JP2000308496A - Nucleic acid probe for detection and/or determination of nonviral organism - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new probe capable of distinguishing a target nucleotide sequence of a target nonviral organism (group) from a nontarget nucleotide sequence of nontarget nonviral organism (group), and usable for detection or the like of the target nonviral organism in a test specimen. SOLUTION: This probe is a hybridization assay probe for distinguishing a target nucleotide sequence of a target nonviral organism or organism group from a nontarget nucleotide sequence of a nontarget nonviral organism or organism group. The probe has a base sequence of formula I or a complementary sequence when the target organism is Mycobacterium avium, a base sequence of formula II or a complementary sequence when the target organism is Mycobacterium intracellulare, or the like. The probe can form a detectable hybrid with a nucleotide sequence present in a nucleic acid from the target organism (group) under a hybridization condition, and the target organism (group) can be specifically detected by detecting the formed hybrid.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]Background of the Invention Field of the invention  The present invention relates to a process based on the use of genetic material such as RNA.
Probes and assays. More specifically, the present invention
Specimens such as sputum, urine, blood, tissue sections, food, soil and
A method for detecting and / or quantifying target non-viral organisms in water
Design and construction of nucleic acid probes for use in assays
And the probe and the genetic material of the target non-viral organism
Pertaining to hybridization.

[0002]Overview  Two single strands of nucleic acid consisting of nucleotides are linked ("c").
"Hybridize") to form a double helical structure. The structure
Two polynucleotide chains pointing in opposite directions during construction
Is a matched compound known as a centrally located “base”.
Hydrogen pairs (weak forms of chemical bonds) between
Are combined. Generally in the double helix structure of nucleic acids
For example, adenine base (A) is replaced with thymine base (T) or
Hydrogen bond with racyl base (U) and guanine base (G)
Hydrogen bonds with cytosine base (C). So I want to follow the chain
In any respect, base pairs AT or AU, TA or UA, GC or
CG is detected. The conventional ("canonical form (canonica
l))) Base pairs AG and GU other than base pairs can also be detected. Nuclear
The first single strand of the acid is sufficiently complementary to the second
Under conditions where the strands promote hybridization of the two
Assuming that it has been placed, a double-stranded nucleic acid will be obtained.
U. Under appropriate conditions, DNA / DNA, RNA / DNA or RNA / RNA
An hybrid may be formed.

[0003] Basic nucleic acid hybridization procedures can be broadly divided into two types. One is known as "solution" hybridization, in which both the "probe" nucleic acid sequence and the nucleic acid molecule from the test sample are free in solution. In another method, the sample nucleic acid is usually immobilized on a solid support and the probe sequence is free in solution.

[0004] The probe may be a single-stranded nucleic acid sequence that is complementary to the nucleic acid sequence to be detected (the "target sequence") to some extent. Further, the probe may be labeled. For prior art in which nucleic acid hybridization is used as a procedure for detecting specific nucleic acid sequences, see U.S. Patent Application No. 456729, dated January 10, 1983,
`` Method for Detection, Identi-fication and Quanti
tation of Non-Viral Organisms "(Kohne I) and
U.S. Patent Application No. 655365, September 4, 1984, entitled "Meth
od for Detecting, Identifying and Quantitating Org
anisms and Viruses "(Kohne II). The description of these patent applications is included herein, as are all other applications referred to herein.

The application also describes a method for detecting the presence of an RNA-containing organism in a sample suspected of containing the RNA-containing organism. The method comprises a nucleic acid from the sample and a nucleic acid molecule shorter than the original rRNA subunit sequence but sufficiently complementary to hybridize with rRNA of one or more non-viral organisms or groups of non-viral organisms. Mixing the probe, incubating the mixture under specific hybridization conditions, and assaying the hybridization of the probe with the test sample rRNA in the resulting mixture. In this patent application, a probe is used that detects only rRNA subunit subsequences that are the same or sufficiently similar to the rRNA subunit subsequences present in a particular organism or group of organisms; It also states that the presence or absence of one or more specific organisms or groups of organisms in the specimen can be detected below.

The present invention provides a method for detecting and / or quantifying any non-viral organism in a non-repetitive (unique) manner.
A novel method and means for designing and constructing DNA probes for use in detecting RNA sequences is provided. Some of the probes of the invention may be used to detect and / or quantify a single species or strain of a non-viral organism, while the remaining probes detect organisms of the entire genus or a desired phylogenetic group. And / or used to quantify.

[0007]Summary of the Invention  In the preparation and use of the probe,
Determine the presence or amount of rRNA from irritable organisms and
C to distinguish from known organisms that are closely related
In an hybridization assay, a predetermined length
Uses single-stranded deoxyoligonucleotides with specific sequences
Is done. According to the present invention,Mycobacterium avium,Myco
bacterium intracellulareas well asMycobacterium tubercul
osis -Specific for each 16S rRNA variable subsequence of complex bacteria
Nucleic acids from each other or under different and appropriate stringency
Professional that does not cross-react with bacterial species or respiratory infections
A probe array is provided. Also,Mycobacterium tubercul
osis-3 subunits of 23S rRNA variable region from complex bacteria
Sequence-specific probes as rRNA variable region probes
Provided. These probes areMycobacteriumGenus
(Specific for 16S and 23S rRNA),Myco-plasma pneumoniae
(5S and 16S rRNA specific), Chlamydia trachomatis
(Specific for 16S and 23S rRNA),Enterobacter clo-acae
(23S rRNA specific),Escherichia coli(16S rRNA specific
Target),Legionella(Specific for 16S and 23S rRNA),Salmon
ella(Specific for 16S and 23S rRNA),Enterococci(16S
rRNA specific),Neisseria gonorrhoeae(Specific for 16S rRNA
Target),Campylobacter(Specific for 16S rRNA),Proteus 
mirabilis(23S rRNA specific),Pseudomonas(23S rR
NA specific), fungi (18S and 28S rRNA specific) and bacteria
(Specific for 16S and 23S rRNA)
RRNA variable region probe useful in assays.

[0008] In one embodiment of the assay method,
The test sample is first maintained under conditions that release rRNA from non-viral organisms present in the sample. The rRNA is single-stranded, so the released rRNA can result in hybridization with sufficiently complementary genetic material. The labelable probe and the target rRNA are contacted in solution under conditions that promote hybridization between the two strands. The reaction mixture is then assayed for the presence of the hybridized probe. The many advantages of the non-viral organism detection method of the present invention over the prior art, such as its accuracy, convenience, economy and speed, will be more fully understood from the detailed description below.

[0009]Detailed description Definition  Terms used in the text and in the claims are as follows:
Define.

[0010]nucleotide  Consists of a phosphate group, a 5 'carbon sugar and a nitrogen-containing base
Subunit of nucleic acid. The 5 'carbon sugar is ribose in RNA
is there. In DNA it is 2-deoxyribose. This term
Also include analogs of such subunits.

[0011]Nucleotide polymer  At least two linked by a phosphodiester bond
Nucleotides.

[0012]Oligonucleotide  Generally, a nucleic acid of a length comprising about 10 to about 100 nucleotides.
Otide polymer, but more than 100 nucleotides in length
Is also good.

[0013]Nucleic acid probe  A double-stranded molecule (high
A single-stranded nucleic acid sequence capable of forming Nucleic acid probes
May be an oligonucleotide or a nucleotide polymer
-It may be.

[0014]hybrid  Watson-Crick base pairing or non-pairing between complementary bases
Formed between two single-stranded nucleic acid sequences by canonical base pairing
Complex.

[0015]Hybridization  Two complementary nucleic acid strands are joined to form a double-stranded
Lid) forming process.

[0016]Complementarity  Via hydrogen bonding between each chain Watson-Crick base pair
Hybrid or duplex DNA: DNA, RNA: RNA or
 DNA: base sequence of single-stranded DNA or RNA to form RNA
The characteristics that the column gives. Adenine (A) is usually less than thymidine (T).
Or uracil (U) and guanine (G)
It is usually complementary to cytosine (C).

Stringency A term that defines the temperature and solvent composition used in hybridization and subsequent processing steps. Under high stringency conditions only highly homologous nucleic acid hybrids are formed. Hybrids without sufficient complementarity are not formed. Thus, the stringency of the assay conditions determines the required amount of complementary nucleic acid between the two nucleic acid strands forming a hybrid. Stringency is chosen to maximize the difference in stability between the hybrid formed with the target nucleic acid and the hybrid formed with the non-target nucleic acid.

[0018]Probe specificity  Determines the ability of the probe to distinguish between target and non-target sequences
The characteristic value to determine. Depends on sequence and assay conditions. Step
The lobe specificity is absolute (ie,
Probe that can also identify the target organism) or
Functional (ie, the target organism and any other
Probe capable of distinguishing from an organism). Depends on usage conditions
Many probe sequences to broad or narrow specificity
Can be used.

[0019]Variable area  There is little difference between target organisms and non-target organisms contained in the specimen.
Both are nucleotide polymers in which one base is different.

[0020]Storage area  Non-variable area.

Sequence divergence A process whereby the similarity of nucleotide polymers is reduced during evolution.

Sequence Convergence A process in which the similarity of nucleotide polymers increases during evolution.

[0023]Bacteria  Phylogenetic eubacteria considered to be one of three major kingdoms
A constituent unit of a group.Tm  50% of probe is hybridized to non-hybridized
The temperature that is converted to the form of the size.

[0024]Thermal stability  Probe: 50% of target hybrid converted to single-chain form
Temperature. Probe-specific factors affecting thermal stability
It needs to be controlled as it affects gender.
Probe sequence detects only one type of organism
Is effective for the probe: target hybrid.
(“P: T”) Thermal Stability and Probes: Non-Target Hybridization
The thermal stability of the pad (“P: NT”). Plow
When designing the valve, subtract the Tm value of P: NT from the Tm value of P: T.
Make the calculated difference as large as possible.

In addition to a novel method of selecting probe sequences, the inventors have determined that specific rRs obtained from a single type of target organism.
Create a DNA probe complementary to the NA sequence and use it effectively in a non-cross-reactive assay for detection of the single organism, with the closest known phylogenetic or phylogenetic It has been found that such detection is possible even in the presence of an organism. All prokaryotic organisms except viruses contain rRNA molecules, including 5S and 16S rRNA, and a larger rRNA molecule known as 23S rRNA. Eukaryotic cells have 5.0S, 5.8S, 18S and 28S rRNA
It is known to have molecules or similar structures. (18S
RRNA detected in small ribosomal subunits, including and 17S rRNA, is sometimes referred to by the term "16S-like". RRNA similarly detected in large ribosome subunits is sometimes referred to by the term "23S-like". Five.
8S rRNA is equivalent to the 5 'end of a 23S-like rRNA). In all organisms examined to date, these rRNA molecules have a highly conserved nucleotide sequence. these
Methods by which significant portions of an rRNA sequence can be determined are known. For example, a complementary oligonucleotide primer of about 20-30 bases in length can be hybridized to a common conserved region of purified rRNA specific for the 5S, 16S or 23S subunit and extended with reverse transcriptase. Thereafter, the nucleotide sequence of the extension product may be determined using a chemical degradation reaction or a dideoxynucleotide terminated sequencing reaction. Lane, DJ, etc., Proc.
Nat'l Acad. Sci. USA 82, 6955-6959 (1985).

According to the present invention, one or more sequenced rRNA variable regions from a target organism are compared to one or more rRNA variable region sequences from a closely related bacterial species and utilized. To select a sequence that is unique to the rRNA of the target organism. From the viewpoint of relative abundance and stability in cells and from the viewpoint of phylogenetic conservation pattern, rRNA is more preferable than DNA as probe target.

[0027] Despite the high degree of conservation of rRNA, many sequence variable regions in the rRNA molecule have also been found to differ between closely related species, and thus have been found to be useful for discrimination between these species. . Differences in rRNA molecules are not randomly distributed throughout the molecule but are concentrated in specific regions. The degree of preservation also varies, and ribosomal RNA subunits form a unique preservation pattern. It is also possible to detect the target site of the diagnostic probe by analyzing the degree of mutation and its distribution. Using this probe selection method, it is also possible to select two or more sequences that are unique to the rRNA of the target organism.

The variable regions were identified by comparative analysis of rRNA sequences published in the literature and rRNA sequences determined by ourselves using procedures known in the art. Sun Mi for comparative analysis
A crosystems (TM) computer was used. The compiler can process many data arrays simultaneously. Computers of this type and computer programs that can be used or applied for the purposes described herein are commercially available.

In general, there are few areas that are useful for discriminating between closely related species of a phylogenetically conserved genus.
There is a region of 400-500 bases from the 5 'end of the 16S rRNA molecule. Analysis of closely related organisms (Nos. 6, 7 and 8)
Figure), the specific position (variable region) where there is a difference between closely related organisms is found. These variable regions of the rRNA molecule are promising candidates for probe design.

FIG. 5, FIG. 6 and FIG. 7 show mutations in 16S and 23S rRNA between two different bacteria that reduce the amount of similarity between them. A more detailed analysis of these figures reveals certain potential patterns among these closely related organisms. In all cases examined, we found that there were enough mutations between the target organism detected in the same specimen and the phylogenetically closest organism to design an effective probe. Furthermore, in all cases examined to date, the similarity between the target organism (s) detected in the same specimen and the phylogenetically closest organism is between 90% and 99%. Notable is Neis
seria gonorrhoeae and Neisseria meningitidis are DN
A: Despite the fact that studies of DNA homology suggested that these two species were in fact the same species, there were sufficient mutations between the rRNAs to design probes. (See Example 21).

The figures also show that the differences are 16S and 23S rR.
Indicates that it is distributed throughout NA. However, many of the differences are concentrated in a few areas. These locations in the rRNA are promising candidates for probe design in our routine assay conditions. We also noted that places with high density of mutations are usually present in the same region of 16S and 23S rRNA with similar values of similarity. Thus, 16S and
Several regions of 23S rRNA were observed to be those regions where significant mutations between the target organism and the phylogenetically closest organism detected in the same specimen were most likely to be present. The present invention provides species-specific probes that hybridize to those regions that show significant variation between the target organism and the phylogenetically closest organism detected in the same specimen.

FIGS. 9, 10 and 11 are schematic illustrations showing the locations of the probes provided in the present invention. Probes designed by these methods are specific for one or a few positions of the target nucleic acid, since, in principle, 16S and 23S RNAs do not contain replicated sequences longer than sequences having a length of about 6 nucleotides. Most of the sequence evolution in each variable region (eg, having a minimum length of 10 nucleotides) is divergent and not convergent. Therefore, reliable probes can be designed based on the small number of rRNA sequences that differ between the target organism and the phylogenetically closest organism. The biological and structural constraints on rRNA molecules that maintain homologous primary, secondary and tertiary structures during evolution and the impact of such constraints on probe diagnostics are for further study. The greater the evolution interval between organisms, the greater the number of variable regions available for discrimination between organisms.

After identification of the variable regions, the sequences are aligned to detect regions of greatest homology or "matched" regions. Here, the sequence is analyzed so that the potential probe region can be identified. Two important conditions for probe design are to maximize homology to the (one or more) target sequence (preferably greater than 90% homology) and minimize homology to the (one or more) non-target sequence (non- Preferably, homology to the target is less than 90%). It has been confirmed that the following policy is effective for designing a probe having desired characteristic values.

First, the probes need to be positioned to minimize the stability of the probe: non-target nucleic acid hybrid. To this end, the probes are arranged to minimize the length of perfect complementarity to the non-target organism, avoid G and C-rich regions homologous to the non-target sequence, and measure as many unstable mismatches as possible. (For example, dG: r
U base pairs are more unstable than some other base pairs).

Second, there is a need to maximize the stability of the probe: target nucleic acid hybrid. For this, A
And avoid long sequences rich in T and T:
Terminate with base pairs and design a probe with an appropriate Tm value. The starting and ending points of the probe are the length and% of G giving a Tm value about 2-10 ° C. higher than the temperature used in the final assay.
And% of C are obtained. The significance and effects of the various assay conditions are described later in the text. Third, regions of the rRNA known to form strong hybridization-inhibiting structures are not preferred. Finally, probes with extensive self-complementarity need to be avoided.

In some cases, multiple sequences may be obtained from a particular region that results in a probe having the desired hybridization characteristics. In other cases, one sequence may be much better than another with one base difference.

The following chart illustrates, as one embodiment of the present invention, a method for selecting a unique rRNA sequence that is effective for detecting a nucleic acid sequence in the presence of a closely related nucleic acid sequence. In this example, the rRNA sequences for organisms AE were determined, numbered and aligned. Sequence 1 is common to all organisms AE. Sequences 2-6 are present only in organisms A, B and C, and sequences 8, 9 or 10 are unique to organism A. Thus, probes complementary to sequences 8, 9 and 10 will hybridize specifically to organism A.

[0038]

[Table 1]

When the mutation pattern of a macromolecule, for example, rRNA, is known, promising candidates for probe design can be narrowed down to a specific region. However, it is not necessary to determine the entire nucleic acid sequence to obtain a probe sequence. 3 by extension from any single oligonucleotide primer
A sequence of 00-400 bases is obtained. Using a single primer to partially sequence the rRNA of the target organism and an organism closely related to the target, an alignment such as that described above can be made. In short, once a valid primer sequence is known, it is not necessary to continue rRNA sequencing with another primer. Conversely, if sequencing with the first primer does not yield a valid probe sequence or a more sensitive probe is desired, another primer may be used to search for another sequence. When the mutation pattern of a molecule is not well understood, more sequence data is needed before probe design.

Therefore, in Examples 1 to 3 described below,
Two 16S-derived primers were used. The first primer did not produce a probe sequence that passed the criteria defined in the present invention. The second primer produced a primer that was determined to be effective as a result of the characterization and specificity tests described above. In Example 4, six 23S primers were used before the described probe sequence was detected.

After identification of the predicted unique sequence,
Synthesize a DNA oligonucleotide sequence. This single-stranded oligonucleotide will serve as a probe in a DNA / rRNA assay hybridization reaction. Specific oligonucleotides can be synthesized using any of several known methods. For example, there is an automated solid-phase chemical synthesis using a cyanoethyl phosphoramidite precursor. Barone.AD
Nucleic Acid Research 12, 4051-4060 (1984). In this method, deoxyoligonucleotides are synthesized on a solid polymer support. 16 at 60 ° C with ammonium hydroxide
The oligonucleotide is released from the support by a time treatment. The solution is dried and the crude product is dissolved in water and separated on a polyacrylamide gel. The concentration of the polyacrylamide gel generally depends on the length of the fragment.
Adjust within the range of ~ 20%. The main band visualized by ultraviolet backlight is cut out of the gel with a razor blade and extracted with 0.1 M ammonium acetate pH 7.0 at room temperature for 8 to 12 hours. After centrifugation,
The supernatant was filtered through a 0.4μ filter, and the mixture was applied to a P-10 column (Pharmac
Demineralize in a). Of course, the use of other known methods for constructing synthetic oligonucleotides is also possible.

Conventional DNA synthesizers use large amounts of synthetic DN.
A can be produced. After synthesis, when the size of the newly produced DNA is examined by gel filtration, molecules of various sizes are generally detected. Some of these molecules indicate abortive synthesis events that occurred during the synthesis process. Usually, as part of the post-synthesis purification process, synthetic DNA is size fractionated and only molecules of appropriate length are preserved. In this way, it is possible to obtain a population of synthetic DNA molecules of uniform size.

However, in general, synthetic DNA is originally
It has been assumed that all consist of a homogeneous population of molecules of the same size and the same base sequence, and that the hybridization properties of each molecule in the preparation are equal. In reality, synthetic
Preparations of DNA molecules are heterogeneous,
It is composed of several molecules of the same size but with some differences from one another and thus different hybridization properties. Preparations having the same sequence sometimes have different hybridization characteristics from preparation to preparation.

Accordingly, a plurality of preparations having the same synthetic probe sequence may have different hybridization characteristics. Thus, probe molecules from different preparations may not have the same specificity. In order to determine the hybridization conditions to be used to obtain the desired probe specificity, it is necessary to examine the hybridization properties of each preparation. For example, Example 4 described later.
Has the specificity profile shown in Table 14. This data was obtained using the hybridization and assay conditions described. Alternative preparations of this probe with different hybridization properties will not necessarily show exactly the same specificity profile when assayed under the conditions of Example 4. Several such probe preparations were made. To obtain the desired specificity,
Hybridization and assay of these probes can be performed under various conditions such as salt concentration and / or temperature. Since the technology of DNA synthesis is also somewhat imperfect, it is necessary to determine the actual conditions of use of the probe for each batch of probes, i.e. to adapt to existing requirements.

After synthesis and purification of a particular oligonucleotide sequence, several procedures are utilized to determine the suitability of the final product. First, the size is determined by polyacrylamide gel electrophoresis. The oligonucleotide is labeled, for example, with 32 P-ATP and T4 polynucleotide kinase. The labeled probe is precipitated with ethanol, centrifuged, and the dried pellet is filled with filling buffer (80% formamide, 20 mM NaO
H, 1mM EDTA, 0.1% bromophenol blue and 0.1
% Xylene cyanol). The specimen is heated at 90 ° C. for 5 minutes and loaded on a denaturing polyacrylamide gel. Electrophoresis in TBE buffer (0.1 M Tris HCl pH 8.3, 0.08 M boric acid, 0.002 M EDTA) at 1.000 V for 1-2 hours. After oligonucleotide electrophoresis, the gel
Expose to line film. The size of the oligonucleotide is then calculated from the migration of the similarly treated oligonucleotide standard.

To confirm the sequence of the synthetic oligonucleotide, the 5 'end of the nucleotide was changed to ³² P-ATP and T
Labeled with ₄ polynucleotide kinase, Maxam, AM
And Gilbert, W., Proc. Nat'l Acad. Sci. USA 74
560-564 (1980), and the products may be analyzed on polyacrylamide gels. It is preferred, but not required, that the nucleotide sequence of the probe be completely complementary to the previously identified unique rRNA sequence.

It is also necessary to determine the dissolution profile including the melting temperature (Tm value) of the oligonucleotide / rRNA hybrid. One method for determining Tm values is to hybridize a ³² P-labeled oligonucleotide to its complementary nucleic acid in 0.1 M phosphate buffer pH 6.8 at 50 ° C. Dilute hybridization mixture, 2c at 50 ° C
m through a hydroxyapatite column. 0.1 M column
Wash with phosphate buffer, 0.02% SDS to elute completely unhybridized single-stranded probe. The column temperature is then reduced to 15 ° C and the temperature is increased by 5 ° C until all probes are single-stranded. The non-hybridizing probe elutes at each temperature, and the number of counts per minute (cpm) of each fraction is measured. The quotient of the value of cpm bound to hydroxyapatite divided by the total cpm added to the column is the% hybridization of the probe to the target nucleic acid.

The following method may be used to determine the thermal stability of the hybrid. 1 ml of 0.12 M phosphate buffer, 0.2% SD
S Dilute in 1 mM EDTA, 1 mM EGTA or dilute in appropriate hybridization buffer. This 1ml
The solution is heated at 45 ° C. for 5 minutes and left in a room temperature water bath for 5 minutes. The 1 ml of the hybrid-containing solution is assayed on a hydroxyapatite column, the hybrids are collected, and the unbound probe is washed away. If a hybridization solution other than 0.12M phosphate buffer is used, the hybridization solution will need to be diluted and bound to 0.12M phosphate buffer. A partial sample of the hybrid is collected, diluted in 1 ml of hybridization solution or the standard 0.12M phosphate buffer described above, and the temperature is increased by 5 ° C. and heating is continued. Continue this process until all hybrids have dissolved. The temperature at which half of the hybrid was converted to the dissolved form is defined as the Tm value. The Tm value for a given hybrid will vary greatly depending on the hybridization solution used. The reason is that thermal stability depends on the concentration of various salts, surfactants, and other solutes that affect the relative hybrid stability during thermal denaturation.

[0049] The extent and specificity of the hybridization reaction as described herein depends on a number of factors;
Manipulation of one or more of these factors can determine the exact sensitivity and specificity of a particular probe and can determine whether it is completely complementary to the target. For example, the base composition of the probe may be important. GC base pairs exhibit higher thermal stability compared to AT base pairs due to additional hydrogen bonding.

Thus, hybridization involving a complementary nucleic acid sequence with a high GC content is more stable at higher temperatures.

It has been found that the length of the target nucleic acid sequence, and thus the length of the probe sequence, is also important. Nucleic acids that are not perfectly complementary are also capable of hybridizing, but usually the longest portion of the completely homologous base sequence will primarily determine hybrid stability. Although oligonucleotide probes of various lengths and base compositions may be used, preferred oligonucleotide probes of the present invention are about 15 to about 50 bases in length and are at least about 75% to 100% homologous to the target nucleic acid.
For most applications, 95% to 100% homology to the target nucleic acid is preferred.

It is also necessary to take into account ionic strength and incubation temperature when constructing probes. It is known that the rate of hybridization increases with increasing ionic strength of the reaction mixture, and that the thermal stability of the hybrid increases with increasing ionic strength. Generally, optimal hybridization of synthetic oligonucleotide probes of about 15 to 50 bases in length will occur at about 5 ° C below the melting point for a given duplex. Incubation below the optimal temperature will hybridize mismatched base pairs, thus resulting in reduced specificity.

With respect to nucleic acid concentration, it is known that the rate of hybridization is proportional to the concentration of the two interacting nucleic acid species. Thus, the presence of compounds such as dextran and dextran sulfate is believed to increase the local concentration of the nucleic acid species and thereby increase the hybridization rate. Another substance that increases the rate of hybridization is disclosed in U.S. Patent Application No. 6,277,955, Jul. 5, 1984, Accelerated Nucleic Acid Reassociation.
ation Method ", its CIP applications, U.S. patent application dated June 4, 1987 (unauthorized), and U.S. Patent Application No. 816711 dated January 7, 1986," Accelerated Nucleic Ac
id Reassociation Method ". These applications are incorporated herein. On the other hand, chemicals that break hydrogen bonds, such as formamide, urea, DMSO and alcohol, will increase the stringency of hybridization.

The selected oligonucleotide probe can be labeled using any of several known methods. Common labels are radioisotopes and non-radioactive indicators.
The isotopic label ^{3 H, 35 S, 32 P} , 125 I
, Cobalt and ¹⁴ C. Many isotope labeling methods use enzymes, and known methods include nick translation, end labeling, second strand synthesis, and reverse transcription. If a radiolabeled probe is used, hybridization can be detected by autoradiography, scintillation counting or gamma counting.
The detection method chosen will depend on the hybridization conditions and the particular radiolabel used for labeling.

It is also possible to use non-isotopic materials for labeling, these can be introduced by incorporation of denatured nucleotides using enzymes or by chemical denaturation of the probe, for example using non-nucleotide linker groups. . Non-isotopic labels include fluorescent molecules, chemiluminescent molecules, enzymes, cofactors, enzyme substrates, haptens or other ligands. Usually, the use of acridinium esters is preferred.

In one embodiment of the DNA / rRNA hybridization assay of the present invention, a labeled probe is reacted with a bacterial target nucleic acid in a solution. rRNA is disclosed in U.S. Patent Application No. 841860, KA Murphy et al.
No. `` Method for Releasing RNA and DNA From Cells ''
Can be released from bacterial cells by the ultrasonic disruption method described in 1. The patent application is incorporated herein. Other known methods for cell disruption include the use of enzymes, osmotic shock, chemical treatment, and the use of vortexing with glass beads. After or simultaneously with the release of the rRNA, the labeled probe is added in the presence of the facilitator and incubated at the optimal hybridization temperature for the time required to achieve a significant reaction. After this incubation period, hydroxyapatite can be added to the reaction mixture to separate probe / rRNA hybrids from non-hybridized probe molecules. The hydroxyapatite pellet is washed, recentrifuged and the hybrid is detected by means appropriate for the label used.

The following are 21 typical examples of the present invention. In these embodiments, the non-repetitive
One or more synthetic probes complementary to the rRNA sequence are determined, constructed and used in a hybridization assay.

[0058]Specific examples  Mycobacterium is acid resistant, alcohol resistant, aerobic, non-
It is a mobile bacillus. These have high lipid content and slow growth
No.Mycobacterium aviumWhenMycobacterium intracellu
lareIs difficult to distinguish fromM. avium-intracellul
areHas been named. Recently,M. intracellul
areincludingM. aviumThe second most complex is separated
Floor importantMycobacteriumTurned out to be. Go
od, R.C., etc.J. Infect. Dis.146, 829-833 (1982).
More recently, these organisms have developed AIDS (acquired immunodeficiency).
Syndrome) is a common cause of opportunistic infections in patients
Was proved. Gill, V. J., etc.J. Clin. Microbio. Two
2, 543-546 (1985). These organisms can be used for most antituberculosis drugs.
Cures such infections in AIDS patients because they are resistant
Treatment is extremely difficult. Often a combination therapy of five drugs
Often used. These infections are prone to serious conditions and
And prompt diagnosis is required, but prior to the present invention,
There was no such diagnostic method.

[0059] Mycobacterium tuberculosis complex (Mtb)
Include Mycobacterium tuberculosis , Mycobacterium bo
vis , Mycobacterium africanum and Mycobacterium mi
There is croti . The first three are human pathogenic and the last one
One is an animal pathogen. These organisms produce slowly growing granulomas on the skin or invade internal organs. Mycobacterium tuberculosis in the lungs is transmitted to other parts of the body by the circulatory, lymphatic, or gastrointestinal tract. Despite advances in public health and the development of effective chemotherapy, Mycobacterium disease, especially tuberculosis, remains a significant health problem worldwide.

In a conventional method for detecting bacteria in a test specimen, the specimen is cultured to increase the number of bacterial cells that can be identified and counted in the observable colony growth. If desired, the culture is further tested to determine antimicrobial susceptibility. At present, the most popular procedure for detecting, isolating and identifying Mycobacterium species is (Ziehl-Nee
lsen or fluorochrome method)
This is a culture method and a biochemical test using acid-resistant bacilli (AFB) smear, Lo-wenstein-Jensen medium and Middlebrook medium. AFB utilizes a high Mycobacterium lipid content that retains pigment after exposure to acid-alcohol. AFB
The smear test is relatively quick and easy to process, but Myco
Bacterium is not always detected. Also, Mycoba
Identification of cteriumavium from non-tuberculosis species and Mycobacterium i
Discrimination between ntracellulare and non-tuberculosis species or Mycobacterium t
uberculosis-Unable to distinguish between bacillus complex and non-tuberculosis species. To accurately identify infectious Mycobacterium species, clinicians always require a 3-8 week growth period,
Thereafter, extensive biochemical tests are performed to obtain culture results.
Another test method based on the detection of Mycobacterium metabolites using ¹⁴ C-labeled substrates has also been developed. In particular, Bactec
The (TM) device can detect the presence of Mycobacterium within 6-10 days after inoculation. Gill, VJ, etc., supra. However, this test does not identify Mycobacterium species.
Such species identification is often critical in prescribing a particular drug to which an organism is sensitive. For this reason, the conventional culture method requires an additional 2-3 weeks, and the Bactec method requires an additional 6-10 days.

Further, Mycoplasma pneumoniae , Mycobact
erium , Legionella , Salmonella , Chlamydia trachoma
tis , Campylobacter , Proteus mirabilis , Enteroco
ccus , Enterobacter cloacae , E.coli , Pseudomonas I
Specific examples relating to groups , bacteria, fungi and Neisseria gonorrhoeae are also described in the examples below.

As shown in the following examples, the present invention is much more advantageous than any of the above prior art methods in terms of test accuracy, specificity and simplicity.
At the same time, the time required for diagnosis is greatly reduced. According to the present invention, it is possible to give a final diagnosis on the day of the test and start effective treatment.

[0063]Example 1  Single-chain deoxyoligonucleotides of defined length with unique sequences
Reotide is prepared and labeled as follows,Mycobacteriu
m aviumSolution for detecting the presence of rRNA from
Use as a probe in hybridization assays
You. This unique sequenceMycobacterium aviumRRNA
Specific and the hybridization conditions of this example
BelowMycobacterium intracellulareIncluding
Nucleic acid from any other bacterial species or respiratory infection
Also does not significantly cross-react. This probe is between two species
Can be distinguished even when about 98% rRNA homology exists in
You. In this embodiment, as in Embodiments 2 and 3, 16S rRN
Use specific primers for the highly conserved region of A.
And byM. avium,M. tuberculosisComplex,M.in
tracellulareAnd sequences for closely related organisms. colon
FungusE. coliThe primer sequence from rRNA was 5'-GGC CGT TAC CCC ACC TAC TAG CTA AT-3 '. Presence of 0.1M KCl and 20mM Tris-HCl pH 8.3
Below 5 ng of primer and 1 μg of each rRNA to be sequenced
Was mixed to a final volume of 10 μl. Reaction mixture at 45 ° C
Heat for 10 minutes, place on ice, add 2.5 μl 35S dATP and 0.5 μl
l of reverse transcriptase was added. Specimen into four partial samples
Each was separately put into a test tube. Each test tube is
Housed A, G, T or C. These nucleos
Pide concentrations are described in Lane et al., Supra. The specimen
Incubate at 40 ° C for 30 minutes, then ethanol precipitate
And centrifuged, and the pellet was lyophilized. 10 pellets
μl of formamide dye (100% formamide, 0.1%
Lomophenol blue, 0.1% xylene cyanol)
Resuspend and load on 80cm 8% polyacrylamide gel
did. The gel was energized at 2000 V for 2-4 hours.

The bacteria phylogenetically closest to the nucleotide sequence of the 16S rRNA of Mycobacterium avium , ie Myco
bacterium intracellulare and Mycobacterium tubercul
The nucleotide sequence of 16S rRNA of osis and Lane, DJ, etc.
Proc. Nat. Acad. Sci. USA 82: 6955 (1985). In addition to determining the rRNA sequence of the organism, a series of clinically significant Mycobacterium sequences were performed.
These are M. fortuitum , M. scrofulaceum and M.ch
elonae . Several organisms of several genera closely related to Mycobacterium were selected and sequenced. These are Rhodococcus bronchialis , Coryneba
cterium xerosis and Norcardia asteroides .

Intelligenetics, Inc., 1975 E1 Camino
Real West, Mountain View, California 94040-2216
Using software commercially available from (IFIND Program), partial rRNA sequences derived from the organism were aligned so as to have maximum nucleotide homology. Mycobact from this alignment
The region of the sequence specific to erium avium was determined. The probes were selected such that they were perfectly complementary to the target nucleic acid sequence and had a mismatch of 10% or more when the probes were aligned with rRNA from the phylogenetically closest known organism. A sequence with a length of 38 bases was selected. Mycobacterium av
The number of mismatched bases for the ium sequence was as follows. Mycobacterium tuberculosis (8); Mycobacterium i
ntracellulare (5); Mycobacterium scro-fulaceum (6);
Mycobacterium chelonae (12) and Mycobacte-rium fortu
itum (10).

The characteristics of the cDNA sequence ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG were determined based on criteria such as length, Tm, sequence analysis and the like described on pages 7 to 8 and were found to be specific for rRNA of Mycobacterium avium . This sequence is Mycobacterium aviu
Complementary to the unique segment detected in m 16S rRNA. The size of the probe is 38 bases. Of the probe
Tm value is 74 ° C., Maxam and Gilbert method (1980), above
As described above , it was confirmed that the probe was correctly synthesized by sequence analysis. The probe can hybridize to the M.avium rRNA in the region corresponding to bases 185-225 of E. coli 16S rRNA.

To demonstrate the reactivity of this sequence against Mycobacterium avium , this sequence was tested as a probe in a hybridization reaction under the following conditions.
Mycobact ³² P end-labeled oligonucleotide probe
1 μg (7 × 10 ^-13 mol) of purified rR from erium avium
Mixed with NA, 0.12 M PB hybridization buffer (equimolar amounts of Na ₂ HPO ₄ and NaH ₂ PO ₄ ), 1 mM EDTA and
The reaction was carried out at 65 ° C. for 60 minutes in 0.02% SDS (sodium dodecyl sulfate) to a final volume of 50 μl. In separate tubes, the probe was mixed with the hybridization buffer containing the target and the hybridization buffer not containing the target, respectively. Separation with hydroxyapatite as described in the patent application cited on page 2, hybrids were quantified by scintillation counting. Table 1 shows the results. The results indicate that the probe is highly reactive with homologous targets and has very low non-specific binding to hydroxyapatite.

[0068]

[Table 2]

To test the M. avium specificity of the probe, rRNA released from cells of another 29 Mycobacterium species and ³² P-labelling by sonication as described in Murphy et al., US Patent Application No. 841860. Mixed with probe. 1 × 10 ⁸
Cells were suspended in 0.1 ml of 5% SDS and sonicated for 10 minutes at 50-60 ° C. 1.0 ml of hybridization buffer (45% sodium diisobutylsulfosuccinate, 40
mM phosphate buffer pH 6.8 and 1 mM EDTA) were added and the mixture was incubated at 72 ° C. for 60 minutes. After incubation, 4.0 ml of hydroxyapatite solution (50 ml of solution)
0.14M sodium phosphate buffer pH6.8, 0.02%
SDS and 1.0g hydroxyapatite) and add
For 5 minutes. The sample was centrifuged and the supernatant was removed. 4.0 ml wash solution (0.14M sodium phosphate
pH 6.8), vortex the sample, centrifuge,
The supernatant was removed. Radioactivity bound to hydroxyapatite was measured by scintillation counting. Table 2 shows the results. This result indicates that the probe is Mycobacterium
avium specific and Mycobacterium intracel
It does not react with other Mycobacterium species including lulare .

[0070]

[Table 3]

Table 3 also shows that the probe did not react with rRNA from any respiratory pathogen when tested in the same manner as described above. Testing in the same manner also revealed that the probe did not react with any other closely related bacterial species and phylogenetically more diverse bacterial species (Table 4).

[0072]

[Table 4]

[0073]

[Table 5]

[0074]Example 2  After alignment as described in Example 1, the criterion,
Characterize the sequence, ACCGCAAAAGCTTTCCACCTAAAGACATGCGCCTAAAG by length, Tm and sequence analysis,Mycobacterium intracellularePeculiar to
It was found that it was a target. This array isMycobacterium
intracellulareRepeats detected in 16S rRNA
Complementary to The probe size was 38 bases.
Was. The Tm value of the probe is 75 ° C, and
It was confirmed that the lobe was synthesized correctly. The probe is
E.coli In the region corresponding to bases 185 to 225 of 16S rRNAM.
intracellulareHybridizes to the RNA.

To demonstrate the reactivity of this sequence against Mycobacterium intracellulare , the probes were tested in a hybridization reaction under the following conditions. 32P
1 μg of end-labeled oligonucleotide probe (7 × 10
^-13 mol) of purified rRNA derived from Mycobacterium intracellulare and mixed with 0.12 M PB (equimolar amounts of Na ₂ HPO ₄ and NaH ₂ PO ₄ ), 1 mM EDTA and 0.02% SDS (sodium dodecyl sulfate) at 65 ° C. And react for 60 minutes in a final volume of 50μ
l Target Mycobacteriumintracell in separate tubes
The probe was mixed with a hybridization buffer containing ulare rRNA and a hybridization buffer not containing the target. Separation with hydroxyapatite as above and hybrids were quantified by scintillation counting. Table 5 shows these results.
Shown in

[0076]

[Table 6]

These data indicate that the probe is highly reactive with homologous targets and has very low non-specific binding to hydroxyapatite.

Probe Mycobacterium intracellulare
To test for specificity, Murphy et al.
Another 29 Mycobacterium by the ultrasonic disruption method described in 1860
The rRNA released from the seed cells was mixed with the ³² P-labeled probe. A hybridization assay was performed in exactly the same manner as in Example 1. Table 6 shows the results. Table 6 shows that the probe is specific to Mycobacterium intracellulare and other Mycobactans including Mycobacterium avium.
It does not react with erium species. These results
Mycobacterium intracellulare rRNA is 98 in M.avium
%, 98% to M.kansasii, 98% to M.asiaticum and M.tube
It is extremely shocking considering that it has 97% homology to rculosis .

[0079]

[Table 7]

Table 7 also shows that the probe did not react with rRNA from any respiratory pathogen when tested in the hybridization assay. Testing in the same manner also revealed that the probe did not react with any other closely related bacterial species and phylogenetically more diverse bacterial species (Table 8).

[0081]

[Table 8]

[0082]

[Table 9]

[0083]Example 3  After alignment as described in Example 1, the three
Array by size, ie, size, array and Tm value Characterize TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG, Mtb-biological complex,Mycobacterium tu
ber-culosis,Mycobacterium africanum,Mycobacter
ium bovisas well asMycobacterium microtisIs specific to
I decided that.

This sequence is complementary to the unique segment detected in the 16S rRNA of the Mtb-bacterial complex. The size of the probe is 35 bases. The Tm value of the probe is 72 ° C,
Sequence analysis confirmed that the probe was synthesized correctly. This probe is based on E. coli 16S rRNA from base 185
Can hybridize to the region corresponding to 225.

To demonstrate the reactivity of this sequence for the Mtb complex, the probes were tested in a hybridization reaction under the following conditions. 1 μg (7 × 10 ⁻¹³ mol) of Myco ³² P-end labeled oligonucleotide probe
Mix with purified rRNA of bacterium tuberculosis , 0.12MP
B Hybridization buffer (equimolar amount of Na ₂ HP
O ₄ and NaH ₂ PO ₄ ), 1 mM EDTA and 0.02% SDS (sodium dodecyl sulfate) were reacted at 65 ° C. for 60 minutes to a final volume of 50 μl. Mycoba targets probes in separate tubes
The hybridization buffer containing cterium tuberculosis rRNA and the target-free hybridization buffer were mixed. Separation with hydroxyapatite as above and hybrids were quantified by scintillation counting. Table 9 shows the results.

[0086]

[Table 10]

These data indicate that the probe is highly reactive with homologous targets and has very low non-specific binding to hydroxyapatite.

To test the Mtb complex specificity of the probe, four Mtb-bacillus complexes and another 25 were tested by sonication as described in US Patent Application No. 841860 to Murphy et al.
RRNA released from Mycobacterium sp. Cells was mixed with a ³² P-labeled probe. A hybridization assay was performed in exactly the same manner as in Example 1. Table 10 shows that the probe is specific to the organism in the Mtb complex and other
Indicates no reaction with Mycobacterium species.

[0089]

[Table 11]

Table 11 also shows that the probe did not react with rRNA from any respiratory pathogen in the hybridization assay. Also tested in the same manner, the probe was found not to react with any other closely related bacterial species or phylogenetic taxonomic diversity (Table 11).

[0091]

[Table 12]

[0092]

[Table 13]

Two derivatives of the probe of Example 3 (probes 2 and 3 below) were prepared and tested.

[0094] 2. CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG 3. ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC All three probes have similar Tm values (72 ° C, 73.5 ° C respectively)
And 72.3 ° C.) and similar hybridization characteristics.

[0095] Hybridization to Mycobacterium tuberculosis biocomplex was 68-75% and non-specific hybridization to hydroxyapatite was less than 2%.

The results of the hybridization assay test of these derivatives are shown below.

[0097]

[Table 14]

[0098]Example 4  Use primers complementary to the highly conserved region of 23S rRNA.M.
tuberculosisProbe specific for the 23S rRNA of the complex
Produced.E.coli Sequence of this primer from rRNA
Was 5'-AGG AAC CCT TGG GCT TTC CG-3 '. Add 5 ng of this primer to 1 μgM. tubercu
losisRR and rR from another closely related Mycobacterium
Mixed with NA and processed according to the procedures described in Examples 1, 2 and 3.
Was. After alignment as described in Example 1, the sequence TGCCCTACCCACACCCACCACAAGGTGATGT contains the Mtb biological complex,Mycobacterium tuberculosis,Myco
-bacterium africanum,Mycobacterium bovisas well asMyco
bac-terium microtiWas determined to be specific.

This sequence is complementary to the unique segment detected in the 23S rRNA of the Mtb-bacterial complex. Oligonucleotide probes were characterized as described above by criteria for length, Tm value and sequence analysis. The size of the probe is 31 bases. The Tm value of the probe was 72.5 ° C., and it was confirmed by sequence analysis that the probe was correctly synthesized. This probe is the base of E. coli 23S rRNA.
It can hybridize to the region corresponding to 1155-1190.

To demonstrate the reactivity of this sequence for the Mtb complex, the probes were tested in a hybridization reaction under the following conditions. 1 μg (7 × 10 ⁻¹³ mol) of Myco ³² P-end labeled oligonucleotide probe
Mixed with purified rRNA of bacterium tuberculosis , 0.12M PB
(Equimolar amounts of Na ₂ HPO ₄ and NaH ₂ PO ₄ ), 1 mM EDTA and
The reaction was carried out at 65 ° C. for 60 minutes in 0.02% SDS (sodium dodecyl sulfate) to a final volume of 50 μl. In separate tubes, the probe was mixed with a hybridization buffer containing the target Mycobacterium tuberculosis rRNA and a hybridization buffer not containing the target, respectively. Separation with hydroxyapatite as above and hybrids were quantified by scintillation counting. Table 14 shows the results.

[0101]

[Table 15]

These data indicate that the probe is highly reactive with homologous targets and has very low non-specific binding to hydroxyapatite.

To test the Mtb complex specificity of the probe, four Mtb-Bacillus complexes and another 25 Myt were tested by sonication as described in Murphy et al., US Patent Application No. 841860.
The rRNA released from cells of cobacterium species was mixed with a ³² P-labeled probe. A hybridization assay was performed in exactly the same manner as in Example 1. Table 15 shows that the probe is specific for the Mtb complex and other Mycobacteriu
m Indicates no reaction with species.

[0104]

[Table 16]

[0105]Example 5  Using two unique primers complementary to 23S rRNA
Three moreMycobacterium tuberculosisComplex probe
Was identified (Examples 5 to 7). The first sequence is CCATCACCACCCTCCTCCGGAGAGGAAAAGG. This sequence of Example 5 was obtained using the 23S primer having the sequence 5'-GGC CAT TAG ATC ACT CC-3 '. This array
Characterizing,Mycobacterium tuberculosis,Mycobacter
ium africanumas well asMycobacterium bovisIncluding etcMyco
bacterium tuberculosisSpecific to the biological complex of
And found out. This sequence from 23S rRNA is 31 bases in length
Tm value is 72 ° C. This probeE.coli 23S rRNA salt
Hybridize to the RNA of the organism in the region corresponding to bases 540 to 575
Can be redisused.

To demonstrate the reactivity and specificity of this probe for the Mycobacterium tuberculosis complex,
This probe was tested in a hybridization reaction under the following conditions. Murphy, etc., were mixed and liberated rRNA and ³² P end-labeled oligonucleotide probe from 30 Mycobacterium species of the cells with sonic disruption method described in U.S. Patent Application No. 841,860. 3 × 10 ⁷ cells in 0.1 ml of 5% SD
Suspended in S 2 and sonicated at 50-60 ° C. for 15 minutes. 1 ml of hybridization buffer (45% diisobutyl sulfosuccinate, 40 mM phosphate buffer pH 6.8, 1 mM EDTA,
1 mM EGTA) was added and the mixture was incubated at 72 ° C. for 2 hours. After incubation, 4 ml of 2% (w / v) hydroxyapatite, 0.12 M sodium phosphate buffer
pH 6.8, 0.02% SDS, 0.02% sodium azide were added and incubated at 72 ° C for 5 minutes. Centrifuge the sample,
The supernatant was removed. 4 ml of wash solution (0.12M sodium phosphate buffer pH 6.8, 0.02% SDS, 0.02% sodium azide) was added, the sample was vortexed, centrifuged and the supernatant was removed. Radioactivity bound to hydroxyapatite was measured by scintillation counting. Table 1 shows the results
6 is shown. This result indicates that the probe was Mycobacterium tube
It is specific to the rculosis biocomplex .

[0107]

[Table 17]

Table 17 shows that the probes did not cross-react with RNA from any of the closely related organisms when tested in the manner described above.

[0109]

[Table 18]

[0110]Example 6  Sequence 5'-CCT GAT TGC CGT CCA GGT TGA GGG AAC CTT TGG G
-Using a 23S primer with a 3 'Mycobact
erium tuberculosisA composite probe was made. This
The lobe sequence was CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC.

This sequence from 23S rRNA is 38 bases in length and has a Tm
75 ° C. It hybridizes to the region corresponding to bases 2195 to 2235 of E. coli 23S rRNA.

As in the complex probe of Example 5, the sequence was characterized and the Mycobacterium tuberculosis , Mycoba
cterium africa-num and Myco such as Mycobacterium bovis
It was found to be specific for the bacterium tubercu-losis biocomplex .

In order to demonstrate the reactivity and specificity of this Example 6 probe to the Mycobacterium tuberculosis complex, it was tested as a probe in a hybridization reaction under the conditions described for the Example 5 probe. The results are shown in Table 18. The results indicate that the probe is a Mycobacterium thermostat that rare isolates do not become human pathogens.
It is specific to Mycobacterium tuberculosis Mycobacterium tuberculosis group except resisti-bile .

[0114]

[Table 19] Table 19 also shows that when tested in the manner described above, the probe did not cross-react with RNA from any phylogenetically related organism.

[0115]

[Table 20]

[0116]Example 7  The same sequence as in Example 6, ie, the sequence 5'-CCT GAT TGC CGT CCA GGT TGA GGG AAC CTT TGG G
-Has another sequence AGGCACTGTCCCTAAACCCGATTCAGGGTTC using the 23S primer with 3 'Mycobacterium tuberculosisMycobacterium tuberculosis group probe
Identified.

This sequence from 23S rRNA had a length of 31 bases and a Tm value of 71 ° C. This is the base of E. coli 23S rRNA
Hybridize to the region corresponding to 2195-2235. Similarly the sequences Mycobacterium tuberculosis complex probes of Examples 5 and 6 characterized, Mycobacterium Tube
rculosis , Mycobacterium africa-num and Mycobacteriu
It was found to be specific for the Mycobacterium tubercu-losis biocomplex such as mbovis .

To demonstrate the reactivity and specificity of this probe for the Mycobacterium tuberculosis complex,
This probe was tested as a probe in a hybridization reaction under the conditions described for the probe of Example 5. Table 20 shows that this probe is Mycobacterium tuberc
It is specific to the ulosis biocomplex .

[0119]

[Table 21]

Table 21 also shows that the probe did not cross-react with RNA from any of the closely related organisms when tested in the manner described above.

[0121]

[Table 22]

In particular, overlapping probes have the same specificity. For example, the probes of Example 6 and Example 7 may be compared.

Ex. 6 CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC Ex. 7 AGGCACTGTCCCTAAACCCGATTCAGGGTTC Multiple sequences are obtained from specific regions that result in probes having desired hybridization characteristics. In other cases, one probe sequence is significantly better than another which differs by only one base. In general, the greater the sequence difference (% mismatch) between a target organism and a non-target organism, the easier it is to denature the probe without compromising the effectiveness of the probe for a particular application. This phenomenon is also demonstrated by the probe derivative of Example 3.

The probe of Example 7 was obtained by adding 5 bases to the 5 'end of the probe of Example 6 and removing 12 bases from the 3' end. The two probes show essentially the same hybridization properties.

[0125]Example 8  Mycobacterium sp.Nocardia,Corynebacteriumas well asRh
o-dococcusEspecially difficult to distinguish. These genera are common
Has antigen, precipitin and G & C counts. These raw
The material is also 92% against the Mycobacterium organisms covered above.
Shows ~ 94% rRNA homology. However, applicants are
Without cross-reaction with related generaMycobacteriumAll of the genus
A probe was designed to detect these bacteria.

One primer complementary to 16S rRNA and 23
Using one primer complementary to S rRNA, the Mycobacterium
Four probes specific to the genus m were identified. Array 1
Was obtained using the 16S primer having the sequence 5'-TTA CTA GCG ATT CCG ACT TCA-3 '. Sequences 2, 3 and 4 were obtained using the 23S primer having the sequence 5'-GTG TCG GTT TTG GGT ACG-3 '. Sequence 1 is E.co
li Mycoba in the region corresponding to bases 1025 to 1060 of 16S rRNA
It can hybridize to RNA of the genus cteri-um. Array 2-4
Is our counting method (see Fig. 2) E.coli 23S r
It hybridizes to regions corresponding to bases 1440 to 1475, 1515 to 1555 and 1570 to 1610 of RNA, respectively.

Sequence 1. CCA TGC ACC ACC TGC ACA CAG GCC ACA AGG 2. 2. GGC TTG CCC CAG TAT TAC CAC TGA CTG GTA CGG CAC CGA ATT CGC CTC AAC CGG CTA TGC GTC ACC TC GGG GTA CGG CCC GTG TGT GTG CTC GCT AGA GGC was characterized and demonstrated to be specific for the genus Mycobacterium .

Sequence 1 derived from 16S rRNA has a length of 30 bases and a Tm
The value is 73 ° C. Sequence 2 derived from 23S rRNA has a length of 33 bases and a Tm value of 75 ° C. Sequence 3 derived from 23S rRNA has a length of 35
The base has a Tm value of 76 ° C. Sequence 4 derived from 23S rRNA has a length of 33 bases and a Tm value of 73 ° C.

Probe 1 against Mycobacterium sp.
Was used as a probe in a hybridization reaction under the following conditions to test the reactivity and specificity of The rRNA released from 30 Mycobacterium species by the ultrasonic disruption method described in U.S. Pat.
It was mixed with a ¹²⁵ I-labeled probe. 3 × 10 ⁷ cells to 0.
Suspended in 1 ml of 5% SDS and sonicated for 15 minutes at 50-60 ° C. 1 ml of hybridization buffer (45%
Diisobutyl sulfosuccinate, 40 mM sodium phosphate pH
6.8, 1 mM EDTA, 1 mM EGTA) was added and the mixture was incubated at 72 ° C. for 2 hours. After incubation, 2
ml of separation solution (2.5g / l cationic magnetic microspheres, 0.17M sodium phosphate buffer pH6.8, 7.5%
Triton X-100 (TM), 0.02% sodium azide) was added and incubated at 72 ° C for 5 minutes. The RNA: probe hybrid bound to the magnetic particles was collected and the supernatant was removed. 1 ml of washing solution (0.12 M sodium phosphate buffer p
H6.8, 14% diisobutyl sulfosuccinate, 5% triton
X-100, 0.02% sodium azide) was added, the particles were collected and the supernatant was removed. This step was repeated twice. The radioactivity bound to the magnetic particles was measured with a gamma counter. Table 22 shows the results. Table 22 shows that the probe is Mycobacteriu
It shows that hybridizing to organisms of the genus m and that all organisms of the genus can be detected by a combination of probes. Table 23 shows that the probe does not react with another closely related bacterium.

[0130]

[Table 23]

[0131]

[Table 24]

[0132]Example 9  Mycoplasma is an aerobic small bacterium without a cell wall.My
coplasma pneumoniaeProduces between 8 and 15 million infections each year
It is estimated that The infection may be asymptomatic or mild
Causes various conditions of bronchitis and pneumonia from severe to severe
Sometimes it rubs. Living organisms account for about 10% of the total population,
For long-term close contact groups, such as raw and military personnel
It is thought to cause pneumonia at a rate of 10-50%.

Previous diagnostic methods required either isolating the organism in culture or demonstrating an increase in antibody titer. To culture the organism, a specimen taken from the trachea is inoculated on an agar or biphasic medium containing a bacterial growth inhibitor. Inspect proliferation for 3-4 days and 7-10 days to confirm the presence of Mycoplasma. Mycoplasma pneum
oniae is hemadsorption tests (adhesion ability of M. pneumoniae against erythrocytes sheep or guinea pig), hemolysis test (M. pneumoniae ability to rise to β hemolysis of red blood cells of sheep or guinea pig blood agar), with specific antibodies It must be identified by growth inhibition or immunofluorescence with specific antibodies. The present invention has the advantage that, compared to any of these conventional methods, the test is simple and the time required for diagnosis is greatly reduced.

Probes specific for M. pneumoniae 5S rRNA were obtained by comparison of known rRNA sequences. M. p
neumoniae , M. galisepticum and Ureaplasma urealyt
icum (Rogers, MJ et al. , 1985, Proc. Natl. Acad. Sci.
USA , 82 (1160-1164), M. capricolum (Hori, H.
1981, Nucl. Acids Res. 9, 5407-5410) and Spir.
oplasma sp. (Walker, RT, etc., 1982 Nucl. Acids Re
s. 10, 6363-6367) were aligned. Alignment was performed as described on page 6. 5S rRNA is isolated and sequenced by the method described by Rogers et al.
Primers complementary to the conserved regions in the RNA were prepared and sequenced as described in Examples 1-4. The conserved regions of 5S rRNA are Fox, GE and Woese, CR, 1975, Nature
256: 505-507. The sequence GCTTGGTGCTTTCCTATTCTCACTGAAACAGCTACATTCGGC was determined to be specific for Mycoplasma pneumoniae .

This sequence corresponds to bases 65 to 10 of E. coli 5S rRNA.
8 in the region corresponding to 5S rRNA of Mycoplasma pneumoniae
Mycoplasma gal is complementary to the unique segment in
lisepticum , Spiroplasma mirum and Ureaplasma ureal
Selected by comparison with the 5S rRNA sequence from yticum . Oligonucleotide probes were characterized as described above. The size of the probe was 42 bases and Tm was 71.5 ° C.

To demonstrate the reactivity of this sequence against Mycoplasma pneumoniae , the probes were tested in a hybridization reaction under the following conditions. ^{The 32} P end-labeled oligonucleotide probe was mixed with 1 μg (7 × 10 ⁻¹³ mol) of purified rRNA from Mycoplasma pneumoniae , and 0.12 M PB (equimolar amounts of Na ₂ HPO ₄ and NaH ₂ PO ₄ )
The reaction was carried out at 65 ° C. for 60 minutes in 1 mM EDTA and 0.02% SDS (sodium dodecyl sulfate) to a final volume of 50 μl. In separate tubes, the probe and the hybridization buffer containing the target Mycoplasma pneumoniae and the hybridization buffer containing no target were mixed, respectively. Separation with hydroxyapatite as above and hybrids were quantified by scintillation counting. Table 24 shows the results.

[0137]

[Table 25]

This data indicates that the probe is highly reactive to homologous targets and has very low non-specific binding to hydroxyapatite.

To test the specificity of the M. pneumoniae 5S probe, a ³² P-labeled probe was mixed with rRNA released from cells of another Mycoplasma species. The hybridization assay was performed exactly as in Example 1. Table 25
Indicates that the probe is specific for Mycoplasma pneumoniae and does not react with any other Mycoplasma species.

[0140]

[Table 26]

As also shown in Table 26, the probe did not react with any other closely related or phylogenetically diverse bacterial species.

[0142]

[Table 27]

Using four unique primers complementary to the conserved region of the 16S rRNA, four additional probe sequences specific to Mycoplasmapneumoniae (sequences 2 to 5) were obtained. These sequences correspond to bases 190 to 190 of E. coli 16S rRNA, respectively.
230, 450-490, 820-860 and 1255-1290. Probe sequence 1 was obtained using a primer having the sequence 5'-GGCCGTTACCCCACCTACTAGCTAAT-3 '. Probe sequence 2
Was obtained using a primer having the sequence 5'-GTATTACCGCGGCTGCTGGC-3 '. Probe sequence 3
Was obtained using a primer having the sequence 5'-CCGCTTGTGCGGGCCCCCGTCAATTC-3 '. Probe sequence 4
Was obtained using a primer having the sequence 5'-CGATTACTAGCGATTCC-3 '. A sequencing reaction was performed as in the previous example. M. pneumoniae sequence is used for Mycoplasma genitalium , Mycoplasma capricolum ,
The sequences were compared with those from Mycoplasma gallisepticum and Spiroplasma mirum .

Probe sequence based on the criteria described in the examples of the parent application AATAACGAACCCTTGCAGGTCCTTTCAACTTTGAT 3. CAGTCAAACTCTAGCCATTACCTGCTAAAGTCATT 4. 4. TACCGAGGGGATCGCCCCGACAGCTAGTAT CTTTACAGATTTGCTCACTTTTACAAGCTGGCGAC was characterized and found to be specific for Mycoplasma pneumoniae .

Probe 2 has a length of 35 bases and a Tm value of 67 ° C. Probe 3 has a length of 35 bases and a Tm value of 66 ° C. Probe 4 has a length of 30 bases and a Tm value of 69 ° C. Probe 5 has a length of 35 bases and a Tm value of 66 ° C.

When the four probes were mixed and the hybridization assay was performed at 60 ° C. as in the previous example.
It was found to be specific for M. pneumoniae . The probe does not cross-react with any organisms shown in another respiratory pathogen or bacterial phylogenetic tree (Table 28).

[0147]

[Table 28]

[0148]

[Table 29]

Example 10 The genus Legionella contains 22 species, all of which can be human pathogenic. These organisms are responsible for Legionnaire disease, acute pneumonia, or Pontiac fever, a non-fatal acute nonpulmonary fever. Legionella species have also been found to be the cause of hospital pneumonia, which mainly affects debilitated patients.

Le containing Legionnaire disease and Pontiac fever
Gionellosis can be diagnosed based on clinical symptoms by direct or indirect fluorescent antibody tests and culture with buffered charcoal yeast extract (BCYE) agar containing selective antimicrobial agents. In the prior art, there is no method to determine the species in one test (Bergey's Manual of Systematic Bacte
riology, p. 283 (1984)). Fluorescent antibody testing cannot identify all species of Legionella , but only a small number of species in which the antibody is present. Culture method
It is not a definitive diagnostic method for Legionella species.

The oligonucleotide sequences described below, when used as probes in nucleic acid hybridization assays, accurately identify all species of Legio-nella . This assay is more sensitive than culture or antibody tests and significantly reduces the identification time and thus the diagnostic time. Therefore, this assay can be considered as a significant improvement over conventional diagnostic methods.

The 3 complementary to the conserved regions of 16S and 23S rRNA
Legionel by using two unique primers
Three probe sequences specific to la species were obtained.

Sequence 1 was obtained by using the 16S primer with the sequence 5'-TCT ACG CAT TTC ACC GCT ACA C-3 '. Probe sequence 2 was obtained by using the 23S primer with the sequence 5'-CAGTCA GGA GTA TTT AGC CTT-3 '. Probe sequence 3 was obtained by using a 16S primer having the sequence 5'-GCT CGT TGC GGG ACT TAA CCC ACC AT-3 '. The sequencing of these primers was performed in the same manner as in the previous examples.

The following three sequences were characterized by the criteria described in Example 1 and proved to be specific to the genus Legionella . The phylogenetically closest Escherichia coli , for comparison with sequences from Legionella species,
Pseudomonas aeruginosa , Vibrio parahaemolyticus and Acinetobacter calcoaceticus were used.

[0155] 1. 1. TACCCTCTCCCATACTCGAGTCAACCAGTATTATCTGACC 2. GGATTTCACGTGTCCCGGCCTACTTGTTCGGGTGCGTAGTTC Sequence 1 derived from CATCTCTGCAAAATTCACTGTATGTCAAGGGTAGGTAAGG 16S rRNA has a length of 40 bases and a Tm value of 72 ° C. Sequence 2 derived from 23S rRNA has a length of 42 bases and a Tm value of 73 ° C.
It is. Sequence 3 derived from 16S rRNA has a length of 40 bases and a Tm value of
68 ° C. Each of these sequences corresponds to 6 of the E. coli 16S rRNA.
30-675, 350-395 of E. coli 23S rRNA and E. coli 23
Legionella R in the region corresponding to 975 to 1020 of S rRNA
Can hybridize to NA. Mixing these probes together gives an average Tm value of 73 ° C. Analysis on a polyacrylamide gel revealed that each probe had the correct length, and sequence analysis demonstrated that each had the correct base sequence.

[0156] The use of three probes were mixed hybridization assays, these probes Legi
onella (Tables 29 and 3
0), was found not to cross-react with any organism selected from another respiratory pathogen or phylogenetic tree (Table 31)
And 32). The use of more than one probe or probe mixture increases assay sensitivity and / or increases the number of non-viral organisms to be detected.

[0157]

[Table 30]

[0158]

[Table 31]

By utilizing two primers complementary to the conserved region of 23S rRNA, three more Legionella- specific sequences (4-6) were obtained. Sequence 4 was obtained from a 23S primer having the sequence 5'-CCT TCT CCC GAA GTT ACG G-3 '. Probe sequences 5 and 6 were derived from the 23S primer having the sequence 5'-AAG CCG GTT ATC CCC GGG GTA ACT TTT-3 '. Sequencing using these primers was performed as in the previous example.

Based on the above criteria, the following three sequences were characterized and proved to be specific to the genus Legionella . Phylogenetically closest Escherichia coli , Pseudomona for comparison with sequences from Legionella species
aeruginosa , Vibrio parahaemolyticus and Acinetoba
cter calcoaceticus was used.

[0161] 4. GCG GTA CGG TTC TCT ATA AGT TAT GGC TAG C GTA CCG AGG GTA CCT TTG TGC T 6. CAC TCT TGG TAC GAT GTC CGA C E. coli 23S rRNA 2 in the region corresponding to bases 1585 to 1620
Probe 4 complementary to 3S rRNA has a length of 31 bases and a Tm value of 67.
° C. Probe 5 complementary to 23S rRNA in a region corresponding to bases 2280 to 2330 of E. coli 23S rRNA has a length of 22 bases.
The Tm value is 66 ° C. Probe 6 complementary to 23S rRNA in the same region as probe 5 has a length of 22 bases and a Tm value of 63 ° C.

When the three probes were mixed with the above probe 3 and subjected to a hybridization assay as described in probes 1 to 3, these probes became Legionel
It was specific to the genus la (Table 33) and did not cross-react with any other respiratory pathogen or any selected organism from the phylogenetic tree (Tables 34 and 35). The use of more than one probe, ie, a mixture of probes, increases assay sensitivity and / or increases the number of non-viral organisms detected.

[0163]

[Table 32]

[0164]

[Table 33]

[0165]Example 11  Chlamydia is a gram-negative, immobile, obligate
It is an endoplasmic bacterium.C.trachomatisSpecies are endemic tigers
Coma (the most common form of preventable visual impairment), encapsulated
It is associated with somatitis and gonorrhea lymphogranulomas (LGV). This
Bacteria are the leading cause of nongonococcal urethritis in men and
It also causes cervicitis and acute salpingitis. Infectious birth canal
Eye disease or chlamydial pneumonia develops in the newborn infant who goes.

Several methods are known for identifying C. trachomatis in the genitourinary tract, such as, for example, indirect immunofluorescence staining of clinical specimens or enzyme immunoassays. However, the method of choice is culturing the organism in cycloheximide-treated McCoy cells. The cell culture is then confirmed morphologically or by fluorescent antibody staining to identify the organism.

The oligonucleotide sequences of the invention described below correctly identify Chlamydia trachomatis isolates when used as probes in nucleic acid hybridization assays. This assay test has the same sensitivity as a culture test or an antibody test, and significantly reduces the time required for identification and therefore the time required for diagnosis as compared to the culture test.

The use of probes to identify and identify each species belonging to a species has novelty and inventive step in the present invention. In fact, Kingsbury, DT & E. Weiss, 1968
J. Bacteriol . 96: 1421-23 (1968); Molder, J.
W., ASM News, vol.50, No.8, (1984) is C.trachomatis
And 10% DNA homology between C.psittacis . Furthermore, these reports indicate that DNA homology is different in different C. trachomatis strains. Weisbe
rg, WG, etc. J.Bactriol .167: at 570-574 (1986), announced the 16S rRNA sequence of C.psittaci, C.trachomati
It was pointed out that s and C.psittaci share more than 95% rRNA homology. From these reports, (1) a probe capable of hybridizing to all strains of C. trachomatis , and
(2) It was predicted that it would be difficult to prepare a probe that could distinguish between C.trachomatis and C.psittaci . The following probes can serve both purposes.

The 7 complementary to the conserved regions of 16S and 23S rRNA
Chlamydia trachomati using two unique primers
s- specific probe sequences were generated. Probe sequence 1
Was obtained from the 16S primer having the sequence 5'-TCT ACG CAT TTC ACC GCT ACA C-3 '. Probe sequence 2 was derived from a 16S primer having the sequence 5'-CCG CTT GTG CGG GCC CCC GTC AAT TC-3 '. Sequences 3 and 4 were obtained from the 16S primer having the sequence 5'-GGC CGT TAC CCC ACC TAC TAG CTA AT-3 '. Probe sequences 5 and 6 were derived from a 23S primer having the sequence 5'-CTTTCCTCCGCGTA-3 '. Probe sequences 7 and 8 were derived from a 23S primer having the sequence 5'-CCT TCT CCC GAA GTT ACG G-3 '. Probe sequence 9 was derived from a 23S primer having the sequence 5'-TCG GAA CTT ACC CGA CAA GGA ATT TC-3 '. Probe sequence 10 was obtained with a primer having the sequence 5'-CTA CTT TCC TGC GTC A-3 '.

The following ten sequences were characterized using the criteria of Example 1 and proved to be specific for Chlamydia trachomatis rRNA. A phylogenetically related Chlamydia psitta for comparison with Chlamydia trachomatis
Used ci .

[0171] 1. CCG ACT CGG GGT TGA GCC CAT CTT TGA CAA 2. 2. TTA CGT CCG ACA CGG ATG GGG TTG AGA CCA TC CCG CCA CTA AAC AAT CGT CGA AAC AAT TGC TCC GTT CGA 4. CGT TAC TCG GAT GCC CAA ATA TCG CCA CAT TCG 5. CAT CCA TCT TTC CAG ATG TGT TCA ACT AGG AGT CCT GAT CC GAC GTC GGT CTT TCT CTC CTT TCG TCT ACG 7. CCG TTC TCA TCG CTC TAC GGA CTC TTC CAA TCG 8. CGA AGA TTC CCC TTG ATC GCG ACC TGA TCT CCG GGG CTC CTA TCG TTC CAT AGT CAC CCT AAA AG 10. TAC CGC GTG TCT TAT CGA CAC ACC CGC G 16S Sequence 1 derived from rRNA has a length of 30 bases and a Tm value of 66 ° C. Sequence 2 derived from 16S rRNA has a length of 32 bases and a Tm value of 67 ° C.
It is. Sequence 3 derived from 16S rRNA has a length of 39 bases and a Tm value of
70 ° C. Sequence 4 derived from 16S rRNA has a length of 33 bases and Tm.
The value is 69 ° C. Sequence 5 derived from 23S rRNA has a length of 41 bases and a Tm value of 71 ° C. Sequence 6 derived from 23Sr RNA has a length of 30 bases and a Tm value of 72 ° C. Sequence 7 from 23S rRNA is long
33 bases and a Tm value of 72 ° C. Sequence 8 derived from 23S rRNA has a length of 30 bases and a Tm value of 71 ° C. Sequence 9 from 23S rRNA is 35 bases in length and has a Tm value of 74 ° C. Array 10 has a length of 28
Base and Tm values are 72 ° C.

Hybridization of probe reactivity and specificity
Tested in an issay assay. ³²P-end label
The oligonucleotide probes 1 and 2 were purified RNA or
At least 10⁷RNA released from individual organisms and 0.55 ml of 41%
Diisobutyl sulfosuccinate, 3% sodium dodecyl sulfate
Lumium, 0.03M sodium phosphate pH6.8, 1mM EDTA,
60 ° C (probe 1) or 64 ° C (probe 1mM EGTA)
The mixture was mixed for 1 hour in 2). As in the previous embodiment, the hybrid
Bound to hydroxyapatite and the bound radioactivity
Was measured by scintillation counting. table
36 is probe 1 and 2C.trachomatisAll of
Shows sufficient hybridization to the serotype. Professional
Probe 1 is testedC.psittaciReacts completely with any strain of
Probe 2 does not react with the two strains. Probe 2
Are organisms with known human infectivityC.psittaciHinoki
Reacts with azalea polyarthritis strain. Table 37 shows the mixed use
When¹²⁵Reactivity of I-labeled probes 3-9 and
Shows specificity. In this case, the hybrid was purchased on March 2, 1987.
As described in U.S. Patent No. 020866 to Arnold et al.
Attached to cationic magnetic particles. These probes are
ExaminationC.trachomatisHybrida enough for all strains of
IsC.psittaciHybridizes with any strain of
Absent. In addition, probes 3 to 9 are normally detected in the genitourinary tract
Set of organisms (Table 38) and phylogenetic crosses of organisms
Tested against section (Table 39). In any case
In addition, the probe was found to be specific. Plow
Bu 10C.psittaci25% heterologous toC.trachomatisTo
Specific.

[0173]

[Table 34]

[0174]

[Table 35]

[0175]

[Table 36]

[0176]

[Table 37]

[0177]Example 12  Campylobacter is a mobile, microaerobic, gram-negative song
Bacilli. This genus is so diverse that it
Notably different. This genus is a well-defined but
Some corrections were made at Bell (Romaniuk, P.J., etc.J.Ba
ctriol.169: 2137-2141 (1987)). Three Campylobact
er species,Campylobacter jejuni,C.colias well asC.laridis
Causes human enteritis. The disease is diarrhea, fever, vomiting
It is accompanied by symptoms such as nausea, abdominal pain, and in some cases vomiting. This
These three organisms cause 2 million infections each year in the United States
(Estimated value is Salmonella which induced diarrheal disease)
And Shigella numbers). Another fungus in this genus is human
It causes sepsis and abortion and infertility of sheep and cattle.
You.

Current methods for diagnosing Campylobacter enteritis include procedures in which an organism is grown and isolated by culture and subjected to a number of biochemical tests. Optimal growth of Campylobacter requires special conditions such as low oxygen pressure and high temperature (42 ° C). Combination of one condition is all Campylobac
It is not preferred for propagation of ter species.

[0179] The following oligonucleotide sequences to be used in a hybridization assay appropriate Campylob
Hybridizes to 16S rRNA of acter species. The present invention
It has significant advantages over traditional Campylobacter detection methods. It is because one probe can detect all relevant Campylobacter remaining two probes intestine Campylobacte
This is because r can be detected and one can detect a human isolate of Campylobacter . Furthermore, the probe of the present invention has the advantage that the assay is easier and the identification time and thus the diagnosis time are greatly reduced as compared with the conventional method.

Using three unique primers complementary to the 16S rRNA, four probes were prepared that hybridized to the 16S rRNA of the relevant Campylobacter species. Sequences 1 and 2 were generated using a 16S rRNA primer having the sequence 5'-GTA TTA CCG CGG CTG CTG GCA C-3 '. Sequence 3 was generated using a 16S primer having the sequence 5'-CCG CTT GTG CGG GCC CCC GTC AAT TC-3 '. Sequence 4 was generated using a 16S rRNA primer having the sequence 5'-GCT CGT TGC GGG ACT TAA CCC AAC AT-3 '.

The following sequences were characterized and used to determine Campylobacter je
It has proven to hybridize to juni , C.coli and C.laridis . The phylogenetically closest Vibrio parahae
Campylocact moly ticus and Wollinella succinogenes
Used for comparison with the er sequence.

[0182] 1. CGC TCC GAA AAG TGT CAT CCT CC 2. 2. CCT TAG GTA CCG TCA GAA TTC TTC CC GCC TTC GCA ATG GGT ATT CTT GGT G GGT TCT TAG GAT ATC AAG CCC AGG Sequence 1 derived from 16S rRNA is 23 bases in length and has a Tm value of 65 ° C. Sequence 2 derived from 16S rRNA has a length of 26 bases and a Tm value of
64 ° C. Sequence 3 derived from 16S rRNA has a length of 25 bases and Tm.
The value is 66 ° C. Sequence 4 derived from 16S rRNA has a length of 24 bases and a Tm value of 61 ° C. Sequence 1 is capable of hybridizing to the region corresponding to bases 405 to 428 of E. coli 16S rRNA.
Sequence 2 can hybridize to the region corresponding to bases 440 to 475 of E. coli 16S rRNA. Sequence 3 is E. coli 16S rRN
It can hybridize to the region corresponding to bases 705 to 735 of A. Sequence 4 is capable of hybridizing to the region corresponding to bases 980-101 of E. coli 16S rRNA.

The reactivity and specificity of the Campylobacter probes were tested in a hybridization assay. ³²
P-terminally labeled oligonucleotide probes and purified RNA or RNA released from cells were mixed in 0.1% sodium dodecyl sulfate. 0.5 ml of hybridization solution (41% diisobutyl sulfosuccinate, 30 mM sodium phosphate pH 6.8, 0.7% sodium dodecyl sulfate, 1 mM
EDTA, 1 mM EGTA) was added and the mixture was incubated at 60 ° C. for 1-1.5 hours. After incubation, 2 to 2.
5 ml of separation solution (2% hydroxyapatite, 0.12 M sodium phosphate pH 6.8, 0.02% sodium dodecyl sulfate) were added and the mixture was incubated at 60 ° C. for 5 minutes. The specimen was centrifuged and the supernatant was removed. 2.5 ml of washing solution (0.12M sodium phosphate pH 6.8, 0.02% sodium dodecyl sulfate) was added, the sample was stirred, centrifuged, and the supernatant was removed. Radioactivity bound to hydroxyapatite was measured by scintillation counting.

Table 40 corresponds to the probe.Campylobacter
seed,C.jejuni,E.colias well asC.laridisHybrid enough
Indicates to soy. Probe 1 is testedCampylobacte
rDetect all species and probe 2 and 4Campylob
acterProbe 3 was isolated from bovine
CreatureC.sputorumOther thanCampylobacterAll the seeds
To detect. Therefore, all probes were used in Campyl
Effective for bacterium identification. Use for other purposes
Which probe to select depends on the desired level of specificity
(Ie, intestinal Campylobacter or all
Campylobacterseed).

[0185]

[Table 38]

Table 41 shows that the probe does not hybridize to related organisms or organisms detected in the gastrointestinal tract.

[0187]

[Table 39]

Further testing of the intestinal Campylobacter- specific probes, Probes 2 and 4, showed that they did not react with rRNA from other organisms detected in the gastrointestinal tract.

[0189]

[Table 40]

[0190]Example 13  Streptococcus is gram positive, oxidizer
It is a zeta negative coccus. This genus is based on group-specific carbohydrates.
And are classified into 18 groups A to R. Streptococcu in group D
s is also enterococcus (enterococcus) (S.faecium,S.faec
alis,S.aviumas well asS.gallinarum) And non-enterococcus
(S.bovisas well asS.equinus).S.faecium
,S.faecalisas well asS.aviumIs a medically important enterococ
cus. Some Streptococcus species
Is a human pathogen. In addition, normal flow in the oral cavity and intestine
But can cause disease if introduced into another site.
Some are. Two examples areS.faeciumas well asF.faecalis
These are commonly found in the intestine, but are bacteremia,
Infections can occur, with urinary tract infections as high as 10% in the United States.
You.

Current methods of detecting enterococcus require that the specimen be cultured for 18-72 hours and a series of biochemical tests performed. The following oligonucleotide sequences, when used in a hybridization assay, produce Streptococcus faecal
Detects is , S.avium and S.faecium accurately. The probe of the present invention is another Stre closely related to DNA homology.
Does not cross-react with ptococcus or Staphylococcus (Ki
epper-Baez, 1981, 1982, Sch-liefer 1984). The present invention also reduces the number of tests required on the specimen, thus greatly reducing the time required for identification or diagnosis. This is a significant advantage over conventional methods.

The probe sequence was identified using a primer complementary to the 16S rRNA having the sequence 5'-CCG CTT GTG CGG GCC CCC GTC AAT TC-3 '. Characterizing the following sequence,
enterococcus, ie S.faecium , S.faecalis and S.avium
Was found to be specific to For comparison with the relevant sequence, phylogenetically closest S.agalactiae , S.bovi
s , S. pneumoniae and S. pyogenes were used.

1. TGC AGC ACT GAA GGG CGG AAA CCC TC
The C AAC ACT TA sequence has a length of 35 bases and a Tm value of 72 ° C. This sequence is E.co
li 16S rRNA can hybridize to the region corresponding to bases 825 to 860. Probes were used in hybridization assays with purified RNA or RNA released from cells to demonstrate the reactivity and specificity of the probe. at least
10 ⁷ cells were agitated in the presence of glass peas in 2% sodium dodecyl sulfate. 0.1m suspension of 0.1ml
l of hybridization buffer (0.96M sodium phosphate pH6.8, 0.002M EDTA, 0.002M EGTA) and incubated at 65 ° C for 2 hours. After incubation, 5 ml of hydroxyapatite, 0.12 M sodium phosphate pH 6.8, 0.02% sodium dodecyl sulfate was added and the mixture was incubated at 65 ° C for 10 minutes. The specimen was centrifuged and the supernatant was removed. 5 ml of washing solution (0.12 M phosphate buffer pH 6.8, 0.02% sodium dodecyl sulfate) was added, the sample was stirred, centrifuged, and the supernatant was removed. The amount of radioactivity bound to hydroxyapatite was determined by scintillation counting. Table 43 shows that the probe is S.fa
Reacts well with ecium , S.faecalis and S.avium and does not react with other related organisms.

[0194]

[Table 41]

[0195]Example 14  Pseudomonas is a gram-negative, non-spore-forming, non-fermentable rod
It is a fungus. Pseudomonas live in the soil and underwater and are healthy
It is rarely transmitted to humans. For those who are already weak
This organism then has various clinical manifestations, such as wound infections,
Postoperative infection, sepsis, childhood diarrhea and respiratory and urinary tract infections
Can occur. Because this organism is resistant to antibioticsPseu
domonasIt is particularly important to identify each genus of bacteria in clinical specimens.
It is important. Based on the study of nucleic acid homology, the genera belonged to RNA groups
Are classified into five homologous groups.Pseudomo
nas83% of all clinical isolates are from RNA group I
And so farPseudomonas aeruginosaIs the most
Separated.

Current methods of detecting Pseudomonas require that a patient sample be cultured for 24-72 hours, followed by a series of biochemical tests. The following oligonucleotide sequences detect clinically significant group I Pseudomonas when used in hybridization assays. The present invention reduces the number of tests performed on a specimen and reduces the time required for detection. This is a significant advance over conventional methods.

A sequence was generated using primers complementary to the conserved region of 23S rRNA having the sequence 5'-CTT TCC CTC ACG GTA-3 '. The following sequence was found to detect Group I Pseudomonas:

1. CAG ACA AAG TTT CTC GTG CTC CGT CC
The T ACT CGA TT probe has a length of 35 bases and a Tm value of 70 ° C. The probe is
In the region corresponding to bases 365 to 405 of E. coli 23S rRNA, I
It can hybridize to RNA of group Pseudomonas . Used in hybridization assays to prove probe reactivity and specificity. ³² P-end-labeled oligonucleotide RN liberated from at least 10 ⁷ cells
A was mixed in a standard manner in 0.48 M sodium phosphate pH 6.8, 1% sodium dodecyl sulfate, 1 mM EDTA, 1 mM EGTA) and incubated at 65 ° C. for 2 hours. After incubation, the RNA: DNA hybrids were bound to hydroxyapatite as described in the previous example, and the bound radioactivity was measured by scintillation counting. Table 44 shows that the probe responded well to all eight species of Group I Pseudomonas tested. The probe did not react with RNA from group II or group V organisms. Group III organism Pseudomonas acidovor representing less than 1% of all non-fermentative Bacillus isolates from clinical specimens
Reaction with ans was small. Table 45 shows that the probe did not respond to other closely related organisms tested.

[0199]

[Table 42]

[0200]Example 15  Examples 15 to 18EnterobacteriaceaeProbe
Will be described. These organisms are all at the DNA level
Is closely related. Differences at the rRNA level are even smaller. An example
For example,Proteus vulgaris 16S rRNA isE.coli95% homologous to
It is. These factors are specific to this group of organisms.
This suggests that the production of a suitable rRNA probe is difficult.
However, weEnterobacter cloacae,Proteu
s mirabilis,Salmonellaas well asE.coliMake a probe
Made.

[0201] Enterobacter spp organisms, Enterobacteria
It is a mobile , gram-negative, non-spore-forming bacillus belonging to the ceae family. This genus is a large heterogeneous group. 8
One species has been defined, but five are clinically important. Enterobacter cloacae and E. aerogenes are the most abundant isolates and are associated with human genitourinary, lung, blood, central nervous system and soft tissue infections.

Current methods of identifying Enterobacter cloacae from patient specimens include culturing the specimens on agar plates for 18-24 hours and performing a series of biochemical tests. When following oligonucleotide sequence is used as a probe for nucleic acid hybridization assays, Enterobacter
cloacae is accurately identified. The present invention reduces the number of tests performed on the specimen and reduces the time required for identification and therefore the time required for diagnosis. This is a significant improvement over the conventional method.

An Enterobacter cloacae- specific probe was obtained using primers complementary to the conserved region of the 23S rRNA having the sequence 5'-CAG TCA GGA GTA TTT AGC CTT-3 '.

Sequence 1. GTG TGT TTT CGT GTA CGG GAC TTT CAC CC was characterized and proved to be specific to E. cloacae . For comparison with the sequence of E. cloacae , phylogenetically closest organisms Escherichia coli , Klebsiella pneum
oniae , Proteus vulgaris , Salmonella enteritidis and Citrobacter freundii .

The probe has a length of 29 bases and a Tm of 68 ° C.
The probe can hybridize to E. cloacae RNA in the region corresponding to bases 305-340 of E. coli 23S rRNA.
This was used in hybridization assays to demonstrate the reactivity and specificity of the probe for E. cloacae . ³² P end-labeled oligonucleotide probe at least 10 ⁷ 1% sodium dodecyl sulfate and liberated RNA from the organism were mixed in 0.48M sodium phosphate pH 6.8 (final volume 0.2 ml), 2 hours at 60 ° C. Incubated. After incubation, 5 ml of 2% hydroxyapatite, 0.12 M sodium phosphate pH 6.8, 0.02%
Sodium dodecyl sulfate was added and the mixture was incubated at 60 ° C. for 10 minutes. The specimen was centrifuged and the supernatant was removed. 5 ml of washing solution (0.12 M sodium phosphate pH 6.8, 0.02
% Sodium dodecyl sulfate), stir the sample,
After centrifugation, the supernatant was removed. The amount of radioactivity bound to hydroxyapatite was determined by scintillation counting. The results are shown in Table 46. Table 46 shows that the probe is E.
Reacts well with cloacae and does not react with RNA from related organisms.

[0206]

[Table 43]

Table 47 shows that the probe does not react with the RNA of the organism detected in urine.

[0208]

[Table 44]

[0209]Example 16  Proteus organismsEnterobacteriaceaeEasy to belong to a tribe
It is a dynamic, gram-negative, non-spore-forming bacillus. Four
ProteusSpecies are known, of which three are:Prot
eusmirabilis,P.vulgarisas well asP.penneriIs a human disease
Cause.

[0210] The most common type of proteus infection occurs in the urethra, but also sepsis, pneumonia, and wound infections. Proteus
mirabilis is the most commonly isolated species, accounting for 10% of acute simple urinary tract infections. Due to differences in antibiotic susceptibility between species, it is desirable to identify the etiological organism at the species level rather than the genus level.

The current method of identifying Proteus mirabilis from patient specimens involves culturing the specimens on agar plates for 18-24 hours followed by a series of biochemical tests.
When the following oligonucleotide sequence is used as a probe for nucleic acid hybridization assays, Proteu
Identify s mirabilis accurately. The present invention reduces the number of tests performed on the specimen and reduces the time required for identification and therefore the time required for diagnosis. This is a significant improvement over the conventional method.

A Proteus mirabilis- specific probe was obtained using primers complementary to the conserved region of the 23S rRNA having the sequence 5'-CAG TCA GGA GTA TTT AGC CTT-3 '.

Sequence 1. CCG TTC TCC TGA CAC TGC TAT TGA TTA AGA CTC was characterized and proved to be specific for P. mirabilis .

For comparison with the sequence of Proteus mirabilis , the phylogenetically closest organism Escherichia coli ,
Klebsiella pneumoniae , Proteus vulgaris , Salmonel
la enteritidis and Citrobacter freundii were used.

[0215] This probe is composed of base 2 of E. coli 23S rRNA.
It can hybridize to P. mirabilis RNA in the region corresponding to 70-305. The probe is 33 bases long and has a Tm value of 66 ° C.
It is. This was used in hybridization assays to demonstrate the reactivity and specificity of the probe for P. mirabilis . ³² P end-labeled oligonucleotide probes and RNA released from at least 10 ⁷ organisms
And 1% sodium dodecyl sulfate, 0.48M sodium phosphate pH 6.8, 1mM EDTA, 1mM EGTA (final volume
0.2 ml) and incubated at 64 ° C. for 2 hours. After incubation, 5 ml of 2% hydroxyapatite, 0.12
M sodium phosphate pH 6.8, 0.02% sodium dodecyl sulfate was added and the mixture was incubated at 64 ° C for 10 minutes. The specimen was centrifuged and the supernatant was removed. 5 ml of washing solution (0.12 M sodium phosphate pH 6.8, 0.02% sodium dodecyl sulfate) was added, the sample was stirred, centrifuged, and the supernatant was removed. The amount of radioactivity bound to hydroxyapatite was determined by scintillation counting. The results are shown in Table 48. Table 46 shows that the probe reacted well with P. mirabilis and not with the other 27 related organisms. Table 49 shows a test performed in the same manner as in Table 48.
Does not react with phylogenetically diverse organisms and two yeasts.

[0216]

[Table 45]

[0219]

[Table 46]

Example 17 An organism belonging to the genus Salmonella is a mobile , gram-negative, non-spore-forming bacillus belonging to the family Enterobacteriaceae . All Salmonellae are so closely related that some scholars consider these organisms to be a species. Nucleic acid homology studies identify and differ in five subgroups
1400 serotypes became known. All serotypes are involved in human intestinal diseases ranging from mild self-limiting gastroenteritis to severe gastroenteritis with bacteremia, and potentially life-threatening Typhoid fever. S.cholerasuis , S.paratyphi A &
S.typhi is the serotype most associated with severe illness and bacteremia. Diagnosis of Salmonella- induced enteritis depends on the detection of organisms in stool specimens. Because infections are mainly caused by the intake of contaminated milk, food and water, a method to identify Salmonella in these substances is essential before these products can reach the consumer.

[0219] Current methods of detecting organisms of the genus Salmonella include procedures in which the specimen is cultured for 1-3 days in a selective medium and a series of biochemical tests are performed. Salmonel in clinical specimens or food
An enrichment step is often required to separate la. The following oligonucleotide sequences, when used as a probe for nucleic acid hybridization assays, Salmon
Accurately identify each strain of the genus ella . The probes of the present invention are specific to all strains of the genus and have other closely related Enterobacteria
Does not react with genus ceae . The probe of the present invention reduces the number of tests performed on the specimen and reduces the time required for identification and hence the time required for diagnosis. This is a significant improvement over the conventional method.

A Salmonella- specific probe was obtained using two primers complementary to 16S and 23S rRNA. Sequence 1 was obtained using a 16S primer having the sequence 5 'TTA CTA GCG ATT CCG ACT TCA 3'. Sequence 2 was obtained using a 23S primer having the sequence 5 'CAG TCA GGA GTA TTT AGC CTT 3'.

Sequence 1. CTC CTT TGA GTT CCC GAC CTA ATC GCT GGC 2. CTC ATC GAG CTC ACA GCA CAT GCG CTT TTG TGT A was characterized and proved to be Salmonella specific.

Sequence 1 derived from 16S rRNA has a length of 30 bases and a Tm
The value is 73 ° C. Sequence 2 derived from 23S rRNA has a length of 34 bases and a Tm value of 71 ° C. These probes are E. coli 16S
It can hybridize to regions corresponding to bases 1125 to 1155 of rRNA and bases 335 to 375 of 23S rRNA. To demonstrate the reactivity and specificity of Probe 1 for each strain of Salmonella , a ³² P end-labeled oligonucleotide probe was used as a probe in the hybridization reaction. Purified RNA or at least 10 ⁷ organisms from free by standard methods RNA was 1 ml of hybridization buffer (final concentration 43% sulfosuccinic acid diisobutyl, 60 mM sodium phosphate pH6.8,1mM EDTA, 1mM EGTA) was mixed with, Incubated at 72 ° C for 2-12 hours. After incubation, 5 ml of a separation solution (2% hydroxyapatite, 0.12 M sodium phosphate pH 6.8, 0.02% sodium dodecyl sulfate) was added, the sample was mixed, and the mixture was heated to 72 ° C.
For 5 minutes, centrifuged, and the supernatant was removed.
4 ml washing solution (0.12M sodium phosphate pH6.8, 0.02%
Sodium dodecyl sulfate) was added, the sample was stirred, centrifuged, and the supernatant was removed. The amount of radioactivity bound to hydroxyapatite was determined by scintillation counting. The results in Table 50 show that two probes used
Shows that it hybridized to the Salmonella subgroup and all 31 serotypes tested.

[0223]

[Table 47]

[0224]

[Table 48]

[0225] The specificity of the probe to Salmonella spp organisms was demonstrated with hybridization reactions containing RNA derived from Salmonella closely organism. The results are shown in Table 51.

[0226]

[Table 49]

Table 52 shows that Salmonella probes 1 and 2 do not hybridize to phylogenetically diverse organisms.

[0228]

[Table 50]

Example 18 Escherichia coli is a gram-negative, non-spore-forming bacillus belonging to the genus Enterbacteriaceae . Five Escheric
hia species, i.e., a clinical isolate E.coli及<br/> beauty E.hermanii account for more than 99% of the strains, E.blattae, E.vulneris, E.fergusonii
It has been known. E. coli is the leading cause of urinary tract infections, bacteremia and neonatal meningitis, also known as traveler's diarrhea.
It is the cause of some gastroenteritis.

The current method of identifying E. coli from patient specimens involves culturing the specimens on agar plates for 18 to 72 hours and performing a series of biochemical tests on the isolated colonies. The following oligonucleotide sequences correctly detect E. coli in the presence of other organisms when used as probes in nucleic acid hybridization assays. The present invention reduces the number of tests performed on the specimen and reduces the time required for identification and therefore the time required for diagnosis. This is a significant improvement over prior art methods.

E. coli- specific probes can be prepared using known E. coli sequences (Brosius et al. , Proc. Natl. Acad. Sci. USA . 75:
4801-4805 (1978)), and Proteus vu for comparison.
lgaris (Carbon et al. , Nuc. Acids Res. 9: 2232-2333 (19
81)), Klebsiella pneumoniae , Salmonella enterit
idis, Enterobacter gergoviae and Citrobacter freund
ii was used. The probe sequence is shown below.

[0232] 1. GCA CAT TCT CAT CTC TGA AAA CTT CCG TGG Probe is an E. coli RNA in the region 995-1030 of 16S rRNA
Hybridize to The probe is 30 bases in length and has a Tm value of 66 ° C. This probe was used in a hybridization assay to test the reactivity and specificity of the probe for E. coli . ³² P-end labeled oligonucleotide probe and sequence 5'-TGG ATG TCA AGA CCA
GGT AAG GTT CTT CGC GTT GCA TCG-3 'and sequence 5'
-CTG ACGACA GCC ATG CAG CAC CTG TCT CAC GGT TCC C
Two unlabeled oligonucleotides having GA AGG CA-3 'and purified RNA or detergent and RNA released from cells by heating were combined with 1% sodium dodecyl sulfate (SD
S), 0.48M sodium phosphate pH 6.8, 1mM EDTA, 1mM
Mix in EGTA (0.2 ml final volume) and incubate at 60 ° C for 2 hours. After incubation, 5 ml of 2%
Hydroxyapatite, 0.12M sodium phosphate pH 6.
8, Add 0.02% sodium dodecyl sulfate and mix
Incubated at 0 ° C. for 10 minutes. The specimen was centrifuged and the supernatant was removed. 5 ml of washing solution (0.12 M sodium phosphate p
H6.8, 0.02% sodium dodecyl sulfate) was added, the sample was agitated, centrifuged, and the supernatant was removed. The amount of radioactivity bound to hydroxyapatite was determined by scintillation counting.

This probe can be used, for example, in E. coli in urine specimens.
Used to detect Table 53 shows that the probe detected seven of the eight E. coli strains tested. The probe is also an organism E.ferg , which is rarely detected in urine
Reacts with usonii .

Table 54 shows that the probe does not react with another organism, a genus other than Shigella , which is rarely isolated in urine. These results indicate that the probe was E.
Indicates that it is effective for detecting E. coli .

[0235]

[Table 51]

[0236]

[Table 52]

[0237]Example 19  Bacteria are the morphological and morphological elements that exist in most natural environments.
And phylogenetically diverse groups of unicellular organisms
You. Many bacteria are harmless or harmful to the environment or the host.
Benefits, but some are harmful and pathogenic. A place
(For example, medium, medicine, or blood, urine, or cerebrospinal fluid)
Bacteria in tissue fluids and tissue biopsies)
Not good or an indicator of illness. For drinking water, food, etc.
Low levels of bacteria in other substances such as
Is accepted. Therefore, detect and quantify the bacteria in the sample
Means are needed. Detect and detect all bacteria in the sample
Current methods for determining and quantifying
It is necessary to culture in many types of media under the air condition.
All bacteria can be detected or quantified in one test
The test method is not known to date. The following oligonuc
Reotide sequence used in hybridization assays
The phylogenetic cross-section
Detect rear. The present invention reduces the number of tests performed and
Reduce the time required for essay. C obtained from an unknown sample
To compare hybridization to a set of standards
Therefore, the number of bacteria present can be quantified to some extent. this
Is a significant improvement over the prior art.

A bacterial probe was designed by examining the known rRNA sequence and the sequence determined by Gen-Probe. The sequence used for comparison was Agrobactrium tumefac
iens (Yang et al., Proc . Natl . Acad . Sci . USA , 82: 4443
(1985), Anacystis nidulans (Tomioka and Sugiura, M
ol.Gen.Genet. 191: 46 (1983), Douglas and Doolittle
, Nuc. Acids. Res. 12: 3373 (1984), Bacillus subtilis.
(Green et al., Gene 37: 261 (1985), Bacillus stearoth
ermophilus (Kop et al., DNA 3: 347 (1984), Bacteroides
fragilis (Weisburg et al. , J. Bacteriol. 164: 230 (1985),
Chlamydia psittaci (Weisburg et al. , J. Bacteriol. 167: 5
70 (1986), Desulfovibrio desulfuricans (Oyaizu and W
oese, System.Appl.Microbiol . 6: 257 (1985), Esche
richia coli (Brosius et al . , Proc. Natl. Acad. Sci.US
A. 77: 201 (1980), Flavobactriumheparinum (Weisbur
g . , J. Bacteriol. 164: 230 (1985), Heliobacterium ch.
lorum (Woese et al., Science 229: 762 (1985), Mycoplasma
PG50 (Frydenberg and Christiansen, DNA 4: 127 (198
5), Proteus vulgaris (Carton et al. , Nuc. Acids Res. 9:23
25 (1981), Pseudomonas testosteroni (Yang et al . , Proc.
Natl . Acad . Sci . US . A. 82: 4443 (1985), Rochalimaea q
uintana (Weisburg et al., Science 230: 556 (1985) Saccharo
myces cerevisiae (Rubstov et al. , Nuc. Acids Res. 8: 577
9 (1980); Georgiev et al. , Nuc. Acids Res. 9: 6953 (198
1)) and human (Torczynski et al., DNA 4: 283 (1985), Gonza
Lez et al . , Proc. Natl. Acad. Sci. USA 82: 7666 (1985).

The following sequences were found to hybridize to a broad phylogenetic cross-section of bacteria and not to yeast or human rRNA.

[0240] 1. 1. CCA CTG CTG CCT CCC GTA GGA GTC TGG GCC 2. CCA GAT CTC TAC GCA TTT CAC CGC TAC ACG TGG GCT CGT TGC GGG ACT TAA CCC AAC AT GGG GTT CTT TTC GCC TTT CCC TCA CGG GGC TGC TTC TAA GCC AAC ATC CTG 6. 6. GGA CCG TTA TAG TTA CGG CCG CC GGT CGG AAC TTA CCC GAC AAG GAA TTT CGC TAC C Probe 1 has a length of 30 bases and a Tm value of 70 ° C. Probe 2 has a length of 33 bases and a Tm value of 69 ° C. Probe 3 has a length of 26 bases and a Tm value of 67 ° C. Probe 4 has a length of 27
Base and Tm values are 69 ° C. Probe 5 has a length of 24 bases and a Tm value of 66 ° C. Probe 6 is 23 bases in length and has a Tm value of 62 ° C. Probe 7 has a length of 34 bases and a Tm value of 66 ° C.
It is. Probes 1-3 hybridize to the 16S rRNA in regions 330-365, 675-715 and 1080-1110 (corresponding to E. coli bases). Probes 4-7 correspond to regions 460-490, 1105-1080 and 1900-1960 (corresponding to E. coli bases).
Hybridize to the 23S rRNA of (probes 6 and 7). Oligonucleotides interact with regions on rRNA that are highly conserved in eubacteria. This means that they can be used as bacterial probes in hybridization assays. Second, it can be used as a tool to obtain rRNA. For example, an oligonucleotide is hybridized to the corresponding rRNA and extended with reverse transcriptase. The sequence of the resulting DNA can be determined and used to deduce a complementary rRNA sequence as described in the Detailed Description section herein.

One use of the present invention is to detect bacteria in bacteria (bacterial urine). To demonstrate the reactivity and specificity of the probe to bacteria detected in urine, 32P end-labeled or 125I-labeled oligonucleotide probes were used with the ultrasonic disruption method described in the standard method (eg, Murphy et al., US Patent No. 841860). Method, surfactants containing glass beads or enzymatic lysis). The probe and RNA were mixed in 0.48 M sodium phosphate pH 6.8, 1 mM EDTA, 1% sodium dodecyl sulfate (final volume 0.2 ml) and hybridized at 60 ° C. for 2 hours. 5 ml of 2% hydroxyapatite, 0.12M sodium phosphate pH 6.8, 0.02% sodium dodecyl sulfate were added and the mixture was incubated at 60 ° C for 10 minutes. The mixture was centrifuged and the supernatant was removed. 5 ml of washing solution (0.12 M sodium phosphate pH 6.8, 0.02% sodium dodecyl sulfate) was added, the sample was stirred, centrifuged and the supernatant was removed. The amount of radioactivity bound to hydroxyapatite was determined by scintillation counting. table
55-68 demonstrate the specificity of these probes, and demonstrate that the combined use of multiple probes can detect all of the tested bacteria.

Table 55 shows that probe 1 hybridized with bacterial RNA most isolated from urine, and yeast
Indicates that it does not hybridize with RNA. Table 56 shows
Probe 1 detects phylogenetically diverse bacteria, indicating that it does not hybridize to human RNA.

[0243]

[Table 53]

[0244]

[Table 54]

Table 57 shows that probe 2 was made of Ureaplasma ureal
It hybridizes with bacterial RNA normally detected in urine other than yicum , and does not hybridize with yeast rRNA.

[0246]

[Table 55]

Table 58 shows that Probe 2 detected phylogenetically diverse bacteria and did not hybridize to human rRNA.

[0248]

[Table 56]

Table 59 shows that probe 3 hybridized to bacterial RNA normally detected in urine and did not detect yeast rRNA.

[0250]

[Table 57]

Table 60 shows that Probe 4 detected phylogenetically diverse bacteria and did not hybridize to human RNA.

[0252]

[Table 58]

Table 61 shows that Probe 4 hybridized with bacterial RNA normally detected in urine and did not detect yeast rRNA.

[0254]

[Table 59]

Table 62 shows that Probe 4 detected phylogenetically diverse bacteria and did not hybridize to human rRNA.

[0256]

[Table 60]

Table 63 shows that Probe 5 hybridized to bacterial RNA normally detected in urine and did not detect yeast rRNA.

[0258]

[Table 61]

Table 64 shows that Probe 5 detected phylogenetically diverse bacteria and did not hybridize to human RNA.

[0260]

[Table 62]

Table 65 shows that probe 6 hybridized to bacterial RNA normally detected in urine and did not detect yeast rRNA.

[0262]

[Table 63]

Table 66 shows that Probe 6 detected phylogenetically diverse bacteria and did not hybridize to human RNA.

[0264]

[Table 64]

Table 67 shows that probe 7 hybridized to bacterial RNA normally detected in urine and did not detect yeast rRNA.

[0266]

[Table 65]

Table 68 shows that Probe 7 detected phylogenetically diverse bacteria and did not hybridize to human RNA.

[0268]

[Table 66]

[0269]Example 20  Fungi are morphological and phylogenetic of simple eukaryotic organisms
To include diverse groups. Three fungi, namelyNeuros
pora crassa,Podosporaas well asSaccharomycesKnown
Using the sequence, fungal rRNA isE.coli58-60% homologous to
It was estimated to be 84-90% homologous to each other. Some fungi are
Proliferate as a single cell (yeast), others are multinucleated filamentous
Proliferate as a body (mold) and some are single cells or
They can grow as polynuclear filaments (dimorphic fungi). Many fungi
Are harmless to environmental habitats, but harmful and cause disease
Some are. In some places the presence of fungi is undesirable
Or an indicator of disease (eg, media, drugs, blood
Fluid, tissue biopsy such as fluid, urine or cerebrospinal fluid). Drinking
Low levels of fungi are not permitted in other products such as water and food.
Is accepted. Therefore, means to detect and quantify fungi in the specimen
Is required.

Current methods for detection and quantification of fungi include microscopic examination of specimens and culturing in various media.
Many yeasts grow on the order of days from clinical specimens, but some filamentous fungi require a 4-week culture period, after which special staining, biochemical analysis, antigen testing, etc., are required. . The following oligonucleotide sequences, when used in a hybridization assay, are the five most isolated yeast strains from clinical specimens: Candida
albicans , Torulopsis glabrata , Candida tropocali
s , Candida parapsilosis and Candida krusei are detected. Trichosporon, Blastomyces , Cryptococcus and Sa
Five other fungi representing the genus ccharomyces are also detected. According to the present invention, it is possible to detect these fungi in one step, and in the case of culturing, the time required for identifying these fungi and removing them as the cause of infection can be reduced. This is a significant improvement over prior art methods.

Using three primers complementary to the conserved regions of the 18S or 28S rRNA, four probes were identified that hybridized with the organism in question. Sequence 1 was obtained using the 18S primer with the sequence 5'-AGAATTTCA CCT CTG-3 '. Sequence 2 was obtained using the 28S primer with the sequence 5'-CCT TCT CCC GAA GTT ACG G-3 '. Sequences 3 and 4 were obtained from the 28S primer having the sequence 5'-TTC CGA CTT CCA TGG CCA CCG TCC-3 '. The following sequences were characterized and proved to hybridize to fungal rRNA. Saccharomyces cerevisi for comparison with the sequence
ae , Saccharomyces carlsbergensis , Escherichia coli
And human rRNA were used.

[0272] 1. 1. CCC GAC CGT CCC TAT TAA TCA TTA CGA TGG 2. CGA CTT GGC ATG AAA ACT ATT CCT TCC TGT GG 3. GCT CTT CAT TCA ATT GTC CAC GTT CAA TTA AGG AAC AAG G Sequence 1 derived from GCT CTG CAT TCA AAC GTC CGC GTT CAA TAA AGA AAC AGG G 18S rRNA has a length of 30 bases and a Tm value of 68 ° C. Sequence 2 derived from 23S rRNA has a length of 32 bases and a Tm value of 67 ° C.
It is. Sequence 3 derived from 23S rRNA has a length of 40 bases and a Tm value of
66 ° C. Sequence 4 derived from 23S rRNA has a length of 40 bases and Tm
The value is 68 ° C. Sequence 1 is Saccharomyces cerevisiae 1
Hybridizes to the region corresponding to positions 845 to 880 of 8S rRNA. Sequence 2 is Saccharomyces cerevisiae 28S rRN
Hybridizes to the region corresponding to positions 1960-2000 of A. Sequences 3 and 4 hybridize to the region 1225-1270 of the 28S rRNA.

To demonstrate the reactivity and specificity of these probes for fungi, they were used in hybridization assays. ^{The 32} P or ¹²⁵ I-labeled probe and purified RNA or RNA released from cells by standard lysis were combined with 0.2 ml of 0.48 M sodium phosphate pH 6.8,
They were mixed in 1% sodium dodecyl sulfate, 1 mM EDTA, 1 mM EGTA, and incubated at 60 ° C. for 2 hours. After incubation, 5 ml of 2% hydroxyapatite, 0.12M
Sodium phosphate pH 6.8, 0.02% sodium dodecyl sulfate was added and the specimen was incubated at 60 ° C for 10 minutes. The sample was centrifuged and the supernatant was removed. Add 5 ml of 0.12 M sodium phosphate pH 6.8, 0.02% sodium dodecyl sulfate,
The specimen was agitated, centrifuged and the supernatant was removed. The results are shown in Table 69. Probe 1 detects all 10 fungi tested, Probe 2 detects all 6 yeasts tested, Probe 3 detects 5 out of 6 yeasts, Probe 4 detects only C. krusei I do. Therefore, probe 4 can be used for the detection and identification of C. krusei in a sample, and a plurality of yeasts can be detected by using probe 1 and 2 or probe 3 and 4 in combination. Can be used for either detection.

One promising use of these probes is
The identification of yeast in urine specimens or other normally sterile body fluids. The probe hybridized to a range of bacteria most commonly isolated from urine (Table 70). Table 71
Is a phylogenetically diverse organism or human RNA
Indicates that no hybridization occurs.

[0275]

[Table 67]

[0276]

[Table 68]

[0277]

[Table 69]

In addition, two derivatives of probe 1 were prepared. CCCGACCGTCCCTATTAATCATTACGATGGTCCTAGAAAC CCCGACCGTCCCTATTAATCATTACGATGG The first derivative operates at 65 ° C and the second derivative operates at 60 ° C.

[0279]Example 21  Gonorrhea is the most commonly reported bacterial infection in the United States,
Over 2 million cases of infection are reported annually. Sexually transmitted
Organism develops prostatic urethritis in men and cervicitis in women
Let it. Serious complications and infertility may occur in untreated patients
May be effective, but in general there are many subclinical infections,
Carriers who spread the infection to consciousness increase.

The causative fungus Neisseria gonorrhoeae is a gram-negative, oxidase-positive diplococcus requiring strict growth conditions. The method of diagnosis depends on the site of infection and the condition of the patient.
Gonorrheic urethritis in men can be diagnosed with high sensitivity and specificity by Gram stain. In order to reliably diagnose gonorrhea in all women and asymptomatic men, cultures that generally require 24-72 hours are required. After detecting the organism from the culture growth,
Neisseri by tests such as carbohydrate degradation, coaggregation, fluorescent antibody screening or chromogenic enzyme substrate assays
a gonorrhoeae needs to be identified.

Neisseria gonorrhoeae is N. meningitidis
, And are particularly difficult to detect and distinguish using nucleic acid probes. Kingsbury, DT, J. Bactriol . 94: 8
70-874 (1967) show that the DNA: DNA homology of both is about 80-94%. AdHoc Committee on Reconcili
ation of Approaches to Bacterial Systematics, In
According to the guidelines established by t'l J. System. Bacteriol. 37: 463-464 (1987), a phylogenetic definition of one species generally means more than 70% DNA: DNA homology. Enacted principles make it possible to identify these organisms even though they are considered to belong to the same species.

Between N. gonorrhoeae and N. meningitidis
rRNA homology is even larger, as expected from known conserved regions. According to our sequencing data, N. gonorrhoeae
The difference between the 16S rRNA sequence between N. meningitidis and N. meningitidis is 1.0% and the difference between 23S rRNA is 1.1%.

In some mutation sites between N. meningitidis and N. gonorrhoeae , other Neisseria are N. gonorr
It is more difficult to generate N. gonorrhoeae probes because they are equal to hoeae . The few mismatches that exist between these two species are the most variable regions, that is, regions that vary not only between species but also between strains. Some believe that species cannot be distinguished by nucleic acid probes at all, and others believe that rRNA is too conserved for use in probe diagnosis, but in the present invention, N. gonorrhoeae and N. mening
We succeeded in producing a probe that can distinguish itidis .

The present invention has significant advantages over prior art methods. Probes are more specific than culture methods and are faster to diagnose than culture methods. Probes are also more sensitive than conventional methods (eg, they can detect a small number of organisms in a clinical specimen).

To identify these probe sequences, the sequence 1. GGCCGTTACCCCACCTACTAGCTAAT 2. GTATTACCGCGGCTGCTGGCAC 3. Primers with GCTCGTTGCGGGACTTAACCCACCAT were used.

Each of the rRNAs selected as targets was E.col
i , N.meningitidis , N.cinerea , N.lactamica , N.muc
It had at least two mismatches for osa and Kingella kingae .

An oligonucleotide complementary to the sequence adjacent to the probe region was synthesized and used as a hybridization mixture in US Patent Application by Hogan et al. (Unlicensed), 1987.
Filed November 24, `` Meansand Method for Enhancing Nu
cleic Acid Hybridization "(" helper "patent application).

The following sequence was characterized and analyzed by Neisseria gonorr
hoeae was found to be specific. N.gonorrhoeae
Neisse , the closest phylogenetic organism for comparison with
ria meningitidis , N.cinerea , N.lactamica , N.mucos
a and Kingella kingae were used.

[0289] 1. CCG CCG CTA CCC GGT AC 2. 2. TCA TCG GCC GCC GAT ATT GGC GAG CAT TCC GCA CAT GTC AAA ACC AGG TA region 125 to 150, which is complementary to 16S rRNA, has a length of 17 bases and a Tm value of 56 ° C. Sequence 2 complementary to 16S rRNA in the region 455-485 has a length of 21 bases and a Tm value of 63 ° C. Region 9
Sequence 3, which is 80 to 1015 and is complementary to 16S rRNA, has a length of 29 bases and a Tm
The value is 56 ° C. Hybridization assays were used to demonstrate the reactivity and specificity of the probe for Neisseria gonorrhoea . Iodination of 3 oligonucleotide probes Sequence 5'-CCC CTG CTT TCC CTC TCT AGA CGT ATG CGG TAT T
AG CTG ATC TTT CG-3 ', 5'-GCC TTT TCT TCC CTG ACA AAA GTC CTT TAC AAC C
CG-3 ', 5'-GGC ACG TAG TTA GCC GGT GCT TAT TCT TCA GGT A
C-3 'and 5'-GGT TCT TCG CGT TGC ATC GAA TTA ATC CACATC AT
Along with an unlabeled oligonucleotide having C CAC CGC-3 'and purified rRNA,
Mix in 0.48M sodium phosphate pH 6.8, 0.5% sodium dodecyl sulfate (SDS) and incubate at 60 ° C for 1 hour. After incubation, 4 ml of 2% hydroxyapatite, 0.12 M sodium phosphate pH 6.8, 0.02% SD
S was added and the mixture was incubated at 60 ° C for 5 minutes. The specimen was centrifuged and the supernatant was removed. 5 ml wash solution (0.
12M sodium phosphate pH 6.8, 2% SDS) was added, the sample was vortexed, centrifuged and the supernatant was removed. Radioactivity bound to hydroxyapatite was measured with a gamma counter.

Table 72 shows that the probe hybridized well to N. gonorrhoeae and did not hybridize to the other species tested.

[0291]

[Table 70]

Further, the following derivatives of the Neisseria probe were prepared and used. GAG GAT TCC GCA CAT GTC AAA ACC AGG GAG GAT TCC GCA CAT GTC AAA ACC AGG TAA CCC GCT ACC CGG TAC GTT C CCG CTA CCC GGT ACG TTC ******

In the above examples, measurement was performed using a standard assay format, but specific probes can be used under various experimental conditions. For example, various additives may be added to the reaction solution to provide optimal reaction conditions for promoting hybridization. Such additives include buffers, chelating agents, organic compounds, nucleic acid precipitants, and sodium dodecyl sulfate, diisobutyl sulfosuccinate, sodium tetradecyl sulfate, sarkosyl and alkali metals such as SO4-2, PO4-3, Cl-1 and HCOO-1. Surfactants such as salts and ammonium salts. It is easy for those skilled in the art to use such additives to obtain optimal conditions for the hybridization reaction. Conditions for promoting hybridization of a single-stranded nucleic acid molecule to a double-stranded nucleic acid are described in the above-mentioned U.S. Patent Application No. 627795, filed July 5, 1984, and its CIP application, filed June 4, 1987, which was unlicensed. US Patent Application No. 81, January 7, 1986)
The subject of 6711. In each case, the title of the invention is "ACCELERA
TED NUCLEIC ACID REASSOCIATION METHOD ”.

The present invention relates to a purified specimen or an unpurified clinical specimen such as sputum, stool, tissue, blood, spinal fluid or synovial fluid, serum, urine or other body fluid, or other specimen such as an environmental or food specimen. From non-viral organisms. Cells can be suspended or lysed in solution prior to cell disruption and hybridization. In the case of an unpurified specimen as described above, the cells are maintained in their own biological environment prior to the assay and are intact and untreated.

The probes of the present invention may be used alone in the assay or may be used in combination with various probes. A plurality of single probes may be bound during nucleic acid synthesis. The result is a single probe molecule that contains multiple probe sequences and thus has multiple specificities. For example, the aforementioned Mycobacterium avium described in Examples 1 and 2 My
A single nucleic acid molecule containing both sequences of cobacterium intracellulare can be synthesized. M.avium or M.intracellulare
The probe hybridizes completely in a hybridization assay with any of the rRNAs. 1
When two separate probe sequences are combined in one assay, only half of the mixed probe is M.avium or M.intracel
Hybridizes with lurale rRNA. Other methods can be used within the scope of the present invention. For example, the probe may be labeled with various labels as described in the text or may be incorporated into a diagnostic kit.

[Brief description of the drawings]

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is an overall view of a chart showing the primary structure of bacterial 16S rRNA of Escherichia coli showing standard reference numbers of bases.

FIG. 1A shows Escherichia coli indicating standard reference numbers for bases.
FIG. 2 is a partial view of a chart showing the primary structure of bacterial 16S rRNA of the present invention.

FIG. 1B. Escherichia coli showing standard reference numbers for bases.
FIG. 2 is a partial view of a chart showing the primary structure of bacterial 16S rRNA of the present invention.

FIG. 2 is an overall view of a chart of the primary structure of Escherichia coli bacterial 23S rRNA showing the standard reference numbers of bases.

FIG. 2A shows Escherichia coli with standard reference numbers for bases.
FIG. 3 is a partial view of a chart showing the primary structure of bacterial 23S rRNA of the present invention.

FIG. 2B shows Escherichia coli with standard reference numbers for bases.
FIG. 3 is a partial view of a chart showing the primary structure of bacterial 23S rRNA of the present invention.

FIG. 2C shows Escherichia coli with standard reference numbers for bases.
FIG. 3 is a partial view of a chart showing the primary structure of bacterial 23S rRNA of the present invention.

FIG. 2D shows Escherichia coli with standard reference numbers for bases.
FIG. 3 is a partial view of a chart showing the primary structure of bacterial 23S rRNA of the present invention.

FIG. 3 is an overall view of a chart showing the primary structure of Escherichia coli bacterial 5S rRNA showing the standard reference numbers of bases.

FIG. 3A shows Escherichia coli with standard reference numbers for bases.
FIG. 2 is a partial view of a chart showing a primary structure of a bacterial 5S rRNA of the present invention.

FIG. 3B. Escherichia coli showing standard reference numbers for bases.
FIG. 2 is a partial view of a chart showing a primary structure of a bacterial 5S rRNA of the present invention.

FIG. 4. Saccharomyces cere indicating standard reference numbers for bases.
BRIEF DESCRIPTION OF THE DRAWINGS It is the whole figure of the chart figure of the primary structure of 18S rRNA of visiae .

FIG. 4A shows Saccharomyces ce indicating standard reference numbers for bases.
FIG. 4 is a partial view of a chart showing the primary structure of 18S rRNA of revisiae .

FIG. 4B. Saccharomyces ce showing standard reference numbers for bases.
FIG. 4 is a partial view of a chart showing the primary structure of 18S rRNA of revisiae .

FIG. 4C. Saccharomyces ce showing standard reference numbers for bases.
FIG. 4 is a partial view of a chart showing the primary structure of 18S rRNA of revisiae .

FIG. 5. Saccharomyces cere indicating standard reference numbers for bases.
BRIEF DESCRIPTION OF THE DRAWINGS It is the whole figure of the chart figure of the primary structure of 28S rRNA of visiae .

FIG. 5A. Saccharomyces ce showing standard reference numbers for bases.
FIG. 2 is a partial view of a chart showing the primary structure of 28S rRNA of revisiae .

FIG. 5B. Saccharomyces ce showing standard reference numbers for bases.
FIG. 2 is a partial view of a chart showing the primary structure of 28S rRNA of revisiae .

FIG. 5C shows Saccharomyces ce indicating standard reference numbers for bases.
FIG. 2 is a partial view of a chart showing the primary structure of 28S rRNA of revisiae .

FIG. 5D. Saccharomyces ce indicating standard reference numbers for bases.
FIG. 2 is a partial view of a chart showing the primary structure of 28S rRNA of revisiae .

FIG. 5E shows Saccharomyces ce indicating standard reference numbers for bases.
FIG. 2 is a partial view of a chart showing the primary structure of 28S rRNA of revisiae .

FIG. 5F. Saccharomyces ce showing standard reference numbers for bases.
FIG. 2 is a partial view of a chart showing the primary structure of 28S rRNA of revisiae .

FIG. 6 is a diagram showing the different positions of 16S rRNA among 12 different related organisms (using E. coli reference numbers). For example, in Example 1, 99.7 was Clostridium botulinium.
FIG . 10 shows the difference in 16S rRNA between E. coli and Clostridium subterminale .

FIG. 7. First 1500 of 23S rRNA between 12 different closely related organisms.
4 is a diagram showing the positions of the bases (using E. coli reference numbers).

FIG. 8 is a diagram showing the position of the terminal base of 23S rRNA between 12 different related organisms (using E. coli reference numbers).

FIG. 9 is a schematic diagram showing positions of probes capable of hybridizing to 16S rRNA.

FIG. 10 is a schematic diagram showing the position of a probe that can hybridize with the first 1500 bases of 23S rRNA.

FIG. 11 is a schematic diagram showing the position of a probe that can hybridize to the terminal base of 23S rRNA.

 ────────────────────────────────────────────────── ─── Continuing on the front page (72) Inventor Lichard Dana Smith United States of America, California, San Diego, Mercer Lane 3522 Hampton Road 1314 (72) Inventor Cierol Houffa MacDonau, California, USA 92122, San Diego, Robbins Street 4697

Claims (69)

[Claims] 1. A hybridization assay probe for distinguishing a target nucleotide sequence of a target organism or group of organisms from a non-target nucleotide sequence of a non-target organism or group of organisms, wherein the probe comprises a Mycobacterium avium
Is, ACCGCAAAAGCTTTCCACCAGAAGACATGCGTCTTGAG or its complementary sequence, the target organism is Mycobacterium intracel
lulare , ACCGCAAAAGCTTTCCACCTAAAGACATGCGCCTAA
AG or its complementary sequence, the target organism is Mycobacterium tu
TAAAGCGCTTTCCACCACAA belonging to berculosis complex bacteria group
GACATGCATCCCGTG or its complementary sequence, the target organism is Myc
TGCCCTA belonging to the bacterium tuberculosis complex bacterial group
CCCACACCCACCACAAGGTGATGT or its complementary sequence, the target organism belongs to the Mycobacterium tuberculosis complex bacteria group, CCATCACCACCCTCCTCCGGAGAGGAAAAGG or its complementary sequence, the target organism belongs to the Mycobacterium tuberculosis complex bacteria group, CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGAT
GC or its complementary sequence, the target organism is Mycobacterium tu
AGGCACTGTCCCTAAACCCG belonging to berculosis complex bacteria group
ATTCAGGGTTC or its complementary sequence, the target organism is Mycobac
CCGCTAAAGCG belonging to terium tuberculosis complex bacteria group
CTTTCCACCACAAGACATGCATCCCG or its complementary sequence, the target organism belongs to the Mycobacterium tuberculosis complex bacterial group, ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC or its complementary sequence, the target organism belongs to the genus Mycobacterium , CCATGCACCACCTGCACACAGGCCACAAGG or its target genus belongs to Mycobacterium , and the target genus belongs to Mycobacterium.
CCCAGTATTACCACTGACTGGTACGG or its complementary sequence, the target organism belongs to the genus Mycobacterium , CACCGAATTCGCCTCAA
CCGGCTATGCGTCACCTC or its complementary sequence, the target organism is
GGGGTACGGCCCGTGTGTGTGCTCG belonging to the genus Mycobacterium
CTAGAGGC or its complementary sequence, the non-target organism is Mycoplas
It is a ma pneumoniae, GCTTGGTGCTTTCCTATTCTCACTGAAAC
AGCTACATTCGGC or its complementary sequence, the non-target organism is Myc
AATAACGAACCCTTGCAGGTCCTT which is oplasma pneumoniae
TCAACTTTGAT or its complementary sequence, the non-target organism is Mycop
lasma pneumoniae , CAGTCAAACTCTAGCCATTACCTGCT
AAAGTCATT or its complementary sequence, the non-target organism is Mycopla
sma pneumoniae , TACCGAGGGGATCGCCCCGACAGCTAGT
AT or its complementary sequence, the non-target organism is Mycoplasma pne
umoniae , CTTTACAGATTTGCTCACTTTTACAAGCTGGCGAC
Or its complementary sequence, the target organism belongs to the genus Legionella , TACCCTCTCCCATACTCGAGTCAACCAGTATTATCTGACC or its complementary sequence, the target organism belongs to the genus Legionella , GG
ATTTCACGTGTCCCGGCCTACTTGTTCGGGTGCGTAGTTC or its complementary sequence, the target organism belongs to the genus Legionella , CATCTC
TGCAAAATTCACTGTATGTCAAGGGTAGGTAAGG or its complementary sequence, the target organism belongs to the genus Legionella , GCGGTACGGT
TCTCTATAAGTTATGGCTAGC or its complementary sequence, the target organism belongs to the genus Legionella , GTACCGAGGGTACCTTTGTGCT or its complementary sequence, the target organism is a genus Legionella ,
CACTCTTGGTACGATGTCCGAC or its complementary sequence, the target organism is Chlamydia trachomatis , CCGACTCGGGGTTGAGC
CCATCTTTGACAA or its complementary sequence, the target organism is Chlam
ydia trachomatis , TTACGTCCGACACGGATGGGGTTGAG
ACCATC or its complementary sequence, the target organism is Chlamydia tr
achomatis , CCGCCACTAAACAATCGTCGAAACAATTGCTCC
GTTCGA or its complementary sequence, the target organism is Chlamydia tr
CGTTACTCGGATGCCCAAATATCGCCACATTCG which is achomatis
Or its complementary sequence, the target organism is Chlamydia trachoma
tis , CATCCATCTTTCCAGATGTGTTCAACTAGGAGTCCTGAT
CC or its complementary sequence, wherein the target organism is Chlamydia tracho
a Matis, JieijijitiCGGTCTTTCTCTCCTTTCGTCTACG or its complementary sequence, wherein the target organism is Chlamydia trachomatis, CCGTTCTCATCGCTCTACGGACTCTTCCAATCG or its complementary sequence, wherein the target organism is Chlamydia trachomatis, CGAAGATTCCCCTTGATCGCGACCTGATCT or its complementary sequence, wherein the target organism is Chlamydia trachomatis, CCG
GGGCTCCTATCGTTCCATAGTCACCCTAAAAG or its complementary sequence,
The target organism is Chlamydia trachomatis , TACCGCG
TGTCTTATCGACACACCCGCG or its complementary sequence, the target organism belongs to the genus Campylobacter , CGCTCCGAAAAGTGTCATCCT
CC or its complementary sequence, the target organism belongs to the genus Campylobacter , CCTTAGGTACCGTCAGAATTCTTCC or its complementary sequence, the target organism belongs to the genus Campylobacter , GCCTTCG
CAATGGGTATTCTTGGTG or its complementary sequence, the target organism is
GGTTCTTAGGATATCAAGCCCAGG belonging to the genus Campylobacter
Or its complementary sequence, belonging to the subgenus group Streptococci said target organism is known as E nterococci, TGCAGCAC
TGAAGGGCGGAAACCCTCCAACACTTA or its complementary sequence, belonging to the subgenus groups wherein the target organism is known as a group I Pseudomonas, CAGACAAAGTTTCTCGTGCTCCGTCCTACTCGATT or its complementary sequence, wherein the target organism is Enterobacter cloacae, GTGTGTTTTCGTGTACGGGACTTTCACCC or its complementary sequence, wherein the target organism is Proteus CCGTTCT, mirabilis
CCTGACACTGCTATTGATTAAGACTC or its complementary sequence, the target organism belongs to the genus Salmonella , CTCCTTTGAGTTCCCGACCT
AATCGCTGGC or its complementary sequence, the target organism is Salmonel
belonging to the genus la , CTCATCGAGCTCACAGCACATGCGCTTTTGTGTA or its complementary sequence, the target organism is Escherichia coli , GCACATTCTCATCTCTGAAAACTTCCGTGG or its complementary sequence, the target organism is a bacterium, CCACTGCTGCCTCCCGTAGG
AGTCTGGGCC or its complementary sequence, the target organism is a bacterium, CCAGATCTCTACGCATTTCACCGCTACACGTGG or its complementary sequence, the target organism is a bacterium, GCTCGTTGCGGGACTTAA
CCCAACAT or its complementary sequence, the target organism is a bacterium, GGGGTTCTTTTCGCCTTTCCCTCACGG or its complementary sequence,
The target organism is a bacterium, GGCTGCTTCTAAGCCAACATCCTG
Or its complementary sequence, wherein the target organism is a bacterium, GGACCG
TTATAGTTACGGCCGCC or its complementary sequence, the target organism is a bacterium, GGTCGGAACTTACCCGACAAGGAATTTCGCTACC or its complementary sequence, the target organism is a fungus, CCCGACCGTC
CCTATTAATCATTACGATGG or its complementary sequence, the target organism is a fungus, CCCGACCGTCCCTATTAATCATTACGATGGTCCTAG
AAAC or its complementary sequence, the target organism is a fungus, CG
ACTTGGCATGAAAACTATTCCTTCCTGTGG or its complementary sequence, wherein the target organism is a fungus, GCTCTTCATTCAATTGTCCACGTTCA
ATTAAGCAACAAGG or its complementary sequence, the target organism is a fungus, GCTCTGCATTCAAACGTCCGCGTTCAATAAAGAAACAGGG or its complementary sequence, the target organism is Neisseria gonorrhoea
e , CCGCCGCTACCCGGTAC or its complementary sequence, the target organism is Neisseria gonorrhoeae , TCATCGGCCGCCG
ATATTGGC or its complementary sequence, the target organism is Neisseria
gonorrhoeae , GAGCATTCCGCACATGTCAAAACCAGGTA or its complementary sequence, the target organism is Neisseria gonorrhoea
e , GAGGATTCCGCACATGTCAAAACCAGG or a complementary sequence thereof, wherein the target organism is Neisseria gonorrhoeae ,
GATTCCGCACATGTCAAAACCAGGTAA or its complementary sequence, wherein the target organism is Neisseria gonorrhoeae , CCCGCTACCCG
GTACGTTC or its complementary sequence, and the target organism is Neis
seria gonorrhoeae , selected from the group consisting of CCGCTACCCGGTACGTTC or its complementary sequence, wherein the probe, under hybridization conditions, is a nucleotide sequence present in a nucleic acid from the target organism or group of organisms, or complementary thereto. The probe is capable of forming a detectable hybrid with a nucleotide sequence, and the probe is capable of forming a nucleotide sequence present in a nucleic acid from a non-target organism or group of organisms, or a nucleotide sequence complementary thereto under the above hybridization conditions. And the probe cannot form a detectable hybrid. 2. The method according to claim 1, wherein the target organism is Mycobacterium avium , and the oligonucleotide sequence is ACCGCAAAAGCTTTCC.
2. The probe according to claim 1, which is ACCAGAAGACATGCGTCTTGAG or its complementary sequence. 3. The method according to claim 2, wherein the target organism is Mycobacterium intracel.
lulare , and the oligonucleotide sequence is ACCGCAAA
2. The probe according to claim 1, which is AGCTTTCCACCTAAAGACATGCGCCTAAAG or its complementary sequence. 4. The method according to claim 1, wherein the target organism is Mycobacterium tubercu.
2. The probe according to claim 1, wherein the probe belongs to the losis complex bacteria group, and the oligonucleotide sequence is TAAAGCGCTTTCCACCACAAGACATGCATCCCGTG or its complementary sequence. 5. The method according to claim 5, wherein the target organism is Mycobacterium tubercul.
belongs to the complex bacterium group, wherein the oligonucleotide sequence is
2. The probe according to claim 1, which is TGCCCTACCCACACCCACCACAAGGTGATGT or its complementary sequence. 6. The method according to claim 6, wherein the target organism is Mycobacterium tubercul.
belongs to the complex bacterium group, wherein the oligonucleotide sequence is
The probe according to claim 1, which is CCATCACCACCCTCCTCCGGAGAGGAAAAGG or its complementary sequence. 7. The method according to claim 7, wherein the target organism is Mycobacterium tubercul.
belongs to the complex bacterium group, wherein the oligonucleotide sequence is
2. The probe according to claim 1, which is CTGTCCCTAAACCCGATTCAGGGTTCGAGGTTAGATGC or its complementary sequence. 8. The method according to claim 8, wherein the target organism is Mycobacterium tubercul.
belongs to the complex bacterium group, wherein the oligonucleotide sequence is
2. The probe according to claim 1, which is AGGCACTGTCCCTAAACCCGATTCAGGGTTC or its complementary sequence. 9. The method according to claim 9, wherein the target organism is Mycobacterium tubercul.
belongs to the complex bacterium group, wherein the oligonucleotide sequence is
2. The probe according to claim 1, which is CCGCTAAAGCGCTTTCCACCACAAGACATGCATCCCG or its complementary sequence. 10. The method according to claim 10, wherein the target organism is Mycobacterium tuberc.
2. The probe according to claim 1, wherein the probe belongs to the ulosis complex bacteria group, and the oligonucleotide sequence is ACACCGCTAAAGCGCTTTCCACCACAAGACATGCATC or its complementary sequence. 11. The target organism belongs to the genus Mycobacterium , and the oligonucleotide is CCATGCACCACCTGCACACAGG.
2. The probe according to claim 1, which is CCACAAGG or its complementary sequence. 12. The target organism belongs to the genus Mycobacterium , and the oligonucleotide sequence is GGCTTGCCCCAGTATTAC.
2. The probe according to claim 1, which is CACTGACTGGTACGG or its complementary sequence. 13. The method according to claim 12, wherein the target organism belongs to the genus Mycobacterium , and the oligonucleotide sequence is CACCGAATTCGCCTCAAC.
2. The probe according to claim 1, which is CGGCTATGCGTCACCTC or its complementary sequence. 14. The target organism belongs to the genus Mycobacterium , and the oligonucleotide sequence is GGGGTACGGCCCGTGTGT.
2. The probe according to claim 1, which is GTGCTCGCTAGAGGC or its complementary sequence. 15. The target organism is Mycoplasma pneumonia.
e , the oligonucleotide sequence is GCTTGGTGCTTTC
2. The probe according to claim 1, which is CTATTCTCACTGAAACAGCTACATTCGGC or its complementary sequence. 16. The method according to claim 16, wherein the target organism is Mycoplasma pneumonia.
e , the oligonucleotide sequence is AATAACGAACCCT
2. The probe according to claim 1, which is TGCAGGTCCTTTCAACTTTGAT or its complementary sequence. 17. The method according to claim 17, wherein the target organism is Mycoplasma pneumonia.
e , wherein the oligonucleotide sequence is CAGTCAAACTCTA
2. The probe according to claim 1, which is GCCATTACCT GCTAAAGTCATT or its complementary sequence. 18. The method according to claim 18, wherein the target organism is Mycoplasma pneumonia.
e , the oligonucleotide sequence is TACCGAGGGGATC
2. The probe according to claim 1, which is GCCCCGACAGCTAGTAT or its complementary sequence. 19. The target organism is Mycoplasma pneumonia.
e , the oligonucleotide sequence is CTTTACAGATTTG
2. The probe according to claim 1, which is CTCACTTTTACAAGCTGGCGAC or its complementary sequence. 20. The target organism belongs to the genus Legionella ,
The oligonucleotide sequence is TACCCTCTCCCATACTCGAGTC
2. The probe according to claim 1, which is AACCAGTATTATCTGACC or a sequence complementary thereto. 21. The target organism belongs to the genus Legionella ,
The oligonucleotide sequence is GGATTTCACGTGTCCCGGCCTA
2. The probe according to claim 1, which is CTTGTTCGGGTGCGTAGTTC or its complementary sequence. 22. The target organism belongs to the genus Legionella ,
The oligonucleotide sequence is CATCTCTGCAAAATTCACTGTA
2. The probe according to claim 1, which is TGTCAAGGGTAGGTAAGG or its complementary sequence. 23. The target organism belongs to the genus Legionella ,
The oligonucleotide sequence is GCGGTACGGTTCTCTATAAGTT
2. The probe according to claim 1, which is ATGGCTAGC or its complementary sequence. 24. The target organism belongs to the genus Legionella ,
The oligonucleotide sequence is GTACCGAGGGTACCTTTGTGCT
2. The probe according to claim 1, which is a complementary sequence thereof. 25. The target organism belongs to the genus Legionella ,
The oligonucleotide sequence is CACTCTTGGTACGATGTCCGAC
2. The probe according to claim 1, which is a complementary sequence thereof. 26. The target organism is Chlamydia trachomati.
s , wherein the oligonucleotide sequence is CCGACTCGGGGTT
2. The probe according to claim 1, which is GAGCCCATCTTTGACAA or its complementary sequence. 27. The target organism is Chlamydia trachomati.
s , wherein the oligonucleotide sequence is TTACGTCCGACAC
The probe according to claim 1, which is GGATGGGGTTGAGACCATC or its complementary sequence. 28. The target organism is Chlamydia trachomati.
s , wherein the oligonucleotide sequence is CCGCCACTAAACA
2. The probe according to claim 1, which is ATCGTCGAAACAATTGCTCCGTTCGA or its complementary sequence. 29. The target organism is Chlamydia trachomati.
s , wherein the oligonucleotide sequence is CGTTACTCGGATG
2. The probe according to claim 1, which is CCCAAATATCGCCACATTCG or its complementary sequence. 30. The target organism is Chlamydia trachomati.
s , wherein the oligonucleotide sequence is CATCCATCTTTCC
2. The probe according to claim 1, which is AGATGTGTTCAACTAGGAGTCCTGATCC or its complementary sequence. 31. The target organism is Chlamydia trachomati.
s , wherein the oligonucleotide sequence is GAGGTCGGTCTTT
2. The probe according to claim 1, which is CTCTCCTTTCGTCTACG or its complementary sequence. 32. The target organism is Chlamydia trachomati.
s , wherein the oligonucleotide sequence is CCGTTCTCATCGC
2. The probe according to claim 1, which is TCTACGGACTCTTCCAATCG or its complementary sequence. 33. The target organism is Chlamydia trachomati.
s , wherein the oligonucleotide sequence is CGAAGATTCCCCT
2. The probe according to claim 1, which is TGATCGCGACCTGATCT or its complementary sequence. 34. The target organism is Chlamydia trachomati.
s , wherein the oligonucleotide sequence is CCGGGGCTCCTAT
2. The probe according to claim 1, which is CGTTCCATAGTCACCCTAAAAG or its complementary sequence. 35. The target organism is Chlamydia trachomati.
s , wherein the oligonucleotide sequence is TACCGCGTGTCTT
2. The probe according to claim 1, which is ATCGACACACCCGCG or its complementary sequence. 36. The target organism belongs to the genus Campylobacter , and the oligonucleotide sequence is CGCTCCGAAAAGTGTCAT.
2. The probe according to claim 1, which is CCTCC or its complementary sequence. 37. The target organism belongs to the genus Campylobacter , and the oligonucleotide sequence is CCTTAGGTACCGTCAGAA.
2. The probe according to claim 1, which is TTCTTCCC or its complementary sequence. 38. The target organism belongs to the genus Campylobacter , and the oligonucleotide sequence is GCCTTCGCAATGGGTATT.
The probe according to claim 1, which is CTTGGTG or its complementary sequence. 39. The target organism belongs to the genus Campylobacter , and the oligonucleotide sequence is GGTTCTTAGGATATCAAG.
2. The probe according to claim 1, which is CCCAGG or its complementary sequence. 40. The target organism belongs to the subgenus of Streptococci known as Enterococci , and the oligonucleotide sequence is TGCAGCACTGAAGGGCGGAAACCCTCCACACTTA.
2. The probe according to claim 1, which is a complementary sequence thereof. 41. The probe of claim 1, wherein said target organism belongs to a subgenus known as Group I Pseudomonas , and wherein said oligonucleotide sequence is CAGACAAAGTTTCTCGTGCTCCGTCCTACTCGATT or a complement thereof. 42. The target organism is Enterobacter cloacae.
Wherein the oligonucleotide sequence is GTGTGTTTTCGTGT
2. The probe according to claim 1, which is ACGGGACTTTCACCC or its complementary sequence. 43. The target organism is Proteus mirabilis , and the oligonucleotide sequence is CCGTTCTCCTGACACT.
2. The probe according to claim 1, which is GCTATTGATTAAGACTC or its complementary sequence. 44. The target organism belongs to the genus Salmonella ,
The oligonucleotide sequence is CTCCTTTGAGTTCCCGACCTAA
2. The probe according to claim 1, which is TCGCTGGC or its complementary sequence. 45. The target organism belongs to the genus Salmonella ,
The oligonucleotide sequence is CTCATCGAGCTCACAGCACATG
2. The probe according to claim 1, which is CGCTTTTGTGTA or its complementary sequence. 46. The target organism is Escherichia coli , and the oligonucleotide sequence is GCACATTCTCATCTCTGA
2. The probe according to claim 1, which is AAACTTCCGTGG or its complementary sequence. 47. The target organism is a bacterium and the oligonucleotide sequence is CCACTGCTGCCTCCCGTAGGAGTCTGGGCC
2. The probe according to claim 1, which is a complementary sequence thereof. 48. The target organism is a bacterium and the oligonucleotide sequence is CCAGATCTCTACGCATTTCACCGCTACACG
The probe according to claim 1, which is TGG or its complementary sequence. 49. The probe according to claim 1, wherein the target organism is a bacterium, and the oligonucleotide sequence is GCTCGTTGCGGGACTTAACCCAACAT or its complementary sequence. 50. The probe according to claim 1, wherein the target organism is a bacterium, and the oligonucleotide sequence is GGGGTTCTTTTCGCCTTTCCCTCACGG or its complementary sequence. 51. The probe according to claim 1, wherein the target organism is a bacterium, and the oligonucleotide sequence is GGCTGCTTCTAAGCCAACATCCTG or its complementary sequence. 52. The probe according to claim 1, wherein said target organism is a bacterium, and said oligonucleotide sequence is GGACCGTTATAGTTACGGCCGCC or its complementary sequence. 53. The target organism is a bacterium and the oligonucleotide sequence is GGTCGGAACTTACCCGACAAGGAATTTCGC
2. The probe according to claim 1, which is TACC or a sequence complementary thereto. 54. The target organism is a fungus and the oligonucleotide sequence is CCCGACCGTCCCTATTAATCATTACGATGG.
2. The probe according to claim 1, which is a complementary sequence thereof. 55. The target organism is a fungus and the oligonucleotide sequence is CCCGACCGTCCCTATTAATCATTACGATGG
The probe according to claim 1, which is TCCTAGAAAC or its complementary sequence. 56. The target organism is a fungus and the oligonucleotide sequence is CGACTTGGCATGAAAACTATTCCTTCCTGT.
2. The probe according to claim 1, which is GG or its complementary sequence. 57. The target organism is a fungus and the oligonucleotide sequence is GCTCTTCATTCAATTGTCCACGTTCAATTA
2. The probe according to claim 1, which is AGCAACAAGG or its complementary sequence. 58. The target organism is a fungus and the oligonucleotide sequence is GCTCTGCATTCAAACGTCCGCGTTCAATAA.
The probe according to claim 1, which is AGAAACAGGG or its complementary sequence. 59. The target organism is Neisseria gonorrhoea
e , the oligonucleotide sequence is CCGCCGCTACCCG
2. The probe according to claim 1, which is GTAC or its complementary sequence. 60. The target organism is Neisseria gonorrhoea
e , the oligonucleotide sequence is TCATCGGCCGCCG
2. The probe according to claim 1, which is ATATTGGC or its complementary sequence. 61. The target organism is Neisseria gonorrhoea
e , the oligonucleotide sequence is GAGCATTCCGCAC
2. The probe according to claim 1, which is ATGTCAAAACCAGGTA or its complementary sequence. 62. The target organism is Neisseria gonorrhoea
e , the oligonucleotide sequence is GAGGATTCCGCAC
ATGTCAAAACCAGG or its complementary sequence.
The probe according to the item. 63. The target organism is Neisseria gonorrhoea
e , the oligonucleotide sequence is GAGGATTCCGCAC
2. The probe according to claim 1, which is ATGTCAAAACCAGGTAA or its complementary sequence. 64. The target organism is Neisseria gonorrhoea
e , the oligonucleotide sequence is CCCGCTACCCGGT
The probe according to claim 1, which is ACGTTC or its complementary sequence. 65. The target organism is Neisseria gonorrhoea
e , the oligonucleotide sequence is CCGCTACCCGGTACG
2. The probe according to claim 1, which is TTC or its complementary sequence. 66. The probe according to any one of claims 1 to 65, wherein the base chain length of the probe is up to about 100 bases. 67. The probe according to any one of claims 1 to 65, wherein the base chain length of the probe is about 15 to about 50 bases. 68. The percent similarity between the known rRNA of the target organism and the known rRNA of the phylogenetically closest organism is 90-99.
The probe according to any one of the above items. 69. The probe according to any one of claims 1 to 68, wherein the probe further comprises a label.