding the fusion protein of the present invention, a vector and a transformant containing the gene, and an organism having the gene integrated into a main chromosome. The present invention also provides a glucose assay kit containing the fusion protein of the present invention, and a glucose sensor.

[0009] The linked PQQGDH of the present invention has high thermal stability and is therefore useful for use in glucose assay kits and glucose sensors.

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION Structure of Linked GDH The linked GDH of the present invention is a fusion protein having a structure in which two water-soluble PQQGDH subunits are linked in tandem. The linked GDH according to the present invention has improved thermal stability.

[0011] Natural water-soluble PQQGDH has a homodimer structure composed of two subunits. The present inventors have now stated that the increased thermostability of the linked GDHs of the present invention is due to the stabilization of the dimeric higher order structure by the expression of these two subunits as fusion proteins. thinking.

In the ligated GDH of the present invention, the two subunits are tandemly linked via a linker fused in frame. Preferably, the linker peptide is at least 5 amino acids in length. It is more preferably at least 10 amino acids, even more preferably at least 13 amino acids in length. The linker region may need to be of some length in order for the two subunits to associate in the correct conformation. There is no particular upper limit on the length of the linker peptide,
It must not have a sequence that is detrimental to the enzymatic activity or intracellular localization of the linked GDH of the present invention.

Preferably, the amino acid sequence of the linker region should be designed so as not to include a partial sequence known to be susceptible to protein hydrolysis. In each subunit, some of the amino acid residues may be deleted or substituted, and other amino acid residues may be added. By substituting an amino acid residue in a specific region with another amino acid residue, the thermal stability of the enzyme and the affinity for the substrate can be improved (for example, JP-A-10-243786, Japanese Patent Application No. 11-101143). And Japanese Patent Application No. 11-124285). These deletions, substitutions or additions can be introduced into one or both of the subunits, and linked PQQGDHs in which these modified subunits are linked are also within the scope of the present invention.

Preferably, the subunit of water-soluble PQQGDH is Acinetobacter calcoac
It is a water-soluble PQQGDH derived from Eticus. Those skilled in the art can obtain the fusion protein of the present invention by connecting and expressing subunits of water-soluble PQQGDH derived from other bacteria according to the teachings of the present invention. These linked PQQGDHs are also within the scope of the present invention. Production process Figure 1 of the connection type GDH is shows construction of the vector to overview and encoding the same of the linked GDH of the present invention. Connected GD of the present invention
H can be created by performing an in-frame fusion in which the two subunits of PQQGDH are linked via a linker peptide. Acinetact
The sequence of the gene encoding natural, water-soluble PQQGDH from E. er calcoaceticus is described in Mol. G
en. Genet. (1989), 217: 430-4.
36.

The gene encoding the ligated GDH of the present invention is constructed by ligating two genes encoding subunits of water-soluble PQQGDH via a gene encoding a linker having an appropriate length. At this time, the subunits and the linker are linked so as to be expressed in-frame as a fusion protein. As a linker,
Any sequence, natural or synthetic, can be used. For example, an appropriate sequence in a vector may be used, a synthetic gene may be prepared, or a desired sequence may be extended upstream or downstream of each subunit by PCR using appropriate primers. . Various methods for such genetic manipulation are known in the art. The gene encoding the ligated GDH thus obtained is transformed into a gene expression vector (eg, a plasmid).
And transform it into a suitable host (eg, E. coli). Many vector-host systems for expressing foreign proteins are known in the art, and various hosts such as bacteria, yeast, and cultured cells can be used.

The linked GDH obtained as described above
After culturing the transformant that expresses, the cells are collected from the culture solution by centrifugation or the like, and then the cells are disrupted by a French press or the like. This is ultracentrifuged to obtain a water-soluble fraction containing PQQGDH. Alternatively, the expressed PQQGDH can be secreted into the culture medium by using an appropriate host vector system. The ligated GDH of the present invention is prepared by purifying the resulting water-soluble fraction by ion exchange chromatography, affinity chromatography, HPLC, or the like. Method for Measuring Enzyme Activity The linked GDH of the present invention has an action of catalyzing a reaction of oxidizing glucose to produce gluconolactone using PQQ as a coenzyme.

The enzyme activity can be measured by quantifying the amount of PQQ reduced by the oxidation of glucose by PQQGDH by a color reaction of a redox dye. As the coloring reagent, for example, PMS (phenazine methosulfate) -DCIP (2,6-dichlorophenolindophenol), potassium ferricyanide, ferrocene and the like can be used. Thermostability The thermostability of the ligated GDH of the present invention is determined by incubating the enzyme at a high temperature (for example, 55 ° C.), removing an aliquot at regular intervals, measuring the enzyme activity, and measuring the decrease in enzyme activity over time. It can be evaluated by monitoring. Alternatively, it can be evaluated by measuring the residual activity after incubation at various temperatures for a certain period of time.

The ligated GDH of the present invention is a wild type PQQG
It is characterized by having higher thermal stability than DH. Therefore, the process of preparing an assay kit or an enzyme sensor using this enzyme is low in inactivation during preparation / purification, high in yield, high in solution, and easy to store the enzyme in enzyme production. In this method, there is little deactivation, and the assay kit or enzyme sensor prepared using the present enzyme has high thermal stability, and thus has advantages such as excellent storage stability. Glucose Assay Kit The present invention also features a glucose assay kit comprising a ligated GDH according to the present invention. The glucose assay kit of the present invention comprises a ligated GDH according to the present invention in an amount sufficient for at least one assay. Typically, the kit contains, in addition to the conjugated GDH of the invention, the buffers required for the assay, mediators, glucose standard solutions for preparing calibration curves, and guidelines for use. The linked GDH according to the present invention may be in various forms,
For example, it can be provided as a lyophilized reagent or as a solution in a suitable storage solution. Preferably, the ligated GDH of the present invention is provided in a holo-form, but can also be provided in the form of an apoenzyme and holo-formed at the time of use. Glucose Sensor The present invention also features a glucose sensor using the linked GDH according to the present invention. As the electrode, a carbon electrode, a gold electrode, a platinum electrode or the like is used, and the enzyme of the present invention is immobilized on the electrode. As the immobilization method, a method using a cross-linking reagent, a method of encapsulating in a polymer matrix,
There is a method of coating with a dialysis membrane, a photocrosslinkable polymer, a conductive polymer, a redox polymer, or the like, or may be fixed in a polymer together with an electron mediator represented by ferrocene or a derivative thereof or adsorbed and fixed on an electrode, These may be used in combination. Preferably, the ligated GDH of the present invention is immobilized on the electrode in a holated form, but immobilized in the form of an apoenzyme, PQQ
Can be provided as a separate layer or in solution.
Typically, the linked GDH of the present invention is immobilized on a carbon electrode using glutaraldehyde and then treated with a reagent having an amine group to block glutaraldehyde.

The measurement of the glucose concentration can be performed as follows. Put buffer solution in thermostat cell,
And CaCl ₂ , and a mediator are added and maintained at a constant temperature. As the mediator, potassium ferricyanide, phenazine methosulfate and the like can be used. The connection type GDH of the present invention as a working electrode
Is used, and a counter electrode (for example, a platinum electrode) and a reference electrode (for example, an Ag / AgCl electrode) are used. After a constant voltage is applied to the carbon electrode and the current becomes steady, a sample containing glucose is added and the increase in the current is measured. The glucose concentration in the sample can be calculated according to a calibration curve prepared with a standard concentration glucose solution.

[0020]

EXAMPLES Hereinafter, the present invention will be described in detail with reference to Examples, but the present invention is not limited to these Examples. Example 1 Construction of Linked GDH FIG. 1 shows a method of constructing a linked GDH and the primary structure of a linker region. Each fragment for constructing the linked GDH is described in A.I. calcoaceticus
LMD79.41 (the Netherlands)
Using a natural PQQGDH structural gene derived from Culture Collection as a template, the gene was amplified by a PCR reaction so as to include a desired restriction enzyme site. The following two sets of oligonucleotide primers were used in the PCR reaction. First Fragment (Nco I / Sac I) Forward 5'-GGCCATGGATAAACATTTATTGGCTAAAATTGCTTTAT-3 'Reverse 5'-GGGAGCTCCTTAGCCTTATAGGTGAACTTAATGAG-3' Second Fragment (Pst I / Hind III) Forward 5'-GGCTGCAGGTTCCTCTAGATCTAGATTGATCTAGATCTAGATCTAGATCTAG 3 'These fragments were converted to the expression vector pTrc99A.
(Pharmacia) at two cloning sites in tandem. The first fragment without the stop codon was inserted into the NcoI / SacI site and the second fragment with the stop codon was replaced with PstI / HindII.
Inserted at the I site. The resulting plasmid pLGB1 is
The two regions encoding GDH encode a fusion protein that is tandemly linked in frame via a linker region. The linker region is derived from the sequence of the multiple cloning site of the expression vector, and encodes 13 amino acid residues of the partial sequence of β-galactosidase. Gene sequencing confirmed that a gene having the desired sequence was obtained.

As a control, a plasmid pGB2 in which a gene encoding wild-type PQQGDH was inserted into the same expression vector pTrc99A was used. Example 2 Production and Purification of Linked GDH As a host cell, E. coli having a PQQGDH structural gene disrupted by insertion mutation was used. coli PP2418 strain (C
Leton-Jansen et al. , 1990)
Was used. This strain was transformed with the plasmid pL obtained in Example 1.
Each transformant was transformed with GB1 and the control plasmid pGB2, and each transformant was transformed into L-broth for 600 n.
37 ° C. in the presence of MPQQ and 5 mM CaCl ₂
Aerobically. 0.3 mM I in mid-log phase
PTG was added, and the cells were further cultured at 30 ° C. until late logarithmic growth. The cells are collected and 10 mM phosphate buffer (pH
7.0) broken by French press in (110Mp)
as), ultracentrifugation (160,500g, 1h, 4 ° C)
Was done. Enzyme activity was found in the water-soluble fraction. This fraction is collected and a 10 mM phosphate buffer (pH 7.0)
Dialysed. Example 3 Measurement of Molecular Weight of Linked GDH The crude enzyme obtained in Example 2 was subjected to cation exchange chromatography (CM-Toyopearl 650M) equilibrated with 10 mM phosphate buffer (pH 7.0) to obtain Elution was carried out with 0.8 M NaCl / 10 mM phosphate buffer (pH 7.0). The fractions showing the activity were subjected to gel filtration chromatography (G-3000, Tosoh) under non-denaturing conditions.
Had a molecular weight of about 100 kDa, as expected for However, further analysis by SDS-PAGE revealed that this fraction contained a small amount of a protein with a molecular weight of 50 kDa. This may be due to in vivo proteolysis or the degradation of the fusion protein during the purification process,
It is considered that a subunit of PQQGDH of 50 kDa was generated. In order to separate and remove this decomposition product, the active fraction was further subjected to gel filtration chromatography in the presence of 2.0 mM guanidine-HCl to give a molecular weight of 10%.
A GDH-active fraction containing only a 0 kDa protein was obtained (FIG. 2). The fraction obtained in this manner is combined with a linked GHD
The enzyme preparation was used in the following experiments. Example 4 Enzyme Assay Enzyme activity was determined by measuring the enzyme in 10 mM MOPS buffer (pH
7.0) in 1 mM CaCl ₂ and 1 μM PQQ
After incubation for 10 minutes at room temperature in the presence of
6 mM phenazine methosulfate, 0.06 mM
2,6-dichlorophenol indophenol (DCI
It was determined by measuring the rate of decrease of the absorbance at 600 nm at 25 ° C. in the presence of P).

The assay was performed at a glucose concentration in the range of 10-1000 mM, and the kinetic parameters of the linked GDH were calculated. The Km values for glucose and lactose of the ligated GDH were 20 mM and 12 mM, respectively, which were almost the same as the natural dimer PQQGDH (Mathushita et a).
l. , 1995; Olsthorn et a.
l. , 1996, 1998).

The Vmax value of the linked GDH with respect to glucose was 897 U / mg, and the Vmax value with respect to lactose was 467 U / mg. There have been several reports on the catalytic activity of the natural dimer PQQGDH, and depending on the method of enzyme preparation and assay, 3
000 U / mg to 7400 U / mg (M
athusita et al. Ols, 1995;
like et al. , 1996, 1998). That is, the linked GDH has a catalytic activity of about 10 to 30% of that of the natural dimer PQQGDH. This value is 5-10 times higher than glucose oxidase commonly used in glucose sensors, and is sufficiently catalytically active to be applied in biosensors. Example 5 Evaluation of Thermal Stability Connected GDH and wild-type GDH were
After treatment in S buffer (pH 7.0) at the indicated temperatures of 30-70 ° C for 20 minutes, and then cooling at 4 ° C for 2 minutes, the remaining enzyme activity was measured at room temperature.

FIG. 3 shows the results. In the temperature range tested, ligated GDH showed higher residual activity than wild-type dimer GDH. These results indicate that ligated GDH has much higher thermostability than wild-type dimeric GDH. Example 6 Linked GDH Linked by a Synthetic Linker Linked GDH of the plasmid pLGB1 obtained in Example 1
Linker portion consisting of 13 amino acids derived from β-galactosidase of DH: Glu-Leu-Gly-Thr-Arg-Gly-Ser-Ser-Ar
g-Val-Asp-Leu-Gln-encoding sequence, Gly-Gly-Gly-Gly-Ser and Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Gly-Ser Plasmids encoding synthetic linker-linked GDH were created by replacing with a strand synthesis oligonucleotide. Purified enzymes were prepared in the same manner as in Example 2 using these plasmids. All of these synthetic linker-linked GDHs were obtained from the linked GDH obtained in Example 2.
It showed comparable enzyme activity and thermal stability to DH. Example 7 Production and Evaluation of Enzyme Sensor 20 mg of carbon paste was added to 5 U of the linked GDH, and the mixture was freeze-dried. After this was mixed well, only the surface of the carbon paste electrode already filled with about 40 mg of carbon paste was filled and polished on filter paper. This electrode was treated in a 10 mM MOPS buffer (pH 7.0) containing 1% glutaraldehyde at room temperature for 30 minutes, and then
10 mM MOPS buffer containing 0 mM lysine (pH
7.0) at room temperature for 20 minutes to block glutaraldehyde. This electrode is connected to 10 mM MOPS
Equilibrate in buffer (pH 7.0) for 1 hour or more at room temperature. The electrodes were stored at 4 ° C.

The glucose concentration was measured using the produced enzyme sensor. Glucose can be quantified in the range of 0.1 mM to 5 mM using the enzyme sensor on which the linked GDH of the present invention is immobilized.

[0026]

[Sequence List] SEQUENCE LISTING <110> Sode, Koji <120> Linked Glucose Dehydrogenase <130> 990 388 <160> 4 <170> PatentIn Ver. 2.0 <210> 1 <211> 38 <212> DNA <213> Acetobacter calcoaceticus <400> 1 ggccatggat aaacatttat tggctaaaat tgctttat 38 <210> 2 <211> 35 <212> DNA <213> Acetobacter calcoaceticus <400> 2 gggagctcct tagccttata ggtgaactta atgag 35 <210> 3 <211> 38 <212> DNA <213> Acetobacter calcoaceticus <400> 3 ggctgcaggt tcctctaact ccatctcaat ttgctaaa 38 <210> 4 <211> 38 <212> DNA <213> Acetobacter calcoaceticus <400> 4 ggaagctttt acttagcctt ataggtgaac ttaatgag 38

[Brief description of the drawings]

FIG. 1 shows a method for constructing a vector encoding a ligated GDH of the present invention and the primary structure of a linker region.

FIG. 2 is a gel electrophoresis diagram of the ligated GDH of the present invention.

FIG. 3 shows conjugated GDH of the present invention and control GDH.
4 is a graph showing the thermal stability of the sample.

 ──────────────────────────────────────────────────続 き Continued on the front page F term (reference) 4B024 AA11 AA20 BA08 CA03 DA05 DA06 EA04 GA11 HA01 4B050 CC03 DD02 LL03 4B063 QA01 QA18 QQ03 QR04 QR65 QS02 QX01 4B065 AA04Y AA26X AB01 AC14 BA02 CA28 CA10 4A030A10A FA74

Claims (12)

[Claims] 1. The two linked via a linker peptide.
A fusion protein containing two water soluble PQQGDH subunits. 2. The fusion protein according to claim 1, wherein the linker peptide has a length of 5 amino acids or more. 3. The method according to claim 1, wherein the water-soluble PQQGDH is Acinet.
The fusion protein according to claim 1 or 2, which is a water-soluble PQQGDH derived from O. calcoaceticus. 4. The linker peptide has the following sequence: Glu-Leu-Gly-Thr-Arg-Gly-Ser-Ser-Arg-Val-Asp-Leu-Gl
The fusion protein according to any one of claims 1 to 3, which has n. 5. The fusion protein according to claim 1, wherein the linker peptide has the following sequence: Gly-Gly-Gly-Gly-Ser. 6. The fusion protein according to claim 1, wherein the linker peptide has the following sequence: Gly-Gly-Gly-Gly-Ser-Gly-Gly-Gly-Gly-Ser. A gene encoding the fusion protein according to any one of claims 1 to 6. 8. A vector containing the gene according to claim 7. 9. A transformant containing the gene according to claim 7. 10. An organism in which the gene according to claim 7 has been integrated into a main chromosome. 11. A glucose assay kit comprising the fusion protein according to claim 1. A glucose sensor comprising the fusion protein according to any one of claims 1 to 6.