JP2000290242A - Non-peptidic dipeptide analogue - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new compound having a stable non-peptidic structure to proteases existing in a large amount in organisms, and having specificity and excellent inhibiting activity to human acquired immune deficiency syndrome virus proteases. SOLUTION: This new compound is expressed by formula I [wherein, R1 is a (substituted) 8-16C aralkyloxycarbonyl, a (substituted) 7-15C arylcarbonyl or the like; R2 is a (substituted) 6-14C aryl; R3 is H, a (substituted) 1-10C alkyl or the like; R4 is a (substituted) 1-15C alkyl, a (substituted) 7-15C aralkyl or the like] and is e.g. N- 4-[acetyl-(1-tert-butylcarbamoyl-2-phenyl-ethyl)-amino]1- benzyl-2-hydroxy-butyl}-3-hydroxy-2-methylbenzamide. The compound of formula I is obtained e.g. by reacting a compound of formula II with an amino compound to obtain a compound of formula III, by reacting it with a metallized vinyl compound to obtain a compound of formula IV and then by the Michael addition reaction of it with an amine, followed by reducing the reaction product.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a non-peptide dipeptide analog having excellent inhibitory activity on a protease derived from human acquired immunodeficiency syndrome virus (HIV) (hereinafter referred to as HIV protease).

[0002]

BACKGROUND OF THE INVENTION Human acquired immunodeficiency syndrome (AIDS)
Is a disease caused by a retrovirus called HIV, which is one of the retin viruses. According to the World Health Organization (WHO), about 10 million people worldwide are affected by the disease, and the number is expected to continue to increase. Also, the disease is fatal and no cure for cure has yet been established. Currently, HIV reverse transcriptase inhibitors such as didopsin and saquinavir, indinavir, ritonavir,
Treatments with combinations of HIV protease inhibitors such as nelfinavir have been tried and confirmed to some extent, but the virus has not been completely removed from the body.

[0003] A general feature of retroviral replication is that the proteases produced by the virus process the precursor proteins of the virus to produce the mature protein required for virus composition and function.
Therefore, if this processing is inhibited, it is considered that infectious viruses can be prevented. For example,
Natl. Acad. Sci., 85 , 4686 (1988) report that Kohl, NE et al. Found that mature infectious virions are not produced when the HIV-encoded protease becomes genetically inactive. It is clear that. That is, inhibition of HIV protease is considered to be effective for prevention or treatment of HIV infection and treatment of AIDS.

[0004] Based on these ideas, HIV protease inhibitors have been searched, and many inhibitors have already been synthesized and found in nature.
Those showing IV activity have been reported (S. Thaisrivong
s, Ann. Reprts in Med. Chem., 1994, 133-1.
P. 44; A. Wlodawer, Pharmacotherapy 1994, 14
Volume (6 Pt2), 9S-20S; G. Moyle and B. Gazzard, Drug
s, 1996, 51, 701-712).

[0005]

However, hitherto found HIV protease inhibitors generally inhibit the replication of HIV in infected cells in the body even when administered orally or parenterally in vivo. Blood levels cannot be maintained for long periods of time and must be administered in clinically large amounts.

The compound of the present invention has a non-peptide structure that is stable to proteases that are often present in the living body, is specific for HIV protease, has excellent inhibitory activity, It is effective even at low concentrations in experiments. The compounds of the present invention are small molecules and have anti-H
A blood concentration at which IV activity can be sufficiently expected can be achieved by oral or parenteral administration.

[0007]

Means for Solving the Problems The present inventors have conducted intensive studies on compounds capable of overcoming the drawbacks of these existing drugs. As a result, a large number of certain non-peptide dipeptide analogs are present in vivo. It has been found that it is stable to proteases, specific to HIV protease, has excellent inhibitory activity, is effective even at low concentrations in cell experiments, and the analog is a small molecule. The present inventors have found that a blood concentration at which anti-HIV activity can be sufficiently expected in vivo can be achieved by oral or parenteral administration, and completed the present invention.

The non-peptide dipeptide analog of the present invention has the general formula

[0009]

Embedded image [Wherein, R ¹ is an aralkyloxycarbonyl group having 8 to 16 carbon atoms which may have a substituent, an alkyloxycarbonyl group having 2 to 10 carbon atoms which may have a substituent, or R 7 represents an arylcarbonyl group having 7 to 15 carbon atoms which may have a substituent, R ² represents an aryl group having 6 to 14 carbon atoms which may have a substituent, and R ³ represents A hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a substituent, an acyl group having 2 to 15 carbon atoms which may have a substituent, 1 to 10 carbon atoms
Represents an alkylsulfonyl group or an arylsulfonyl group having 6 to 14 carbon atoms which may have a substituent,
R ⁴ is an alkyl group having 1 to 15 carbon atoms which may have a substituent, an aralkyl group having 7 to 15 carbon atoms which may have a substituent or a group represented by the formula R ⁶ NHCOCH (R ⁵ ) −
A group (wherein R ⁵ is a group having 1 carbon atom which may have a substituent)
An alkyl group having 6 to 14 carbon atoms, an aryl group having 6 to 14 carbon atoms which may have a substituent, or an aralkyl group having 7 to 15 carbon atoms which may have a substituent;
⁶ is an alkyl group having 1 to 6 carbon atoms which may have a substituent, and 6 to 14 carbon atoms which may have a substituent.
And represents an aryl group, an aralkyl group having 7 to 15 carbon atoms which may have a substituent or a cycloalkyl group having 3 to 8 carbon atoms. ). Or a pharmacologically acceptable salt thereof or a prodrug thereof.

In the above formula (1), R ^{1 represents} an “aralkyloxycarbonyl group having 8 to 16 carbon atoms” of the “aralkyloxycarbonyl group having 8 to 16 carbon atoms which may have a substituent”. Is, for example, benzyloxycarbonyl, α-naphthylmethyloxycarbonyl, β-naphthylmethyloxycarbonyl, naphthylmethyloxycarbonyl, diphenylmethyloxycarbonyl,
Phenethyloxycarbonyl, 1-naphthylethyloxycarbonyl, 2-naphthylethyloxycarbonyl,
1-phenylpropyloxycarbonyl, 2-phenylpropyloxycarbonyl, 3-phenylpropyloxycarbonyl, 1-naphthylpropyloxycarbonyl, 2-naphthylpropyloxycarbonyl, 3-naphthylpropyloxycarbonyl, 1-phenylbutyloxycarbonyl, 2 -Phenylbutyloxycarbonyl, 3-phenylbutyloxycarbonyl, 4-phenylbutyloxycarbonyl, 1-naphthylbutyloxycarbonyl, 2-naphthylbutyloxycarbonyl, 3
-Naphthylbutyloxycarbonyl, 4-naphthylbutyloxycarbonyl, 1-phenylpentyloxycarbonyl, 2-phenylpentyloxycarbonyl, 3-
Phenylpentyloxycarbonyl, 4-phenylpentyloxycarbonyl, 5-phenylpentyloxycarbonyl, 1-naphthylpentyloxycarbonyl, 2
-Naphthylpentyloxycarbonyl, 3-naphthylpentyloxycarbonyl, 4-naphthylpentyloxycarbonyl, 5-naphthylpentyloxycarbonyl,
Suitable examples include 1-phenylhexyloxycarbonyl, 2-phenylhexyloxycarbonyl, 3-phenylhexyloxycarbonyl, 4-phenylhexyloxycarbonyl, 5-phenylhexyloxycarbonyl, 6-phenylhexyloxycarbonyl group, and the like. Is a benzyloxycarbonyl group.

In the above formula (1), the “substituent” of the “optionally substituted aralkyloxycarbonyl group having 8 to 16 carbon atoms” for R ¹ includes, for example, methyl, ethyl, n Alkyl groups having 1 to 4 carbon atoms such as -propyl, isopropyl, n-butyl, isobutyl, s-butyl, tert-butyl; methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy,
1 to 4 carbon atoms such as s-butoxy and tert-butoxy
Alkoxy groups; fluorine atom, chlorine atom, bromine atom,
A halogen atom such as an iodine atom;
Preferably, it is a methyl group, a methoxy group, a fluorine atom or a chlorine atom.

In the above formula (1), the “aralkyloxycarbonyl group having 8 to 16 carbon atoms which may have a substituent” for R ¹ is preferably a methyl group, a methoxy group, a fluorine atom or A benzyloxycarbonyl group optionally substituted with a chlorine atom, more preferably a benzyloxycarbonyl group.

In the above formula (1), R ^{1 represents} “optionally substituted alkyloxycarbonyl group having 2 to 10 carbon atoms” as “alkyloxycarbonyl group having 2 to 10 carbon atoms”. Is, for example, methoxycarbonyl, ethoxycarbonyl, n-propoxycarbonyl, isopropoxycarbonyl, n-butoxycarbonyl, s-butoxycarbonyl, isobutoxycarbonyl, tert-butoxycarbonyl, n-pentoxycarbonyl, 1-methylbutoxycarbonyl, 2-methylbutoxycarbonyl, isopentoxycarbonyl, 1-ethylpropoxycarbonyl, neopentoxycarbonyl, n-hexyloxycarbonyl, 1-methylpentoxycarbonyl,
2-methylpentoxycarbonyl, 3-methylpentoxycarbonyl, isohexyloxycarbonyl, 1,1
-Dimethylbutoxycarbonyl, 2,2-dimethylbutoxycarbonyl, 3,3-dimethylbutoxycarbonyl, 1,2-dimethylbutoxycarbonyl, 1,3-dimethylbutoxycarbonyl, 2,3-dimethylbutoxycarbonyl, 2-ethylbutoxycarbonyl , Heptyloxycarbonyl, 1-methylhexyloxycarbonyl, 2-methylhexyloxycarbonyl, 3-methylhexyloxycarbonyl, 4-methylhexyloxycarbonyl, 5-methylhexyloxycarbonyl, 1
-Propylbutoxycarbonyl, 4,4-dimethylpentoxycarbonyl, octyloxycarbonyl, 1-methylheptyloxycarbonyl, 2-methylheptyloxycarbonyl, 3-methylheptyloxycarbonyl, 4-methylheptyloxycarbonyl, 5-methylheptyl Oxycarbonyl, 6-methylheptyloxycarbonyl, 1-propylpentoxycarbonyl, 2-
Ethylhexyloxycarbonyl, 5,5-dimethylhexyloxycarbonyl, nonyloxycarbonyl, 3
-Methyloctyloxycarbonyl, 4-methyloctyloxycarbonyl, 5-methyloctyloxycarbonyl, 6-methyloctyloxycarbonyl, 1-propylhexyloxycarbonyl, 2-ethylheptoxycarbonyl, 6,6-dimethylheptoxycarbonyl group And the like, and preferably an ethyloxycarbonyl or tert-butoxycarbonyl group.

In the above formula (1), examples of the “substituent” of the “optionally substituted alkyloxycarbonyl group having 2 to 10 carbon atoms” for R ¹ include methoxy, ethoxy, n An alkoxy group having 1 to 4 carbon atoms such as propoxy, isopropoxy, n-butoxy, isobutoxy, s-butoxy and tert-butoxy; a halogen atom such as a fluorine atom, a chlorine atom, a bromine atom and an iodine atom; a hydroxyl group; Examples thereof include an amino group and the like, preferably a methoxy group, a fluorine atom or a chlorine atom.

In the above formula (1), the “optionally substituted alkyloxycarbonyl group having 2 to 10 carbon atoms” for R ¹ is preferably a methoxy group, a fluorine atom or a chlorine atom. It is a tert-butoxycarbonyl group which may be substituted, and more preferably a tert-butoxycarbonyl group. In the above formula (1), the “arylcarbonyl group having 7 to 15 carbon atoms” of the “arylcarbonyl group having 7 to 15 carbon atoms which may have a substituent” for R ¹
Examples thereof include a benzoyl, indenylcarbonyl, 1-naphthylcarbonyl, 2-naphthylcarbonyl, phenanthrenylcarbonyl, anthracenylcarbonyl group and the like, and a benzoyl group is preferable.

In the above formula (1), the “substituent” of the “optionally substituted arylcarbonyl group having 7 to 15 carbon atoms” for R ¹ includes, for example, methyl, ethyl,
1-4 carbon atoms such as n-propyl, isopropyl, n-butyl, isobutyl, s-butyl and tert-butyl
Alkyl groups, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, s
An alkoxy group having 1 to 4 carbon atoms such as -butoxy and tert-butoxy; a halogen atom such as a fluorine atom, a chlorine atom, a bromine atom and an iodine atom; a hydroxyl group; Or it is a hydroxyl group.

In the above formula (1), the “optionally substituted arylcarbonyl group having 7 to 15 carbon atoms” for R ¹ is preferably a 3-hydroxy-2-methylbenzoyl or a 3-hydroxy-2-methylbenzoyl. -Hydroxy-2,5-dimethylbenzoyl group.

In the above formula (1), examples of the “aryl group having 6 to 14 carbon atoms” of the “aryl group having 6 to 14 carbon atoms which may have a substituent” for R ² include, for example, Examples include a phenyl, indenyl, naphthyl, phenanthrenyl, anthracenyl group and the like, and preferably a phenyl group, a 2-naphthyl group or a biphenyl group.

In the above formula (1), examples of the “optionally substituted aryl group having 6 to 14 carbon atoms” and “substituent” for R ² include, for example, methyl, ethyl, n-propyl, An alkyl group having 1 to 4 carbon atoms such as isopropyl, n-butyl, isobutyl, s-butyl and tert-butyl; methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, s-butoxy, te
an alkoxy group having 1 to 4 carbon atoms such as rt-butoxy; a fluorine atom, a chlorine atom, a bromine atom, a halogen atom such as an iodine atom and the like; and a phenyl group, preferably methyl, methoxy, It is a fluorine atom, a chlorine atom or a phenyl group, and more preferably a phenyl group.

In the above formula (1), the “aryl group having 6 to 14 carbon atoms which may have a substituent” for R ² is preferably methyl, methoxy, fluorine atom, chlorine atom or phenyl. A phenyl or 2-naphthyl group which may be substituted with a group; and a phenyl, 2-naphthyl or biphenyl group.

In the above formula (1), the “alkyl group having 1 to 10 carbon atoms” of the “alkyl group having 1 to 10 carbon atoms which may have a substituent” for R ³ includes, for example, Methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, isobutyl, tert-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-hexyl, -Methylpentyl, 2-methylpentyl, 3-methylpentyl, isohexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl , 2,3-dimethylbutyl, 2-ethylbutyl, heptyl, 1-methylhexyl, 2-methylhexyl, 3-
Methylhexyl, 4-methylhexyl, 5-methylhexyl, 1-propylbutyl, 4,4-dimethylpentyl, octyl, 1-methylheptyl, 2-methylheptyl, 3-methylheptyl, 4-methylheptyl, 5-methyl Heptyl, 6-methylheptyl, 1-propylpentyl, 2-ethylhexyl, 5,5-dimethylhexyl, nonyl, 3-methyloctyl, 4-methyloctyl, 5-methyloctyl, 6-methyloctyl, 1-propylhexyl, 2-ethylheptyl, 6,6-dimethylheptyl, decyl, 1-methylnonyl, 3-methylnonyl, 8-methylnonyl, 3-ethyloctyl, 3,7
-Dimethyloctyl, 7,7-dimethyloctyl group and the like, preferably having 1 to 4 carbon atoms, and more preferably a methyl group.

In the above formula (1), examples of the “substituent” of the “optionally substituted alkyl group having 1 to 10 carbon atoms” for R ³ include, for example, methoxy, ethoxy, n-propoxy An alkoxy group having 1 to 4 carbon atoms such as isopropoxy, n-butoxy, isobutoxy, s-butoxy and tert-butoxy; a halogen atom such as a fluorine atom, a chlorine atom, a bromine atom and an iodine atom; a hydroxyl group; And a methoxy group, a fluorine atom or a chlorine atom.

In the above formula (1), the “optionally substituted alkyl group having 1 to 10 carbon atoms” for R ³ is preferably an unsubstituted alkyl group having 1 to 4 carbon atoms. And more preferably a methyl group.

In the above formula (1), R ^{3 represents} an “acyl group having 2 to 15 carbon atoms which may have a substituent”.
Examples of the `` acyl group to -15 '' include, for example, acetyl, propionyl, butyryl, isobutyryl, valeryl, isovaleryl, pivaloyl, octanoyl, nonylcarbonyl, decylcarbonyl, 3-methylnonylcarbonyl,
Aliphatic acyl groups such as 8-methylnonylcarbonyl, 3-ethyloctylcarbonyl, 3,7-dimethyloctylcarbonyl, undecylcarbonyl, dodecylcarbonyl, tridecylcarbonyl, tetradecylcarbonyl; benzoyl, α-naphthoyl, β- Examples include an aromatic acyl group such as naphthoyl, and preferably,
It has 2 to 6 carbon atoms, more preferably an acetyl group or a propionyl group.

In the above formula (1), examples of the “substituent” of the “optionally substituted acyl group having 2 to 15 carbon atoms” for R ³ include, for example, methoxy, ethoxy, n-propoxy An alkoxy group having 1 to 4 carbon atoms such as isopropoxy, n-butoxy, isobutoxy, s-butoxy, tert-butoxy; a halogen atom such as a fluorine atom, a chlorine atom, a bromine atom or an iodine atom; a hydroxyl group; Examples include a group and the like, preferably methyl, methoxy, a fluorine atom or a chlorine atom.

In the above formula (1), the “optionally substituted acyl group having 2 to 15 carbon atoms” for R ³ is preferably an unsubstituted acyl group having 2 to 6 carbon atoms. And more preferably an acetyl or propionyl group.

In the above formula (1), “C 1 to C 1” of R ³
Examples of the "zero alkylsulfonyl group" include, for example, methanesulfonyl, ethanesulfonyl, n-propanesulfonyl, isopropanesulfonyl, n-butanesulfonyl, isobutanesulfonyl, s-butanesulfonyl, te
rt-butanesulfonyl, n-pentanesulfonyl, isopentanesulfonyl, 2-methylbutanesulfonyl, neopentanesulfonyl, n-hexanesulfonyl, 4-
Methylpentanesulfonyl, 3-methylpentanesulfonyl, 2-methylpentanesulfonyl, 3,3-dimethylbutanesulfonyl, 2,2-dimethylbutanesulfonyl, 1,1-dimethylbutanesulfonyl, 1,2-dimethylbutanesulfonyl, 1, 3-dimethylbutanesulfonyl, 2,3-dimethylbutanesulfonyl n-heptanesulfonyl, 1-methylhexanesulfonyl, 4-methylhexanesulfonyl, 4,4-dimethylpentanesulfonyl, n-octanesulfonyl, 2-methylheptanesulfonyl, 5 -Methylheptanesulfonyl, 2-ethylhexanesulfonyl, 5,5-dimethylhexanesulfonyl, n-nonanesulfonyl, 3-methyloctanesulfonyl, 6-methyloctanesulfonyl, 1-propylhexanesulfonyl And 6,6-dimethylheptanesulfonyl, n-decanesulfonyl, 3-methylnonanesulfonyl, 8-methylnonanesulfonyl, 3-ethyloctanesulfonyl, 7,7-dimethyloctanesulfonyl and the like. Has 1 to 4 carbon atoms, and is more preferably a methanesulfonyl group.

In the above formula (1), the “arylsulfonyl group having 6 to 14 carbon atoms” of the “arylsulfonyl group having 6 to 14 carbon atoms which may have a substituent” for R ³
Examples thereof include phenylsulfonyl, indenylsulfonyl, naphthylsulfonyl, phenanthrenylsulfonyl, anthracenylsulfonyl and the like, and a phenylsulfonyl group is preferred.

In the above formula (1), as the “substituent” of the “optionally substituted arylsulfonyl group having 6 to 14 carbon atoms” for R ³ , for example, methyl, ethyl,
1-4 carbon atoms such as n-propyl, isopropyl, n-butyl, isobutyl, s-butyl and tert-butyl
Alkyl groups; methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, s
-An alkoxy group having 1 to 4 carbon atoms such as butoxy and tert-butoxy; and a halogen atom such as a fluorine atom, a chlorine atom, a bromine atom and an iodine atom, preferably a methyl group or a methoxy group. It is.

In the above formula (1), the “optionally substituted arylsulfonyl group having 6 to 14 carbon atoms” for R ³ is preferably p-toluenesulfonyl, p-methoxybenzenesulfonyl Or a mesitylenesulfonyl group.

In the above formula (1), examples of the “optionally substituted alkyl group having 1 to 15 carbon atoms” for R ⁴ include, for example, methyl, ethyl, n-propyl, isopropyl, n- Butyl, s-butyl, isobutyl, tert-butyl, n-pentyl, 1-methylbutyl, 2-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methyl Pentyl, isohexyl, 1,1-
Dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, 2-ethylbutyl, heptyl, 1-methylhexyl, -Methylhexyl, 3-methylhexyl, 4-methylhexyl, 5-methylhexyl, 1-propylbutyl, 4,4-dimethylpentyl, octyl, 1-methylheptyl, 2-methylheptyl, 3-methylheptyl, 4- Methylheptyl,
5-methylheptyl, 6-methylheptyl, 1-propylpentyl, 2-ethylhexyl, 5,5-dimethylhexyl, nonyl, 3-methyloctyl, 4-methyloctyl, 5-methyloctyl, 6-methyloctyl, 1-
Propylhexyl, 2-ethylheptyl, 6,6-dimethylheptyl, decyl, 1-methylnonyl, 3-methylnonyl, 8-methylnonyl, 3-ethyloctyl, 3,
7-dimethyloctyl, 7,7-dimethyloctyl, undecyl, 4,8-dimethylnonyl, dodecyl, tridecyl, tetradecyl, pentadecyl, 3,7,11-trimethyldodecyl group, and the like.
It has 1 to 4 carbon atoms, more preferably a methyl, ethyl or isopropyl group.

In the above formula (1), examples of the “substituent” of the “optionally substituted alkyl group having 1 to 15 carbon atoms” as R ⁴ include, for example, methoxy, ethoxy, n-propoxy An alkoxy group having 1 to 4 carbon atoms such as isopropoxy, n-butoxy, isobutoxy, s-butoxy and tert-butoxy; a halogen atom such as a fluorine atom, a chlorine atom, a bromine atom and an iodine atom; And preferably a methoxy group, a hydroxyl group, a fluorine atom or a chlorine atom.

In the above formula (1), the “optionally substituted alkyl group having 1 to 15 carbon atoms” for R ⁴ preferably has 1 to 4 carbon atoms. More preferably, it is an ethyl, 2-hydroxyethyl or isopropyl group.

In the above formula (1), examples of the “optionally substituted aralkyl group having 7 to 15 carbon atoms” for R ⁴ include benzyl, α-naphthylmethyl, β-naphthylmethyl, Indenylmethyl, phenanthrenylmethyl, anthracenylmethyl, diphenylmethyl, 1-phenethyl, 2-phenethyl, 1-naphthylethyl, 2-
Naphthylethyl, 1-phenylpropyl, 2-phenylpropyl, 3-phenylpropyl, 1-naphthylpropyl, 2-naphthylpropyl, 3-naphthylpropyl, 1
-Phenylbutyl, 2-phenylbutyl, 3-phenylbutyl, 4-phenylbutyl, 1-naphthylbutyl, 2
-Naphthylbutyl, 3-naphthylbutyl, 4-naphthylbutyl, 1-phenylpentyl, 2-phenylpentyl, 3-phenylpentyl, 4-phenylpentyl, 5
-Phenylpentyl, 1-naphthylpentyl, 2-naphthylpentyl, 3-naphthylpentyl, 4-naphthylpentyl, 5-naphthylpentyl, 1-phenylhexyl, 2-phenylhexyl, 3-phenylhexyl, 4
-Phenylhexyl, 5-phenylhexyl, 6-phenylhexyl and the like, and preferably a benzyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
In the case of representing a (R ⁵ ) — group, examples of the “alkyl group having 1 to 6 carbon atoms” of the “alkyl group having 1 to 6 carbon atoms which may have a substituent” for R ⁵ include, for example, , Methyl, ethyl, n-propyl, isopropyl, n-butyl, s-butyl, isobutyl, tert-butyl, n-pentyl, 1-
Methylbutyl, 2-methylbutyl, isopentyl, 1-
Ethylpropyl, neopentyl, n-hexyl, 1-methylpentyl, 2-methylpentyl, 3-methylpentyl, isohexyl, 1,1-dimethylbutyl, 2,2-
Examples thereof include dimethylbutyl, 3,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, and 2-ethylbutyl groups. Four, more preferably a tert-butyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
(R ⁵⁾ - in the case of a group, the "substituent" of the "carbon atoms which may have a substituent 1 to six alkyl group" for R ⁵ is, for example, methyl, ethyl, n- Propyl, isopropyl, n-butyl, isobutyl, s-butyl, tert
Alkyl groups having 1 to 4 carbon atoms such as -butyl; methoxy, ethoxy, n-propoxy, isopropoxy, n
-Alkoxy groups having 1 to 4 carbon atoms such as butoxy, isobutoxy, s-butoxy and tert-butoxy; halogen atoms such as fluorine, chlorine, bromine and iodine; benzyloxy and the like. And preferably a methoxy group, a fluorine atom, a chlorine atom or a benzyloxy group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
In the case where the (R ⁵ ) — group is represented, the “optionally substituted alkyl group having 1 to 6 carbon atoms” for R ⁵ is preferably
It has 1 to 4 carbon atoms which may have a substituent, and is more preferably a tert-butyl or benzyloxymethyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
In the case where the (R ⁵ )-group is represented, examples of the “optionally substituted aryl group having 6 to 14 carbon atoms” for R ⁵ include, for example, phenyl, indenyl, naphthyl, phenanthrenyl, anthracenyl group and the like. And preferably a phenyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
(R ⁵ ) — when representing a “substituent” of the “optionally substituted aryl group having 6 to 14 carbon atoms” of R ⁵
As, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, s-butyl, te
an alkyl group having 1 to 4 carbon atoms such as rt-butyl; methoxy, ethoxy, n-propoxy, isopropoxy,
C1 to C4 alkoxy groups such as n-butoxy, isobutoxy, s-butoxy and tert-butoxy; halogen atoms such as fluorine, chlorine, bromine and iodine; benzyl and the like. Yes, preferably
It has 1 to 4 carbon atoms, and is more preferably a methyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
The “aryl group having 6 to 14 carbon atoms which may have a substituent” for R ^{5 in} the case of representing a (R ⁵ ) — group is preferably a phenyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
In the case of representing a (R ⁵ ) — group, examples of the “aralkyl group having 7 to 15 carbon atoms” of the “aralkyl group having 7 to 15 carbon atoms which may have a substituent” for R ⁵ include, for example, Benzyl, α-naphthylmethyl, β-naphthylmethyl, indenylmethyl, phenanthrenylmethyl, anthracenylmethyl, diphenylmethyl, 1-phenethyl, 2-phenethyl, 1-naphthylethyl, 2-naphthylethyl,
1-phenylpropyl, 2-phenylpropyl, 3-phenylpropyl, 1-naphthylpropyl, 2-naphthylpropyl, 3-naphthylpropyl, 1-phenylbutyl, 2-phenylbutyl, 3-phenylbutyl, 4-phenylbutyl, 1-naphthylbutyl, 2-naphthylbutyl, 3-naphthylbutyl, 4-naphthylbutyl, 1-phenylpentyl, 2-phenylpentyl, 3-phenylpentyl, 4-phenylpentyl, 5-phenylpentyl, 1-naphthylpentyl, 2-naphthyl pentyl, 3
-Naphthylpentyl, 4-naphthylpentyl, 5-naphthylpentyl, 1-phenylhexyl, 2-phenylhexyl, 3-phenylhexyl, 4-phenylhexyl, 5-phenylhexyl, 6-phenylhexyl and the like. Preferably, it is a benzyl, naphthylmethyl or phenylethyl group, more preferably a benzyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
(R ⁵⁾ - in the case of a group, the "substituent" of the "substituted aralkyl group which may having 7 to 15 carbon have a" for R ⁵ is, for example, methyl, ethyl, n- An alkyl group having 1 to 4 carbon atoms such as propyl, isopropyl, n-butyl, isobutyl, s-butyl and tert-butyl; methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, s-butoxy , Te
an alkoxy group having 1 to 4 carbon atoms such as rt-butoxy; a halogen atom such as a fluorine atom, a chlorine atom, a bromine atom and an iodine atom; a hydroxyl group; a benzyloxy group; , A chlorine atom or a benzyloxy group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
The “aralkyl group having 7 to 15 carbon atoms which may have a substituent” for R ⁵ when it represents a (R ⁵ ) — group is preferably a benzyl group, a phenylethyl group, a naphthylmethyl group , A 4-chlorobenzyl group, a 4-benzyloxybenzyl group or a 4-hydroxybenzyl group, and more preferably a benzyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
In the case where the (R ⁵ )-group is represented, examples of the “optionally substituted alkyl group having 1 to 6 carbon atoms” for R ⁶ include, for example, methyl, ethyl, n-propyl, isopropyl, n
-Butyl, s-butyl, isobutyl, tert-butyl, n
-Pentyl, 1-methylbutyl, 2-methylbutyl, isopentyl, 1-ethylpropyl, neopentyl, n-
Hexyl, 1-methylpentyl, 2-methylpentyl,
3-methylpentyl, isohexyl, 1,1-dimethylbutyl, 2,2-dimethylbutyl, 3,3-dimethylbutyl, 1,2-dimethylbutyl, 1,3-dimethylbutyl, 2,3-dimethylbutyl, -Ethylbutyl group and the like, preferably having 1 to 4 carbon atoms, more preferably an ethyl group or a tert-butyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
In the case where the (R ⁵ ) — group is represented, the “C ⁶ carbon atom” of the “optionally substituted aryl group having 6 to 14 carbon atoms” for R 6
Examples of the “to 14 aryl groups” include phenyl, indenyl, naphthyl, phenanthrenyl, anthracenyl groups and the like, and a phenyl group is preferable.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
(R ⁵⁾ - in the case of a group, "substituent" of the "carbon atoms which may have a substituent 6 to 14 aryl groups" in R ⁶
As, for example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, s-butyl, te
an alkyl group having 1 to 4 carbon atoms such as rt-butyl; methoxy, ethoxy, n-propoxy, isopropoxy,
Alkoxy groups having 1 to 4 carbon atoms such as n-butoxy, isobutoxy, s-butoxy and tert-butoxy; and halogen atoms such as fluorine atom, chlorine atom, bromine atom and iodine atom. Is a methyl group, a methoxy group, a fluorine atom or a chlorine atom, and more preferably a methyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
In the case where the (R ⁵ )-group is represented, the “optionally substituted aryl group having 6 to 14 carbon atoms” for R ⁶ is preferably 2-methylphenyl, 3-methylphenyl or 4-
It is a methylphenyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
In the case of representing a (R ⁵ ) — group, the “aralkyl group having 7 to 15 carbon atoms which may have a substituent” for R ⁶ includes:
For example, benzyl, α-naphthylmethyl, β-naphthylmethyl, indenylmethyl, phenanthrenylmethyl,
Anthracenylmethyl, diphenylmethyl, 1-phenethyl, 2-phenethyl, 1-naphthylethyl, 2-naphthylethyl, 1-phenylpropyl, 2-phenylpropyl, 3-phenylpropyl, 1-naphthylpropyl,
2-naphthylpropyl, 3-naphthylpropyl, 1-phenylbutyl, 2-phenylbutyl, 3-phenylbutyl, 4-phenylbutyl, 1-naphthylbutyl, 2-naphthylbutyl, 3-naphthylbutyl, 4-naphthylbutyl, 1-phenylpentyl, 2-phenylpentyl, 3
-Phenylpentyl, 4-phenylpentyl, 5-phenylpentyl, 1-naphthylpentyl, 2-naphthylpentyl, 3-naphthylpentyl, 4-naphthylpentyl, 5-naphthylpentyl, 1-phenylhexyl, 2
-Phenylhexyl, 3-phenylhexyl, 4-phenylhexyl, 5-phenylhexyl, 6-phenylhexyl and the like, and preferably benzyl,
It is a naphthylmethyl or phenylethyl group, more preferably a benzyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
(R ⁵⁾ - in the case of a group, the "substituent" of the "substituted aralkyl group which may having 7 to 15 carbon have a" of R ⁶ may be, for example, methyl, ethyl, n- An alkyl group having 1 to 4 carbon atoms such as propyl, isopropyl, n-butyl, isobutyl, s-butyl and tert-butyl; methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, s-butoxy , Te
An alkoxy group having 1 to 4 carbon atoms such as rt-butoxy; a halogen atom such as a fluorine atom, a chlorine atom, a bromine atom and an iodine atom; and a methyl group is preferable.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
The “aralkyl group having 7 to 15 carbon atoms which may have a substituent” for R ^{6 in} the case of representing a (R ⁵ ) — group is preferably 2-methylbenzyl, 3-methylbenzyl or 4-
It is a methylbenzyl group.

In the above formula (1), R ⁴ is a group represented by the formula R ⁶ NHCOCH
In the case of representing a (R ⁵ ) — group, examples of the “cycloalkyl group having 3 to 8 carbon atoms” for R ⁶ include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl,
Examples thereof include cycloheptyl and cyclooctyl groups, preferably those having 4 to 6 carbon atoms, more preferably cyclohexyl group.

In the above formula (1), R ¹ is preferably a benzoyl group which may have a substituent, more preferably a 3-hydroxy-2-methylbenzoyl group. .

In the above formula (1), R ² is preferably an aryl group having 6 to 14 carbon atoms which may have a substituent, more preferably phenyl or 2-naphthyl. Or a biphenyl group.

In the above formula (1), R ³ is preferably an acyl group having 2 to 15 carbon atoms which may have a substituent, and more preferably an unsubstituted carbon group. 2 through 4
And most preferably an acetyl group.

In the above formula (1), a preferable one of R ⁴ is a group represented by the formula R ^6a NHCOCH (R ^5a ) — group (where R ^5a has 7 to 15 carbon atoms which may have a substituent). And R ^6a is an alkyl group having 1 to 6 carbon atoms), and more preferably, R ^6b NHCOCH (R
^5b) - group (R ^5b are benzyl, naphthylmethyl or phenylethyl group, R ^6b is a C 1 -C a 4 alkyl group), most preferably, wherein R ^6c NHCO
A CH (R ^5c ) — group (R ^5c is a benzyl group;
^6c is a tert-butyl group).

The "pharmacologically acceptable salt" refers to the salt of the compound (1) of the present invention, since the compound can be converted to a salt. Such a salt is preferably a fluorinated salt. Inorganic acid salts such as hydrohalates, hydrochlorides, hydrobromides, hydrohalides such as hydroiodates, nitrates, perchlorates, sulfates, phosphates; methanesulfonates; Lower alkane sulfonates such as trifluoromethane sulfonate and ethane sulfonate, aryl sulfonates such as benzene sulfonate and p-toluene sulfonate, acetic acid,
Organic acid salts such as malic acid, fumarate, succinate, citrate, tartrate, oxalate, and maleate; and glycine, lysine, arginine, ornithine, glutamate, asparagine Amino acid salts such as acid salts can be mentioned.

When the compound (1) of the present invention is left in the air, it may absorb water and may absorb adsorbed water or form hydrates. Included in the invention.

Furthermore, the compound (1) of the present invention may absorb some other solvent to form a solvate, and such salts are also included in the present invention.

The “prodrug” means a compound in which the compound (1) of the present invention has a hydroxyl group, and the hydroxyl group is modified with a group which can be cleaved in a living body. Examples thereof include acyloxyalkyl groups such as ethylcarbonyloxymethyl, pivaloyloxymethyl, dimethylaminoacetyloxymethyl and 1-acetoxyethyl; 1- (methoxycarbonyloxy) ethyl, 1- (ethoxycarbonyloxy) ethyl Ethoxycarbonyloxymethyl, 1- (isopropoxycarbonyloxy) ethyl, 1- (t-butoxycarbonyloxy) ethyl, 1- (ethoxycarbonyloxy) propyl, 1- (cyclohexyloxycarbonyloxy) ethyl (Alkoxycarbonyloxy) alkyl A carbonyloxyalkyl group such as an oxodioxorenylmethyl group such as 4-methyl-oxodioxolenylmethyl, 4-phenyl-oxodioxolenylmethyl, oxodioxorenylmethyl; "Acyl group";"succinic acid half ester salt residue";"phosphate ester salt residue";"ester forming residue such as amino acid"; carbamoyl group; substituted with one or two lower alkyl groups. And a "carbonyloxyalkyloxycarbonyl group" such as pivaloyloxymethyloxycarbonyl.

Preferred compounds of the present invention include (1) R ¹ is
A compound which is a benzoyl group which may have a substituent,
(2) a compound wherein R ¹ is a 3-hydroxy-2-methylbenzoyl group, (3) a compound wherein R ² is an aryl group having 6 to 14 carbon atoms which may have a substituent,
(4) a compound wherein R ² is a phenyl, 2-naphthyl or biphenyl group; (5) a compound wherein R ³ is an acyl group having 2 to 15 carbon atoms which may have a substituent;
(6) a compound wherein R ³ is an unsubstituted acyl group having 2 to 4 carbon atoms; (7) a compound wherein R ³ is an acetyl group;
(8) R ⁴ is a group represented by the formula R ^6a NHCOCH (R ^5a ) -group (R ^5a
Is an aralkyl group having 7 to 15 carbon atoms which may have a substituent, and R ^6a is an alkyl group having 1 to 6 carbon atoms), (9) R ⁴ is Formula R ^6b NH
A compound which is a COCH (R ^5b ) — group (R ^5b is a benzyl, naphthylmethyl or phenylethyl group, and R ^6b is an alkyl group having 1 to 4 carbon atoms);
⁴ is a compound of the formula R ^6c NHCOCH (R ^5c ) —, wherein R ^5c is a benzyl group and R ^6c is a tert-butyl group.

Further, compounds comprising a combination of two or more of these (1) to (12) are also suitable.

Specific compounds included in the present invention are illustrated below, but the present invention is not limited to these.

In Tables 1 and 2, Me represents a methyl group;
Et represents an ethyl group, iPr represents an isopropyl group, tBu represents a tert-butyl group, cHx represents a cyclohexyl group, Ac represents an acetyl group, Boz represents a benzoyl group, and Ph represents a phenyl group. , Bz represents a benzyl group, BiPh represents a 4-phenylphenyl group, Tos represents a p-toluenesulfonyl group, and Bo represents
c represents a tert-butoxycarbonyl group, and Naph-2
-Represents a naphthalen-2-yl group.

[0064]

Embedded image

[0065]

[Table 1] ――――――――――――――――――――――――――――――――――― Number R ¹ R ² R ³ R ⁴ ―――― ――――――――――――――――――――――――――――― 1-1 3-OH-2-Me-Boz Ph Tos Et 1-2 3-OH -2-Me-Boz Ph Tos iPr 1-3 3-OH-2,5-di-Me-Boz Ph Tos iPr 1-4 3-OH-2-Me-Boz Ph Tos Me 1-5 3-OH- 2-Me-Boz Ph 4-MeO-Ph-SO ₂ Et 1-6 3-OH-2-Me-Boz Ph 2,4,6-Tri-Me-Ph-SO ₂ Et 1-7 3-OH- 2-Me-Boz Ph Tos 2-OH-Et 1-8 Boc Ph Tos iPr 1-9 Boc Ph Ac Bz 1-10 3-OH-2-Me-Boz Ph 4-MeO-Ph-SO ₂ Me 1- 11 3-OH-2-Me-Boz Ph 4-MeO-Ph-SO ₂ iPr 1-12 3-OH-2-Me-Boz Ph 2,4,6-Tri-Me-Ph-SO ₂ Me 1- 13 3-OH-2-Me-Boz Ph 2,4,6-Tri-Me-Ph-SO ₂ iPr 1-14 Boc Ph 4-MeO-Ph-SO ₂ Et 1-15 Boc Ph 2,4,6 -Tri-Me-Ph-SO ₂ Et 1-16 Bbc Ph 4-MeO-Ph-SO ₂ 2-OH-Et 1-17 Boc Ph 2,4,6-Tri-Me-Ph-SO ₂ iPr 1- 18 Boc Ph 4-MeO-Ph-SO ₂ Bz ―――――――――――――――――――――――――――――――――

[0066]

Embedded image

[0067]

[Table 2] ――――――――――――――――――――――――――――――――― Number R ¹ R ² R ³ R ⁵ R ⁶ ―― ――――――――――――――――――――――――――――――― 2-1 Boc Ph Ac Ph t-Bu 2-2 3-OH-2- Me-Boz Ph H Ph t-Bu 2-3 Boc Ph H t-Bu t-Bu 2-4 Boc Ph H t-Bu Bz 2-5 Boc Ph Ac Ph Bz 2-6 Boc Ph H Ph t-Bu 2 -7 3-OH-2-Me-Boz Ph H t-Bu t-Bu 2-8 Z Ph Ac Ph t-Bu 2-9 Boc Ph H Ph (CH ₂ ) ₂ t-Bu 2-10 Z Ph Ac Bz t-Bu 2-11 Boc Ph H Naph-2-CH ₂ t-Bu 2-12 Boc Ph Ac Bz Bz 2-13 3-OH-2-Me-Boz Ph Ac Ph t-Bu 2-14 3- OH-2-Me-Boz Ph Ac Bz t-Bu 2-15 Boc Ph Bz Bz t-Bu 2-16 3-OH-2-Me-Boz Ph Ac Ph Bz 2-17 Boc Ph Ac Naph-2-CH ₂ t-Bu 2-18 3-OH-2-Me-Boz Ph Ac Naph-2-CH ₂ t-Bu 2-19 3-OH-2-Me-Boz Ph Bz Bz t-Bu 2-20 3- OH-2-Me-Boz Ph H Bz t-Bu 2-21 3-OH-2-Me-Boz Ph Ac Bz Bz 2-22 Boc Ph Ac Bz t-Bu 2-23 Boc Ph Me Bz t-Bu 2 -24 Boc Ph Ac Bz 2-Me-Bz 2-25 Boc Ph Ac Bz 3-Me-Bz 2-26 Boc Ph Ac Bz 4-Me-Bz 2-27 3-OH-2-Me-Boz Ph Me Bz t-Bu 2-28 3-OH -2-Me-Boz Ph Ac Bz 2-Me-Ph 2-29 3-OH-2-Me-Boz Ph Ac Bz 3-Me-Ph 2-30 3-OH-2-Me-Boz Ph Ac Bz 4 -Me-Ph 2-31 3-OH-2-Me-Boz Ph Prn Bz t-Bu 2-32 3-OH-2-Me-Boz Naph-2- Ac Bz t-Bu 2-33 3-OH- 2-Me-Boz Ph Ac Bz Et 2-34 3-OH-2-Me-Boz Naph-2- Ac Bz Et 2-35 3-OH-2-Me-Boz BiPh Ac Bz t-Bu 2-36 3 -OH-2-Me-Boz Ph Ac 4-OH-Bz t-Bu 2-37 3-OH-2-Me-Boz Ph Ac Bz cHx 2-38 Boc Ph Ac BzOCH ₂ t-Bu 2-39 3- OH-2-Me-Boz Ph Ac 4-BozOBz t-Bu 2-40 3-OH-2-Me-Boz Ph Ac 4-Cl-Bz t-Bu 2-41 Boc Naph-2 Ac Ph t-Bu 2 -42 3-OH-2-Me-Boz Naph-2 H Ph t-Bu 2-43 Boc Naph-2 H t-Bu t-Bu 2-44 Boc Naph-2 H t-Bu Bz 2-45 Boc Naph -2 Ac Ph Bz 2-46 Boc Naph-2 H Ph t-Bu 2-47 3-OH-2-Me-Boz Naph-2 H t-Bu t-Bu 2-48 Z Naph-2 Ac Ph t- Bu 2-49 Boc Naph-2 H Ph (CH ₂ ) ₂ t-Bu 2-50 Z Naph-2 Ac Bz t-Bu 2-51 Boc Naph-2 H Naph-2-CH ₂ t-Bu 2-52 Boc Naph-2 Ac Bz Bz 2-53 3-OH-2-Me-Boz Naph-2 Ac Ph t-Bu 2-54 3-OH-2-Me-Boz Naph-2 Ac Bz t-Bu 2-55 Boc Naph-2 Bz Bz t-Bu 2-56 3-OH-2-Me-Boz Naph-2 Ac Ph Bz 2-57 Boc Naph-2 Ac Naph-2-CH ₂ t-Bu 2-58 3-OH -2-Me-Boz Naph-2 Ac Naph-2-CH ₂ t-Bu 2-59 3-OH-2-Me-Boz Naph-2 Bz Bz t-Bu 2-60 3-OH-2-Me-Boz Naph-2 H Bz t-Bu 2 -61 3-OH-2-Me-Boz Naph-2 Ac Bz Bz 2-62 Boc Naph-2 Ac Bz t-Bu 2-63 Boc Naph-2 Me Bz t-Bu 2-64 Boc Naph-2 Ac Bz 2-Me-Bz 2-65 Boc Naph-2 Ac Bz 3-Me-Bz 2-66 Boc Naph-2 Ac Bz 4-Me-Bz 2-67 3-OH-2-Me-Boz Naph-2 Me Bz t-Bu 2-68 3-OH-2-Me-Boz Naph-2 Ac Bz 2-Me-Ph 2-69 3-OH-2-Me-Boz Naph-2 Ac Bz 3-Me-Ph 2-70 3-OH-2-Me-Boz Naph-2 Ac Bz 4-Me-Ph 2-71 3-OH-2-Me-Boz Naph-2 Prn Bz t-Bu 2-72 3-OH-2-Me- Boz Naph-2 Ac Bz Et 2-73 3-OH-2-Me-Boz Naph-2 Ac Bz t-Bu 2-74 3-OH-2-Me-Boz Naph-2 Ac 4-OH-Bz t- Bu 2-75 3-OH-2-Me-Boz Naph-2 Ac Bz cHx 2-76 Boc Naph-2 Ac BzOCH ₂ t-Bu 2-77 3-OH-2-Me-Boz Naph-2 Ac 4- BozOBz t-Bu 2-78 3-OH-2-Me-Boz Naph-2 Ac 4-Cl-Bz t-Bu ―――――――――――――――――――――― ――――――――― In Tables 1 and 2, preferred compounds are 1-1, 1-
2, 1-3, 1-4, 1-5, 1-6, 1-7, 2-
2, 2-7, 2-13, 2-14, 2-16, 2-1
8, 2-19, 2-20, 2-21, 2-27, 2-2
8, 2-29, 2-30, 2-31, 2-32, 2-3
3, 2-34, 2-35, 2-36, 2-39 or 2-
40, more preferably N- {4- [acetyl-
(1-tert-butylcarbamoyl-2-phenyl-ethyl) -amino] 1-benzyl-2-hydroxy-butyl} -3-hydroxy-2-methylbenzamide (Ex. No. 2-14), N- {4- [ Acetyl- (1-tert-
Butylcarbamoyl-2-phenyl-ethyl) -amino] -1-naphthylmethyl-2-hydroxy-butyl
-3-hydroxy-2-methylbenzamide (Exemplified Compound No. 2-32) or N- {4- [acetyl- (1-te
rt-butylcarbamoyl-phenyl-ethyl) -amino] -1- (4-phenyl) -phenylmethyl-2-hydroxy-butyl} -3-hydroxy-2-methylbenzamide (Exemplified Compound No. 2-35).

[0068]

BEST MODE FOR CARRYING OUT THE INVENTION The compound (1) of the present invention can be produced by the following method. (Method A)

[0069]

Embedded image In the above formula, R ¹ , R ² and R ⁴ have the same meaning as described above, and R ⁷
Is an alkyl group having 1 to 4 carbon atoms (preferably a methyl or ethyl group, more preferably an ethyl group);
R ⁸ is an alkyl group having 1 to 4 carbon atoms or an alkoxy group having 1 to 4 carbon atoms (preferably a methyl, ethyl, methoxy or ethoxy group, more preferably an ethyl group)
It is. (Step A-1) In this step, the compound (2) or a reactive derivative of the carboxylic acid thereof is reacted with an amino compound,
This is a step of producing a compound (3).

The reaction is carried out according to a usual peptide synthesis method, for example, an azide method, an active esterification method, a mixed acid anhydride method or a condensation method.

In the azide method, an amino acid hydrazine produced by reacting an amino acid or an ester thereof with hydrazine in an inert solvent at around room temperature is reacted with a nitrite compound to convert it into an azide compound, It is carried out by treating with a compound.

Examples of the nitrite used include alkali metal nitrites such as sodium nitrite and alkyl nitrites such as isoamyl nitrite. Isoamyl nitrite is preferred.

Examples of the inert solvent used include, for example,
Halogenated hydrocarbons such as methylene chloride and chloroform; ethers such as ether and tetrahydrofuran; amides such as dimethylformamide and dimethylacetamide; sulfoxides such as dimethylsulfoxide; pyrrolidones such as N-methylpyrrolidone. And methylene chloride, tetrahydrofuran or dimethylformamide is preferred.

The two reactions in the azide method usually involve 1
The reaction temperature is -50 to 0 ° C (preferably -30 to -5 ° C) in the first stage, and -1 in the second stage.
0 to 10 ° C. (preferably −5 to 5 ° C.), and the reaction time is 5 minutes to 1 hour (preferably 10 minutes to 30
Minutes), and the latter is 10 hours to 5 days (preferably 18 hours).
Hours to 3 days).

The active esterification method is carried out by reacting an amino acid with an active esterifying agent in a solvent to produce an active ester, and then reacting it with an amine compound.

The solvent used is not particularly limited as long as it is inert. Examples thereof include halogenated hydrocarbons such as methylene chloride and chloroform; ethers such as ether and tetrahydrofuran; dimethylformamide and dimethylacetamide. And amides such as methylene chloride, tetrahydrofuran or dimethylformamide.

Examples of the active esterifying agent used include N-hydroxy compounds such as N-hydroxysuccinimide, 1-hydroxybenzotriazole, N-hydroxy-5-norbornene-2,3-dicarboximide. The active esterification reaction is suitably performed in the presence of a condensing agent such as dicyclohexylcarbodiimide (DCC). Also, 1,1'-oxalyl diimidazole, 2,2'-dipyridyl disulfide, N, N'-disuccinimidyl carbonate, diphenylphosphoric azide (DPPA), diethyl cyanophosphoric acid (DEPC), N, N'-bis (2-oxo-3-oxazolidinyl) phosphinic chloride (BOP-C
I), N, N'-carbonyldiimidazole, N, N '
-Disuccinimidyl oxalate (DSO), N,
N'-diphthalimide oxalate (DPO), N,
N'-bis (norbornenylsuccinimidyl) oxalate (BNO), 1,1'-bis (benzotriazolyl) oxalate (BBTO), 1,1'-bis (6-
Chlorobenzotriazolyl) oxalate (BCT
O) condensing in the presence of a condensing agent of 1,1'-bis (6-trifluoromethylbenzotriazolyl) oxalate (BTBO), bromo-tris-pyrrolidino-phosphonium-hexafluoro-phosphate (PyBrOP) Can also.

In the active esterification reaction, the reaction temperature is-
10 to 25 ° C. (preferably −5 to 10 ° C.), the temperature of the reaction between the active ester compound and the amine is around room temperature, and the reaction time is 30 minutes to 10 hours for both reactions (preferably 1 to 6 hours). ).

The mixed acid anhydride method is carried out by producing a mixed acid anhydride of an amino acid and then reacting the mixed acid anhydride with an amine.

The reaction for producing the mixed acid anhydride is carried out in an inert solvent (for example, ethers such as ether and tetrahydrofuran, amides such as dimethylformamide and dimethylacetamide) such as ethyl chlorocarbonate and isobutyl chlorocarbonate. Carbonic lower alkyl halides, di-lower alkyl cyanophosphoric acids such as diethyl cyanophosphoric acid (DEPC), or diphenyl phosphoric acid azide (DPP)
It is achieved by reacting A) with an amino acid. A preferred solvent is tetrahydrofuran and a preferred reagent is isobutyl chlorocarbonate.

The reaction is preferably carried out with triethylamine, N
The reaction is carried out in the presence of an organic amine such as -methylmorpholine (preferably triethylamine or N-methylmorpholine) and the reaction temperature is between -10 and 25 ° C (preferably -5
To 20 ° C.), and the reaction time is 30 minutes to 5 hours (preferably 1 to 3 hours).

The reaction between the mixed acid anhydride and the amine is preferably carried out by using an inert solvent (eg, ethers such as ether and tetrahydrofuran; amides such as dimethylformamide and dimethylacetamide (particularly preferably tetrahydrofuran or dimethylacetamide). Formamide)) in the presence of the above-mentioned organic amine, the reaction temperature is 0 ° C. to room temperature (preferably 10 to 25 ° C.), and the reaction time is 1 hour to 24 hours (preferably 10 to 25 hours). 18 hours).

The condensation method is carried out by directly reacting an amino acid and an amine in the presence of a condensing agent (preferably dicyclohexylcarbodiimide) such as dicyclohexylcarbodiimide or carbonyldiimidazole, and the above-mentioned reaction for producing an active ester is carried out. It is performed in a similar manner.

After completion of the reaction, the target compound (1) of this reaction is collected from the reaction mixture according to a conventional method. For example,
The reaction mixture is appropriately neutralized, and if there is any insoluble matter, it is removed by filtration, and an immiscible organic solvent such as water and ethyl acetate is added.After washing with water, the organic layer containing the target compound is separated. After drying over anhydrous magnesium sulfate or the like, the solvent is distilled off. If necessary, the obtained target compound can be further purified by a conventional method, for example, recrystallization, reprecipitation or chromatography. (Step A-2) This step is a step of reacting compound (3) with a metallized vinyl compound to produce compound (4).

The metallized vinyl compounds used include:
Examples thereof include vinylmagnesium bromide and vinyllithium, preferably vinylmagnesium bromide.

The solvent to be used is not particularly limited as long as it does not hinder the reaction and dissolves the starting materials to some extent, but hydrocarbons such as pentane, hexane and cyclohexane, diethyl ether, tetrahydrofuran, dioxane And aprotic solvents such as halogenated hydrocarbons such as methylene chloride and chloroform, and ethers (particularly tetrahydrofuran).

The reaction temperature and reaction time vary depending on the starting materials and the solvent used, and are not particularly limited.
At 0 to 70 ° C (preferably -10 to 20 ° C), 0.5
10 to 10 hours (preferably 1 to 6 hours).

After completion of the reaction, the target compound (1) of this reaction is collected from the reaction mixture according to a conventional method. For example, the reaction mixture is appropriately neutralized, and if insolubles are present, they are removed by filtration. Then, an immiscible organic solvent such as water and ethyl acetate is added. And dried over anhydrous magnesium sulfate or the like, and then the solvent is distilled off. If necessary, the obtained target compound can be further purified by a conventional method, for example, recrystallization, reprecipitation or chromatography. (No. A-3
a, 3b and 3c Steps) In this step, various amines are added to compound (4) by Michael in the presence of a base (A
Step 3a) and reducing the product (Step A-3b) to obtain compound (1).

The base used in step A-3a is preferably an alkali metal hydride such as lithium hydride, sodium hydride or potassium hydride; triethylamine, tributylamine, diisopropylethylamine, N-methylmorpholine , Pyridine, 4- (N, N-dimethylamino) pyridine, N, N-dimethylaniline, N, N-diethylaniline, 1,5-diazabicyclo [4.3.0] non-5-ene, 1,4-diazabicyclo [2.2.2] Octane (DABCO), 1,
Examples thereof include organic bases such as 8-diazabicyclo [5.4.0] undec-7-ene (DBU), and more preferable examples include organic bases such as triethylamine and tributylamine.

The solvent used in step A-3a includes:
There is no particular limitation as long as it does not hinder the reaction and dissolves the starting material to some extent, but is preferably an aliphatic hydrocarbon such as hexane, heptane, ligroin, or petroleum ether; such as benzene, toluene, or xylene. Aromatic hydrocarbons; halogenated hydrocarbons such as methylene chloride, chloroform, carbon tetrachloride, dichloroethane, chlorobenzene, and dichlorobenzene; esters such as ethyl formate, ethyl acetate, propyl acetate, propyl acetate, butyl acetate and diethyl carbonate ; Diethyl ether, diisopropyl ether
Ethers such as ter, tetrahydrofuran, dioxane, dimethoxyethane, diethylene glycol dimethyl ether; methanol, ethanol, n-propano-
, Isopropanol, n-butanol, isobutanol
Alcohols such as toluene, t-butanol, isoamyl alcohol, diethylene glycol, glycerin, octanol, cyclohexanol, methyl cellosolve; nitro compounds such as nitroethane and nitrobenzene;
Nitriles such as acetonitrile and isobutyronitrile; amides such as formamide, dimethylformamide, dimethylacetamide, and hexamethylphosphorotriamide; and sulfoxides such as dimethyl sulfoxide and sulfolane, and more preferably. Alcohols such as ethanol.

The reaction temperature and reaction time in step A-3a vary depending on the starting materials and the solvent used, and are not particularly limited, but are usually -20 to 70 ° C. (preferably -10 to 30 ° C.) and 1 to 1 to 30 ° C. 10 hours (preferably 1 to 6 hours).

The reduction reaction in step A-3b is as follows. Use alkali metal borohydrides such as sodium borohydride, lithium borohydride, aluminum hydride compounds such as lithium aluminum hydride, lithium triethoxide aluminum, and hydride reagents such as sodium tellurium hydride. 1. Reactions carried out in alcohols such as methanol, ethanol, ethers such as ether and tetrahydrofuran or the above-mentioned mixed solvents. Using a catalyst such as palladium carbon, platinum, and Raney nickel, alcohols such as methanol and ethanol, ethers such as tetrahydrofuran and dioxane, fatty acids such as acetic acid, and organic compounds thereof. 2. Reaction for performing catalytic reduction at room temperature in a mixed solvent of a solvent and water 3. Reaction performed using a Lewis acid such as aluminum chloride, tin tetrachloride or titanium tetrachloride and a silyl hydride compound such as triethylsilane hydride or triphenylsilane hydride. For example,
A radical initiator such as azobisisobutyronitrile and triphenylboron is used as a catalyst, and is usually reduced by a radical reducing agent such as tributyltin hydride, triphenyltin hydride and dibutyltin hydride. Achieved according to law.

After completion of the reaction, the target compound (1) of this reaction is collected from the reaction mixture according to a conventional method. For example, the reaction mixture is appropriately neutralized, and if insolubles are present, they are removed by filtration, an immiscible organic solvent such as water and ethyl acetate are added, and after washing with water, the organic layer containing the target compound is washed. It is obtained by separating and drying over anhydrous magnesium sulfate or the like, and then distilling off the solvent. If necessary, the obtained target compound can be further purified by a conventional method, for example, recrystallization, reprecipitation or chromatography. (Method B)

[0094]

Embedded image (Steps B-1a, 1b and 1c) In this step, after adding various amine derivatives to the compound (3) by Michael (Step B-1a), the carbonyl group is reduced (B-
Step 1b) and a step of introducing R ³ using various electrophiles (Step B-1c).

Step B-1a can be performed similarly to step A-2a, and step B-1b can be performed similar to step A-2b.

The base used in the step B-1c is as follows:
There is no particular limitation as long as it is used as a base in a normal reaction, but preferably, alkali metal carbonates such as sodium carbonate, potassium carbonate, and lithium carbonate; sodium hydrogen carbonate, potassium hydrogen carbonate, and hydrogen carbonate Alkali metal bicarbonates such as lithium; alkali metal hydrides such as lithium hydride, sodium hydride, potassium hydride; alkali metals such as sodium hydroxide, potassium hydroxide, barium hydroxide, lithium hydroxide Inorganic bases such as hydroxides; sodium methoxide, sodium ethoxide, potassium t-butoxide,
Alkali metal alkoxides such as lithium methoxide; triethylamine, tributylamine, diisopropylethylamine, N-methylmorpholine, pyridine,
(N, N-dimethylamino) pyridine, N, N-dimethylaniline, N, N-diethylaniline, 1,5-diazabicyclo [4.3.
0] Nona-5-ene, 1,4-diazabicyclo [2.2.2] octane (DABCO), 1,8-diazabicyclo [5.4.0] undec-7-
Organic bases such as ene (DBU) or organometallic bases such as butyllithium and lithium diisopropylamide can be mentioned. More preferred are organic bases such as triethylamine. In order to carry out the reaction effectively, quaternary ammonium salts such as benzyltriethylammonium chloride and tetrabutylammonium chloride; crown ethers such as dibenzo-18-crown-6; Pyridines such as aminopyridine and 4-piperidinopyridine can also be added.

The solvent used in the step B-1c includes:
There is no particular limitation as long as it does not hinder the reaction and dissolves the starting material to some extent, but is preferably an aliphatic hydrocarbon such as hexane, heptane, ligroin, or petroleum ether; such as benzene, toluene, or xylene. Aromatic hydrocarbons; halogenated hydrocarbons such as methylene chloride, chloroform, carbon tetrachloride, dichloroethane, chlorobenzene, and dichlorobenzene; esters such as ethyl formate, ethyl acetate, propyl acetate, propyl acetate, butyl acetate and diethyl carbonate ; Diethyl ether, diisopropyl ether
Ethers such as ter, tetrahydrofuran, dioxane, dimethoxyethane, diethylene glycol dimethyl ether; ketones such as acetone, methyl ethyl ketone, methyl isobutyl ketone, isophorone and cyclohexanone; nitro compounds such as nitroethane and nitrobenzene; acetonitrile, isobutyi Nitriles such as lonitrile; amides such as formamide, dimethylformamide, dimethylacetamide, and hexamethylphosphorotriamide.

The reaction temperature and the reaction time of the step B-1c are as follows:
There is no particular limitation depending on the starting material, the solvent used, and the like.
° C) for 1 to 24 hours (preferably 3 to 15 hours).

After completion of the reaction, the target compound (1) of this reaction is collected from the reaction mixture according to a conventional method. For example, the reaction mixture is appropriately neutralized, and if insolubles are present, they are removed by filtration, and then an immiscible organic solvent such as water and ethyl acetate is added. It is obtained by separating and drying over anhydrous magnesium sulfate or the like, and then distilling off the solvent. If necessary, the obtained target compound can be further purified by a conventional method, for example, recrystallization, reprecipitation or chromatography. (Steps B-2a, 2b and 2c) In this step, after removing the amine protecting group of compound (5) (step B-2a) and modifying the amino group by a condensation reaction with compound (11) (Step B-2b), removing the protecting group for the hydroxyl group (B-
Step 2c).

Step B-2b can be performed in the same manner as in step A-1.

The removal of the protecting group in step B-2a varies depending on the type, but is generally carried out as follows by a method well known in the art.

When the protecting group for the amino group is an aliphatic acyl group, an aromatic acyl group, an alkoxycarbonyl group or a substituted methylene group forming a Schiff base, an acid or a base is added in the presence of an aqueous solvent. Can be removed.

The acid used is not particularly limited, as long as it does not inhibit the reaction, and it is usually used as an acid. Preferably, the acid used is, for example, hydrochloric acid, sulfuric acid, phosphoric acid or hydrobromic acid. Inorganic acids are used, and as the base used,
There is no particular limitation as long as it does not affect the other parts of the compound, but preferably, metal alkoxides such as sodium methoxide, sodium carbonate, potassium carbonate,
Alkali metal carbonates such as lithium carbonate, alkali metal hydroxides such as sodium hydroxide, potassium hydroxide and lithium hydroxide or ammonia such as aqueous ammonia and concentrated ammonia-methanol are used.

It should be noted that isomerization may occur in hydrolysis with a base.

The solvent to be used is not particularly limited as long as it is one used in a usual hydrolysis reaction. Water; alcohols such as methanol, ethanol and n-propanol , Tetrahydrofuran, dioxane
An organic solvent such as ters or a mixed solvent of water and the above organic solvent is preferable.

The reaction temperature and reaction time vary depending on the starting material, solvent and acid or base to be used, and are not particularly limited.
Performed at 50 ° C. for 1 to 10 hours.

When the amino-protecting group is an aralkyl group or an aralkyloxycarbonyl group, it is usually brought into contact with a reducing agent in a solvent (preferably catalytic reduction at room temperature under a catalyst). The removal method or the removal method using an oxidizing agent is preferable.

The solvent used in the removal by catalytic reduction is not particularly limited as long as it does not participate in the present reaction, but alcohols such as methanol, ethanol and isopropanol, and diethyl ether Ethers such as ter, tetrahydrofuran, dioxane, toluene,
Aromatic hydrocarbons such as benzene and xylene; aliphatic hydrocarbons such as hexane and cyclohexane; esters such as ethyl acetate and propyl acetate; fatty acids such as acetic acid; Mixed solvents are preferred.

The catalyst to be used is not particularly limited as long as it is usually used in a catalytic reduction reaction, but is preferably palladium carbon, Raney-nickel, platinum oxide,
Platinum black, rhodium-aluminum oxide, triphenylphosphine-rhodium chloride, palladium-barium sulfate are used.

Although the pressure is not particularly limited, it is usually 1 to 1
It is performed at 0 atm.

The reaction temperature and the reaction time vary depending on the starting material, the solvent, the type of the catalyst and the like.
C. for 5 minutes to 24 hours.

The solvent used in the removal by oxidation is not particularly limited as long as it does not participate in the present reaction, but is preferably a water-containing organic solvent.

Preferred examples of such organic solvents include ketones such as acetone, halogenated hydrocarbons such as methylene chloride, chloroform, carbon tetrachloride, nitriles such as acetonitrile, diethyl ether, tetrahydrofuran, and the like. Mention may be made of ethers such as dioxane, amides such as dimethylformamide, dimethylacetamide, hexamethylphosphorotriamide and sulfoxides such as dimethylsulfoxide.

The oxidizing agent to be used is not particularly limited as long as it is a compound used for oxidation. Preferably, potassium persulfate, sodium persulfate, ammonium cerium nitrate (CAN), 2,3- Dichloro-5,6-dicyano-p-
Benzoquinone (DDQ) is used.

The reaction temperature and the reaction time vary depending on the starting material, the solvent and the type of the catalyst, but are usually from 0 to 150.
C. for 10 minutes to 24 hours.

When the protecting group for the amino group is an alkenyloxycarbonyl group, the protecting group for the amino group is usually substituted with an aliphatic acyl group, an aromatic acyl group, an alkoxycarbonyl group or a Schiff base. It is achieved by treating with a base in the same manner as in the conditions of the removal reaction in the case of a methylene group. In the case of allyloxycarbonyl, the removal method using palladium and triphenylphosphine or nickel tetracarbonyl is particularly simple and can be carried out with few side reactions.

The removal of the protecting group in step B-2c varies depending on the type thereof, but is generally carried out as follows by a method well known in the art. When the protecting group for the hydroxyl group is an aralkyl group or an aralkyloxycarbonyl group, it is usually removed by contact with a reducing agent in a solvent (preferably catalytic reduction at room temperature under a catalyst) or oxidation. A method of removing with an agent is preferred.

The solvent used in the removal by catalytic reduction is not particularly limited as long as it does not participate in the present reaction, but alcohols such as methanol, ethanol and isopropanol, and diethyl ether Ethers such as ter, tetrahydrofuran, dioxane, toluene,
Aromatic hydrocarbons such as benzene and xylene; aliphatic hydrocarbons such as hexane and cyclohexane; esters such as ethyl acetate and propyl acetate; fatty acids such as acetic acid; Mixed solvents are preferred.

The catalyst to be used is not particularly limited as long as it is usually used in a catalytic reduction reaction. Preferably, the catalyst is palladium carbon, Raney-nickel, platinum oxide,
Platinum black, rhodium-aluminum oxide, triphenylphosphine-rhodium chloride, palladium-barium sulfate are used.

Although the pressure is not particularly limited, it is usually 1 to 1
It is performed at 0 atm.

The reaction temperature and the reaction time vary depending on the starting material, the solvent, the type of the catalyst and the like.
C. for 5 minutes to 24 hours.

When the protecting group for a hydroxyl group is an aliphatic acyl group, an aromatic acyl group or an alkoxycarbonyl group, it is removed by treating with a base in a solvent.

The base used is not particularly limited as long as it does not affect the other parts of the compound, but is preferably a metal alkoxide such as sodium methoxide; sodium carbonate, potassium carbonate, carbonate Alkali metal carbonates such as lithium; alkali metal hydroxides such as sodium hydroxide, potassium hydroxide and lithium hydroxide or ammonia water, and ammonias such as concentrated ammonia-methanol are used.

The solvent to be used is not particularly limited as long as it is a solvent used in a usual hydrolysis reaction. Water; alcohols such as methanol, ethanol and n-propanol; , Tetrahydrofuran, dioxane
An organic solvent such as ters or a mixed solvent of water and the above organic solvent is preferable.

The reaction temperature and reaction time vary depending on the starting material, solvent and base used, and are not particularly limited.
In order to suppress a side reaction, the temperature is usually 1 to 0 to 150 ° C.
For 10 to 10 hours.

Incidentally, the B-2c step was carried out by using B-2a and B-
It can be performed prior to the step 2b.

After completion of the reaction, the target compound (1) of this reaction is collected from the reaction mixture according to a conventional method. For example, the reaction mixture is appropriately neutralized, and if insolubles are present, they are removed by filtration, an immiscible organic solvent such as water and ethyl acetate are added, and after washing with water, the organic layer containing the target compound is washed. It is obtained by separating and drying over anhydrous magnesium sulfate or the like, and then distilling off the solvent. If necessary, the obtained target compound can be further purified by a conventional method, for example, recrystallization, reprecipitation or chromatography.

[0128]

Embedded image (Steps C-1a, 1b and 1c) In this step, after adding a protected amino group to the compound (4) with Michael (Step C-1a), the compound is reduced (Step C-1b), The generated hydroxyl group is protected with an acetyl group (Step C-1c).
It is a process.

The steps C-1a and C-1b can be performed in the same manner as the steps A-3a and A-3b, respectively.

The acetylation of the hydroxyl group in the step C-1c is not particularly limited as long as it is a commonly used method. Examples of the acetylating agent used include acetyl chloride, acetic anhydride,
Perfluorobenzene acetic acid, imidazolide acetate, trifluoroethyl acetic acid, and trichloroethyl acetic acid can be mentioned, and acetic anhydride is preferred.

The base to be used is not particularly limited as long as it is used as a base in a usual reaction. Preferably, alkali metal carbonates such as sodium carbonate, potassium carbonate and lithium carbonate; Alkali metal bicarbonates such as sodium, potassium bicarbonate, lithium bicarbonate; alkali metal hydrides such as lithium hydride, sodium hydride, potassium hydride; sodium hydroxide, potassium hydroxide, barium hydroxide; Inorganic bases such as alkali metal hydroxides such as lithium hydroxide; alkali metal alkoxides such as sodium methoxide, sodium ethoxide, potassium t-butoxide, lithium methoxide; triethylamine, tributylamine, diisopropylethylamine;
N-methylmorpholine, pyridine, 4- (N, N-dimethylamino) pyridine, N, N-dimethylaniline, N, N-diethylaniline, 1,5-diazabicyclo [4.3.0] non-5-ene, 1 ,
Organic bases such as 4-diazabicyclo [2.2.2] octane (DABCO) and 1,8-diazabicyclo [5.4.0] undec-7-ene (DBU) or organic metal bases such as butyllithium and lithium diisopropylamide And the like.

In order to carry out the reaction effectively, quaternary ammonium salts such as benzyltriethylammonium chloride and tetrabutylammonium chloride,
Crown ethers such as dibenzo-18-crown-6,
Pyridines such as dimethylaminopyridine and pyrrolidinopyridine can also be added.

The solvent to be used is not particularly limited as long as it does not hinder the reaction and dissolves the starting material to some extent, but is preferably an aliphatic hydrocarbon such as hexane, heptane, ligroin or petroleum ether. Hydrogens; aromatic hydrocarbons such as benzene, toluene, xylene; halogenated hydrocarbons such as methylene chloride, chloroform, carbon tetrachloride, dichloroethane, chlorobenzene, dichlorobenzene; ethyl formate, ethyl acetate, propyl acetate; Esters such as butyl acetate and diethyl carbonate; ethers such as diethyl ether, diisopropyl ether, tetrahydrofuran, dioxane, dimethoxyethane and diethylene glycol dimethyl ether; acetone, methyl ethyl ketone, methyl isobutyl ketone, isophorone, cycloether Ketones such as xanone; nitro compounds such as nitroethane and nitrobenzene; nitriles such as acetonitrile and isobutyronitrile; amides such as formamide, dimethylformamide, dimethylacetamide and hexamethylphosphorotriamide; dimethyl sulfoxide And sulfolane such as sulfolane.

The reaction temperature and reaction time vary depending on the starting material, solvent, base used and the like, and are not particularly limited.
In order to suppress a side reaction, the temperature is usually 1 to 0 to 150 ° C.
For 10 to 10 hours.

After completion of the reaction, the target compound (1) of this reaction is
It is collected from the reaction mixture according to a conventional method. For example, anti
The reaction mixture is appropriately neutralized, and if insolubles are present,
After removal by filtration, mix with water and ethyl acetate.
Add organic solvent and wash with water.
And dried over anhydrous magnesium sulfate and the like.
Obtained by leaving. The obtained target compound is
If necessary, conventional methods such as recrystallization, reprecipitation or chromatography
It can be further purified by graphics or the like. (Steps C-2a, 2b and 2c) This step comprises the steps of:
After removing the protecting group (Step C-2a), in the presence of a base,
R ^ThreeA group is introduced (Step C-2b) and acetyl on the hydroxyl group is introduced.
This is a step of removing a group (Step C-2c).

The step C-2a can be carried out in the same manner as the step B-2a, and the step C-2b can be carried out in the step B-1.
It can be performed in the same manner as in step c.

The method used in step C-2c is not particularly limited as long as it is a method commonly used for removing an acetyl group bonded to a hydroxyl group, but is removed by treating with a base in a solvent.

The base used in step C-2c includes:
There is no particular limitation as long as it does not affect the other parts of the compound, but preferably metal alkoxides such as sodium methoxide; alkali metal carbonates such as sodium carbonate, potassium carbonate and lithium carbonate; water Alkali metal hydroxides such as sodium oxide, potassium hydroxide and lithium hydroxide, or aqueous ammonia, and ammonias such as concentrated ammonia-methanol are used.

As the solvent used in the step C-2c,
There is no particular limitation as long as it is used in a usual hydrolysis reaction. Water; alcohols such as methanol, ethanol and n-propanol; ethers such as tetrahydrofuran and dioxane; An organic solvent such as a solvent or a mixed solvent of water and the above-mentioned organic solvent is preferable.

The reaction temperature and the reaction time vary depending on the starting material, the solvent and the base used, and are not particularly limited.
In order to suppress a side reaction, the temperature is usually 1 to 0 to 150 ° C.
For 10 to 10 hours.

After completion of the reaction, the target compound (1) of this reaction is collected from the reaction mixture according to a conventional method. For example, the reaction mixture is appropriately neutralized, and if insolubles are present, they are removed by filtration, an immiscible organic solvent such as water and ethyl acetate are added, and after washing with water, the organic layer containing the target compound is washed. It is obtained by separating and drying over anhydrous magnesium sulfate or the like, and then distilling off the solvent. If necessary, the obtained target compound can be further purified by a conventional method, for example, recrystallization, reprecipitation or chromatography. (Steps C-3a and 3b) This step is a step of introducing the R ¹ group after removing the protecting group for the amino group (Step C-3a) (Step C-3b).

The steps C-3a and C-3b can be performed in the same manner as the steps B-2a and B-2b, respectively. (Method D)

[0143]

Embedded image (Steps D-1a and 1b) This step is a step in which the amine derivative is added with Michael (Step D-1a) and then reduced (Step D-1b).

The steps D-1a and D-1b can be performed in the same manner as the steps A-3a and A-3b, respectively. (Steps D-2a and 2b) This step is a step of introducing the R ¹ group after removing the protecting group for the amino group (step D-2a) (step D-2b).

Steps D-2a and D-2b can be performed in the same manner as steps B-2a and B-2b, respectively.

Examples of the dosage form of the compound (I) of the present invention include oral administration by tablets, capsules, granules, powders or syrups, and parenteral administration by injections or suppositories. These preparations include excipients (eg, sugar derivatives such as lactose, sucrose, glucose, mannitol, sorbitol; starch derivatives such as corn starch, potato starch, α-starch, dextrin; cellulose derivatives such as crystalline cellulose). Gum arabic; dextran; organic excipients such as pullulan: and silicate derivatives such as light anhydrous silicic acid, synthetic aluminum silicate, calcium silicate, magnesium metasilicate aluminate; phosphates such as calcium hydrogen phosphate; Carbonates such as calcium carbonate; sulfates such as calcium sulfate Mechanical excipients), lubricants (eg, stearic acid, metal salts of stearic acid such as calcium stearate, magnesium stearate; talc; colloidal silica; waxes such as veegum, gay wax). Boric acid; adipic acid; sulfates such as sodium sulfate; glycol; fumaric acid; sodium benzoate; DL leucine; fatty acid sodium salts; lauryl sulfates such as sodium lauryl sulfate and magnesium lauryl sulfate; And binders (eg, hydroxypropylcellulose, hydroxypropylmethylcellulose, polyvinylpyrrolidone, macrogol, and compounds similar to the above-mentioned excipients). And disintegrants (eg, For example, cellulose derivatives such as low-substituted hydroxypropylcellulose, carboxymethylcellulose, carboxymethylcellulose calcium, internally cross-linked sodium carboxymethylcellulose; carboxymethyl starch;
Examples include chemically modified starch and cellulose such as sodium carboxymethyl starch and cross-linked polyvinyl pyrrolidone. ), Stabilizers (paraoxybenzoic acid esters such as methylparaben and propylparaben; alcohols such as chlorobutanol, benzyl alcohol and phenylethyl alcohol; benzalkonium chloride; phenols such as phenol and cresol; thimerosal; Acetic acid; and sorbic acid), flavoring agents (for example, commonly used sweeteners, sour agents, flavors, etc.), and diluents. It is manufactured by a well-known method.

The amount used depends on the condition, age, administration method and the like. For example, in the case of oral administration,
0.01 mg / kg body weight (preferably 0.1 mg / kg
/ kg body weight), with an upper limit of 10 mg / kg body weight (preferably 1 mg / kg body weight), and in the case of intravenous administration, a lower limit of 0.001 mg / kg body weight per dose (preferably,
0.01 mg / kg body weight), and up to 1 mg / kg body weight (preferably 0.1 mg / kg body weight) is desirably administered once or several times a day depending on the symptoms.

[0148]

EXAMPLES Example 1 4- (Toluenesulfonyl-isopropyl-amino)
-1-benzyl-2-hydroxy-butyryl] -carba
Tert-butyl ester of mimic acid (Exemplary Compound No. 1-
8) (1-a) (tert-butoxycarbonyl) -4-amino-5-phenyl
1-penten-3-one Commercially available (tert-butoxycarbonyl) phenylalanine (16.0 g, 60 mmol), 1-ethyl-3- (3
-Dimethylaminopropyl) carbodiimide hydrochloride (hereinafter abbreviated as EDC; 19 g, 100 mmol) and N, O
-Dimethylhydroxyamine hydrochloride (6.5 g, 67 m
mol) to tetrahydrofuran (200 ml),
Stirred at room temperature for 8 hours. After completion of the reaction, ethyl acetate (400 ml) was added to the reaction solution, and the resulting solution was washed successively with a 5% aqueous potassium hydrogen sulfate solution (100 ml) and a saturated aqueous sodium hydrogen carbonate solution (100 ml), and then dried over anhydrous sodium sulfate (50 g). Dried. The solvent was distilled off under reduced pressure, and the obtained residue was directly used in the next reaction (29 g). This residue (29 g) was added to tetrahydrofuran (100 m
1), 1N vinylmagnesium bromide / tetrahydrofuran solution (225 ml) was added at 0 ° C., and the mixture was stirred for 2 hours. After completion of the reaction,
° C, and 3N hydrochloric acid (40 ml) was added thereto.
Further, ethyl acetate (500 ml) was added thereto, and the mixture was separated. The obtained organic layer was washed with a saturated aqueous solution of sodium hydrogen carbonate (200 ml) and dried over anhydrous sodium sulfate (50 ml).
g), the solvent was distilled off under reduced pressure, and the obtained residue was purified by silica gel flash column chromatography (hexane: ethyl acetate = 7: 3) to obtain 7.4 g (40%) of the title compound. I got

¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 1.41
(s, 9H), 2.99 (dd, 1H, J1 = 13.8, J2 = 6.4Hz), 3.14 (dd,
1H, J1 = 13.8, J2 = 6.4Hz), 4.87 (dd, 1H, J1 = 13.8, J2 =
6.4Hz), 5.23 (d, 1H, J = 7.2Hz), 5.84 (d, 1H, J = 10.2H
z), 6.32-6.48 (m, 2H), 7.09-7.29 (m, 5H). Melting point 70 ° C (1-b) {4- [acetyl- (1-tert-butylcarbamoyl-
2-phenyl-ethyl) amino] -1-benzyl-2-
Hydroxy-butyl} -carbamic acid tert-ester The compound obtained in Example 1-a (1.1 g, 3.8 mmol)
l), phenylalanine tert-butylamide hydrochloride 1.4
g (4.4 mmol) and 1.2 g of triethylamine
(12 mmol) was dissolved in ethanol (25 ml) and stirred at room temperature for 3 hours. Thereafter, the reaction solution was cooled to 0 ° C., and sodium borohydride (210 mg, 5.6 m
mol), and the mixture was stirred at 0 ° C. for 4 hours. After completion of the reaction, acetic acid (0.5 ml) was added to the reaction solution, and
A saturated aqueous sodium hydrogen carbonate solution (20 ml) was added,
Liquid separation was performed, and the obtained organic layer was dried over anhydrous sodium sulfate (20%).
g). The solvent was distilled off under reduced pressure, and the obtained residue was directly used for the next reaction (1.5 g). This residue (1.5 g), acetic anhydride (1.6 g, 16 mmol),
Triethylamine (1.6 mg, 16 mmol) and a catalytic amount of 4-dimethylaminopyridine were treated with methylene chloride (2.
5 ml) and stirred at room temperature for 12 hours. After completion of the reaction, a saturated saline solution (40 ml) was added, and ethyl acetate (100 ml) was added thereto, followed by liquid separation. After the obtained organic layer was dried over anhydrous sodium sulfate (40 g), the solvent was distilled off under reduced pressure, and the obtained residue was subjected to thin-layer chromatography (hexane: ethyl acetate: acetone = 5: 4: 1). Purification gave 1.4 g (64%) of the title compound. ¹ H-NMR: δ ppm (CDCl ₃ , 270 Mhz): 7.28-7.13 (m, 3
H), 4.80-4.09 (m, 4H), 3.30-3.08 (m, 3H), 2.13-2.01 (m, 1
0H), 1.32 (s, 9H), 1.27 (s, 9H). Melting point 88 ° C (1-c) 4- (toluenesulfonyl-isopropyl-amino)
-1-benzyl-2-hydroxy-butyryl] -carba
Tert-Butylminic acid 4- (benzyl-isopropyl-amino) -1-benzyl-2-acetoxy-butyryl] -carbamic acid tert-butyl ester obtained by the method of Example 1-b (294
Acetic acid (0.1 ml) and 10% palladium-carbon (500 mg) were added to the resulting mixture, and the mixture was stirred under a hydrogen atmosphere at room temperature for 1 day. After returning to a nitrogen atmosphere, impurities were removed by filtration, the solvent was distilled off under reduced pressure, and the obtained residue was used for the next reaction as it was. 4- (isopropyl-amino) -1-benzyl-2 obtained by the above method
-Acetoxy-butyryl] -carbamic acid tert-butyl ester (212 mg, 0.56 mmol) was dissolved in methylene chloride (5 ml), and triethylamine (138 mg, 1.36 mmol) and tosyl chloride (173 mg, 0.91 mmol) were dissolved therein. Was added at 0 ° C., and the mixture was stirred for 2 hours. After the completion of the reaction, a saturated sodium hydrogen carbonate solution (20 ml) was added to the reaction solution, and ethyl acetate (100 ml) was added, followed by separation. The obtained organic layer was dried over anhydrous sodium sulfate (20 g), the solvent was distilled off under reduced pressure, and the obtained residue was purified by thin-layer chromatography (hexane: ethyl acetate = 5: 5) to give 4- (Toluenesulfonyl-isopropyl-amino) -1-benzyl-2-acetoxy-butyryl] -carbamic acid tert-
224 mg (67%) of the butyl ester were obtained. 4- (toluenesulfonyl-isopropyl-amino) -1-benzyl-2-acetoxy-butyryl] -carbamic acid t
ert-butyl ester (80 mg) was added to methanol (5 m
l) was added thereto, and a 1 N aqueous sodium hydroxide solution (1 ml) was further added thereto, followed by stirring for 2 hours. After completion of the reaction, a 5% potassium hydrogensulfate solution (20 ml) was added to the reaction solution, and ethyl acetate (50 ml) was added, followed by separation. The obtained organic layer was dried over anhydrous sodium sulfate (20 g), the solvent was distilled off under reduced pressure, and the obtained residue was purified by thin-layer chromatography (hexane: ethyl acetate = 7: 3) to give the title compound. ¹ H-NMR to obtain 69 mg (75%): δ ppm (CDCl ₃ , 270 MHz): 7.75 to 7.66 (m, 2
H), 7.37-7.22 (m, 8H), 4.70 d, 1H, J = 7.5 Hz), 3.
99-3.63 (m, 3H), 3.46-3.00 (m, 3H), 2.99-2.77 (m,
3H), 2.24 (s, 3H), 2.00-1.94 (m, 1H), 1.38 (s, 9
H), 1.13 (d, 6H, J = 6.8 Hz). Mass: 490 (M) + (Example 2) N- {4- (toluenesulfonyl-ethyl-amino)
-1-benzyl-2-hydroxy-butyryl} -3-hi
Droxy-2-methyl-benzamide (Exemplified Compound No. 1-1) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.76-7.71 (m, 2)
H), 7.68-7.60 (m, 5H), 6.97 (dd, 1H, J1 = J2 = 7.7
Hz), 6.78 (d, 1H, J1 = 7.7 Hz), 6.58 (d, 1H, J1 =
7.7 Hz), 5.96 (d, 1H, J1 = 8.6 Hz), 4.47-4.40 (m, 1
H), 4.08-3.86 (m, 3H), 3.65-3.04 (m, 6H), 2.94-2.8
0 (m, 1H), 2.42 (s, 3H), 2.00 (s, 3H), 1.10 (t, 3H,
J: 7.2 Hz). Mass: 510 (M) + (Example 3) N- {4- (toluenesulfonyl-isopropyl-a)
Mino) -1-benzyl-2-hydroxy-butyryl｝-
3-Hydroxy-2-methyl-benzamide (Exemplified Compound No. 1-2) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.71-7.61 (m, 2)
H), 7.34-7.16 (m, 7H), 6.96 (t, 1H, J = 7.8 Hz),
6.77 (d, 1H, J = 7.8 Hz), 6.57 (d, 1H, J = 7.8 H
z), 5.93 (d, 1H, J = 8.1 Hz), 5.55 (s, 1H), 4.46-
4.33 (m, 1H), 4.16-3.77 (m, 2H), 3.47-3.01 (m ,. 3
H), 2.87 (dd, 1H, J1 = 14.2, J2 = 10.3 Hz), 2.42
(s, 3H), 2.04 (s, 3H), 1.11 (d, 3H, J = 6.7 Hz),
0.96 (d, 3H, J = 6.7 Hz). Mass: 524 (M) + (Example 4) N- {4- (toluenesulfonyl-isopropyl-a)
Mino) -1-benzyl-2-hydroxy-butyryl｝-
3-Hydroxy-2,5-dimethyl-benzamide (Exemplified Compound No. 1-3) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.73.76 (m, 2)
H), 7.37-7.19 (m, 7H), 6.59 (s, 1H), 6.34 (s, 1H),
5.85 (d, 1H, J = 7.1 Hz), 4.45-3.85 (m, 4H), 3.49
-3.05 (m, 3H), 2.87 (dd, 1H, J1 = 14.3, J2 = 9.4 H
z), 2.42 (s, 3H), 2.16 (s, 3H), 1.13 (d, 3H, J =
Mass: 538 (M) + (Example 5) N-Δ4- (toluenesulfonyl-methyl-amino) . 6.7 Hz), 0.99 (d, 3H, J = 6.7 Hz).
-1-benzyl-2-hydroxy-butyryl} -3-hi
Droxy-2-methyl-benzamide (Exemplified Compound No. 1-4) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.81-7.59 (m, 2)
H), 7.34-7.16 (m, 7H), 6.96 (t, 1H, J = 7.9 Hz),
6.77 (d, 1H, J = 7.9 Hz), 6.57 (d, 1H, J = 7.9 H
z), 6.00 (d, 1H, J = 8.6 Hz), 4.48-4.40 (m, 2H),
4.04-3.73 (m, 2H), 3.53-3.02 (m, 3H), 2.43 (s, 3
H), 2.05 (s, 3H), 2.01-1.55 (m, 5H). Mass: 496 (M) + (Example 6) N- [4-{(4-methoxy) -benzenesulfonyl]
-Ethyl-amino} -1-benzyl-2-hydroxy-
Butyryl] -3-hydroxy-2-methyl-benzami
De (Compound No. ^{1-5) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.77-7.66 (m, 2
H), 7.33-7.19 (m, 6H), 6.99-6.87 (m, 3H), 6.74 (d,
1H, J = 7.9 Hz), 6.57 (d, 1H, J = 7.9 Hz), 6.01
(d, 1H, J = 8.6 Hz), 4.47-4.31 (m, 3H), 3.88-3.00
(m, 7H), 2.82 (dd, 1H, J1 = 14.3, J2 = 9.4 Hz), 2.
13-1.66 (m, 3H), 1.26 (dd, 3H, J1 = 11.3, J2 = 7.1
Hz) Mass: 527 (M) + (Example 7) N- [4-{(2,4,6-trimethyl) -benzenes]
Ruphonyl-ethyl-amino} -1-benzyl-2-hi
Droxy-butyryl] -3-hydroxy-2-methyl-
Benzamide (Exemplified Compound No. 1-6) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.40-7.19 (m, 6)
H), 6.97-6.88 (m, 3H), 6.73 (d, 1H, J = 8.0Hz), 6.50
(d, 1H, J = 8.0 Hz), 5.94 (d, 1H, J = 7.2 Hz), 4.36
-4.14 (m, 3H), 3.80-3.00 (m, 7H), 2.58 (s, 6H), 2.2
7s, 3H), 2.05-1.68 (m, 5H) Mass: 538 (M) + (Example 8) N- [4- (toluenesulfonyl-hydroxyethyl)
-Amino) -1-benzyl-2-hydroxy-butylyl
^1-3 -Hydroxy-2-methyl-benzamide (Exemplified Compound No. 1-7) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.40-7.19 (m, 6
H), 6.97-6.88 (m, 3H), 6.73 (d, 1H, J = 8.0Hz), 6.50
(d, 1H, J = 8.0 Hz), 5.94 (d, 1H, J = 7.2 Hz), 4.36
-4.14 (m, 3H), 3.80-3.00 (m, 7H), 2.58 (s, 6H), 2.2
7s, 3H), 2.05-1.68 (m, 5H) Mass: 527 (M) + (Example 9) {4- [acetyl- (1-tert-butylcarbamoyl-
1-phenyl-methyl) amino] -1-benzyl-2-
Hydroxy-butyl｝ -carbamic acid tert-ester (Exemplified Compound No. 2-1) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.50-6.79 (m, 10)
H), 5.63-3.98 (m, 5H), 2.80-2.14 (m, 5H), 1.30 (s, 9H). Mass: 525 (M) + (Example 10) {4- (acetyl-benzyl-amino) -1-benzyl
-2 (R) -hydroxy-butyl} -carbamic acid te
rt-ester (Exemplified Compound No. 1-9) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.50-6.99 (m, 10)
H), 5.90-3.90 (m, 5H), 2.99-2.10 (m, 5H), 1.30 (s, 9H). Mass: 426 (M) + (Example 11) {4- (acetyl-benzyl-amino) -1-benzyl
-2 (S) -hydroxy-butyl} -carbamic acid te
rt-ester (Exemplified Compound No. 1-9) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.50-6.99 (m, 10)
H), 5.90-4.00 (m, 5H), 2.80-2.10 (m, 5H), 1.30 (s, 9H). Mass: 426 (M) + (Example 12) N- {4- [acetyl- (1 -Tert-butylcarbamoy
1-phenyl-methyl) -amino] 1-benzyl-
2-hydroxy-butyl} -3-hydroxy-2-methyl
Rubenzuamido (Compound No. ^{2-2) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.60-7.00 (m, 10
H), 6.90-6.22 (m, 3H), 5.40-3.88 (m, 5H), 2.80-2.10
(m, 5H), 1.30 (s, 9H), 1.26 (s, 9H). Mass: 517 (M) + (Example 13) {4- (1-tert-butylcarbamoyl-1-tert-butyl)
Ru-methyl) amino] -1-benzyl-2 (S) -hydr
Roxy-butyl｝ -carbamic acid tert-ester (Exemplary Compound No. 2-3) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.70-7.00 (m, 7
H), 6.90-6.29 (m, 2H), 5.83-3.88 (m, 5H), 2.80-2.00 (m,
5H), 1.30 (s, 9H), 1.20 (s, 9H). Mass: 463 (M) + (Example 14) {4- (1-tert-butylcarbamoyl-1-tert-butyi)
Ru-methyl) amino] -1-benzyl-2 (R) -hydr
Roxy-butyl｝ -carbamic acid tert-ester (Exemplified Compound No. 2-3) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.50-6.90 (m, 10)
H), 6.88-6.22 (m, 2H), 5.29-3.88 (m, 4H), 2.90-2.10
(m, 5H), 1.30 (s, 9H), 1.26 (s, 9H). Mass: 463 (M) + (Example 15) {4- (1-benzylcarbamoyl-1-tert-butyl)
-Methyl) amino] -1-benzyl-2 (R) -hydro
X-butyl ＮＭＲ- carbamic acid tert-ester (Exemplified Compound No. 2-4) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.70-6.99 (m, 8
H), 6.90-6.22 (m, 3H), 5.29-3.99 (m, 4H), 2.80-2.10 (m,
5H), 1.29 (s, 9H). Mass: 497 (M) + (Example 16) {4- (1-benzylcarbamoyl-1-tert-butyl)
-Methyl) amino] -1-benzyl-2 (S) -hydro
Carboxymethyl - butyl} - carbamic acid tert- ester (Compound No. ^{2-4) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.70-7.06 (m, 10
H), 6.90-6.27 (m, 3H), 5.40-3.98 (m, 4H), 2.90-2.10
(m, 6H), 1.31 (s, 9H). Mass: 497 (M) + (Example 17) {4-acetyl- (1-benzylcarbamoyl-1-f)
Enyl-methyl) amino] -1-benzyl-2 (R)-
Hydroxy-butyl｝ -carbamic acid tert-ester (Exemplified Compound No. 2-5) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.57-6.98 (m, 10)
H), 6.90-6.29 (m, 3H), 5.29-3.88 (m, 5H), 2.90-2.25
(m, 5H), 1.33 (s, 9H). Mass: 559 (M) + (Example 18) {4-acetyl- (1-benzylcarbamoyl-1-f)
Enyl-methyl) amino] -1-benzyl-2 (S)-
Hydroxy-butyl｝ -carbamic acid tert-ester (Exemplified Compound No. 2-5) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.70-6.90 (m, 9)
H), 6.60-6.22 (m, 3H), 5.23-3.70 (m, 5H), 2.80-2.10 (m,
5H), 1.30 (s, 9H). Mass: 559 (M) + (Example 19) {4- (1-benzylcarbamoyl-1-phenyl-meth)
Tyl) amino] -1-benzyl-2 (S) -hydroxy
- butyl} - carbamic acid tert- ester (Compound No. ^{2-6) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.70-7.05 (m, 10
H), 7.00-6.32 (m, 3H), 5.33-3.90 (m, 5H), 2.80-2.20
(m, 5H), 1.31 (s, 9H). Mass: 559 (M) + (Example 20) N- {4- [acetyl- (1-tert-butylcarbamoy)
1-tert-butyl-methyl) -amino] 1-benzyl
2-hydroxy-butyl} -3-hydroxy-2-
Methylbenzamide (Compound No. ^{2-7) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.60-7.11 (m, 9
H), 6.90-6.33 (m, 3H), 5.55-3.88 (m, 5H), 2.90-2.20 (m,
5H), 1.33 (s, 9H). Mass: 497 (M) + (Example 21) {4- (1-tert-butylcarbamoyl-1-phenyl)
-Methyl) amino] -1-benzyl-2 (S) -hydro
Carboxymethyl - butyl} - carbamic acid benzyl ester (Compound No. ^{2-8) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.80-7.00 (m, 10
H), 6.98-6.55 (m, 3H), 5.25-3.89 (m, 6H), 2.80-2.00 (m,
5H), 1.20 (s, 9H). Mass: 559 (M) + (Example 22) {4- (1-tert-butylcarbamoyl-3-phenyl)
-Propyl) amino] -1-benzyl-2 (R) -hydr
Roxy-butyl｝ -carbamic acid tert-ester (Exemplified Compound No. 2-9) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.88-6.99 (m, 10)
H), 6.88-6.44 (m, 3H), 5.63-3.99 (m, 6H), 2.89-2.10 (m,
5H), 1.36 (s, 9H). Mass: 511 (M) + (Example 23) {4- (1-tert-butylcarbamoyl-3-phenyl)
-Propyl) amino] -1-benzyl-2 (S) -hydrido
Roxy-butyl} -carbamic acid tert-ester (Exemplified Compound No. 2-9) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.50-6.33 (m, 10
H), 6.78-6.20 (m, 3H), 5.50-3.99 (m, 4H), 2.99-2.00
(m, 5H), 1.29 (s, 9H). Mass: 511 (M) + (Example 24) {4-acetyl- (1-tert-butylcarbamoyl-2)
-Phenyl-ethyl) amino] -1-benzyl-2
(S) -Hydroxy-butyl} -carbamic acid benzyl
Glycol ester (Compound No. ^{2-10) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.40-6.99 (m, 10
H), 6.80-6.20 (m, 3H), 5.63-3.90 (m, 4H), 2.90-2.10
(m, 5H), 1.34 (s, 9H). Mass: 553 (M) + (Example 25) {4- (1-tert-butylcarbamoyl-2-naphthyl)
-Ethyl) amino] -1-benzyl-2 (S) -hydro
Carboxymethyl - butyl} - carbamic acid tert- ester (Compound No. ^{2-11) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.60-6.59 (m, 12
H), 5.53-3.98 (m, 6H), 2.90-2.00 (m, 6H), 1.20 (s, 9H). Mass: 547 (M) + (Example 26) {4- (1-benzylcarbamoyl-2) -Phenyl-e
Tyl) amino] -1-benzyl-2-hydroxy-buty
Ru-carbamic acid tert-ester (Exemplified Compound No. 2-12) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.50-6.99 (m, 10
H), 6.90-6.22 (m, 2H), 5.23-3.88 (m, 5H), 2.80-2.10
(m, 5H), 1.30 (s, 9H). Mass: 573 (M) + (Example 27) N- {4- [acetyl- (1-tert-butylcarbamoy)
Ru-2-phenyl-ethyl) -amino] 1-benzyl-
2-hydroxy-butyl} -3-hydroxy-2-methyl
Rubenzuamido (Compound No. ^{2-13) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.60-6.90 (m, 8
H), 6.87-5.99 (m, 2H), 5.03-3.58 (m, 6H), 2.80-2.11 (m,
4H), 1.29 (s, 9H). Mass: 559 (M) + (Example 28) N- {4- [acetyl- (1-tert-butylcarbamoy)
Ru-2-phenyl-ethyl) -amino] 1-benzyl-
2-hydroxy-butyl} -3-hydroxy-2-methyl
Rubenzamide (Exemplified Compound No. 2-14) The compound obtained in Example 1 (1-b) (135 mg, 0.2)
1 mmol), 4N hydrogen chloride / 1,4-dioxane solution (5 ml) was added, and the mixture was allowed to stand for 5 hours. After completion of the reaction, the solvent was distilled off under reduced pressure, and dimethylformamide (5 ml) was added thereto.
0.26 mmol), 3-hydroxy-2-methylbenzoic acid (45 mg, 0.30 mmol), 1-hydroxybenzotriazole (29 mg, 0.22 mmol), and triethylamine (66 mg, 0.65 mmol). Stirred for hours.

After the completion of the reaction, saturated saline (20 ml) was added, ethyl acetate (100 ml) was added thereto, and the mixture was separated. The obtained organic layer was washed with saturated saline (20 ml), and sulfuric anhydride was added. After drying with sodium (20 g), the solvent was distilled off under reduced pressure, and the obtained residue was used for the next reaction as it was.

To the residue was added methanol (5 ml).
Further, a 1N aqueous sodium hydroxide solution (1 m
l) was added and stirred for 2 hours. After the reaction is completed, add 5
A 20% potassium hydrogen sulfate solution (20 ml) was added, and ethyl acetate (100 ml) was added to carry out liquid separation. The obtained organic layer was dried over anhydrous sodium sulfate (50 g), the solvent was distilled off under reduced pressure, and the obtained residue was purified by thin-layer chromatography (hexane: ethyl acetate = 5: 5) to give the title compound. 1
7 mg (25%) were obtained.

¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.33
-7.14 (m, 5H), 7.03-6.93 (m, 1H), 6.84-6.17 (m, 3H), 5.9
6 (3H, s), 5.94 (s, 1H), 4.73-4.30 (m, 4H), 4.18-3.48 (m,
2H), 2.77-2.21 (m, 4H), 1.30 (s, 9H). IR: 3325, 2969, 2931, 1648, 1586, 1526, 1455, 13
67, 1282, 1225, 1208, 1176, 1112, 1093, 700 cm ^-1 Mass: 559 (M) + (Example 29) N- {4- [benzyl- (1-tert-butylcarbamoy)
Ru-2-phenyl-ethyl) -amino] 1-benzyl-
2-hydroxy-butyl} -carbamic acid tert-S
Ter (Exemplified Compound No. 2-15) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.54-6.90 (m, 8
H), 6.77-5.90 (m, 3H), 4.73-3.58 (m, 6H), 2.77-2.30 (m,
6H), 1.29 (s, 9H), 1.20 (s, 9H). Mass: 587 (M) + (Example 30) N- {4- [acetyl- (1-benzylcarbamoyl-
-Phenyl-methyl) -amino] -1-benzyl-2-
Hydroxy-butyl} -3-hydroxy-2-methylbe
Nsamide (Exemplified Compound No. 2-16) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.60-7.00 (m, 5
H), 6.99-6.90 (m, 1H), 6.85-5.90 (m, 6H), 4.96-3.48
(m, 3H), 2.77-2.29 (m, 5H), 1.27 (s, 9H). Mass: 593 (M) + (Example 31) N- {4- [acetyl- (1-benzylcarbamoyl-
2-naphthyl-ethyl) -amino] 1-benzyl-2-
Hydroxy-butyl｝ -carbamic acid tert-ester (Exemplary Compound No. 2-17) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.90-7.10 (m, 8
H), 6.80-5.90 (m, 6H), 5.94-5.88 (m, 1H), 4.93-3.38
(m, 5H), 2.97-2.00 (m, 5H), 1.39 (s, 9H). Mass: 587 (M) + (Example 32) N- {4- [acetyl- (1-tert-butylcarbamoy)
Ru-2-naphthyl-ethyl) -amino] -1-benzyl
-2-hydroxy-butyl} -3-hydroxy-2-me
Chirubenzuamido (Compound No. ^{2-18) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.44-7.10 (m, 5
H), 7.09-6.90 (m, 2H), 6.77-5.90 (m, 6H), 5.94 (s, 1H),
4.73-3.48 (m, 5H), 2.77-2.21 (m, 5H), 1.29 (s, 9H). Mass: 623 (M) + (Example 33) N- {4- [acetyl- (1-tert- Butylcarbamoy
2-phenyl-ethyl) -amino] -1-benzyl
-2-hydroxy-butyl} -3-hydroxy-2-me
Chirubenzuamido (Compound No. ^{2-19) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.88-7.00 (m, 8
H), 6.80-5.90 (m, 6H), 4.79-3.40 (m, 6H), 2.77-2.21 (m,
5H), 1.30 (s, 9H). Mass: 621 (M) + (Example 34) N- {4- (1-tert-butylcarbamoyl-2-fe)
Nil-ethyl) -amino] -1-benzyl-2-hydro
Xy-butyl} -3-hydroxy-2-methylbenzure
Mide (Exemplified Compound No. 2-20) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.44-6.80 (m, 9
H), 6.70-5.90 (m, 5H), 4.83-3.40 (m, 6H), 2.77-2.21 (m,
5H), 1.29 (s, 9H). Mass: 531 (M) + (Example 35) N- {4- [acetyl- (1-benzylcarbamoyl-
2-phenyl-ethyl) -amino] -1-benzyl-2
-Hydroxy-butyl} -3-hydroxy-2-methyl
Benzamide (Exemplified Compound No. 2-21) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.60-7.10 (m, 5
H), 7.03-6.90 (m, 3H), 6.45-5.90 (m, 4H), 4.80-3.44
(m, 5H), 2.80-2.21 (m, 4H), 1.29 (s, 9H). Mass: 607 (M) + (Example 36) N- {4- [acetyl- (1-tert-butylcarbamoy)
2-phenyl-ethyl) -amino] -1-benzyl
Tert-d-2-hydroxy-butyl} -carbamic acid
Stele (Exemplified Compound No. 2-22) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.54-7.15 (m, 6
H), 7.09-6.90 (m, 2H), 6.77-5.90 (m, 6H), 4.90-3.30
(m, 6H), 2.90-2.20 (m, 6H), 1.29 (s, 9H). Mass: 539 (M) + (Example 37) N- {4- [methyl- (1-tert-butylcarbamoyl)
-2-phenyl-ethyl) -amino] -1-benzyl-
2-hydroxy-butyl} -carbamic acid tert-S
Ter (Exemplified Compound No. 2-23) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.44-7.10 (m, 5
H), 7.09-6.60 (m, 2H), 6.60-5.90 (m, 5H), 4.80-3.50
(m, 4H), 2.90-2.21 (m, 5H), 1.29 (s, 9H). Mass: 511 (M) + (Example 38) N- {4- [acetyl- (1-tert-butylcarbamoy)
2-phenyl-ethyl) -amino] -1-benzyl
-2-hydroxy-butyl} -3-hydroxy-2-me
Chirubenzuamido (Compound No. ^{2-14) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.70-6.90 (m, 1
0H), 4.80-4.24 (m, 5H), 4.11-3.07 (m, 7H), 2.64-2.
34 (m, 5H), 2.30 (s, 3H), 2.30-1.66 (m, 3H), 1.29
(s, 9H). Mass: 573 (M) + (Example 39) N- {4- [acetyl- (1- (2-methyl) -benzyl]
Rucarbamoyl-2-phenyl-ethyl) -amino]-
1-benzyl-2-hydroxy-butyl} -carbamine
Acid tert-ester (Exemplified Compound No. 2-24) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.70-6.80 (m, 9)
H), 4.80-4.20 (m, 4H), 4.00-3.01 (m, 6H), 2.64-2.3
4 (m, 5H), 2.25 (s, 3H), 2.15-1.66 (m, 3H), 1.35
(s, 9H). Mass: 587 (M) + (Example 40) N- {4- [acetyl- (1- (3-methyl) -benzyl]
Rucarbamoyl-2-phenyl-ethyl) -amino]-
1-benzyl-2-hydroxy-butyl} -carbamine
Acid tert-ester (Exemplified Compound No. 2-25) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.90-7.10 (m, 6
H), 6.96-6.60 (m, 3H), 4.90-4.20 (m, 4H), 3.75-3.0
0 (m, 6H), 2.70-2.37 (m, 6H), 2.15-1.83 (m, 4H),
2.30 (s, 3H), 1.26 (s, 9H) Mass: 587 (M) + (Example 41) N- {4- [acetyl- (1- (4-methyl) -benzyl)
Rucarbamoyl-2-phenyl-ethyl) -amino]-
1-benzyl-2-hydroxy-butyl} -carbamine
Acid tert-ester (Exemplified Compound No. 2-26) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.90-7.10 (m, 6)
H), 7.00-6.70 (m, 4H), 4.80-4.00 (m, 4H), 3.90-3.0
1 (m, 3H), 2.64-2.37 (m, 3H), 2.15-1.83 (m, 3H),
2.30 (s, 3H), 1.25 (s, 9H) Mass: 587 (M) + (Example 42) N- {4- [methyl- (1-tert-butylcarbamoyl)
-2-phenyl-ethyl) -amino] -1-benzyl-
2-hydroxy-butyl} -3-hydroxy-2-methyl
Rubenzuamido (Compound No. ^{2-27) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.90-7.01 (m, 7
H), 6.99-6.70 (m, 3H), 4.79-4.20 (m, 3H), 3.90-3.0
1 (m, 4H), 2.55-2.37 (m, 6H), 2.15-1.79 (m, 3H),
2.29 (s, 3H), 1.39 (s, 9H). Mass: 545 (M) + (Example 43) N- {4- [acetyl- (1- (2-methyl) -benzyl)
Rucarbamoyl-2-phenyl-ethyl) -amino]-
1-benzyl-2-hydroxy-butyl {-3-hydro
Xy-2-methylbenzamide (Exemplary Compound No. 2-2
8) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.70-7.10 (m, 6
H), 6.99-6.66 (m, 3H), 4.80-4.20 (m, 5H), 3.75-3.0
1 (m, 5H), 2.64-2.37 (m, 6H), 2.15-1.83 (m, 3H),
2.25 (s, 3H), 1.35 (s, 9H) Mass: 621 (M) + (Example 44) N- {4- [acetyl- (1- (3-methyl) -benzyl)
Rucarbamoyl-2-phenyl-ethyl) -amino]-
1-benzyl-2-hydroxy-butyl {-3-hydro
Xy-2-methylbenzamide (Exemplary Compound No. 2-2
9) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.70-7.10 (m, 6
H), 6.99-6.66 (m, 3H), 4.80-4.20 (m, 5H), 3.75-3.0
1 (m, 5H), 2.64-2.37 (m, 6H), 2.15-1.83 (m, 3H),
2.25 (s, 3H), 1.35 (s, 9H) Mass: 621 (M) + (Example 45) N- {4- [acetyl- (1- (4-methyl) -benzyl)
Rucarbamoyl-2-phenyl-ethyl) -amino]-
1-benzyl-2-hydroxy-butyl {-3-hydro
Xy-2-methylbenzamide (Exemplary Compound No. 2-3
0) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.33-6.93 (m, 8
H), 6.84-6.17 (m, 3H), 4.99-4.22 (m, 5H), 4.18-3.48
(m, 2H), 2.99-2.21 (m, 4H), 1.26 (s, 9H). Mass: 621 (M) + (Example 46) N- {4- [propionyl- (1-tert-butylcarba)
Moyl-2-phenyl-ethyl) -amino] -1-ben
Jil-2-hydroxy-butyl {-3-hydroxy-2
- methylbenzamide (Compound No. ^{2-31) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.44-7.10 (m, 5
H), 7.09-6.90 (m, 2H), 6.77-5.90 (m, 6H), 5.94 (s, 1H),
4.73-3.48 (m, 5H), 2.77-2.21 (m, 5H), 1.29 (s, 9H). Mass: 587 (M) + (Example 47) N- {4- [acetyl- (1-tert- Butylcarbamoy
Ru-2-naphthyl-ethyl) -amino] -1-naphthyl
Methyl-2-hydroxy-butyl {-3-hydroxy-
2-methylbenzamide (Exemplified Compound No. 2-32) (47-a) (tert-butoxycarbonyl) -4 (S) -amino-5
(R) -Naphthyl-1-penten-3-one Commercially available (tert-butoxycarbonyl) (R) -naphthylalanine (3.1 g, 9.9 mmol), 1-ethyl-3-
(3-dimethylaminopropyl) carbodiimide hydrochloride (hereinafter abbreviated as EDC; 2.5 g, 13 mmol), triethylamine (1.5 g, 14 mmol) and N, O-
Dimethylhydroxyamine hydrochloride (1.2 g, 13 mm
ol) was added to tetrahydrofuran (30 ml) and stirred at room temperature for 8 hours.

After completion of the reaction, ethyl acetate (200
ml), and the resulting solution was washed successively with a 5% aqueous solution of potassium hydrogen sulfate (30 ml) and a saturated aqueous solution of sodium hydrogen carbonate (30 ml), and dried over anhydrous sodium sulfate (20 ml).
g). The solvent was distilled off under reduced pressure, and the obtained residue was directly used in the next reaction (3.5 g).

This residue (3.5 g) was dissolved in tetrahydrofuran (40 ml), and a 1N vinylmagnesium bromide / tetrahydrofuran solution (30 ml) was added thereto.
Was added at 0 ° C., and the mixture was stirred for 2 hours.

After the completion of the reaction, the reaction solution was cooled to 0 ° C., 3N hydrochloric acid (20 ml) was added thereto, and ethyl acetate (100 ml) was further added thereto to carry out liquid separation. The obtained organic layer was washed with a saturated aqueous solution of sodium hydrogen carbonate (40 ml), dried over anhydrous sodium sulfate (20 g), the solvent was distilled off under reduced pressure, and the obtained residue was subjected to silica gel flash column chromatography (hexane: Ethyl acetate =
7: 3) to give 440 mg (15 mg) of the title compound.
%).

¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 1.45
(s, 9H), 2.99 (dd, 1H, J1 = 13.8, J2 = 6.4Hz), 3.14 (dd,
1H, J1 = 13.8, J2 = 6.4Hz), 4.87 (dd, 1H, J1 = 13.8, J2 =
6.4Hz), 5.23 (d, 1H, J = 7.2Hz), 5.84 (d, 1H, J = 10.2H
z), 6.29-6.48 (m, 2H), 7.00-7.35 (m, 14H). Mas
s: 325 (M) + melting point 90 ° C (47-b) {4- [acetyl- (1 (S) -tert-butylcarbamoy)
2- (R) -naphthyl-ethyl) amino] -1 (S)-
Benzyl-2 (S) -hydroxy-butyl} -carbami
Acid tert-ester The compound obtained in Example 47 (47-a) (171 mg, 0.1 mg).
525 mmol), 175 g (0.57 mmol) of phenylalanine tert-butylamide hydrochloride and 154 mg (1.5 mmol) of triethylamine were dissolved in ethanol (4 ml) and stirred at room temperature for 3 hours. afterwards,
The reaction was cooled to 0 ° C. and sodium borohydride (29
mg, 0.75 mmol) and stirred at 0 ° C. for 4 hours.

After completion of the reaction, acetic acid (0.5 ml) was added to the reaction solution.
And then add a saturated aqueous solution of sodium hydrogen carbonate (20
ml), and the mixture was separated, and the obtained organic layer was dried over anhydrous sodium sulfate (10 g). The solvent is distilled off under reduced pressure,
The obtained residue was used for the next reaction as it was (300 m
g).

The residue (300 mg) and acetic anhydride (22
9 g, 2.2 mmol), triethylamine (209 m
g, 2.1 mmol) and a catalytic amount of 4-dimethylaminopyridine in methylene chloride (5 ml).
Stirred for hours.

After completion of the reaction, a saturated saline solution (40 ml) was added, and ethyl acetate (100 ml) was added thereto, followed by separation. The obtained organic layer was washed with anhydrous sodium sulfate (40
g), the solvent is distilled off under reduced pressure, and the obtained residue is subjected to thin-layer chromatography (hexane: ethyl acetate = 5:
Purification in 5) gave 227 g (64%) of the title compound.

¹ H-NMR: δ ppm (CDCl ₃ , 270 Mhz): 7.
40-7.13 (m, 10H), 4.80-4.09 (m, 4H), 3.30-3.08 (m, 3H), 2.
13-2.01 (m, 10H), 1.32 (s, 9H), 1.27 (s, 9H). Mass: 6
31 (M) + melting point 79 ° C (47-c) N- {4- [acetyl- (1 (S) -tert-butylcarba)
Moyl-2- (R) -naphthyl-ethyl) -amino] -1
(S) -benzyl-2 (S) -hydroxy-butyl−-3
-Hydroxy -2-methylbenzamide The compound obtained in Example 47 (47-b) (227 mg, 0.
21 mmol), 4N hydrogen chloride / 1,4-dioxane solution (5 ml) was added, and the mixture was allowed to stand for 5 hours.

After the completion of the reaction, the solvent was distilled off under reduced pressure.
Add dimethylformamide (5 ml) and add EDC
(202 mg, 1.1 mmol), 3-hydroxy-2
-Methylbenzoic acid (153 mg, 1.0 mmol), 1
-Hydroxybenzotriazole (79 mg, 0.52
mmol) and triethylamine (100 mg, 1.0 mg).
mmol) and stirred at room temperature for 12 hours.

After the completion of the reaction, saturated saline (20 ml) was added, ethyl acetate (100 ml) was added thereto, and the mixture was separated. The obtained organic layer was washed with saturated saline (20 ml), and sulfuric anhydride was added. After drying with sodium (20 g), the solvent was distilled off under reduced pressure, and the obtained residue was used for the next reaction as it was.

To this residue was added methanol (5 ml),
Further, a 1N aqueous sodium hydroxide solution (1 m
l) was added and stirred for 2 hours.

After completion of the reaction, a 5% potassium hydrogen sulfate solution (20 ml) was added to the reaction solution, and ethyl acetate (100 ml) was added.
Was added and liquid separation was performed. The obtained organic layer was dried over anhydrous sodium sulfate (50 g), the solvent was distilled off under reduced pressure, and the obtained residue was purified by thin-layer chromatography (hexane: ethyl acetate = 2: 8) to give the title compound 34mg (25%)
I got

¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.8
8-7.15 (m, 6H), 6.99-6.70 (m, 3H), 4.66-4.20 (m, 5
H), 3.75-3.01 (m, 6H), 2.64-2.37 (m, 4H), 2.15-1.8
3 (m, 3H), 2.20 (s, 3H), 1.30 (s, 9H) Mass: 621 (M) + (Example 48) N- {4- [acetyl- (1-ethylcarbamoyl-2)
-Phenyl-ethyl) -amino] -1-benzyl-2-
Hydroxy-butyl} -3-hydroxy-2-methylbe
Nsamide (Exemplified Compound No. 2-33) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.80-7.44 (m,
3H), 7.41-7.00 (m, 7H), 4.36-4.16 (m, 3H), 3.53-3.1
6 (m, 9H), 2.66-2.37 (m, 3H), 2.15-1.83 (m, 5H),
2.00 (s, 3H), 1.38 (t, 3H, J = 7.1 Hz). Mass: 545 (M) + (Example 49) N- ｛4- [acetyl- (1-ethylcarbamoyl-2)
-Phenyl-ethyl) -amino] -1-naphthylmethyl
-2-hydroxy-butyl} -3-hydroxy-2-me
Chirubenzuamido (Compound No. ^{2-34) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.88-7.41 (m,
5H), 7.38-7.08 (m, 7H), 4.46-4.14 (m, 3H), 3.51-3.0
6 (m, 10H), 2.66-2.40 (m, 3H), 2.15-1.83 (m, 5H),
2.09 (s, 3H), 1.33 (t, 3H, J = 7.1 Hz). Mass: 595 (M) + (Example 50) N- {4- [acetyl- (1-tert-butylcarbamoy)
-(4-phenyl) -phenyl-ethyl) -amino]
-1-benzyl-2-hydroxy-butyl} -3-hydrido
Roxy-2-methylbenzamide (Exemplified Compound No. 2-
35) (50-a) (tert-butoxycarbonyl) -4 (S) -amino-5
(4-phenyl) -phenyl-1-penten-3-one Commercially available (tert-butoxycarbonyl) (4-phenyl)
-Phenylalanine (6.0 g, 20 mmol), 1-
Ethyl-3- (3-dimethylaminopropyl) carbodiimide hydrochloride (hereinafter abbreviated as EDC; 6.0 g, 35 mm)
ol), triethylamine (3.5 g, 35 mmol)
And N, O-dimethylhydroxyamine hydrochloride (3.
5,35 mmol) in tetrahydrofuran (60 ml)
And stirred at room temperature for 8 hours.

After completion of the reaction, ethyl acetate (200
ml), and the resulting solution was washed successively with a 5% aqueous solution of potassium hydrogen sulfate (30 ml) and a saturated aqueous solution of sodium hydrogen carbonate (30 ml), and dried over anhydrous sodium sulfate (20 ml).
g). The solvent was distilled off under reduced pressure, and the obtained residue was directly used in the next reaction (6.0 g).

This residue (6.0 g) was dissolved in tetrahydrofuran (100 ml), and a 1N solution of vinylmagnesium bromide / tetrahydrofuran (65 ml) was added.
l) was added at 0 ° C., and the mixture was stirred for 2 hours.

After the completion of the reaction, the reaction solution was cooled to 0 ° C., 3N hydrochloric acid (20 ml) was added thereto, and ethyl acetate (100 ml) was further added thereto to carry out liquid separation. The obtained organic layer was washed with a saturated aqueous solution of sodium hydrogen carbonate (40 ml), dried over anhydrous sodium sulfate (20 g), the solvent was distilled off under reduced pressure, and the obtained residue was subjected to silica gel flash column chromatography (hexane: Ethyl acetate = 7
5:25) to give 3.4 g (31) of the title compound.
%).

¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 1.40
(s, 9H), 2.89 (dd, 1H, J1 = 13.8, J2 = 6.4Hz), 3.14 (dd,
1H, J1 = 13.8, J2 = 6.4Hz), 4.87 (dd, 1H, J1 = 13.8, J2 =
6.4Hz), 5.23 (d, 1H, J = 7.2Hz), 5.84 (d, 1H, J = 10.2H
z), 6.32-6.48 (m, 2H), 7.00-7.35 (m, 14H).
s: 351 (M) + melting point 90 ° C (50-b) {4- [acetyl- (1 (S) -tert-butylcarbamoy)
Ru-1-{(4-phenyl) -phenyl} -ethyl) a
Mino] -1 (S) -benzyl-2 (S) -hydroxy-bu
Tyl｝ -carbamic acid tert-ester The compound obtained in Example 50 (50-a) (349 mg, 0.1%).
993 mmol), 418 mg (1.36 mmol) of phenylalanine tert-butylamide hydrochloride and 254 mg (2.5 mmol) of triethylamine were dissolved in ethanol (4 ml) and stirred at room temperature for 3 hours. afterwards,
The reaction was cooled to 0 ° C. and sodium borohydride (47
mg, 1.3 mmol) and stirred at 0 ° C. for 4 hours. After completion of the reaction, acetic acid (0.5 ml) was added to the reaction solution, and a saturated aqueous sodium hydrogen carbonate solution (20 m
1) was added, and the mixture was separated. The obtained organic layer was dried over anhydrous sodium sulfate (10 g). The solvent was distilled off under reduced pressure, and the obtained residue was directly used for the next reaction (320 m
g). This residue (320 mg) and acetic anhydride (308 m
g, 3.0 mmol), triethylamine (364 m
g, 3.6 mmol) and a catalytic amount of 4-dimethylaminopyridine were added to methylene chloride (5 ml).
Stirred for hours. After completion of the reaction, a saturated saline solution (40 ml) was added, and ethyl acetate (100 ml) was added thereto, followed by liquid separation. The obtained organic layer was washed with anhydrous sodium sulfate (40
g), the solvent is distilled off under reduced pressure, and the obtained residue is subjected to thin-layer chromatography (hexane: ethyl acetate = 4:
Purification in 6) gave 441 g (64%) of the title compound.

¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.
38-7.13 (m, 10H), 4.80-4.09 (m, 4H), 3.30-3.08 (m, 3H), 2.
13-2.01 (m, 10H), 1.32 (s, 9H), 1.27 (s, 9H). Mass: 6
57 (M) + melting point 79 ° C (50-c) N- {4- [acetyl- (1 (S) -tert-butylcarba)
Moyl-2- (R) -naphthyl-ethyl) -amino] -1
(S) -benzyl-2 (S) -hydroxy-butyl−-3
-Hydroxy -2-methylbenzamide The compound obtained in Example 50 (50-b) (195 mg, 0.
29 mmol), 4N hydrogen chloride / 1,4-dioxane solution (5 ml) was added, and the mixture was allowed to stand for 5 hours.

After the completion of the reaction, the solvent was distilled off under reduced pressure.
Add dimethylformamide (5 ml) and add EDC
(179 mg, 0.93 mmol), 3-hydroxy-
2-methylbenzoic acid (82 mg, 0.54 mmol),
1-hydroxybenzotriazole (62 mg, 0.4
0 mmol) and triethylamine (81 mg, 0.8
0 mmol) and stirred at room temperature for 12 hours.

After the completion of the reaction, saturated saline (20 ml) was added, ethyl acetate (100 ml) was added thereto, and the mixture was separated. The obtained organic layer was washed with saturated saline (20 ml), and sulfuric anhydride was added. After drying with sodium (20 g), the solvent was distilled off under reduced pressure, and the obtained residue was used for the next reaction as it was.

To this residue, methanol (5 ml) was added.
Further, a 1N aqueous sodium hydroxide solution (1 m
l) was added and stirred for 2 hours.

After completion of the reaction, a 5% potassium hydrogen sulfate solution (20 ml) was added to the reaction solution, and ethyl acetate (100 ml) was added.
Was added and liquid separation was performed. The obtained organic layer was dried over anhydrous sodium sulfate (50 g), the solvent was distilled off under reduced pressure, and the obtained residue was purified by thin-layer chromatography (ethyl acetate only) to obtain 30 mg (30%) of the title compound. Obtained.

¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.7
8-7.03 (m, 14H), 7.00-6.40 (m, 5H), 4.54-4.23 (m,
6H), 3.74-3.11 (m, 7H), 2.66-2.40 (m, 3H), 2.15-1.
83 (m, 5H), 2.13 (s, 3H), 1.33 (s, 9H) Mass: 649 (M) + (Example 51) N- {4- [acetyl- (1-tert-butylcarbamoy)
2- (4-hydroxy) -phenyl-ethyl) -a
Mino] -1-benzyl-2-hydroxy-butyl｝ -3
-Hydroxy -2-methylbenzamide (Exemplified Compound No. 2-36) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.77-7.11 (m, 7
H), 7.00-6.55 (m, 3H), 4.55-4.23 (m, 6H), 3.80-3.0
1 (m, 7H), 2.55-2.36 (m, 4H), 2.22-1.83 (m, 4H),
2.13 (s, 3H), 1.34 (s, 9H) Mass: 589 (M) + (Example 52) N- {4- [acetyl- (1-cyclohexylcarbamo )
Yl-2-phenyl-ethyl) -amino] -1-benzyl
2-hydroxy-butyl} -3-hydroxy-2-
Methylbenzamide (Compound No. ^{2-37) 1 H-NMR: δ} ppm (CDCl 3, 270MHz): 7.88-7.11 (m, 7
H), 6.95-6.54 (m, 3H), 4.44-4.33 (m, 6H), 3.76-3.0
1 (m, 7H), 2.63-2.36 (m, 4H), 2.15-1.83 (m, 3H),
2.13 (s, 3H), 1.80-1.23 (m, 4H). Mass: 599 (M) + (Example 53) N- {4- [acetyl- (1-tert-butylcarbamoy)
2-phenyl-ethyl) -amino] -1-benzyl
Oxymethyl-2-hydroxy-butyl} -carbamine
Acid tert-ester (Exemplified Compound No. 2-38) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.90-7.10 (m, 6)
H), 6.96-6.60 (m, 3H), 4.90-4.20 (m, 4H), 3.75-3.0
0 (m, 6H), 2.70-2.37 (m, 6H), 2.15-1.83 (m, 4H),
2.30 (s, 3H), 1.26 (s, 9H) Mass: 569 (M) + (Example 54) N- {4- [acetyl- (1-tert-butylcarbamoy)
2- (4-benzyloxy) -phenyl-ethyl)
-Amino] -1-benzyl-2-hydroxy-butyl}
-3-Hydroxy-2-methylbenzamide (Exemplified Compound No. 2-39) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.87-7.09 (m, 9)
H), 6.95-6.55 (m, 6H), 4.84-4.21 (m, 6H), 3.86-3.0
1 (m, 7H), 2.77-2.22 (m, 4H), 2.15-1.83 (m, 3H),
2.22 (s, 3H), 1.31 (s, 9H) Mass: 579 (M) + (Example 55) N- {4- [acetyl- (1-tert-butylcarbamoy)
2- (4-chloro) -phenyl-ethyl) -ami
[No] -1-benzyl-2-hydroxy-butyl} -3-
Hydroxy-2-methylbenzamide (Exemplified Compound No. 2-40) ¹ H-NMR: δ ppm (CDCl ₃ , 270 MHz): 7.74-7.03 (m, 7
H), 6.95-6.47 (m, 3H), 4.44-4.29 (m, 6H), 3.76-3.0
1 (m, 7H), 2.63-2.36 (m, 4H), 2.15-1.83 (m, 3H),
2.13 (s, 3H), 1.26 (s, 9H) Mass: 608 (M) + (Test Example 1) Measurement of HIV protease inhibitory activity Using peptide synthesized with HIV protease expressed in Escherichia coli, peptide derivative of the present invention Was determined as follows using the IC ₅₀ value as an index. a) Construction of expression vector BH containing the main part of HTLV IIIB provirus
10 clones (Flossie Wong-Staal 'et al., Nature, 313
Vol. 277-284, 1985).
ClaI site in ag region and EcoR in pol region
The region flanked by the I site was cut out, and the obtained fragment was inserted into the same site of pBR322 and cloned.

Then, a synthetic fragment containing a translation initiation codon (ATG) GATCCTACCAAGTGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGAT GATGGTTCACTACCCACGCTCTCGCAGTCATAATTCGCCCCCTCTTAATCTAGC is inserted between the BamHI and ClaI sites located 5 ′ upstream of the insertion site.
A T7 promoter region [(Bgl II to BamHI)
Fragment) Barbara A. Moffatt et al., J. Mol. Biol.
189, pp. 113-130, 1986].

After cutting the Bgl II site (top region of the pol region) in the obtained plasmid, klenow
Repair synthesis is performed on the fragments, followed by T4D
The expression vector pT7HIV. Containing the HIV gag region and a part of the pol region was recombined with NA ligase.
GP (-) was constructed. b) Expression in E. coli E. coli BL-21 containing the T7 polymerase gene [(D
E-3) Barbara A. Moffatt et al., J. Mol. Biol., 189
Vol. 113-130, 1986], pT7HIV.
GP (-) was introduced, and the resulting transformant was transformed into M9CA- containing 200 μg / ml ampicillin.
The cells were cultured at 37 ° C. in a 10% LB medium until the absorbance at 600 nm reached 2.

0.4 mM isopropylthio-β-D-
Galactoside was added, and the culture was further continued for 3 hours.

The obtained cells were collected and stored as pellets at -80 ° C.

The polyprotein synthesized from the present expression vector is decomposed in the cells by autolysis to produce HIV protease. c) Purification The bacterial cells obtained from 2 liters of the culture solution were added to 60 ml of buffer A [50 mM Tris-HCl (pH 7.5), 1 mM
Dithiothreitol, 0.7% lysozyme, 10 μg /
ml aprotinin, 5 mM ethylenediaminetetraacetic acid, 1
0 μg / ml benzamide, 1 mM fluorinated phenylmethylsulfonic acid, 10% glycerin] at 0 ° C.
After leaving for 0 minutes, Triton X-100 (0.1
%) And left at 0 ° C. for 10 minutes.

The freeze-thaw was performed four times, and DNase I was used.
(0.1 mg) and 10 mM magnesium chloride were added to decompose the DNA in the suspension.

The supernatant obtained by centrifuging the suspension was subjected to DE.
AE Sephadex A25 column (5 cm ID x
20 cm) and fractionated. The same column was used for buffer B [50 mM-HEPES (pH 7.8), 1
mM dithiothreitol, 10 μg / ml aprotinin, 5 mM ethylenediaminetetraacetic acid, 10 μg / ml benzamide, 1 mM phenylmethylsulfonic acid, 1 mM
[0% glycerin].

The flow-through fractions in which the activity was observed were collected, and ammonium sulfate precipitation (60%) was performed. The obtained precipitate was washed with 2 ml of buffer C [50 mM Tris-HCl (pH 7.5), 1 m
M dithiothreitol, 1 mM ethylenediaminetetraacetic acid, 200 mM sodium chloride]. S
2000SW gel filtration column (7.5mm inner diameter x 60c
m, manufactured by Tosoh Corporation)
Fractionation was performed at a flow rate of ml / min.

The obtained active fraction was concentrated twice using an ultrafiltration membrane having a molecular weight cut off of 10,000 daltons, and stored at -80 ° C as an enzyme solution. d) Activity measurement The measurement of HIV protease inhibitory activity is described in D. Mat
aoshishi et al. (Science 247, 95).
4 (1990)).

That is, 20 μM of the synthetic substrate 4- (4-
Dimethylaminophenylazo) benzoic acid (DABCY
L) -Ser-Gln-Asn-Tyr-Pro-Il
e-Val-Gln-5-[(2-aminoethyl) amino] naphthalene-1-sulfonic acid (EDANS) (BA
CHEM) and 50 mM sodium acetate containing a test compound at each concentration dissolved in dimethyl sulfoxide (pH
5.5) A reaction solution of 1M saline was prepared. The partially purified recombinant HIV protease was added thereto, the reaction was started at room temperature, and the reaction product was measured with a fluorescence spectrophotometer. The amount of reaction produced per unit time in the presence of each concentration of the test compound was calculated, and the 50% inhibitory concentration (I
C ₅₀ ) was determined.

The results are shown in Table 3 for the compounds of Examples 28, 47 and 50 of the present invention.

[0187]

TABLE 3 -------------------------- compounds protease inhibitory activity (IC ₅₀ nM) ----------- −−−−−−−−−−−−−−− Example 28 90 Example 47 29 Example 50 47 −−−−−−−−−−−−−−−−−−−−−−−− The compounds of the present invention, in particular, Examples 28, 47 and 50,
It exhibited excellent protease inhibitory activity.

[0188]

Industrial Applicability The novel non-peptide dipeptide analog derivative of the present invention has excellent HIV protease inhibitory activity and is therefore useful as a prophylactic or therapeutic agent for AIDS.

──────────────────────────────────────────────────の Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C07C 271/20 C07C 271/20 311/18 311/18 (72) Inventor Yuji Ozawa Hiromachi, Shinagawa-ku, Tokyo 1-258, Sankyo Co., Ltd. (72) Inventor Akiko Sugiyama 1-2-58, Hiromachi, Shinagawa-ku, Tokyo F-term (reference) 4C206 AA01 AA02 AA03 GA07 GA08 HA22 JA13 MA01 NA15 ZB33 ZC20 ZC55 4H006 AA01 AA03 AB29 AC44 AC52 AC53 AC61 AC80 BA02 BA21 BA25 BA26 BA29 BA32 BA50 BA51 BA92 BB11 BB12 BB15 BB20 BB25 BB26 BC10 BC19 BE20 BE22 BE23 BV35 BV53 RA02 RA14 RA46

Claims (11)

[Claims] 1. A compound of the general formula [Wherein, R ¹ represents an aralkyloxycarbonyl group having 8 to 16 carbon atoms which may have a substituent, an alkyloxycarbonyl group having 2 to 10 carbon atoms which may have a substituent, or R ² represents an arylcarbonyl group having 7 to 15 carbon atoms which may have a substituent; R ² represents an aryl group having 6 to 14 carbon atoms which may have a substituent; R ³ represents , A hydrogen atom, carbon atom 1 which may have a substituent
An alkyl group having 1 to 10 carbon atoms, an acyl group having 2 to 15 carbon atoms which may have a substituent, an alkylsulfonyl group having 1 to 10 carbon atoms or a carbon atom having 6 to 5 carbon atoms which may have a substituent shows the 14 arylsulfonyl group, R ⁴ is a substituted alkyl group which may having 1 to 15 carbon atoms have a carbon atoms which may have a substituent group 7 to 15 aralkyl group Or a compound of the formula R ⁶ NHCOCH (R ⁵ ) —
A group (wherein R ⁵ is a group having 1 carbon atom which may have a substituent)
An alkyl group having 6 to 14 carbon atoms, an aryl group having 6 to 14 carbon atoms which may have a substituent, or an aralkyl group having 7 to 15 carbon atoms which may have a substituent;
⁶ is an alkyl group having 1 to 6 carbon atoms which may have a substituent, and 6 to 14 carbon atoms which may have a substituent.
And represents an aryl group, an aralkyl group having 7 to 15 carbon atoms which may have a substituent or a cycloalkyl group having 3 to 8 carbon atoms. ). Or a pharmacologically acceptable salt thereof or a prodrug thereof. 2. The compound according to claim 1, wherein R ¹ is a benzoyl group which may have a substituent. 3. The compound according to claim 1, wherein R ¹ is a 3-hydroxy-2-methylbenzoyl group. 4. The compound according to claim 1, wherein R ² is an aryl group having 6 to 14 carbon atoms which may have a substituent. 5. The compound according to claim 1, wherein R ² is a phenyl, 2-naphthyl or biphenyl group. 6. The compound according to claim 1, wherein R ³ is an optionally substituted acyl group having 2 to 15 carbon atoms. 7. The compound according to claim 1, wherein R ³ is an unsubstituted acyl group having 2 to 4 carbon atoms. 8. The compound according to claim 1, wherein R ³ is an acetyl group. 9. R ⁴ is a group represented by the formula R ^6a NHCOCH (R ^5a ) — wherein R ^5a has 7 to 15 carbon atoms which may have a substituent.
Aralkyl groups, and R ^6a is an alkyl group having 1 to 6 carbon atoms). 10. The method according to claim 10, wherein R ⁴ is of the formula R ^6b NHCOCH (R ^5b ) —
The compound according to any one of claims 1 to 8, wherein the group is a group ( ^R5b is a benzyl, naphthylmethyl or phenylethyl group, and ^R6b is an alkyl group having 1 to 4 carbon atoms). 11. R ⁴ is a compound of the formula R ^6c NHCOCH (R ^5c ) —
^9. The compound according to claims 1 to 8, wherein the group is a group ( ^R5c is a benzyl group and ^R6c is a tert-butyl group).