JP2000270881A - Protein having biological activity of cat interferon beta and its production - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain the subject new protein comprising a protein having a specific amino acid sequence and biological activity of cat interferon β, useful as an antiviral agent for virus disease of cat, an antitumor agent for cat tumor, etc. SOLUTION: This new protein comprises an amino acid sequence of the formula or an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence of the formula, has biological activity of cat interferon β and is useful as an antiviral agent for various virus diseases of cat in which no effective therapeutic agent is known except vaccine, an antitumor agent for various tumors of cat, etc. The protein is obtained by carrying out PCR using a gene arrangement in the vicinity of 3' end of interferon of another mammal as a primer with a cat splenic DNA as a template, incorporating the obtained gene into a vector to prepare a recombinant vector, transducing the vector into Escherichia coli, etc., and expressing the gene.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a protein having a biological activity of feline interferon β (hereinafter referred to as FeIFN-β) and a method for producing the protein, and is also prepared when the protein is produced. The present invention relates to a gene encoding the protein, a recombinant vector incorporating the gene, and a transformant transformed with the recombinant vector.

[0002]

2. Description of the Related Art Interferons are roughly classified into α, β and γ (Senm GC and Lengyel P., JBC, 1992). Of these, IFN-β is a cytokine produced by various fibroblasts, shares a receptor with IFN-α, and exhibits basically the same biological activity as IFN-α (Microbiology of Kyoto Prefectural University of Medicine) Classroom edition, 1995 cytokine data manual,
Nankodo). Unlike IFN-α, which is classified as αI, αII (Ω or ω) or τ, IFN-β is only one kind
(Edited by Kasahara Shinpei, 1997 Cytokine, Japan Medical Museum).

[0003] Regarding FeIFN, IFN-αII (I
Patents have been published regarding the protein expression method, purification method, antiviral action, and the like of FN-Ω) (Japanese Patent Application Laid-Open No. H02-1).
95884, JP-A-03-139276). In addition, a patent has been published for IFN-γ in addition to its expression / purification method, which includes an antiviral effect, an effect of promoting expression of major histocompatibility class II, and an adjuvant effect (WO96 / 03435). However, FeIFN-
As for β, native FeIFN-β has never been purified, and there has been no clone of a gene fragment encoding the amino acid of recombinant FeIFN-β. At present, an expression system has not been established. The only finding about FeIFN-β concerns the gene sequence that encodes that amino acid.
(Lyons, LA et al., 1997 Nature Genet 15: 47-5
6) In the report, only a partial gene sequence of FeIFN-β (a sequence of 177 bases from the 3 ′ end) was clarified, and a gene sequence encoding all amino acids of FeIFN-β was determined. is not.

[0004] Generally, the biological activities of IFN include:
It is known to have antiviral action, cytostatic action and immune response regulating action.In humans, IFN-β and IFN-α
Is known to have a dramatic therapeutic effect on hepatitis B and C virus infections, and has been applied to the treatment of many viral infections, and the therapeutic effect has been recognized.

[0005]

At present, feline interferon is not available except for IFN-ω. Thus, if FeIFN-β becomes available, its therapeutic effect on many feline viral infections, including feline AIDS, leukemia, viral diarrhea, and the like can be expected when administered alone or in combination with IFN-ω. It is also expected to be used not only as an antiviral agent but also as an antitumor agent.

However, despite the fact that FeIFN-β is expected as a drug, its amino sequence has not yet been elucidated, and it cannot be said that a sufficient amount has been supplied by recombinant techniques and the like. is there. Therefore, the present invention
An object of the present invention is to provide a large amount of FeIFN-β, a protein having the biological activity of feline interferon, using a genetic engineering technique.

[0007] Specifically, in view of the situation that no effective FeIFN-β has yet been provided, the present invention provides
By isolating and identifying the gene encoding N-β,
A transformant transformed with a vector incorporating this gene was produced, and FeIFIF was transformed using the transformant.
An object of the present invention is to express N-β to obtain a large amount of FeIFN-β, a protein having the biological activity of feline interferon.

The present invention relates to a gene fragment encoding a protein having the biological activity of FeIFN-β, a recombinant vector incorporating and expressing the gene, and a recombinant vector required for the production of FeIFN-β. It is also an object to produce a transformant transformed by a vector.

[0009]

Means for Solving the Problems In order to achieve the above object of the present invention, the present inventors have isolated and isolated the gene of FeIFN-β.
By identifying and producing a transformant capable of mass-producing FeIFN-β from this gene fragment, and recovering and purifying the protein produced by the produced transformant, the biological activity of feline interferon can be reduced. The present inventors have found that FeIFN-β, which is a protein having the protein, can be provided in large quantities, and have completed the present invention.

The protein having the biological activity of FeIFN-β of the present invention has the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4, or 1 or 2 in the amino acid sequence represented by SEQ ID NO: 2 or SEQ ID NO: 4. It has an amino acid sequence in which several amino acids have been deleted, substituted or added. The protein may be a protein in which a part of the amino acid sequence is removed from the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, for example, from the N-terminal or C-terminal of the protein represented by SEQ ID NO: 2 or SEQ ID NO: 4. Includes those from which amino acids have been removed. The protein of SEQ ID NO: 4 corresponds to the amino acid sequence of the protein of SEQ ID NO: 2 excluding the N-terminal signal peptide portion.

The protein of the present invention includes not only a single protein having the above-mentioned biological activity of feline interferon but also a protein which binds to another protein or polypeptide to form a larger protein. Fusion protein. These fusion proteins include, for example, cats and cats in the state of fusion proteins.
In some cases, the biological activity of interferon is not exhibited or the activity is low, but a protein having the biological activity of FeIFN-β is released when the fusion protein is cleaved by an enzyme.

The protein having the biological activity of FeIFN-β of the present invention has the amino acid sequence shown in SEQ ID NO: 2 and SEQ ID NO: 4 in which one or several amino acids are deleted, substituted or added. Even if it has, as long as it has the biological activity of FeIFN-β,
Such proteins can be prepared from new gene fragments produced by digesting / cleaving genes encoding those proteins with one or more restriction enzymes, and then joining the cut DNA fragments. In addition, gene amplification using primers with gene mutations or gene deletions (polymerase chain reaction, PC
In R), a DNA fragment encoding a target protein with mutation or deletion can be amplified, and the DNA fragment can be easily obtained by expressing the protein. On the other hand, it can also be obtained as a product of an allele present in a cat or another feline other than a cat.

The gene of the present invention has the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or the amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences, and comprises FeIFN-β This gene encodes a protein having a biological activity of, and acts as an autonomous unit for expression of the polypeptide, such as the structural gene itself, as well as sequences necessary for expressing the structural gene, such as a promoter and a terminator. Things are also included.

The recombinant vector of the present invention has the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or the amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences. -β
It contains a gene encoding a protein having a biological activity of, and has a transcription initiation site, a promoter, an enhancer, a translation initiation signal, etc. on the 5 ′ side so that the protein can be expressed. On the side, there are various vectors such as a plasmid and a baculovirus vector, which are expression vectors containing a terminator, a polyA addition signal and the like.

The transformant of the present invention contains the above-mentioned recombinant vector, and host cells of the transformant include microorganisms such as Escherichia coli and yeast, insect cells and various cell lines derived from cats. Various cells such as such mammalian cells can be used. In addition, as the transformant of the present invention, Escherichia coli and insect cells are preferable in terms of mass production of the protein, and highly and easily, and can be purified at low cost,
Therefore, it is preferable to employ a plasmid and a baculovirus vector as the most preferred vector system.

The method for producing a protein having the biological activity of FeIFN-β according to the present invention comprises the steps of (1) deleting the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or deleting one or several amino acids in these amino acid sequences; A substituted or added amino acid sequence, or a partial amino acid sequence of the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4;
A step of preparing a recombinant vector containing a gene encoding a protein having IFN-β biological activity and capable of producing the protein, and (2) transforming a host cell with the obtained recombinant vector. And (4) culturing the transformed host cell to produce a protein, and (4) separating and recovering the produced protein. Further, the production method of the present invention is characterized in that a plasmid is used as a recombinant vector and Escherichia coli is used as a host cell.

Another method for producing a protein having a biological activity of FeIFN-β of the present invention uses a baculovirus vector. This method comprises the steps of (1) making the gene capable of expressing the protein. Preparing a baculovirus transfer vector linked under the control of a baculovirus polyhedron promoter, and (2) introducing the resulting baculovirus transfer vector into Escherichia coli having baculovirus genomic DNA, thereby obtaining a recombinant baculovirus genome. A step of producing DNA;
(3) transfecting the produced recombinant baculovirus genomic DNA into insect cells to produce a recombinant baculovirus, and (4) infecting the insect cells with the produced recombinant baculovirus, and And producing a protein, and (5) a step of separating and recovering the produced protein.

As such a transformant, a recombinant FeIFN-β having a biological activity in Escherichia coli transformed with an Escherichia coli expression plasmid incorporating the isolated gene fragment or an insect cell transformed with a baculovirus vector is used.
After the production of, was separated and recovered for the first time according to the present invention.

The present invention relates to a recombinant baculovirus containing a gene encoding a protein having the biological activity of FeIFN-β, which is obtained in each step of the protein production method using the baculovirus vector system, A recombinant baculovirus transfer vector for producing a baculovirus, E. coli containing the recombinant baculovirus genome transfected with the baculovirus transfer vector, and the produced recombinant baculovirus were infected. And insect cells that express the protein.

[0020]

BEST MODE FOR CARRYING OUT THE INVENTION A protein having the biological activity of FeIFN-β having the amino acid sequence of SEQ ID NO: 2 was identified as follows. In other words, Fe that has already been partially elucidated
Base sequence near the 5 'end of the IFN-β gene (Lyons, LA e
t al., 1997 Nature Genetic 15: 47-56), and each synthesis corresponding to each of the gene sequences near the 3 'end of various interferons already isolated from other mammals. A DNA fragment containing the full length gene of FeIFN-β was amplified by PCR using feline spleen DNA as a template by using an antisense primer mixed with the primers.

Next, the DN amplified by the above-described gene amplification method is used.
Using the A fragment as a template and a synthetic primer containing a sequence near the predicted translation start codon or a sequence near the translation stop codon of the expected FeIFN-β gene,
PCR (nested PCR) was performed to amplify a gene fragment including the translation initiation codon to the translation termination codon of the FeIFN-β gene.

Thereafter, the amplified DNA fragment of the FeIFN-β gene was incorporated into a commercially available vector plasmid to obtain a recombinant plasmid. The thus obtained recombinant plasmid was named pCR-FeIFN-β. Next, using this recombinant plasmid, the nucleotide sequence of the integrated FeIFN-β gene was determined. The obtained sequence is shown in SEQ ID NO: 1. Escherichia coli into which this plasmid pCR-FeIFN-β was introduced was named FeI-β.

Next, an expression method such as preparation of an expression vector for expressing FeIFN-β using the FeIFN-β gene thus obtained will be described.

In order to produce FeIFN-β in E. coli, the above pC
The DNA fragment of the translation part of the FeIFN-β gene was amplified by PCR using the DNA of R-FeIFN-β as a template, and the amplified DNA fragment was incorporated into a plasmid to obtain an E. coli expression vector. The expression plasmid containing the FeIFN-β gene prepared as described above was
-FeIFN-β, and E. coli transfected with this plasmid and transformed were named E-FeIFNβ.

The protein having the biological activity of FeIFN-β of the present invention (hereinafter also referred to as FeIFN-β protein) is obtained by culturing the transformed E. coli E-FeIFNβ and isolating the produced protein from the E. coli body. Can be obtained by purification.

Next, it is composed of a part of the amino acid sequence of FeIFN-β, and is composed of feline interferon β.
The protein having the biological activity of is described. This protein has an amino acid sequence excluding the signal peptide deduced from the amino acid sequence of SEQ ID NO: 2 (amino acids 1 to 21 of SEQ ID NO: 2), and is shown in SEQ ID NO: 4. This protein was identified as follows.

That is, the above-mentioned pCR-FeIFN-β DNA was used as a template, and the signal peptide was deleted by PCR using FeIFN.
Amplify the DNA fragment of the -β gene and remove the signal peptide-deficient Fe
IFN-β gene (hereinafter, referred to as del.FeIFN-β gene),
This del.FeIFN-β gene was incorporated into a commercially available plasmid, Escherichia coli expression vector. The plasmid thus prepared was named pGEX-del.FeIFN-β, and Escherichia coli transformed with this plasmid was named E-del.FeIFNβ.

Next, the E. coli E-del.FeIFNβ was cultured, and the produced protein was separated from the E. coli body and purified to obtain the protein of the present invention.

Further, the expression of FeIFN-β in E. coli was
It can also be performed using an E. coli expression vector other than EX-FeIFN-β. As a construction of such a plasmid, pCR-
The translated portion of the FeIFN-β gene lacking the signal peptide region amplified by PCR using the DNA of FeIFN-β as a template is pET-32a (+)
(Made by Novagen), and the E. coli expression vector thus prepared was named pET-FeIFN-β. Escherichia coli transformed with pET-FeIFN-β introduced was named E-His-FeIFNβ.

Then, the E. coli E-His-FeIFNβ is cultured, and the produced protein is separated from the body of Escherichia coli and purified. Similarly, the signal sequence of FeIFN-β of the present invention is removed, and An active protein (hereinafter, also referred to as del.FeIFN-β protein) was obtained.

As described above, when the host is a prokaryotic cell, for example, a gene fragment encoding a protein having the biological activity of FeIFN-β is ligated to an expression vector, and the prokaryotic cell is transformed to produce a FeIFN-β protein. Cells and de
l. FeIFN-β protein producing cells can be created. As such a prokaryotic cell, Escherichia coli and Bacillus subtilis can be used, but E. coli (Escherichia co
li).

Further, such transformants as FeIFN-β protein-producing cells and del.FeIFN-β protein-producing cells can be produced using not only prokaryotic cells such as Escherichia coli but also various cells. The case where another cell is used as a host will be described in more detail.

When the host cell is a eukaryotic cell, for example,
Created from FeI-β, E-FeIFNβ or E-del.FeIFNβ
A gene fragment encoding a protein having the biological activity of FeIFN-β is ligated to a promoter such as a virus, and the eukaryotic cell is transformed to transform the FeIFN-β protein or del.
FeIFN-β protein producing cells can be produced.
When a recombinant virus vector such as a baculovirus is used, for example, the method of Smith et al. (Mol. Cell Bio
l., 1983: 2156-2165), recombinant virus vectors can be created.

Baculovirus has a strong promoter activity for controlling the production of polyhedrin (polyhedron), which is a virus protein that is not essential for virus replication, so that a foreign gene is introduced into the polyhedrin gene region,
It can be applied to a system that produces a large amount of the protein encoded by the foreign gene. Specifically, a foreign gene is incorporated into the downstream of the polyhedrin promoter of the baculovirus transfector vector, and the constructed recombinant transfer vector is transfected into baculovirus-infected insect cells. Homologous recombination is caused between the baculovirus genome and a partial nucleotide sequence of the baculovirus genome to produce a baculovirus in which a foreign gene has been integrated into the genome. Then, by infecting insect cells with the produced recombinant baculovirus, a large amount of exogenous protein can be produced.

Alternatively, as another method, a large amount of exogenous protein can be produced as follows. That is, a transfer vector having a recognition sequence of a transposon into which a foreign gene has been incorporated is transfected into Escherichia coli containing a baculovirus genomic DNA and a transposon, and the foreign gene is inserted into the baculovirus genome by the action of the transposon. A recombinant baculovirus DNA is prepared, and it can be transfected into insect cells.
By obtaining a recombinant baculovirus containing a foreign gene and further infecting the insect virus with a new insect cell, a large amount of foreign protein can be produced.

As a specific method, pCR-FeIFN-β
A transfer vector constructed by incorporating the translated portion of the FeIFN-β gene lacking the signal peptide region amplified by PCR with the DNA of the template into pFastBac HTa (manufactured by Life Technology Co.) was named pFast-IFNβ, and this pFast-IFNβ
Is transfected into Escherichia coli DH10αBac containing baculovirus genomic DNA and transposon works.
E. coli harboring the recombinant baculovirus genomic DNA into which the FeIFN-β gene was inserted was named EBac-FeIFNβ.

Next, the recombinant baculovirus DNA was taken out from the Escherichia coli EBac-FeIFNβ, transfected into insect cells, Sf9, and the recombinant baculovirus released into the culture supernatant was infected to new Sf9 cells and cultured. The protein of the present invention was obtained by separating and purifying the produced protein from the cells.

[0038] The recombinant protein thus obtained is considered to have a higher-order structure closer to the natural protein than the recombinant protein expressed in Escherichia coli, and has a high biological activity.

The protein having the biological activity of FeIFN-β of the present invention and having the amino acid sequence of SEQ ID NO: 2 and the protein having the amino acid sequence of SEQ ID NO: 4 are the base sequences of SEQ ID NO: 1 and SEQ ID NO: 3, FeIFN-β
Is not necessarily transcribed / translated from the genome encoding, for example, may be produced by a chemical synthesis method, expression of a transformant, or the like.

The nucleotide sequences encoding the amino acids of SEQ ID NO: 2 and SEQ ID NO: 4 may be those obtained by any of the chemical synthesis method, DNA replication method, reverse transcription method, and transcription method.

In addition, the present invention incorporates a gene fragment encoding a protein having the biological activity of FeIFN-β having the amino acid sequences of SEQ ID NO: 2 and SEQ ID NO: 4, and can produce these proteins. Provide a synthetic plasmid that is a recombinant vector,
As such a plasmid, for example, the above-mentioned pGEX-FeIFN-
β, pGEX-del.FeIFN-β, and pET-FeIFN-β. In addition, those related to baculovirus include a transfer vector incorporating the above gene fragment for preparing a baculovirus vector and a baculovirus vector having a recombinant baculovirus genome prepared using this transfer vector. .

Furthermore, the present invention incorporates a gene fragment encoding a protein having the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, and is capable of producing FeIFN-β protein and del.FeIFN-β protein. It is intended to provide a transformant obtained by transforming a host cell with a vector such as a plasmid. Examples of such cells include those using Escherichia coli or insect cells as host cells.Examples of the transformed Escherichia coli include Escherichia coli E-FeIFNβ containing the above plasmid pGEX-FeIFN-β and the above plasmid pGEX-del. E. coli E-del.FeIFN containing .FeIFN-β
β was deposited as the deposit numbers FERM P-17119 and FERM P-17120, respectively, at the Patent Microorganisms Depositary Center of the Institute of Biotechnology, Ministry of International Trade and Industry on December 24, 1998, and the plasmid pET-FeIFN-β E. coli E-His-Fe containing
IFNβ has been deposited with the Patent Microorganisms Depositary of the Biotechnology Research Institute, Ministry of International Trade and Industry on November 2, 1999, under the accession number FERM P-17629.

As an expression system using a baculovirus, Escherichia coli EBac-FeIFNβ containing a recombinant baculovirus genome into which a gene encoding a protein having the biological activity of FeIFN-β has been incorporated was introduced in July 1999.
It has been deposited at the Patent Microorganisms Depositary of the Institute of Biotechnology, Ministry of International Trade and Industry on April 14, as Accession No. FERM P-17467. And this is E. coli EBac-FeIFN
Recombinant baculovirus produced from
Also provided are Sf9 cells infected with a recombinant baculovirus producing N-β protein.

The present invention further comprises the steps of culturing eukaryotic cells such as microorganisms or insect cells, which are the above-described transformed transformants, and separating and recovering the produced protein having the biological activity of FeIFN-β. Also provided is a method of producing a protein. Various types of chromatography can be used to separate the protein from the cultured cells, but affinity chromatography to which a specific antibody or the like is bound is preferably used.

The biological activity of FeIFN-β of the obtained protein was determined by measuring the most prominent activity of FeIFN-β, ie, the antiviral activity, by comparing cultured cells of cats with VSV (vessels).
C. of Armstrong (Armstrong, 1981 Meth. Enzymol. 78: 381-387) using icular stomatitis virus)
(Cytopathic) inhibition can be performed.

[0046]

The present invention will be described in more detail with reference to the following examples.

1. Preparation of transformant E-FeIFNβ expressing FeIFN-β protein (1) Amplification of FeIFN-β gene by PCR The spleen was isolated from a 4-month-old male cat, cut into small pieces, and DN
An A extraction buffer (150 mM sodium chloride, 10 mM Tris-HCl, pH 8.0, 10 mM EDTA and 0.1% SDS (EDTA is ethylenediaminetetraacetate, SDS is an abbreviation for sodium dodecyl sulfate)). To this suspension was added 100 μg / ml proteinase K,
For 1 hour and then at 37 ° C. for 16 hours.
The digested solution was treated with phenol-chloroform to obtain a cat genomic DNA in an aqueous layer. Further, the obtained cat genomic DNA was purified by ethanol precipitation, and the purified DNA was TE (10 mM).
Tris-HCl, pH 8.0 and 1 mM EDTA), and used as a template DNA for amplifying the FeIFN-β gene by PCR.

The cat genome DN obtained as described above
A 170 ng and 0.5 μM of each of the following sense primer and antisense mixed primer
Reaction buffer (1.25 units of commercially available Taq DNA polymerase (Boehringer Mannheim), 200 μl each
M deoxynucleotide, 10 mM Tris-HCl, pH 7.
4, consisting of 10 mM potassium chloride and 1.5 mM magnesium chloride) and overlaying the mixed solution with paraffin oil. The mixture was heated at 94 ° C for 60 seconds, at 50 ° C for 90 seconds, and at 72 ° C for 120 seconds. PCR was performed for 30 cycles. The base sequences of the sense primer and the antisense mixed primer used are as follows.

Sense primer: 5'-TGAAAGTGGGAAATTCCTCTG (SEQ ID NO: 5) Antisense mixed primer: 5'-GWCCWTTCMWATKCAGTRSMTT (SEQ ID NO: 6, where W is
A or T, M is A or C, K is G or T, R
Represents A or G, and S represents C or G, respectively. The PCR product containing 1 μl of the PCR product containing the amplified DNA fragment of the FeIFN-β gene and 0.5 μM of each of a sense primer and an antisense primer having the following sequence:
After mixing with the reaction buffer and overlaying the mixture with paraffin oil, the mixture was heated at 94 ° C for 60 seconds, 55 ° C for 90 seconds, 72 ° C for 120 seconds.
PCR was performed for 30 cycles, with one cycle as one second. The base sequences of the sense primer and the antisense mixed primer used are as follows.

Sense primer: 5'-TGGAAGAAGGGCATTCACACT (SEQ ID NO: 7) Antisense primer: 5'-AGRTSYTCAGTTYYGGARGT (SEQ ID NO: 8, where R is A
Alternatively, G means S or C, and Y means C or T. The DNA fragment amplified by the PCR was separated by electrophoresis using a 1.2% agarose gel, and it was confirmed that a DNA fragment of 652 base pairs had been amplified. This corresponded to the size of the FeIFN-β gene. Next, using T1 ligase (manufactured by Toyobo Co., Ltd.), 5 μl of the PCR product was used to convert the DNA fragment of the FeIFN-β gene contained therein into the blunt-ended site of the commercially available plasmid vector pCR-Blunt (manufactured by Invitrogen). Incorporated by binding at 16 ° C., 16 h incubation. The plasmid thus constructed was named pCR-FeIFN-β.

Next, using the obtained DNA solution of pCR-FeIFN-β, commercially available competent Escherichia coli XL1-Blue (manufactured by Stratagene) was transformed into plasmid D according to the attached manual.
Transformation by introducing NA into E. coli, 50 μg /
Culture on LB agar medium containing 1 ml of ampicillin (agar medium containing 1 g of Bacto tryptone, 5 g of Bacto yeast extract, 10 g of sodium chloride, and 15 g of Bacto agar in 1 L) at 37 ° C for 17 hours. The grown transformant FeI-β was obtained. Next, the plasmid DNA extracted from FeI-β is digested with EcoRI and subjected to electrophoresis on a 1.2% agarose gel to obtain a DNA corresponding to the size (661 base pairs) of the FeIFN-β gene and its associated restriction enzyme sites. Clones with fragments were selected.

(2) Determination of the base sequence of the FeIFN-β gene DNA of the recombinant plasmid was extracted and purified from the clone obtained above, and a commercially available automatic sequencer and cycle sequence kit (manufactured by Amersham Pharmacia)
PCR-FeIFN-β by the dideoxy sequencing method using
The nucleotide sequence of the FeIFN-β gene integrated into was determined. That is, the sequence was determined using a primer complementary to the forward primer region and the reverse primer region present in the vector portion of pCR-Blunt, and the sequence was determined as shown in SEQ ID NO: 1.
The nucleotide sequence of the FeIFN-β gene was obtained.

The nucleotide sequence data obtained in this manner was compared with the nucleotide sequence of a known interferon-β other than cat interferon-β, and the results are shown in FIGS. Are shown in Table 1 below.
Also, compare the amino acid sequences of various interferons,
The results are shown in FIG. 5, and the amino acid sequence identity rates are shown in Table 2. 3 and 4 show the results of the dog, human, bovine and equine interferon-β gene and the base sequence of the FeIFN-β gene combined so that the homologous portion is maximized, and FIG. FIG. 4 shows the results of the amino acid sequence predicted from the human, bovine and equine interferon-β gene and the base sequence of the FeIFN-β gene together with the homologous portion maximized. In these figures, “.” Indicates the case of the same base or amino acid sequence as that of FeIFN-β, and “−” indicates the case of deletion. Although three or two IFN-β genes are present in cattle and horses, respectively, the β1 gene was used as a representative for analysis.

[0054]

[Table 1]

[Table 2] As is clear from these results, the base sequence of the FeIFN-β gene has 70-80% homology with the base sequence of the above-mentioned four types of mammalian interferon-β genes, and the predicted amino acid sequence is also the same. It showed 50-70% homology.

From the comparison of the amino acid sequences described above,
IFN-β was presumed to have a signal peptide of amino acids 1 to 21 like other types of interferon-β. In addition, there are three cysteine residues that are said to affect the three-dimensional structure (3 in the amino acid sequence of FeIFN-β).
8, 52 and 161).

(3) Construction of FeIFN-β Expression Plasmid FIG. 1 shows a method for preparing the FeIFN-β expression plasmid. That is, P using 10 ng of the aforementioned pCR-FeIFN-β DNA as a template
The DNA fragment of the FeIFN-β gene is amplified by the CR method, and the amplified DNA
The fragment was used in the base sequence derived from the sense primer and FeIFN-
After cutting at the EcoRI cleavage site present downstream of the 3 ′ end of the β gene, glutathione-S-transferase (hereinafter, GS
PGEX-4T-3 (manufactured by Pharmacia), which is a plasmid vector that can be expressed as a fusion protein with the plasmid pGEX-FeIF.
N-β was obtained. In order to match the frames of the GST protein and the FeIFN-β protein, sense primers and antisense primers having the following nucleotide sequences were synthesized and used as the primers used for PCR. The nucleotide sequence is as follows.

Sense primer: 5'-CAGTGAATTCCATGACCGGCAGGTGCATCC (SEQ ID NO: 9) Antisense primer: 5'-GTAACGGCCGCCAGTGTGCT (SEQ ID NO: 10) (4) Preparation of FeIFN-β protein-producing Escherichia coli Was transformed with E. coli XL1-Blue (manufactured by Stratagene) and transformed by introducing plasmid DNA into E. coli according to the attached manual.

Next, LB containing 50 μg / ml ampicillin
After culturing in a liquid medium at 37 ° C for 17 hours, ampicillin-resistant clones were obtained.
DNA was extracted. The obtained plasmid DNA is digested with EcoRI, and a gene fragment (574 bp) corresponding to the size containing the FeIFN-β gene and its associated restriction enzyme site, etc.
Clones harboring Escherichia coli are selected and transformed E-FeIF
Nβ was obtained. The transformed E. coli containing the obtained expression plasmid pGEX-FeIFN-β was deposited as E-FeIFNβ (Accession No. FERM P-17119).

2. Preparation of transformant E-del.FeIFNβ expressing del.FeIFN-β protein Next, the case of del.FeIFN-β protein lacking a signal peptide will be described. Generally, it is known that a signal peptide present at the amino terminus of a protein reduces the amount of recombinant protein produced. Therefore,
In the present invention, in order to increase the production amount of a protein having the biological activity of recombinant FeIFN-β, a del.FeIFN-β protein in which amino acids (amino acids 1 to 21 of SEQ ID NO: 2) deduced as a signal peptide are deleted is used. A plasmid to express was constructed. Hereinafter, the construction of the del.FeIFN-β protein expression plasmid will be described in detail.

(1) Amplification of del.FeIFN-β Gene by PCR FIG. 2 shows a method for preparing a del.FeIFN-β expression plasmid.
That is, the nucleotide sequence of SEQ ID NO: 1 encoding a part of the amino acid sequence of SEQ ID NO: 2 (amino acids 22 to 28)
(Nucleotide Nos. 149 to 168) A sense primer having a sequence added with a restriction enzyme EcoRI cleavage sequence at the 5 ′ end of the base sequence complementary to the base sequence, and downstream of the FeCRN-β gene integration site of pCR-FeIFN-β described above. A sequence complementary to the base sequence derived from the existing plasmid, and the same antisense primer as that used in the construction of the above-described FeIFN-β expression plasmid at 0.5 μM each, and as a template, the aforementioned pCR-Fe
10 ng of IFN-β DNA was mixed with the above PCR reaction buffer, and the mixture was overlaid with paraffin oil.
P with 60 seconds at 55 ° C, 90 seconds at 72 ° C, and 120 seconds at 72 ° C
CR was performed for 30 cycles. The nucleotide sequences of the primers used are as follows.

Sense primer: 5'-CAGTGAATTCGTGAGCTACAAGTTGCTTGG (SEQ ID NO: 11) Antisense primer: 5'-GTAACGGCCGCCAGTGTGCT (SEQ ID NO: 10) (2) Construction of del.FeIFN-β Expression Plasmid Separation by electrophoresis using agarose gel, corresponding to the size containing the del.FeIFN-β gene and its associated restriction enzyme sites
It was confirmed that a DNA fragment of 541 base pairs had been amplified. Next, the amplified DNA fragment was cleaved at the respective EcoRI cleavage sites present in the nucleotide sequence derived from the sense primer and downstream of the 3 ′ end of the FeIFN-β gene, and then plasmid vector pGEX-4T-1 (manufactured by Pharmacia) ) Was inserted into the EcoRI site to obtain a plasmid pGEX-del.FeIFN-β.

(3) Preparation of del.FeIFN-β protein-producing Escherichia coli DNA solution of pGEX-del.FeIFN-β was mixed with commercially available competent Escherichia coli XL1-Blue (manufactured by Stratagene). A transformant was obtained by introducing the plasmid DNA into E. coli according to the manual to obtain a transformant.

Next, LB containing 50 μg / ml ampicillin
After culturing at 37 ° C. for 17 hours in a liquid medium, ampicillin-resistant clones were obtained, and plasmid DNA was extracted from each cultured transformant clone. The obtained plasmid DNA is digested with EcoRI, and a clone containing a gene fragment (510 base pairs) corresponding to the size including the del.FeIFN-β gene and its associated restriction enzyme site is selected and transformed. body
E-del.FeIFNβ was obtained. The resulting expression plasmid pGEX-
transformed E. coli containing del.FeIFN-β
Deposited as Nβ (Accession number FERM P-17120).

3. Separation and recovery of protein and confirmation of biological activity Next, E. coli prepared in (1) (4) and (2) (3) above
The protein derived from the FeIFN-β DNA fragment and the protein derived from the del.FeIFN-β DNA fragment were expressed, and it was confirmed that this protein had the biological activity of FeIFN-β as follows.

(1) GST-FeIFN-β fusion protein and GS
Production of T-del.FeIFN-β fusion protein Transformants, E-FeIFNβ and E-del.FeIFNβ, are cultured to produce the protein, and separated using the GST Purification Kit (Pharmacia). -GST-FeIFN-β fusion protein and GST-del.FeIFN-β fusion protein were separated and purified based on the purification manual.

That is, E-FeIFNβ or E-del.FeIFN
β was cultured in an LB liquid medium at 37 ° C. until the turbidity OD ₆₀₀ = 0.5, and IPTG (isopropyl β-D-thiogalactoside) was added to a concentration of 1.0 mM.
C. to produce the desired fusion protein in E. coli. Next, E. coli collected by centrifugation was used to remove PBS (-) containing 1% Triton X-100 (137 mM sodium chloride, 2.68 mM potassium chloride, 8.1 mM disodium hydrogen phosphate). , And 1.47 mM potassium dihydrogen phosphate (pH 7.4)), sonicated, and then subjected to centrifugation to obtain a soluble fraction containing the fusion protein. GST-FeIFN-β fusion protein or GST-del.FeIFN-β protein was separated and purified from the obtained soluble fraction by glutathione Sepharose column chromatography. Thereafter, 10 g was added to the solution containing the purified GST-FeIFN-β fusion protein or GST-del.FeIFN-β fusion protein.
Unit / mg protein thrombin is added, and the fusion protein is cleaved by reacting at room temperature for 16 hours.
Mixture with FN-β protein or GST and del.FeIFN-β
A mixture with the protein was obtained. After removing glutathione from the reaction solution containing this mixture by dialysis, glutathione Sepharose column chromatography is performed again, and the FeIFN-β protein sample and del.FeIF
N-β protein samples were obtained respectively.

(2) Measurement of antiviral activity of FeIFN-β and del.FeIFN-β The antiviral activity of the above-mentioned FeIFN-β protein sample and del.FeIFN-β protein sample was determined by the Armstrong CPE inhibition method. For reference, VSV and feline cell line CRFK
(Crandell feline kidney cell).

[0068] That is, CRFK cells 10 ⁵ cells / ml so as to 10% fetal calf serum (hereinafter abbreviated as FBS) minimum Dulbecco's Modified Eagle containing essential medium (hereinafter abbreviated as DMEM)
, And 0.1 ml was dispensed into each well of a 96-well culture plate. After culturing at 37 ° C for 24 hours, FeIFN-β protein sample or deluted with DMEM containing 1% FBS
l.Add FeIFN-β protein sample and collect sample at 37 ° C for 24 hours.
Acted on CRFK cells. Then, the culture solution and the specimen were removed, and VSV was infected in DMEM containing fresh 1% FBS. VS
Cytopathy due to V infection was measured by the following procedure.

That is, a virus infection control (FeIF
100% cytopathic (N-β or del.FeIFN-β not treated)
At which point 0.2% is added to each well of the culture plate.
Crystal violet-10% formalin-0.2 M citric acid solution was added, and the mixture was allowed to stand under ultraviolet irradiation for 10 minutes to stain living cells. Then, after removing the staining solution and washing each well with water, the dye remaining in each well was dissolved in 0.1 ml of ethanol, and colorimetrically determined at 570 nm using an immunoreader to quantify the degree of cell degeneration. Graphed. From the graph
The reciprocal of the dilution factor of the sample expected to show 50% cytopathicity was shown as interferon activity (hereinafter referred to as IFN activity).

[0070] The obtained FeIFN-β IFN activity of the protein sample and del.FeIFN-β protein sample is ¹⁰⁶ units per mg, respectively, IF human or mouse
It showed a value similar to N-β. Therefore, it was confirmed that the protein of SEQ ID NO: 2 was a protein having the biological activity of FeIFN-β. Similarly, it was confirmed that the del.FeIFN-β protein lacking the signal peptide of SEQ ID NO: 4 was a protein having the biological activity of FeIFN-β.

4. FeIFN-β protein produced from E-FeIFN-β and del.FeIFN-β produced from E-del.FeIFN-β
Comparison with protein amount Protein amount and E-de of FeIFN-β produced from E-FeIFN-β
l.Comparing the protein amounts of del.FeIFN-β produced from FeIFN-β, these proteins were separated from E. coli proteins by SDS-polyacrylamide gel electrophoresis, and FeIFN-
The bands of the β protein and del.FeIFN-β protein were scanned and read as peaks, and the peak areas were compared. The detailed method and results are shown below.

That is, E-FeIFN-β and E-del.FeIFN-β were each added to an LB medium containing 50 μg / ml ampicillin in an LB medium.
Incubate at 16 ° C for 16 hours, and add 10 μl of each culture
After adding to 1 ml of the medium, the cells were cultured at 37 ° C. for 3 hours. Next, IPTG at a final concentration of 1 mM was added to each culture solution and cultured at 37 ° C. for 3 hours to promote the production of FeIFN-β protein and del.FeIFN-β protein.

The final culture solution is subjected to micro-high-speed centrifugation.
Centrifuge at 3000 rpm for 5 minutes to remove FeIFN-β protein or d
E. coli producing el.FeIFN-β protein was obtained for sedimentation. Each of the E. coli obtained as a precipitate was suspended in 100 μl of a phosphate buffer, and a portion of the suspension was used to measure the total protein concentration of each of the E. coli suspensions. And total protein concentration to 100
μg / 10 μl. 10 μl of each E. coli suspension having the same total protein concentration was electrophoresed on a 12% polyacrylamide gel containing 1% SDS to separate E. coli proteins from FeIFN-β protein or del.FeIFN-β protein.

To visualize the separated proteins, an acrylamide gel was subjected to 2.5% Coomassie Brilliant Blue R
Staining was performed with a staining solution containing 250, 50% methanol, and 5% acetic acid. Next, Image Master VDS (Pharmacia)
Using the stained FeIFN-β protein as well as del.
After creating the image file of the band of FeIFN-β protein,
The image was scanned, and the peak area of each obtained band was calculated. del.The peak area of the FeIFN-β protein is 2.8 of the peak area of the FeIFN-β protein.
By removing the signal peptide, the amount of recombinant feline interferon-β produced in Escherichia coli increased 2.8-fold.

Next, in the case of using an Escherichia coli expression vector to which a histidine tag different from the above Escherichia coli expression vector is added, preparation of the vector and expression of the protein will be described.

5. Invention of protein using Escherichia coli expression vector to which a histidine tag is added (1) Construction of pET-FeIFN-β expression plasmid FIG. 6 schematically shows a method of constructing pET-FeIFN-β. First, except for the primers used, the above pGEX-FeIFN-β
A DNA fragment encoding FeIFN-β lacking the signal peptide region was amplified by the PCR method under the same conditions as in the preparation method described above. The primers used are a sense primer to which a BamHI cleavage site has been added and an antisense primer to which a SalI cleavage site has been added. The sequences are as follows.

Sense primer: 5'-GTGAGGATCCGTGAGCTACAAGTTGCTTGG (SEQ ID NO: 12) Antisense primer: 5'-TCAGGTCGACGTAACGGCCGCCAGTGTGCT (SEQ ID NO: 13) Specifically, 1 μl of a solution containing 10 ng of pCR-FeIFN-β DNA
And 0.5 mM each of the above sense primer and antisense primer were mixed in a PCR buffer, and the mixture was overlaid with paraffin oil, and then at 94 ° C. for 60 seconds,
30 cycles of PCR were performed at 55 ° C. for 90 seconds and 72 ° C. for 120 seconds as one cycle, and Fe containing the desired signal peptide region was deleted.
A gene fragment (545 bp) encoding IFN-β was amplified. Next, the obtained signal peptide region was deleted.
PET-32, an Escherichia coli expression plasmid vector that can add a histidine tag to the expressed protein after double digestion of the DNA fragment encoding FeIFN-β with BamHI and SalI
a (+) (Novagen) at the BamHI-SalI site,
The plasmid pET-FeIFN-β was obtained.

(2) Preparation of FeIFN-β protein-producing Escherichia coli DNA solution of pET-FeIFN-β was mixed with commercially available competent Escherichia coli BL21 DE3 (Stratagene), and pET-32
a (+) (manufactured by Novagen) A transformant was obtained by introducing the plasmid DNA into E. coli according to the attached manual. Thereafter, an ampicillin-resistant Escherichia coli clone was obtained in the same manner as in the above-mentioned method for producing E-FeIFN-β, and plasmid DNA was extracted from each cultured transformant clone. The obtained plasmid DNA was double-digested with BamHI and SalI, and the gene fragment (537 base pairs) corresponding to the size including the FeIFN-β gene lacking the signal peptide region and the associated restriction enzyme site was integrated. Clones were selected to obtain a transformant E-His-FeIFNβ.

Next, for confirmation, a commercially available plasmid DN was used.
A Extraction kit (Wizard plasmid purification system, manufactured by Promega) was used to extract plasmid DNA from E-His-FeIFNβ according to the manual attached thereto, and 100 ng of the plasmid DNA was double-digested with BamHI and SalI. Analysis was performed by agarose gel electrophoresis using 2% agarose. E-His-FeIFNβ by agarose gel electrophoresis
FIG. 7 shows the results of analysis of pET-FeIFN-β contained in. The gel was stained with a 0.5 μg / ml ethidium bromide solution. Lane 1 in FIG. 7 is a DNA size marker (φX1
74 / HaeIII, manufactured by Nippon Gene Co., Ltd.
Shows the results of electrophoresis of the double digested pET-FeIFN-β. As shown in FIG. 7, the lane 2 contains His-FeIF
Since the N-β band is detected at a position of about 537 base pairs, E-His-FeIFNβ is a pET-FeIF incorporating the FeIFN-β gene fragment in which the signal peptide region of 537 base pairs has been deleted.
It was confirmed that the transformant was N-β. In addition,
A transformed Escherichia coli containing the obtained expression plasmid pET-FeIFN-β was deposited as E-His-FeIFNβ (Accession No. FERM P-17629).

(3) Production of histidine-tagged FeIFN-β protein Transformant E cultured at 37 ° C for 15 hours in 10 ml of a liquid medium
5 ml of -His-FeIFNβ was added to 500 ml of a new liquid medium, and the turbidity of the liquid medium at 600 nm was further reduced.
The cells were cultured from 0.6 to 1.0. Next, IPTG having a final concentration of 1.0 mM was added to the Escherichia coli culture, and the cells were cultured for 3 hours, and the desired histidine-added FeIFN-β protein (hereinafter, His-FeIF) was added.
N-β) was induced. IPTG treated E-His-Fe
His-FeIFN-β protein expressed in IFNβ was converted to sodium dodecyl sulfate using a 15% polyacrylamide gel.
Separated by polyacrylamide gel electrophoresis (hereinafter abbreviated as SDS-PAGE), 0.25% Coomassie Brilliant Blue R25
After staining with a staining solution consisting of 0, 5% acetic acid and 50% methanol, the protein staining image when the excess staining solution was removed with a decolorizing solution consisting of 7% acetic acid and 5% methanol was shown in FIG. A. In addition, His-FeIFN- separated by SDS-PAGE
β protein was also detected by Western blotting. That is, the His-FeIFN-β protein separated by SDS-PAGE was transferred to a BS85 nitrocellulose membrane (manufactured by Schlescher & Schrell) using a protein blotting device (manufactured by Bio-Rad), and the transferred His-FeIFN-β protein was used. 1
After reacting with a mouse anti-histidine monoclonal antibody (manufactured by QIAGEN) as a secondary antibody and a horseradish peroxidase (HRP) -conjugated goat anti-mouse IgG serum (manufactured by OEM Concept) as a secondary antibody, 0.03% 4-chloro-1-
The nitrocellulose membrane is immersed in a color developing solution consisting of naphthol and 0.03% hydrogen peroxide to perform a color-forming reaction.
FeIFN-β protein was detected. The His-FeIFN-β protein thus detected is shown in FIG.

FIG. 8A shows the analysis of FeIFN-β protein in E-His-FeIFNβ by SDS-polyacrylamide gel electrophoresis. Lane 1 shows a molecular weight marker (Rainbow marker, Amersham Life Science Co., Ltd.). Lane 2 is a control, that is, the expressed protein of E-His-FeIFNβ not treated with IPTG, and lane 3 is E-His-FeIFN treated with IPTG.
This figure shows a case where the target His-FeIFN-β protein is induced by β, and a band of His-FeIFN-β is observed at a position of about 37 kDa. FIG. 8B shows E-His- by Western blotting using a mouse anti-histidine monoclonal antibody.
The results of analysis of the His-FeIFN-β protein in FeIFNβ are shown. Lane 1 is a molecular weight marker, and Lane 3 is E-His-FeIFNβ treated with IPTG and the target His-FeIFN.
The case where -β protein is induced is shown. As is clear from these results, the His-FeIFN-β protein that specifically reacted with the mouse anti-histidine monoclonal antibody was detected in lane 3. These results indicate that E-His-FeIFNβ treated with IPTG expresses a protein expressing His-FeIFN-β protein.

(4) Purification of His-FeIFN-β protein His-FeIFN from transformant E-His-FeIFNβ treated with IPTG
Purification of -β protein was performed by the following operation. That is, IPTG-treated E-His-FeIFNβ was added to 1 mM EDTA, 1 mM
Phenylmethanesulfonyl fluoride (PMSF) and 50
After suspending in a solution consisting of mM Tris-hydrochloric acid (pH 8.0) and sonication, His-FeIFN-β was obtained in an insoluble fraction by centrifugation. The obtained insoluble fraction containing His-FeIFN-β was subjected to 1 mM EDTA containing 6 M urea, 1 mM PMSF, 1 mM 2-mercaptoethanol, 2% Triton X-100, 0.5 M sodium chloride and 50 mM Tris-. It is dissolved in a solution of hydrochloric acid (pH 8.0) (hereinafter abbreviated as column buffer), and His-FeIFN-β in the solution is transferred to Ni-NTA agarose (nickel-nitrilotriacetic acid agarose, Qiagen) resin carrier Fractionated by affinity column chromatography.
That is, H dissolved in a column buffer containing 6 M urea
Overlay the is-FeIFN-β solution on the affinity column,
-FeIFN-β is bound to Ni-NTA agarose resin, and then the Ni-NTA agarose resin to which His-FeIFN-β is bound is washed with a column buffer, and then washed with a column buffer.
The eluate containing 500 mM imidazole was overlaid on a column packed with Ni-NTA agarose resin, and the dissociated and eluted Hi
The s-FeIFN-β protein was recovered.

(5) Removal of histidine tag from His-FeIFN-β protein 5 ml of a solution containing 500 μg of His-FeIFN-β was added to 500 ml of a phosphate buffer (137 mM sodium chloride, 2.68 mM potassium chloride, 8.1 mM disodium hydrogen phosphate, and 1.47 mM
(Potassium dihydrogen phosphate, pH 7.4) for 24 hours at 4 ° C. Add 5 units of thrombin (Pharmacia) to the dialysed His-FeIFN-β solution, and add
Incubate for 16 hours and histidine tag and FeIFN-
β was divided. Next, the divided histidine tag and Fe
The solution containing IFN-β was overlaid on the column packed with the above-mentioned Ni-NTA agarose resin, and FeIFN-β was recovered as a flow-through fraction. The FeIFN-β protein lacking the signal peptide region obtained by this method was named nonHis-FeIFN-β.

(6) Measurement of antiviral activity of nonHis-FeIFN-β The antiviral activity of the above nonHis-FeIFN-β protein sample was determined by VSV using Armstrong's CPE inhibition method.
And feline cell line CRFK (Crandell felinekidney
The measurement was carried out in the same manner as in the above (3 (2)) using the cell (3). As a result, IFN activity nonHis-FeIFN-β protein sample was ¹⁰⁶ units per mg.

Next, using a baculovirus vector,
A case where an eukaryotic insect cell is expressed as a host will be described.

6. Construction of Baculovirus Vector and Expression of Protein A gene fragment encoding a protein having the biological activity of FeIFN-β is ligated to the polyhedron promoter of a baculovirus transfer vector, and the transfer vector is introduced into Escherichia coli having baculovirus genomic DNA. . Next, the recombinant baculovirus genomic DNA having the FeIFN-β gene fragment obtained here is introduced into insect cells, and the produced recombinant baculovirus is infected into insect cells to convert the recombinant FeIFN-β protein. Can be produced. Hereinafter, the FeIFN-β protein produced by the baculovirus protein expression system is referred to as BacF
eIFN-β. FIGS. 9 and 10 show the operation flow, and the present invention will be described more specifically with reference to examples.

(1) Construction of Transfer Vector DN of plasmid pCR-FeIFN-β into which a gene fragment encoding a protein having the biological activity of FeIFN-β described above was inserted
Sense primer with BamHI cleavage site added using A as template
(GTGAGGATCCGTGAGCTACAAGTTGCTTGG, SEQ ID NO: 12) and an antisense primer to which a SalI cleavage site was added
(TCAGGTCGACGTAACGGCCGCCAGTGTGCT, SEQ ID NO: 13) and PCR under the same conditions as described above was performed.
A signal peptide region-deleted FeIFN-β gene fragment having a cleavage site and a SalI cleavage site added to the 3 ′ end, respectively, was amplified. This amplified gene fragment is located downstream of the histidine tag of pFastBac HTa (manufactured by Life Technology) which is a baculovirus transfer vector.
Recombinant plasmid pFas integrated at BamHI-SalI cleavage site
t-IFNβ was produced. Whether pFast-IFNβ contains a gene fragment encoding a protein having the biological activity of FeIFN-β can be determined by using a 2% agarose gel to determine the restriction enzyme cleavage pattern when pFast-IFNβ DNA is double digested with BamHI and SalI. This was confirmed by detecting the FeIFN-β gene fragment lacking the 537 base pair signal peptide region by electrophoresis. FIG. 11 shows the detection of the FeIFNβ gene fragment in pFast-IFNβ. In the figure, “φX174 / HaeIII” is a size marker, and “pFast-IFNβ” is pFast-IFNβ DNA
FIG. 4 shows the results of electrophoresis of a restriction enzyme cleavage pattern when double digested with mHI and SalI. The gel was stained with a 0.5 μg / ml ethidium bromide solution. As can be seen from FIG. 11, the BamHI-SalI fragment of pFast-IFNβ appeared at the position of 537 bp, confirming that pFast-IFNβ contained a gene fragment encoding a protein having the biological activity of FeIFN-β.

(2) Preparation of Recombinant Baculovirus Genomic DNA Escherichia coli DH10Bac harboring baculovirus genomic DNA
(Manufactured by Life Technology) with pFast-IFNβ, 100 µg / ml Bluo-gal and 40 µg / ml IPTG.
After culturing at 37 ° C for 15 hours in LB agar medium containing FeIFN-
Recombinant baculovirus genome DN incorporating β gene
A white colony formed by Escherichia coli having A was selected, and the obtained Escherichia coli was named EBac-FeIFNβ and deposited (Accession No. FERM P-17467). Next, EBac-FeIFNβ was cultured in LB liquid medium at 37 ° C. for 15 hours, and the cultured DNC
Recombinant baculovirus genomic DNA contained in fraction A was prepared.

(3) Preparation of Recombinant Baculovirus The transfection method using CELLFECTIN reagent (manufactured by Life Technology Co.) introduced the above-mentioned recombinant baculovirus genomic DNA into Sf9 cells, which are established insect cells.
Grace insect cell culture medium (10% FB) containing 50 units / ml penicillin and 50 μg / ml streptomycin
S, containing 0.33% yeast rate and 0.33% lactalbumin hydrolyzate (manufactured by Life Technology Co., Ltd.), cultured at 27 ° C. for 72 hours, centrifuged the cell culture at 500 × g for 5 minutes, A recombinant baculovirus was obtained.

(4) Propagation of recombinant baculovirus 0.5 ml of the above-mentioned recombinant baculovirus solution was added to 35 ml of a culture solution containing 1.5 × 10 ⁶ Sf9 cells per 1 ml, and the mixture was added at 27 ° C.
After culturing the cells for 72 hours, the cells were centrifuged at 500 × g for 5 minutes to obtain a recombinant baculovirus in the culture supernatant.

(5) Measurement of titer of recombinant baculovirus 2 ml of a culture solution containing 5 × 10 ⁵ Sf9 cells per ml was added to each well of a 6-well cell culture plate, and cultured at 27 ° C. for 1 hour. After removing the culture solution from the wells with an aspirator, each well was mixed with 1 ml of a recombinant baculovirus solution diluted 10 times with FBS-free Grace's insect cell medium in 6 steps ( ^10-3 to ^10-8 dilution). Was added and incubated at room temperature for 1 hour. At this time, the virus solution diluted from 10 ^-3 to 10 ^-8 was cultured in two wells for each virus concentration. Next, after removing the culture solution from each well of the 6-well cell culture plate with an aspirator,
2 ml of Grace's insect cell medium containing 1% agarose was added to each well and incubated at 27 ° C for 5 days.
Plaque formation in each well of the cultured 6-well cell culture plate was observed, and the virus titer was determined by multiplying the maximum dilution of virus in which plaque formation was observed by the number of plaques in the well. The virus titer of the recombinant baculovirus obtained here was 2 × 10 ⁹ pfu (plaque formin
g unit) / ml.

(6) Purification and recovery of histidine-tagged BacFeIFN-β protein 1 × was added to 50 ml of a culture solution containing 2 × 10 ⁶ Sf9 cells per 1 ml.
0.5 ml of a recombinant baculovirus solution of 10 ⁹ pfu / ml was added (corresponding to MOI (Multiplicity of infection) = 5), and cultured at 27 ° C. for 72 hours, and then the culture was centrifuged at 500 × g for 5 minutes. Sf9 cells infected with recombinant baculovirus were obtained for sedimentation. Then, 20 mM Tris-HCl (pH 8.5), 5 mM 2-
The recombinant baculovirus-infected Sf9 cells obtained as a sediment were suspended in a cell lysate consisting of mercaptoethanol, 100 mM potassium chloride, 1 mM phenylmethanesulfonyl fluoride (PMSF), and 1% nonidet P-40. The suspension was centrifuged at 10,000 × g for 10 minutes to separate into a soluble fraction and a cell lysate. The cell lysate was subjected to sodium dodecyl sulfate-polyacrylamide electrophoresis (SDS-PAGE),
The separation pattern when stained with Coomassie Brilliant Blue R250 is shown in FIG. 12A, a mouse anti-histidine monoclonal antibody (manufactured by Qiagen) as a primary antibody, and a horseradish peroxidase-conjugated goat anti-mouse IgG antibody (manufactured by OEM Concept). FIG. 12B shows histidine-tagged BacFeIFN-β detected by Western blotting using) as a secondary antibody.

FIG. 12 shows the results of SDS-PAGE.
Indicates the case of staining with Coomassie brilliant blue R250, and B indicates the case of detection by Western blotting. In each case, a molecular weight marker (rainbow marker) and a ground material of uninfected cells were simultaneously used as a control. The results of the electrophoresis are shown. As is clear from these results, in the cells infected with the recombinant baculovirus, there is a BacFeIFN-β band at about 23 kDa, which indicates that these proteins are expressed.

Next, 20 mM Tris-hydrochloric acid (pH 8.
5) Ni-NTA (nickel-nitrilotriacetic acid, Qiagen) agarose resin equilibrated with a buffer consisting of 5 mM 2-mercaptoethanol, 500 mM potassium chloride, 20 mM imidazole and 10% (v / v) glycerol The soluble fraction of recombinant baculovirus-infected cells was overlaid on the column, and BacFeI
By affinity chromatography utilizing the affinity between the histidine tag added to the amino terminal side of FN-β and the Ni-NTA agarose resin, the histidine-tagged BacFeIFN-β is adsorbed to the Ni-NTA agarose resin. Was. Next, the adsorbed histidine-tagged BacFeIFN-β
Was released from the column with a protein release solution consisting of 20 mM Tris-HCl (pH 8.5), 5 mM 2-mercaptoethanol, 100 mM potassium chloride, 100 mM imidazole and 10% (v / v) glycerol, and was recovered.

(7) Recovered amount of histidine-tagged BacFeIFN-β 5 μl was separately collected from 5 ml of the column-purified solution containing histidine-tagged BacFeIFN-β, and a protein quantification method using Coomassie Brilliant Blue R (Bradford, M. ., 197
6, Anal. Biochem. 72: 248-254), the amount of protein in 5 μl was measured, and the total amount of histidine-tagged BacFeIFN-β purified by column was calculated from the amount of protein. As a result, the recovered purified histidine-tagged BacFeI
FN-β was 200 μg.

(8) Removal of Histidine Tag from Recombinant BacFeIFN-β Protein A solution containing 200 μg of histidine-tagged BacFeIFN-β, 5 m
l with 500 ml of the dialysate (50 mM Tris-HCl, pH 8.0,
In 0.5 mM EDTA, 1 mM dithiothreitol)
Dialysis at 4 ° C. for 24 hours. Histidine-tagged B after dialysis
To the acFeIFN-β solution, add 100 units of Tobacco Etch virus protease (manufactured by Life Technology Co., Ltd.), and incubate at 30 ° C. for 1 hour to mix the histidine tag and BacFeIFN-β.
β was divided. Next, the split histidine tag and Ba
The solution containing cFeIFN-β was overlaid on a Ni-NTA agarose resin column, and BacFeIFN-β was recovered as a flow-through fraction.

(9) IFN of recombinant BacFeIFN-β protein
ActivityAs a result of measurement in the same manner as the IFN activity measurement method in the E. coli expression system, the IFN activity of the obtained BacFeIFN-β was
10 ⁷ units per mg and was 1-digit high.

[0098]

Effects of the Invention According to the present invention, a large amount can be produced using a microorganism transformed with a protein having the biological activity of FeIFN-β, and no effective therapeutic agent other than a vaccine is known for cats. This protein can be used as an antiviral agent against various viral infections and as an antitumor agent against various cat tumors.

[0099]

[Sequence List Free Text]

SEQ ID NO: 5: synthetic oligonucleotide sense primer encoding a base sequence near the 5 ′ end of FeIFN-β gene.

SEQ ID NO: 6: synthetic oligonucleotide antisense primer encoding a base sequence near the 3 ′ end of FeIFN-β gene

SEQ ID NO: 7: synthetic oligonucleotide sense primer containing translation initiation codon of FeIFN-β gene

SEQ ID NO: 8: synthetic oligonucleotide antisense primer containing a translation termination codon of FeIFN-β gene

SEQ ID NO: 9: synthetic oligonucleotide sense primer in which the frames of GST protein and FeIFN-β protein match.

SEQ ID NO: 10: Complementary to the plasmid-derived nucleotide sequence downstream of the site where pCR-FeIFN-β and the del.FeIFN-β gene of pCR-del.FeIFN-β are integrated. Synthetic oligonucleotide antisense primer.

SEQ ID NO: 11: GST protein and del.FeIFN
-Synthetic oligonucleotide sense primer whose frame coincides with that of the β protein.

SEQ ID NO: 12: synthetic oligonucleotide sense primer to which a BamHI cleavage site has been added.

SEQ ID NO: 13: Synthetic oligonucleotide antisense primer to which a SalI cleavage site has been added.

[0108]

[Sequence List] SEQUENCE LISTING <110> kyoritsu shoji <120> Proteins having bioactivities of Feline Interferon-beta and method for preparations of the same. <130> KRS-4 <140> <141> <160> 11 <170> PatentIn Ver. 2.0 <210> 1 <211> 652 <212> DNA <213> Felis catus <220> <221> CDS <222> (86) .. (643) <400> 1 tggaagaagg gcattcacac tgcaaactct cgaagtcttt gcttcagcac ctagacagta 60 gcaggcaaga cttcctattt tcatc atg acc ggc agg tgc atc ctc caa atc 112 Met Thr Gly Arg Cys Ile Leu Gln Ile 1 5 gct ctc ttg gtg tgt ttc ttc acc acc gcg cat tcc gtg agc tac aag 160 Ala Leu Leu Val Cys Phe His Ser Val Ser Tyr Lys 10 15 20 25 ttg ctt gga ttc caa cta aga agc agc agt ttg gag tgt cag gag ctc 208 Leu Leu Gly Phe Gln Leu Arg Ser Ser Ser Leu Glu Cys Gln Glu Leu 30 35 40 ctg gtg aac ttg aac aga acc tct aaa tat tgc ctc aag gac agg atg 256 Leu Val Asn Leu Asn Arg Thr Ser Lys Tyr Cys Leu Lys Asp Arg Met 45 50 55 aac ttc gag gtc cct gag gag att aaa aaa tca cag cgg ttc cag aag 304 Asn Phe Glu Val Pro Glu Glu Ile Lys Lys Ser Gln Arg Phe Gln Lys 60 65 70 gag gaa gcc ata ttg gtc atc aac gag atg ttc cag aag atc ttt aat 352 Glu Glu Alu Ila Leu Val Ile Asn Glu Met Phe Gln Lys Ile Phe Asn 75 80 85 att ttc agt aga agc acc tct agc acg gga tgg aat gag acc act gtt 400 Ile Phe Ser Arg Ser Thr Ser Ser Thr Gly Trp Asn Glu Thr Thr Val 90 95 100 105 gag aac ctc ctt gcg aca ctc cac tgg cag aag gaa cac ctg gaa acg 448 Glu Asn Leu Leu Ala Thr Leu His Trp Gln Lys Glu His Leu Glu Thr 110 115 120 atc ctg gag gaa atc atg gag gag gaa aac ttc acc tgg gac aat acg 496 Ile Leu Glu Glu Ile Met Glu Glu Glu Asn Phe Thr Trp Asp Asn Thr 125 130 135 acc ctt ctg aac ctg aag aaa tac tac tta agg att gtg cgg tac ctg 544 Thr Leu Leu Asn Leu Lys Lys Tyr Tyr Leu Arg Ile Val Arg Tyr Leu 140 145 150 aag gcc aag gag tac agc gtc tgt gcc tgg aca gta gtc cac gca gaa 592 Lys Ala Lys Glu Tyr Ser Val Cys Ala Trp Thr Val Val His Ala Glu 155 160 165 atc ctc aga aac ttt ttc ttc ctt gag aga ctt aca gat tac ctc caa 640 Ile Leu Arg Phe Phe Phe Leu Glu Arg Leu Thr Asp Tyr Leu Gln 170 175 180 185 aac tgaggacct 652 Asn <210> 2 <211> 186 <212> PRT <213> Felis catus <400> 2 Met Thr Gly Arg Cys Ile Leu Gln Ile Ala Leu Leu Val Cys Phe Phe 1 5 10 15 Thr Thr Ala His Ser Val Ser Tyr Lys Leu Leu Gly Phe Gln Leu Arg 20 25 30 Ser Ser Ser Leu Glu Cys Gln Glu Leu Leu Val Asn Leu Asn Arg Thr 35 40 45 Ser Lys Tyr Cys Leu Lys Asp Arg Met Asn Phe Glu Val Pro Glu Glu 50 55 60 Ile Lys Lys Ser Gln Arg Phe Gln Lys Glu Glu Ala Ile Leu Val Ile 65 70 75 80 Asn Glu Met Phe Gln Lys Ile Phe Asn Ile Phe Ser Arg Ser Thr Ser 85 90 95 Ser Thr Gly Trp Asn Glu Thr Thr Val Glu Asn Leu Leu Ala Thr Leu 100 105 110 His Trp Gln Lys Glu His Leu Glu Thr Ile Leu Glu Glu Ile Met Glu 115 120 125 Glu Glu Asn Phe Thr Trp Asp Asn Thr Thr Leu Leu Asn Leu Lys Lys 130 135 140 Tyr Tyr Leu Arg Ile Val Arg Tyr Leu Lys Ala Lys Glu Tyr Ser Val 145 150 155 160 Cys Ala Trp Thr Val Val His Ala Glu Ile Leu Arg Asn Phe Phe Phe 165 170 175 Leu Glu Arg Leu Thr Asp Tyr Leu Gln Asn 1 80 185 <210> 3 <211> 498 <212> DNA <213> Felis catus <220> <221> CDS <222> (1) .. (495) <400> 3 gtg agc tac aag ttg ctt gga ttc caa cta aga agc agc agt ttg gag 48 Val Ser Tyr Lys Leu Leu Leu Gly Phe Gln Leu Arg Ser Ser Ser Leu Glu 1 5 10 15 tgt cag gag ctc ctg gtg aac ttg aac aga acc tct aaa tat tgc ctc 96 Cys Gln Glu Leu Leu Val Asn Leu Asn Arg Thr Ser Lys Tyr Cys Leu 20 25 30 aag gac agg atg aac ttc gag gtc cct gag gag att aaa aaa tca cag 144 Lys Asp Arg Met Asn Phe Glu Val Pro Glu Glu Ile Lys Lys Ser Gln 35 40 45 cgg ttc cag aag gag gaa gcc ata ttg gtc atc aac gag atg ttc cag 192 Arg Phe Gln Lys Glu Glu Ala Ile Leu Val Ile Asn Glu Met Phe Gln 50 55 60 aag atc ttt aat att ttc agt aga agc accg tg tgg aat 240 Lys Ile Phe Asn Ile Phe Ser Arg Ser Thr Ser Ser Thr Gly Trp Asn 65 70 75 80 gag acc act gtt gag aac ctc ctt gcg aca ctc cac tgg cag aag gaa 288 Glu Thr Thr Val Glu Asn Leu Leu Ala Thr Leu His Trp Gln Lys Glu 85 90 95 cac ctg gaa acg atc ctg gag gaa atc atg gag gag gaa aac tt c acc 336 His Leu Glu Thr Ile Leu Glu Glu Ile Met Glu Glu Glu Asn Phe Thr 100 105 110 tgg gac aat acg acc ctt ctg aac ctg aag aaa tac tac tta agg att 384 Trp Asp Asn Thr Thr Leu Leu Asn Leu Lys Lys Tyr Tyr Leu Arg Ile 115 120 125 gtg cgg tac ctg aag gcc aag gag tac agc gtc tgt gcc tgg aca gta 432 Val Arg Tyr Leu Lys Ala Lys Glu Tyr Ser Val Cys Ala Trp Thr Val 130 135 140 gtc cac gca gaa atc ctc aga aac ttt ttc ttc ctt gag aga ctt aca 480 Val His Ala Glu Ile Leu Arg Asn Phe Phe Phe Leu Glu Arg Leu Thr 145 150 155 160 gat tac ctc caa aac tga 498 Asp Tyr Leu Gln Asn 165 <210> 4 <211 > 165 <212> PRT <213> Felis catus <400> 4 Val Ser Tyr Lys Leu Leu Gly Phe Gln Leu Arg Ser Ser Ser Leu Glu 1 5 10 15 Cys Gln Glu Leu Leu Val Asn Leu Asn Arg Thr Ser Lys Tyr Cys Leu 20 25 30 Lys Asp Arg Met Asn Phe Glu Val Pro Glu Glu Ile Lys Lys Ser Gln 35 40 45 Arg Phe Gln Lys Glu Glu Ala Ile Leu Val Ile Asn Glu Met Phe Gln 50 55 60 Lys Ile Phe Asn Ile Phe Ser Arg Ser Thr Ser Ser Thr Gly Trp Asn 65 70 75 80 Glu Thr Thr Val Glu Asn Leu Leu Ala Thr Leu His Trp Gln Lys Glu 85 90 95 His Leu Glu Thr Ile Leu Glu Glu Ile Met Glu Glu Glu Asn Phe Thr 100 105 110 Trp Asp Asn Thr Thr Leu Leu Asn Leu Lys Lys Tyr Tyr Leu Arg Ile 115 120 125 Val Arg Tyr Leu Lys Ala Lys Glu Tyr Ser Val Cys Ala Trp Thr Val 130 135 140 Val His Ala Glu Ile Leu Arg Asn Phe Phe Phe Leu Glu Arg Leu Thr 145 150 155 160 Asp Tyr Leu Gln Asn 165 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide sense primer coding for a sequence neighboring the 5'-end of feline interferon-beta genes. <400> 5 tgaaagtggg aaattcctct g 21 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide antisense primer coding for a sequence neighboring the 3'-end of feline interferon-beta genes. <400> 6 gwccwttcmw atkcagtrsm tt 22 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificia l Sequence: Synthetic oligonucleotide primer of sense orientation including the translational initiation codon for the FeIFN-beta gene. <400> 7 tggaagaagg gcattcacac t 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <220> < 223> Description of Artificial Sequence: Synthetic oligonucleotide antisense primer including the translational termination codon for the FeIFN-beta gene. <400> 8 agrtsytcag ttyyggargt 20 <210> 9 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide primer of sense orientation designated for in-frame cloning of GST and FeIFN-beta genes. <400> 9 cagtgaattc catgaccggc aggtgcatcc 30 <210> 10 <211> 20 <212> DNA <213 > Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide antisense primer coding for a sequence neighboring the 3'-end of FeIFN-beta and del.FeIFN-beta genes. <400> 10 gtaacggccg ccagtgtgct 20 <210> 11 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide primer of sense orientation designated for in-frame cloning of GST and del.FeIFN-beta genes. <400> 11 cagtgaattc gtgagctaca agttgcttgg 30 <210> 12 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: Synthetic oligonucleotide primer with a BamHI site. <400> 12 gtgaggatcc gtgagctaca agttgcttgg 30 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence < 220> <223> Description of Artificial Sequence: Synthetic oligonucleotide antisence primer with a SalI site. <400> 13 tcaggtcgac gtaacggccg ccagtgtgct 30

[Brief description of the drawings]

FIG. 1 is a diagram showing a method for constructing a plasmid for expressing the FeIFN-β gene in Escherichia coli.

FIG. 2 shows a method for constructing a plasmid for expressing the del.FeIFN-β gene in Escherichia coli.

FIG. 3. Canine, human, bovine and equine IFN-β genes and FeIFN-
The results are shown in which the base sequence of the β gene is additionally described so that the homologous portion is maximized. In the figure, the same base as that of the FeIFN-β gene is indicated by “•”, and the deletion is indicated by “−”.

FIG. 4 is a diagram showing a continuation of FIG. 3;

FIG. 5 shows dog, human, bovine, and horse IFs shown in FIGS.
FIG. 3 is a view showing the results of adding amino acid sequences predicted from the nucleotide sequences of the N-β gene and the FeIFN-β gene so that the homologous portion is maximized. In the figure, the same amino acid as FeIFN-β is indicated by “•”, and the deletion is indicated by “-”.

FIG. 6 is a diagram schematically showing the construction of an E. coli expression plasmid pET-FeIFN-β.

FIG. 7 is a photograph showing the result of electrophoretic analysis of a FeIFN-β gene fragment in pET-FeIFN-β. In the figure, lane 1 is a size marker (φX174 / HaeIII, manufactured by Nippon Gene), and lane 2 is extracted from E-His-FeIFNβ.
FIG. 2 shows the results of electrophoretic analysis of pET-FeIFN-β plasmid DNA double-digested with BamHI and SalI.
In addition, the band of the expressed FeIFN-β gene fragment is referred to as “← FeIF
N-β gene fragment ".

FIG. 8: E- by SDS-polyacrylamide gel electrophoresis
5 is a photograph showing the analysis result of FeIFN-β protein in His-FeIFNβ, where A is Coomassie brilliant blue R
B stained at 250; B is by Western blot using mouse anti-histidine monoclonal antibody. In each electrophoresis, lane 1 is a molecular weight marker, lane 2 is a control, a case where protein expression was not induced by IPTG, and lane 3 was
This is the case where protein expression was induced by IPTG. In addition,
Express the expressed His-FeIFN-β protein band as “← His-Fe
IFN-β ".

FIG. 9 is a diagram schematically illustrating a method for constructing a baculovirus expression system that expresses a protein having a biological activity of FeIFNβ.

10 is a continuation of FIG. 9 and schematically illustrates a method for constructing a baculovirus expression system that expresses a protein having a biological activity of FeIFNβ.

FIG. 11 is a photograph of electrophoresis showing a result of detecting a FeIFNβ gene fragment in pFast-IFNβ. In the figure, `` φX174
/ HaeIII "is a size marker and" pFast-IFNβ "
FIG. 4 shows the results of electrophoresis of restriction enzyme cleavage patterns when pFast-IFNβ DNA was double-digested with BamHI and SalI.
The gel was stained with a 0.5 μg / ml ethidium bromide solution. The band of the BamHI-SalI fragment of pFast-IFNβ is indicated by “← pFast-IFNβBamHI-SalI fragment”.

FIG. 12 is a photograph of electrophoresis showing the detection results of BacFeIFN-β expressed in recombinant baculovirus-infected Sf9 cells. In the figure, A is Coomassie Brilliant Blue R250
B, Western blotting using a mouse anti-histidine monoclonal antibody. Both A and B show the case where the molecular weight marker, the protein expressed in uninfected cells (control) and the protein expressed in infected cells were electrophoresed.
The BacFeIFN-β protein band of interest is “← Bac
FeIFN-β ".

──────────────────────────────────────────────────続 き Continued on the front page (51) Int.Cl. ⁷ Identification symbol FI Theme coat ゛ (Reference) C12P 21/02 C12N 5/00 B

Claims (18)

[Claims] 1. A protein comprising the amino acid sequence of SEQ ID NO: 2 or the amino acid sequence of SEQ ID NO: 2 in which one or several amino acids have been deleted, substituted or added, and having the biological activity of feline interferon β. . 2. A protein comprising the amino acid sequence of SEQ ID NO: 4 or the amino acid sequence of SEQ ID NO: 4 in which one or several amino acids have been deleted, substituted or added, and having the biological activity of feline interferon β. . 3. A protein comprising the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 or a partial amino acid sequence thereof and having a biological activity of feline interferon β. 4. A biological activity of feline interferon β, which is an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or an amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences. A gene encoding a protein having 5. The biological activity of feline interferon β, which is an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or an amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences. A recombinant vector capable of expressing the protein, comprising a gene encoding a protein having 6. The recombinant vector according to claim 5, wherein the recombinant vector is a synthetic plasmid. 7. A biological activity of feline interferon β, which is an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or an amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences. A transformant comprising a recombinant vector containing a gene encoding a protein having 8. The transformant according to claim 7, wherein the transformant is Escherichia coli. 9. Accession number FERM using E. coli as a host
P-17119, FERM P-17120 or F
A recombinant vector deposited under ERM P-17629. 10. Accession number FER using E. coli as a host
A transformant deposited under MP-17119, FERM P-17120 or FERM P-17629. 11. The biological activity of feline interferon β, which is an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or an amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences. Containing a gene encoding a protein having
A recombinant baculovirus capable of expressing the protein. 12. The biological activity of feline interferon β, which is an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or an amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences. Containing a gene encoding a protein having
A recombinant baculovirus transfer vector capable of producing the recombinant baculovirus according to claim 11. 13. The biological activity of feline interferon β, which is an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or an amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences. E. coli containing a recombinant baculovirus genome into which a gene encoding a protein having 14. An Escherichia coli containing the recombinant baculovirus genome deposited under accession number FERM P-17467. 15. The biological activity of feline interferon β, which is an amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or an amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences. Containing a gene encoding a protein having
Insect cells infected with a recombinant baculovirus capable of expressing the protein. 16. The amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, or the amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences, or the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4 A step of preparing a recombinant vector that is a partial amino acid sequence of the sequence and contains a gene encoding a protein having the biological activity of feline interferon β, and is capable of producing the protein; Biological activity of feline interferon β, comprising the steps of transforming a host cell with a recombinant vector, culturing the transformed host cell to produce a protein, and separating and recovering the produced protein A method for producing a protein having: 17. The method according to claim 16, wherein the recombinant vector is a synthetic plasmid and the host cell is Escherichia coli.
A method for producing a protein having the biological activity of interferon β. 18. An amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 4, an amino acid sequence in which one or several amino acids are deleted, substituted or added in these amino acid sequences, or an amino acid of SEQ ID NO: 2 or SEQ ID NO: 4 A baculovirus, which is a partial amino acid sequence of the sequence and which is linked to a gene encoding a protein having a biological activity of feline interferon β under the control of a baculovirus polyhedron promoter so that the protein can be expressed; A step of preparing a transfer vector; a step of introducing the obtained baculovirus transfer vector into Escherichia coli containing baculovirus genomic DNA to produce a recombinant baculovirus genomic DNA; Insect cells Transfecting and producing a recombinant baculovirus, infecting insect cells with the produced recombinant baculovirus, culturing the infected cells and producing the protein, and separating and recovering the produced protein And producing a protein having the biological activity of feline interferon β.