JP2000300255A - Identification system for plant cell - Google Patents

Abstract

PROBLEM TO BE SOLVED: To protect a plant having a property value by genetically giving an identification mark to the plant through the introduction of a DNA sequence consisting of a specific base pairs to the genome of the plant. SOLUTION: An identification mark is genetically given to a plant by introducing a DNA sequence, which is composed of 100 or less base pairs, preferably 80 or less base pairs, more preferably 60 or less base pairs, especially preferably 40 or less base pairs, and characteristic in the genome of a plant, into the genome of the plant. Further, the DNA sequence contains (i) the first sequence of 10 base pairs, (ii) a serial repetition sequence of at least two times of an identification mark of 6 or more base pairs, and (iii) the second sequence of 10 base pairs, and preferably; the DNA sequence further contains a selected marker gene. Preferably, these DNA sequences are introduced with Agrobacterium tumefaciens.

Description

DETAILED DESCRIPTION OF THE INVENTION

BACKGROUND OF THE INVENTION Developing a wide variety of plant lines with unique and commercially valuable properties has been an important field of agricultural science before the beginning of modern biotechnology. Many of these plants or their plant cells have proprietary value as a patent or commercial secret. Therefore, plant owners are interested in tracking and identifying the distribution of these valuable plants,
Some of these plants may have been owned by patent infringers or individuals who exploited trade secrets.

[0002] Current methods of genetically identifying an organism, such as a plant, include detecting restriction fragment length polymorphism (RFLP). RELP analysis relies on differences and similarities in the endogenous genomic sequence of one plant when compared to the endogenous genomic sequence of another plant.

SUMMARY OF THE INVENTION The present invention relates to a novel method for registering plants or plant cells by introducing a predetermined DNA sequence into the plant genome. These DNs
The A sequence can be easily detected and recovered by standard techniques such as Southern blotting or polymerase chain reaction (PCR).

Accordingly, the present invention relates to a method for producing
It features a method of genetically marking a plant for identification by introducing a unique DNA sequence in the plant genome into the plant genome. The DNA sequence is 80
Not more than 100 base pairs (eg, not more than 60 or 40 base pairs), or at least 1
0 base pairs (eg, at least 30, 50, or 70 base pairs)
Base pairs). The DNA sequence comprises: (1) a 10 base pair first sequence; (2) at least two tandem repeats of a discrimination sequence of 6 base pairs or more; and (3) a 10 base pair second sequence. be able to. Instead, the DNA sequence comprises: (1) a 10 base pair first sequence; (2)
And (3) a second sequence of 10 base pairs, wherein the first sequence and the second sequence are identical. A tandem repeat refers to a copy of a single sequence, all in the same orientation, along one strand of a double-stranded DNA molecule. By identical sequence is meant the same sequence in the same 5 'to 3' orientation.

[0005] The invention further provides a method of genetically marking a plant for identification by introducing the DNA sequence into the plant genome, wherein the DNA sequence is unique in the plant genome. In a linear order along said DNA sequence, (1) a 10 base pair first sequence;
(2) at least two tandem repeats of an identification sequence of 6 base pairs or more; and (3) a second sequence of 10 base pairs, wherein the first sequence, the second sequence, and the identification sequence But not a sequence that alters transcription or encodes a functional protein. The DNA sequence optionally includes a selectable marker gene.

Further, the present invention is a method for genetically marking a plant for identification by introducing the DNA sequence into the plant genome, wherein said DNA sequence is unique in said plant genome. , A method that is not a sequence that alters transcription or that encodes a functional protein. The DNA sequence comprises: (1) a 10 base pair first sequence; (2) at least two tandem repeats of a discrimination sequence of 6 base pairs or more; and (3) a 10 base pair second sequence. be able to. Instead, the DNA
The sequences are (1) a 10 base pair first sequence; (2) a 6 base pair or more intervening sequence; and (3) a 10 base pair second sequence, wherein the first sequence and the second sequence Can be included.

Further, the present invention is a method for genetically marking a plant for identification by introducing the DNA sequence into the plant genome, wherein said DNA sequence is unique in said plant genome. In a linear order along said DNA sequence, (1) a 10 base pair first sequence;
(2) an intervening sequence of 6 base pairs or more; and (3) a sequence comprising a 10 base pair second sequence, wherein the first sequence, the second sequence, and the identification sequence alter transcription. The method includes a method in which the first sequence and the second sequence are the same, but not the sequence encoding a functional protein. The DNA sequence can optionally include a selectable marker gene.

[0008] The DNA sequence used in the method of the present invention may be prepared by any standard technique known in the art.
For example, Agrobacterium tumefaciens (Agro
bacterium tumefaciens) or the particle gun method.

[0009] The selectable marker gene optionally used in the method of the present invention may be any gene whose activity facilitates the selection of plant cells containing the introduced DNA sequence.

A functional protein is a polypeptide having a known biochemical activity in addition to its structural characteristics (eg, molecular weight, pKa, isoelectric point, etc.). Thus, a polypeptide with a molecular weight of 20 kDa on a gel and nothing else is not a functional protein.

The method of the present invention provides a novel means of identifying plants by introducing a unique foreign DNA sequence into the plant genome. In some embodiments, the DNA sequence does not include a sequence that affects plant gene expression or a sequence that encodes a functional protein. Such a D
The NA sequence has various advantages. For example, the foreign DNA sequence has no effect on plant biology,
This reduces the political and social concerns that a recombinant plant having a different biological activity than a wild-type plant is dangerous to humans or the environment. It is therefore expected that plants approved in the art for human consumption or cultivation can be genetically marked without any regulatory obstacles.

[0012] Other features or advantages of the present invention will be apparent from the following figures and detailed description.

DESCRIPTION OF THE DRAWINGS FIG. 1 is an illustration of some DNA sequences used in the method of the present invention to identify the geographic origin of a plant. Ten base pair tandem repeats are of geographic origin in plants, eg, the United States (AAAAA
AAAAA; SEQ ID NO: 1), Africa (CCCCCCCC
CCC; SEQ ID NO: 2), Asia (GGGGGGGGGG
G; SEQ ID NO: 3), Europe (TTTTTTTTTT
T; SEQ ID NO: 4) or Pacific Island (ACACCACA)
CAC; SEQ ID NO: 5). Each box between these tandem repeats represents additional sequence information regarding the nature and origin of the plant.

FIG. 2 shows the specific 100 base pair DNA used to mark plants from the United States.
FIG. 4 is an illustration of the sequence, and the primer sequence (AAAAAAAAA).
AAAAACCCCAAAGTAAAACCCAAAAG
TAAACCCCAAAGTAAAAAAAAAAA; SEQ ID NO: 6) is omitted.

DETAILED DESCRIPTION The present invention is based on a novel means for genetically marking a plant or plant cell by introducing an artificial DNA sequence into the genome of the plant cell.

Within the scope of the present invention, the use of short sequences (less than 100 base pairs) is envisaged. The short sequence is divided into four parts that identify the plant owner (eg, company), geographical origin (eg, Europe), national origin (eg, Germany), and other plant characteristics (eg, tomato). can do.

Without further elaboration, it is believed that one skilled in the art can, using the preceding disclosure and the following description, utilize the present invention to its fullest extent. The following description is to be construed as merely illustrative of how those skilled in the art can practice the invention, and should not limit the remainder of the disclosure in any way. Any publications cited in this disclosure section are hereby incorporated by reference.

<100 bp registered sequence> Short fragments of DNA of 100 bp or less and their complementary strands can be synthesized using standard oligonucleotide synthesis techniques. The fragment can be modified to include flanking sequences for cloning into a plasmid vector. One type of DNA sequence useful in the method of the invention is illustrated in FIG.

Referring to FIG. 1, there is shown a set of DNA sequences, each marking a plant from a particular region of the world. 100 bp DNA from 5 'to 3'
The sequence consists of (1) a 22 base pair primer sequence A, (2)
A 10 base pair sequence representing the geographical origin of the plant (SEQ ID NO:
1-5), (3) a 36 base pair identification sequence described below,
(4) a tandem repeat of a 10 base pair sequence, and (5)
Contains 22 base pair primer sequence B. The identifier sequence is a triple tandem repeat of a 12 nucleotide sequence,
This 12 nucleotide sequence consists of, in linear order, 3 nucleotides to identify the country origin of the plant, 4 nucleotides to identify the company owner, and 5 nucleotides to identify the properties of the plant. This "3 + 4 + 5" I
The D sequence is repeated three times without intervening sequences between the repeated sequences.

In general, the identification sequence contains information that clearly identifies the marked plant. In the above example, the identification sequences include sequences that mark the country origin of the plant, the owner of the plant, and various properties of the plant.

These sequences were converted to plasmid vectors (eg, standard pBI with the kanamycin selectable marker removed).
For introduction into an Agrobacterium tumefaciens binary vector (such as 101), the ID sequence can be chemically or enzymatically introduced into the vector.
The complete 100 base pair sequence can be introduced into the appropriate region of the vector by standard cloning techniques (Sambrook et al., Eds., Molecular Cloning: A Laborat.
ory Manual.2nd, ed., Cold Spring Harbor Laborator
y, Cold Spring Harbor Laboratory Press, Cold Sprin
g Harbor, NY, 1989).

PBI containing the sequence to be introduced into the plant genome
101 can be used to transform the common Agrobacterium tumefaciens strain LBA4404 by electroporation or freeze / thaw. The transformed bacteria are then used to infect target plant cells. After cloning and culturing the plant cells, individual clones containing the 100 base pair sequence (typically at least 10 clones) were isolated from the genomic DNA from which the primers A and B were isolated.
Confirm by performing PCR using The PCR product is optionally sequenced, if possible. Thereafter, the confirmed clones are differentiated into grown plants.

The integrated identification sequence is the first shoot,
It can be confirmed secondarily by isolating genomic DNA from seedlings or other tissues and performing PCR using primers A and B. Again, PCR
The product can also be sequenced. At this time, the phenotype and ploidy of the plant should also be confirmed.

A more detailed description of the above plasmids and bacterial strains can be found in Kado, Genet Eng20: 1-24, 1998;
ormac et al., Mol Biotechnol 9: 155-159, 1998; Guerrero
Et al., Plant Mol Biol 21: 929-935, 1993; and the references cited herein.

<Inclusion of Selection Marker> To facilitate the isolation of a plant cell clone containing the registered sequence,
The base sequence registration sequence was replaced with a wild-type pBI as shown in FIG.
It can be cloned into the 101 vector. Thereafter, this plasmid is introduced into plant cells by the gold particle gun method (for example, Wakita et al., Genes Genet Syst 73:
219-226, 1998; Sawasaki et al., Gene 218: 27-35, 1998;
And references cited herein).
Briefly, 37 μL of a 40 mg / mL gold stock solution (1.6 μm diameter; BioRad) was added to 25 μL of water and 2
Mix sequentially with μg of plasmid DNA in a 250 μL Eppendorf tube. The tubes are vortexed before and after each addition. 20 μL
100 nM free base spermidine and 50 μL of 2.5 M
The CaCl ₂ is placed in separate drops on the side wall of the tube so that each solution does not mix prematurely with the DNA / gold solution.
The tube is then mixed by vortexing for 10 seconds to aggregate the DNA into gold particles, which precipitate. Centrifuge the tube for 5 seconds and remove the supernatant. Add 100 μL of 100% ethanol and place the tube on ice. A 5 μL volume of the sonicated gold / DNA mixture is then used for each particle gun drive.

Thereafter, the cells into which the gold / DNA mixture has been implanted are grown on a medium containing sufficient kanamycin, and
A plant cell containing a sequence of 00 base pairs is selected. Each group or portion of kanamycin resistant tissue (typically at least 10 clones) is considered to have independently undergone transformation. Thereafter, the transformed tissue is differentiated into a grown plant. Confirmation of the existence of the registered sequence is performed as described above.

<Registration Number System> The incorporated registration sequence can be PCR-amplified and sequenced from any registered plant. The resulting sequence can be used to assign a registration number to the plant. For example,
The “3 + 4 + 5” ID array is converted into the following numbers. Let A = 1, C = 2, G = 3, and T = 4 for each base. At this time, AAAACCTAAAGT of 12 base pairs of direct repeat sequence (SEQ ID NO: 7; see FIG. 2) is composed of a series of Arabic numerals 111222241113.
4 is converted. Note that the sequence CCCT and the corresponding Arabic numeral 2224 represent plant owners (see above). The Arabic numerals from the 12 base pair sequence add up to a total of 23. Thus, under this system, the plant corresponds to the genetically assigned accession number 22224.23.

When the assigned registered sequence is not a sequence that affects plant transcription or a sequence that encodes a functional protein, the registered sequence excludes the owner who kept the primer A sequence, the primer B sequence, or both secret. It remains hidden from everyone. This is because, biologically and biochemically, these marked plants are no different from the original unmarked plants.

[Alternative Embodiment] Although the present invention has been described in accordance with the detailed description of the present invention, the above description is for the purpose of illustrating the present invention, and is not intended to limit the scope of the present invention. It should be understood that this is limited by the appended claims. Other views, advantages, and improvements are within the scope of the invention.

For example, an additional code layer can be used with the method of the invention to protect the transparency of the assigned genetic marker.

[Brief description of the drawings]

FIG. 1 shows a DNA sequence for identifying the geographical origin of a plant.

FIG. 2 is a view showing a DNA sequence for marking a plant derived from the United States.

 ────────────────────────────────────────────────── ─── Continued on the front page (71) Applicant 599058268 Chen-Yuan Kao Taiwan, Taipei, Section 1 Chen-Quo N Road, Lane 23, Number 30, Seventh Floor (72) Inventor Chen -Yuan Kao Taiwan, Taipei, Section 1, Chen-Kuo N Road, Lane 23, Number 30, Seventh Floor F Term (Reference) 2B030 AB04 AD20 CA06 CA17 4B024 AA08 BA80 CA05 DA01 EA06 EA10 FA10 GA27 HA20 4B065 AA11X AA89X AA99Y AB01 BA02 BA25 CA53

Claims (20)

[Claims] 1. A method for genetically marking plants for identification, comprising a DNA comprising less than 100 base pairs.
A method comprising introducing a sequence into the plant genome, wherein said DNA sequence is unique in said plant genome. 2. The method of claim 1, wherein said DNA sequence comprises no more than 80 base pairs. 3. The method of claim 2, wherein said DNA sequence consists of no more than 60 base pairs. 4. The method of claim 3, wherein said DNA sequence comprises no more than 40 base pairs. 5. The method of claim 1, wherein said DN
The A sequence is (1) a first base sequence of 10 base pairs; (2) at least two tandem repeats of a discrimination sequence of 6 base pairs or more;
And (3) a method comprising a 10 base pair second sequence. 6. The method of claim 1, wherein the DN
The A sequence comprises: (1) a first sequence of 10 base pairs; (2) an intervening sequence of 6 base pairs or more; and (3) a second sequence of 10 base pairs. The method wherein the two sequences are identical. 7. The method of claim 1, wherein said DN
The A sequence is replaced with Agrobacterium tumefaciens (Ag
robacterium tumefaciens) into the plant genome. 8. The method of claim 1, wherein said DNA sequence consists of at least 10 base pairs. 9. The method of claim 8, wherein said DNA sequence consists of at least 30 base pairs. 10. The method of claim 9, wherein said DNA sequence consists of at least 50 base pairs. 11. The method of claim 1, wherein said DNA sequence consists of at least 70 base pairs. 12. A method for genetically marking a plant for identification, comprising introducing a DNA sequence into the plant genome, wherein said DNA sequence is unique in said plant genome, In a linear order along the sequence: (1) a 10 base pair first sequence; (2) at least two tandem repeats of a discriminating sequence of 6 base pairs or more; and (3) a 10 base pair A method comprising two sequences, wherein the first sequence, the second sequence, and the identification sequence are not sequences that alter transcription or encode a functional protein. 13. The method of claim 11, wherein said DNA sequence further comprises a selectable marker gene. 14. The method according to claim 14, wherein the DNA sequence is used for Agrobacterium tumefaciens.
12. The method of claim 11, wherein the method is introduced by: 15. A method for genetically marking a plant for identification, comprising introducing a DNA sequence into the plant genome, wherein said DNA sequence is unique in said plant genome and A method that is not a sequence to be altered or a sequence encoding a functional protein. 16. The method of claim 15, wherein the DNA sequence comprises: (1) a first sequence of 10 base pairs; (2)
A method comprising at least two direct repeats of a discriminating sequence of 6 base pairs or more; and (3) a second sequence of 10 base pairs. 17. The method of claim 15, wherein the DNA sequence comprises: (1) a 10 base pair first sequence; (2)
And (3) a method comprising a 10 base pair second sequence, wherein the first sequence and the second sequence are the same. 18. The method according to claim 18, wherein the DNA sequence is obtained by Agrobacterium tumefaciens.
16. The method of claim 15, wherein the method is introduced by: 19. A method for genetically marking a plant for identification, comprising introducing a DNA sequence into the plant genome, wherein said DNA sequence is unique in said plant genome. In a linear order along the sequence, said first sequence comprises: (1) a 10 base pair first sequence; (2) a 6 base pair or more intervening sequence; and (3) a 10 base pair second sequence. A method wherein one sequence, the second sequence, and the intervening sequence are not sequences that alter transcription or encode a functional protein, and wherein the first sequence and the second sequence are identical. 20. The method of claim 19, wherein said DNA sequence further comprises a selectable marker gene.