JP2000287690A - Oligonucleotide primer, and classification and identification of bacteria using the same - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a new oligonucleotide primer which has a specific base sequence, can hybridize to bacterial 16S rDNA, and allows extremely rapid and accurate classification and identification of bacteria. SOLUTION: This is a new oligonucleotide primer which has a base sequence selected from the group comprising the sequences shown by formulas I to XVI, can hybridize to bacterial 16S rDNA, and allows extremely rapid and accurate classification and identification of bacteria. Each oligonucleotide primer was obtained by designing from base sequences of a conserved region which is relatively well conserved among bacterial species in the base sequence of short- chain variable region which is different among bacterial species in a gene sequence of bacterial 16S rDNA. It was possible to rapidly and accurately classify and identify a bacterium by applying the PCR method using the primer and using genomic DNA of a subject bacterium as a template, followed by analyzing the amplified short-chain fragment.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a novel oligonucleotide primer and a method for classification and identification of bacteria using the same.

[0002]

2. Description of the Related Art Conventionally, bacteria have been identified by various types such as morphological properties such as cell morphology and colony morphology and color tone by microscopy, physiological properties such as Gram stainability and quinone composition, and biochemical properties. It has been based on a variety of analyses.

[0003] However, the method of identifying a bacterium by clarifying the properties of the bacterium using these methods and comparing the results with a known bacterium whose properties are evident includes many operations such as culturing, which take time. Was very time and labor intensive. In addition, in order to accurately determine the test results and identify bacteria, there is a problem that a high skill is required. Techniques for automatically analyzing some biochemical properties and identifying bacteria have been developed, and the demand for skilled techniques has been reduced. However, with respect to the culturing operation, the operation itself still accounts for a large proportion of the entire identification work, and a time problem remains.

[0004] In order to solve such a time problem in the identification of a bacterium that requires such a culture operation, a method for identifying a bacterium using a base sequence such as a 16S ribosomal RNA gene as an index has recently been developed. (Japanese Unexamined Patent Publication No.
-86699). In the identification using such a base sequence as an index, the culturing operation can be omitted by applying the PCR method, and the above-mentioned time problem can be solved.

[0005] By using the base sequence of the species-specific region (about 250 bases) in the DNA fragment of short chain length (about 340 bases) amplified using the primer of the present invention, all bacteria can be Rapid and accurate identification can be achieved.

[0006] Ribosomal RNA is a component of ribosome, which is an apparatus for protein synthesis in cells, and is a biological macromolecule which is extremely important for maintaining life and is present in all living organisms. Its structure is relatively well preserved during the evolution of living organisms, of which 16S ribosomal RNA molecules are present in all bacteria, and in many bacteria, their gene sequences have been determined and a rich database (US Gene Bank managed by the US, EMBL managed by Europe, and DDBJ managed by Japan).

[0007] The 16S ribosomal RNA gene is composed of a conserved region commonly conserved in all bacteria and a variable region of a short chain length having a different base sequence between bacterial species. Bacteria can be identified by analysis.

[0008]

The problem to be solved by the present invention is based on the base sequence of the prior art bacterium based on the base sequence of the variable region of the short chain length which differs among bacterial species in the gene sequence of 16S ribosomal RNA. An object of the present invention is to provide a novel primer which has both quickness and simplicity over an identification method and can accurately identify a bacterium, and a bacterium classification / identification method using the same.

[0009]

Means for Solving the Problems In order to solve the above problems, as a result of intensive research focusing on a method of identifying bacteria using the gene sequence of 16S ribosomal RNA as an index, 16S
Primers were designed based on the nucleotide sequence of the conserved region that is relatively well conserved among the bacterial species present in the ribosomal RNA gene, and PCR was applied using genomic DNA obtained from the identified bacteria as a template. Was obtained. Analyze the obtained amplified fragment of short chain length and obtain the knowledge that rapid classification and identification of bacteria is possible by determining the taxonomic position of the bacteria based on the determined base sequence I was able to.

In the first embodiment of the present invention, the following A
Group: GAACGCTGGCGGCAGGCCTAACACATGC (SEQ ID NO: 1); GAACGCTGGCGGCAGGCCTAATACATGC (SEQ ID NO: 2); GAACGCTGGCGGCAGGCTTAACACATGC (SEQ ID NO: 3); GAACGCTGGCGGCAGGCTTAATACATGC (SEQ ID NO: 4); GAACGCTGGCGGCATGCTTAACACATGC (SEQ ID NO: 7); GAACGCTGGCGGCATGCTTAATACATGC (SEQ ID NO: 8); GAACGCTGGCGGCGGGCCTAACACATGC (SEQ ID NO: 9); GAACGCTGGCGGCGGGCCTAATACATGC (SEQ ID NO: 10); Having a base sequence selected from the group consisting of: GAACGCTGGCGGCGTGCCTAATACATGC (SEQ ID NO: 14); GAACGCTGGCGGCGTGCTTAACACATGC (SEQ ID NO: 15); and GAACGCTGGCGGCGTGCTTAATACATGC (SEQ ID NO: 16); Oligonucleotide primers are provided that are capable of hybridizing to the 16S ribosomal RNA gene.

In a second embodiment of the present invention, the following B
An oligonucleotide primer having a base sequence selected from the group consisting of: ATTCCCCACTGCTGCCTCCCGTAGGAGT (SEQ ID NO: 17); and ATTCCCTACTGCTGCCTCCCGTAGGAGT (SEQ ID NO: 18), and capable of hybridizing to a bacterial 16S ribosomal RNA gene. Is provided.

According to a third aspect of the present invention, there is provided a primer set comprising at least one oligonucleotide primer selected from the group A and at least one oligonucleotide primer selected from the group B. Is done.

In a fourth aspect of the present invention, there is provided an oligonucleotide primer having the following nucleotide sequence: GTCTCAGTCCCAGTGTG (SEQ ID NO: 19).

In a fifth aspect of the present invention, the above-described oligonucleotide primer set is used to apply a polymerase chain reaction to a genomic DNA obtained from a bacterium to be identified as a template to obtain an amplified fragment having a short chain length. A method for rapid classification and identification of bacteria is provided, which comprises determining the taxonomic position of the bacteria based on the nucleotide sequence.

In the above-mentioned classification / identification method, the oligonucleotide primer of SEQ ID NO: 19 or the above-mentioned oligonucleotide primer set can be used as a sequence primer for determining the base sequence of the amplified fragment serving as an identification index.

First, a variable region that differs between bacterial species existing in the 16S ribosomal RNA gene and two conserved regions that are relatively well conserved between bacterial species that sandwich the region are specified. A primer sequence is selected from the two conserved regions to design a primer. In order to specify the storage area, 16S ribosomes should be selected from databases published on the Internet.
Collect the RNA gene sequence and perform base sequence alignment. The alignment includes alignment software published on the Internet (alignment software name: CLUSTALW, URL: http)
p: // www. ddbj. nig. ac. jp /, "International DNA Database" of the National Institute of Genetics).

The primer having the selected base sequence can be artificially synthesized by a known method.
The primer of the present invention is selected and designed from a nucleotide sequence that is commonly present between bacterial species, but actually differs slightly among some bacteria. However, amplification with the primers of the present invention is possible even when only a small number of bases are different. The reason is that the present invention can select at least one primer from each group composed of a plurality of base sequences.

Next, the 16S ribosome RN was
Amplify the target DNA encoding A. The PCR method is basically a method for enzymatically synthesizing a specific gene sequence using two primers that hybridize with the opposite strand and are adjacent to a target region on a template DNA. Mold DN
By repeating a cycle including denaturation of A, annealing, and extension of annealed primers using a thermostable enzyme (DNA polymerase), a fragment containing a specific gene sequence can be exponentially amplified.
DNA polymerase uses single-stranded DNA as a template
Enzymes that synthesize DNA include, for example, Taq polymerase and Tth DNA polymerase derived from Thermus thermophilis. The PCRO method was described by Saiki et al., Science 230, 1350-13.
54 (1985).

Next, genomic DNA serving as a template is extracted from the bacteria. There are various methods for extracting DNA from bacteria, but in general, methods such as treating cells with cell wall-degrading enzymes such as lysozyme, physical disruption using glass beads, and repeated freezing and thawing methods are used. . Reagents for extraction are also commercially available. However, PC
When using genomic DNA as a template in the R method,
Need not necessarily be extracted in an intact state. Therefore, it is possible to select a method in which the possibility of sample contamination is low, the operation is simple, and the method can be performed quickly.

Next, the amplified fragment obtained by the PCR method is purified. Known methods for purifying DNA include methods that separate DNA by agarose gel electrophoresis and then extract the DNA from the gel, methods that use polyethylene glycol, and methods that use ultrafiltration membranes for DNA recovery. And kits are also commercially available. When purifying DNA amplified by the PCR method, the problem is that primers added excessively during the PCR reaction and four types of deoxytriphosphate (dATP, dGTP, dCTP, dTTP)
It is important to remove this.

Next, the base sequence of the purified amplified fragment is determined. As a method for determining the base sequence of DNA, a dideoxy method (Sange method) in which the synthesis reaction of DNA polymerase is specifically stopped using a dideoxynucleotide.
r, F. , Nicklen, S .; , Coulson,
A. R. : Proc. Natl. Acad. Sci. U
SA, 74, 5463-5467 (l977)) and the Maxamou-Gilbert method using base-specific chemical modification (M
axam, A .; M. , Gilbert, W .; : Pro
c. NatLAcad. Sci. USA, 74, 560
-564 (1977)). At present, among DNA sequencing methods, a direct sequencing method by the dideoxy method, which is easy to operate and kits are commercially available, is generally used, and has already been automated by a DNA sequencer.

Finally, a molecular evolutionary phylogenetic tree is estimated based on the base sequence of the amplified DNA fragment, and the taxonomic position of the bacterium to be identified is identified and identified. Molecular evolutionary phylogenetic tree analysis software is open to the public on the Internet or the like, and can be used (for example, http: // server).
{Rdp. life. uiuc. edu / ('992 /
3) → http: // www. cme. msu. edu
/ RDP (current), the Ribo of Michigan State University
normal Database).

Hereinafter, the present invention will be described in detail with reference to examples. However, the technical scope of the present invention is not limited by the following examples.

[0024]

EXAMPLES Example 1: Design of primers Escherichia coli, Bacillus
subtilis (NCDO 1769); li
cheniformis (DSM13); stea
<RTIgt; rotherophilus, </ RTI> B. et al. cereus (I
AMl 2605), BreviBacillus br
evis (NCIMB 9372), Flavobac
terium okeanokoites (lFO 1
2536T), Pseudomonas putida
(IAMl236), Lactococcus lac
tis (NCDO 2118), Streptococ
cus cremoris (ATCC 19257),
Alcaligenes faecalis, Lact
obacillus johnsonii (ATCC
33200), Acetobacter aceti
(JCM7641), Salmonella typh
i, Brevibacterium mmcbrellne
ri (ATCC 49030), Serratia f
icaria (JCM1241), Pediococ
us acidilactici (DSM2028
4), Helicobacter hepaticu
s and Eubacterium nodatum (AT
CC 33099) was aligned.

[0025] As a result of the alignment, two regions were found on the 16S ribosomal RNA gene, which flanked the variable regions that differed between bacterial species and were relatively well conserved between bacterial species. Based on the nucleotide sequence of this conserved region, the following three groups of primers were designed. The first group includes oligonucleotide primers of SEQ ID NOs: 1 to 16 described in the sequence A, and 16S of E. coli.
Nucleotide numbers 31 to 5 of the sense strand of the rRNA gene
This corresponds to the 8th position. The second group includes oligonucleotide primers of SEQ ID NOS: 17 and 18 described in the sequence B group, which are located at nucleotide positions 338 to 365 of the antisense strand of the 16S rRNA gene of E. coli. Is equivalent to The third group is the oligonucleotide primers of SEQ ID NO: 19, which is 16S of E. coli.
This corresponds to base numbers 312 to 328 of the antisense strand of the rRNA gene.

Example 2 Extraction of Genomic DNA from Bacteria Genomic DNA as a template was extracted using Instagene (Biorad), a genomic DNA extraction kit. The method is described below. Take a platinum loop of a bacterial colony on an agar medium (NA: Nissui) and transfer it to a microtube. After 200 μl of Instagene solution was added and suspended, the mixture was heated at 56 ° C. for 20 minutes. After heating, the suspension was vigorously vortexed for 10 seconds to suspend, and heated at 100 ° C. for 8 minutes. After heating, the suspension was again vortexed for 10 seconds, and then centrifuged at 12,000 rpm for 5 minutes. Supernatant liquid 2
0 μl was used for a PCR reaction as a template solution.

Example 3 Purification by Polymerase Chain Reaction
Using at least one oligonucleotide primer selected from the sequence A group and the at least one oligonucleotide primer selected from the sequence B group,
The following bacteria: Escherichia coli (IFO03301)
Using the genomic DNA of Bacillus subtilis (IFO13721) and genomic DNA as a template, PCR was applied to test whether an amplified fragment was obtained.

Amplification by the polymerase chain reaction is performed by PCR.
Using Reagent Kit Gene Amp (Perkin Elmer), the procedure was as follows. The reaction system is 70 μl and the template DN
A20μl, each primer (100pmol / μl) 1μ
l, lOx PCR buffer 10 l, 10 mM each dA
Mix 2 μl of TP, dTTP, dCTP, dGTP, 29.5 μl of sterile water, and 0.5 μl of 5 U Amplitac polymerase,
Cycles set at 94 ° C. for 30 seconds, 60 ° C. for 30 seconds, and 72 ° C. for 30 seconds were repeated 30 times.

Confirmation of the amplified fragment was carried out using 1 × TBE (89 mM Tris,
After electrophoresis using a 3.0% agarose gel (NuSieve GTG Agarose (manufactured by FMC)) in 89 mM Boric acid, 2 mM EDTA-2Na) and staining with ethidium bromide, the gel was irradiated with ultraviolet light and the DNA band was The detection was performed. As a result of the electrophoresis, an amplified DNA fragment of about 320 base pairs could be confirmed (see FIG. 1).

Example 4: Amplification obtained by PCR method
Purification of Fragment Purification of the amplified fragment was performed using a centrifugal ultrafiltration disk filter unit (fraction molecular weight: 30,000, manufactured by Millipore). The procedure is described below. The PCR reaction solution was injected into the cup portion of the filter unit, and TE buffer (pH 8.0) was added three times as much as the reaction solution.
After centrifugation at 2,000 rpm for 1-2 minutes, the filtrate was discarded. 400 μl of TE buffer is added again, and 12,000 rpm is added so that the solution in the filter cup becomes 30 to 40 μl.
m. Purification was confirmed by the agarose gel electrophoresis. As a result, excessively added primers and dATP, dTTP, dCT
It was confirmed that P and dGTP were removed (FIG. 2).
reference).

Example 5: Sequence of base sequence of purified amplified fragment
The amplified fragment was determined amplified and purified as a template, were prepared in sample for sequence. The dideoxy method was used for the sequence of the amplified fragment. For the preparation of the sequence sample, in the case of the dye primer method, Thermo Sequenase is used.
pre-mixed cycle sequence
ng kit (manufactured by Amersham). As the sequence primer, an oligonucleotide primer of SEQ ID NO: 19, which was fluorescently labeled, was used. The procedure is described below. Primer solution (1 pmol / μ
l) 2 μl and 10 μl of the purified amplified fragment solution were mixed, and sterile distilled water was added to make a total volume of 25 μl. Reagent of each of A, C, G, and T for each 6 μl of the mixed solution
Was added to make the total amount 8 μl. The sequencing reaction was performed using a thermal cycler (GeneAmpPCRSys).
tem 2400) at 94 ° C. for 30 seconds and 50 ° C.
A cycle of 5 seconds and 30 seconds at 72 ° C. was repeated 25 times. The sequence reaction product obtained by this reaction was used as a sample for sequencing. Loading Dye on sequencing sample
Was added and mixed, and 2 μl of the mixture was subjected to electrophoresis on an acrylamide gel for sequencing set in a Hitachi DNA sequencer (SQ-3000), and then a signal was detected with a laser and a fluorescence detector, and the accompanying gene sequence analysis software was used. To determine the nucleotide sequence (see FIG. 3).

In the case of the die terminator method, DyeTe
rminer Cycle Sequencing
FS Ready Reaction Kit (PEA
A sample for sequencing was prepared using the method of PliedBiosystems. As the sequencing primer, the PCR primer was used. The procedure is described below. 5 μl of purified amplified fragment solution, Termina
1 ReadyReactionnmix 8μl and PC
1 μm of the solution of the primer used in R (3.2 pmo1 / l)
and mixed with sterilized distilled water to make a total volume of 20 μl. The sequencing reaction was performed using a thermal cycler (Gen
Using e Amp PCR System 2400), a cycle of 15 seconds at 96 ° C, 5 seconds at 50 ° C, and 4 minutes at 60 ° C was repeated 25 times. After the reaction is completed, Loadin
g Buffer 5μ1 and mix, half of which is PEA
appliedBiosystemsABI PRISM
After electrophoresis on a acrylamide gel for sequencing set in a 373 DNA sequencer, a signal was detected with a laser and a fluorescence detector, and the base sequence was determined by analyzing with an accompanying gene sequence analysis software (see FIG. 4).

Example 6: Identification of bacteria Bacteria were identified by estimating an evolutionary phylogenetic tree based on the nucleotide sequence of the amplified fragment and determining the taxonomic position of the bacteria. The estimation of the evolutionary phylogenetic tree can be performed by using the link site “Ribosoma1 Datab” published on the Internet
case Project (RDP), URL: http
p: // server @ rdp. life. uiuc.
edu / "(Evolutionary phylogenetic tree estimation software name: Suggest Tree).

The above E. coli (IFO 03)
301)) and B. subtilis (I.
Using genomic DNA obtained from FO 13721)) as a template, PCR is performed using at least one oligonucleotide primer selected from sequence A and at least one oligonucleotide primer selected from sequence B, The nucleotide sequence of the obtained amplified fragment was determined by the above method, and the evolutionary phylogenetic tree was estimated using the above-mentioned evolutionary phylogenetic tree estimation software. As a result, the evolutionary phylogenetic trees shown in FIGS. 5 and 6 were obtained. That is, E.C. coli rrS
E and E. coli (IFO 03301) and B. coli in FIG. subtilis 5 and B. sub
tilis (IFO 13721) was the same as the strain name.

[0035]

According to the present invention, the short-chain DNA fragment amplified by the PCR method has a species-specific base sequence effective for identifying bacteria. Therefore, by comparing this nucleotide sequence with the gene sequence of 16S ribosomal RNA of another bacterium, the taxonomic position of the bacterium can be determined, and the bacterium can be classified and identified. Furthermore, according to the present invention, bacteria can be classified and identified very quickly and accurately.

[0036]

[Sequence List] SEQUENCE LISTING <110> Denso <120> Olygonucleotide primers and methods for classifying and identifyin g bacteria using the same <130> ND984994 <160> 19 <210> 1 <211> 28 <212> DNA <213> Artificial Sequence <400> 1 gaacgctggc ggcaggccta acacatgc 28 <210> 2 <211> 28 <212> DNA <213> Artificial Sequence <400> 2 gaacgctggc ggcaggccta atacatgc 28 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <400> 3 gaacgctggc ggcaggctta acacatgc 28 <210> 4 <211> 28 <212> DNA <213> Artificial Sequence <400> 4 gaacgctggc ggcaggctta atacatgc 28 <210> 5 <211> 28 <212> DNA <213> Artificial Sequence <400> 5 gaacgctggc ggcatgccta acacatgc 28 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <400> 6 gaacgctggc ggcatgccta atacatgc 28 <210> 7 <211> 28 <212> DNA <213> Artificial Sequence <400> 7 gaacgctggc ggcatgctta acacatgc 28 <210> 8 <211> 28 <212> DNA <213> Artificial Sequence <400> 8 gaacgctggc ggcatgctta atacatgc 28 <210> 9 <211> 28 <212> DNA <213> Artificial Sequence <400> 9 gaacgctggc ggcgggccta acacatgc 28 <210> 10 <211> 28 <212> DNA <213> Artificial Sequence <400> 10 gaacgctggc ggcgggccta atacatgc 28 <210> 11 <211> 28 <212> DNA <213> Artificial Sequence <400> 11 gaacgctggc ggcgggctta acacatgc 28 <210> 12 <211> 28 <212> DNA <213> Artificial Sequence <400> 12 gaacgctggc ggcgggctta atacatgc 28 <210> 13 <211> 28 <212> DNA <213> Artificial Sequence <400> 13 gaacgctggc ggcgtgccta acacatgc 28 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <400> 14 gaacgctggc ggcgtgccta atacatgc 28 <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <400> 15 gaacgctggc ggcgtgctta acacatgc 28 <210> 16 <211> 28 <212> DNA <213> Artificial Sequence <400> 16 gaacgctggc ggcgtgctta atacatgc 28 <210> 17 <211> 28 <212> DNA <213> Artificial Sequence <400> 17 attccccact gctgcctccc gtaggagt 28 <210> 18 <211> 28 <212> DNA <213> Artificial Sequence <400> 18 attccctact gctgcctccc gtaggagt 28 <210> 19 <211> 28 <212> DNA <213> Artificial Sequence <400> 19 gtctcagtcc cagtgtg 17

[Brief description of the drawings]

FIG. 1 is a photograph of an electrophoresis gel showing an amplified fragment.

FIG. 2 is a photograph of an electrophoresis gel showing that contaminants have been removed.

FIG. 3 shows the results of determining the nucleotide sequence of the purified amplified fragment by the dye primer method.

FIG. 4 shows the results of determining the nucleotide sequence of the purified amplified fragment by the terminator method.

FIG. 5 is an evolutionary phylogenetic tree estimated based on the nucleotide sequence of an amplified fragment obtained from Escherichia coli (IFO03301).

FIG. 6 is an evolutionary phylogenetic tree estimated on the basis of the nucleotide sequence of an amplified fragment obtained from Bacillus subtilis (IFO13721).

 ──────────────────────────────────────────────────の Continued on the front page F term (reference) 4B024 AA11 CA01 CA11 CA20 HA14 HA19 4B063 QA13 QA18 QQ06 QQ42 QQ54 QR62 QS14 QS16 QS25 QS36 QX02

Claims (7)

[Claims] Group A: GAACGCTGGCGGCAGGCCTAACACATGC (SEQ ID NO: 1); GAACGCTGGCGGCAGGCCTAATACATGC (SEQ ID NO: 2); GAACGCTGGCGGCAGGCTTAACACATGC (SEQ ID NO: 3); GAACGCTGGCGGCAGGCTTAATACATCAT (SEQ ID NO: 4); (SEQ ID NO: 6); GAACGCTGGCGGCATGCTTAACACATGC (SEQ ID NO: 7); GAACGCTGGCGGCATGCTTAATACATGC (SEQ ID NO: 8); GAACGCTGGCGGCGGGCCTAACACATGC (SEQ ID NO: 9); GAACGCTGGCGGCGGGCCTAATACATGC (SEQ ID NO: 10); A base selected from the group consisting of: GAACGCTGGCGGCGTGCCTAACACATGC (SEQ ID NO: 13); GAACGCTGGCGGCGTGCCTAATACATGC (SEQ ID NO: 14); GAACGCTGGCGGCGTGCTTAACACATGC (SEQ ID NO: 15); and GAACGCTGGCGGCGTGCTTAATACATGC (SEQ ID NO: 16). Oligonucleotide primers having a sequence and capable of hybridizing to the bacterial 16S ribosomal RNA gene. 2. A group B comprising: ATTCCCCACTGCTGCCTCCCGTAGGAGT (SEQ ID NO: 17); and ATTCCCTACTGCTGCCTCCCGTAGGAGT (SEQ ID NO: 18); and hybridizes to a bacterial 16S ribosomal RNA gene. Oligonucleotide primers that can be used. 3. A primer set comprising at least one oligonucleotide primer selected from group A according to claim 1 and at least one oligonucleotide primer selected from group B according to claim 2. . 4. An oligonucleotide primer having the following base sequence: GTCTCAGTCCCAGTGTG (SEQ ID NO: 19). 5. A genomic DN obtained from a bacterium to be identified using the oligonucleotide primer set according to claim 3.
A. Rapid classification of bacteria, characterized in that the polymerase chain reaction is applied using A as a template, and the taxonomic position of the bacteria is determined based on the nucleotide sequence of the obtained amplified fragment of short chain length.
Identification method. 6. The method for classifying and identifying bacteria according to claim 5, wherein the oligonucleotide primer according to claim 4 is used as a sequencing primer for determining the base sequence of the amplified fragment serving as an identification index. . 7. The classification and identification of the bacterium according to claim 5, wherein the oligonucleotide primer set according to claim 3 is used as a sequencing primer for determining the base sequence of the amplified fragment serving as an identification index. Method.