JP2000197493A - Preparation of double-stranded dna except a part of terminal homopolymer and determination of base sequence thereof - Google Patents

Abstract

PROBLEM TO BE SOLVED: To obtain a double-stranded DNA that is useful for decision the base sequence by allowing a restriction enzyme having the cleavage site outside the recognition site to act on the double-stranded DNA having a homopolymer on the chain end and removing the homopolymer part. SOLUTION: A restriction enzyme having the cleavage site on the outside of the recognition site is allowed to act on a double stranded DNA bearing homopolymer parts on one or both chain ends and at least one of the homopolymer is cut off to obtain the objective double stranded DNA from which the homopolymers that disturbs the decision of the base sequence and locating on the chain ends are selectively removed wholly or partially and is useful as a template for deciding the base sequence. The homopolymer part comprises the homopolymer and non-homopolymer and at least one part of the non-homopolymer is the recognition site of the restriction enzyme and the restriction enzyme is preferably in the class IIS.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

TECHNICAL FIELD The present invention relates to a method for preparing a double-stranded DNA obtained by removing a part or all of the homopolymer part from a double-stranded DNA having a homopolymer part at a terminal, and the method obtained by this method. The present invention relates to a method for determining a nucleotide sequence using double-stranded DNA.

[0002]

2. Description of the Related Art A nucleotide sequence determination method is an essential technique in the field of medical biology as a method for analyzing a gene transcript as a functional unit while preparing a full-length cDNA library. It is very important to obtain 100,000 types of cDNA clones from humans and mice and to identify their positions on the genome to identify genes and analyze their functions.

[0003] Several methods have been proposed for preparing a cDNA library. The present inventors have proposed the following method as a method for synthesizing full-length cDNA with high efficiency, and have aimed for practical use. Further research is ongoing. In this method, first-strand cDNA is synthesized using poly (A) RNA as a template, oligo dT having a specific restriction enzyme site on the 5 ′ side and an anchor site on the 3 ′ side as a primer, and the resulting first-strand cDNA is synthesized. Oligo dG is added to the 3 'end of the cDNA using an enzyme such as terminal deoxynucleotidyl transferase. Next, using the oligo dC having a restriction enzyme site on the 5 ′ side as a primer, the second strand c
DNA synthesis is performed, and the cDNA is introduced into a vector using restriction enzyme sites present at both ends of the cDNA. Here, by using methylated dCTP instead of dCTP as a substrate for the first strand cDNA synthesis and using a hemimethylation-sensitive restriction enzyme as a restriction enzyme, only the restriction enzyme sites at both ends of the cDNA are cleaved. It is devised as follows. A method for preparing a full-length cDNA library by such a method is described in WO98 / 20122.
And Carninci, P. et al. Genomics 37 (1996) 327-336,
The details are described in Carninci, P. et al. DNA Res. 4 (1997) 61-66, and a huge number of full-length cDNA clones have actually been obtained. The nucleotide sequence of the obtained full-length cDNA clone is being analyzed. By proceeding like this, the position of the cDNA on the genome is identified.

However, a homopolymer of oligo dA: dT and oligo dG: dC exists at both ends of the cDNA library obtained by the above method. In other words, one of the two ends of the double-stranded cDNA cut out of the vector with the restriction enzyme
A: dT is present and the other oligo dG: dC (usually 11-16
Base pairs). Oligo dA: dT is derived from the poly A chain originally contained in mRNA, and one oligo dG: dC
Is derived from dG tailing introduced as a site for attaching a primer when preparing double-stranded DNA.

However, when the double-stranded cDNA was sequenced as a template and its base sequence was determined, it was found that the above-mentioned homopolymer portion hindered the sequencing method. The sequencing method using double-stranded cDNA as a template includes a dideoxy method using a DNA polymerase utilizing the Sanger method and a transcription sequencing method using an RNA polymerase developed by the present inventors. Also, the base sequence is determined from the base and the chain length at the terminal of the reaction product obtained in the presence of a terminator that stops the chain elongation by the polymerase.

However, although the cause is not clear, there is a problem that if a homopolymer portion is present at the end of the double-stranded cDNA, the sequence is difficult to read as a result of sequencing. Furthermore, if the double-stranded cDNA is amplified by PCR before sequencing, the polymerase will synthesize the homopolymer part with the wrong chain length (number of repeating bases), and certain bases that should have the same length should be used. The chain length of fragments having as a terminal part is different,
As a result, a fragment of a specific length contains a plurality of fragments having different terminal bases, which may make sequencing impossible. This tendency is particularly strong when a double-stranded cDNA having oligo dG: dC at at least one of its ends is used as a template.

The above problem has proven to be a very alarming problem in DNA sequencing.
Furthermore, due to the above obstacles, it is difficult to determine the nucleotide sequence efficiently, quickly, and accurately for a huge number of clones in a cDNA library, and where in the full-length cDNA library each gene is located. It is also difficult to specify whether they are doing it. The problem is, for example,
Although it can be reduced to some extent by shortening the chain length of oligo dA: dT and oligo dG: dC, in the actual reaction, oligo d
It is not easy to shorten the chain length of A: dT and oligo dG: dC. The oligo dA: dT is derived from the poly A chain originally contained in the mRNA as described above, but by shortening the oligo dT in the primer used in the transcription reaction, theoretically, the oligo dA: dT Can be shortened. However, if the oligo dT in the primer is short, there is a problem that the yield of the transcript is reduced, which is not practical. In addition, oligo dG: dC is derived from dG tailing introduced as a site for attaching a primer when preparing double-stranded DNA, as described above, and by shortening dG tailing, oligo d
G: dC can be shortened. However, it is actually difficult to adjust dG tailing to a desired chain length.

[0008]

SUMMARY OF THE INVENTION Accordingly, an object of the present invention is to provide a double-stranded DNA obtained by selectively removing a part or all of a homopolymer portion present at the end of a double-stranded DNA, which is an obstacle in determining a base sequence. An object of the present invention is to provide a method for preparing cDNA.
Furthermore, an object of the present invention is to remove a part or the whole of the homopolymer portion present at the end obtained by the above method.
It is an object of the present invention to provide a method for determining a nucleotide sequence using a single-stranded DNA as a template.

[0009]

Means for Solving the Problems The present invention provides a double-stranded DNA having a homopolymer portion at one or both ends thereof, by allowing a restriction enzyme having a cleavage site outside of a recognition site to act on at least one of the homopolymers. The present invention relates to a method for preparing a double-stranded DNA, characterized in that part or all of a part is cut off. Furthermore, the present invention is a method for determining the base sequence of this double-stranded DNA using one or both of the double-stranded DNA as a template, wherein the double-stranded DNA serving as the template is prepared by the method of the present invention. The present invention relates to a method for determining a base sequence, characterized in that the DNA sequence is a double-stranded DNA prepared as described above.

[0010]

BEST MODE FOR CARRYING OUT THE INVENTION The method for preparing a double-stranded DNA of the present invention comprises:
On a double-stranded DNA having a homopolymer portion at one or both ends, a restriction enzyme having a cleavage site outside the recognition site is acted on.
A part or all of at least one of the homopolymer portions is cut off. The target of cutting off part or all of the homopolymer part in the method of the present invention is a double-stranded DNA having a homopolymer part consisting of oligo dG: dC or oligo dA: dT at one end, and oligo dG: dC at one end. Or oligo dA: dT
Having a homopolymer moiety consisting of: oligo dG: dC or oligo dA: having a homopolymer moiety consisting of dT: dT at the other end
Can be DNA. When having a homopolymer portion at both ends, usually, if one end is oligo dA: dT, the other end is oligo dG: dC, but not limited to this, and both ends are oligo dA: dT. Alternatively, both ends may be oligo dG: dC. Further, the chain length of the homopolymer portion is not limited, and is usually between 5 and 20, and according to the chain length of the homopolymer portion, a `` restriction enzyme having a cleavage site outside the recognition site '' described below is used. It can be selected as appropriate. When a part of the homopolymer part is cut off, the chain length of the remaining homopolymer part can be appropriately determined from the viewpoint of reducing the influence on the base sequence determination method.

In the method for preparing a double-stranded DNA of the present invention, "a restriction enzyme having a cleavage site in addition to a recognition site" is used. "Restriction enzyme having a cleavage site outside the recognition site" is a restriction enzyme having a cleavage site away from the recognition site,
As such a restriction enzyme, for example, a class IIS restriction enzyme is known. When the class IIS restriction enzyme is, for example, BbvI, as shown in the following formula, it has a recognition site consisting of 5′-GCAGC and its complementary chain and a cleavage site (▼ ▲) at a site away from this recognition site. The sequence of the recognition site and the distance between the recognition site and the cleavage site differ depending on the type of restriction enzyme.

[0012]

Embedded image

As class IIS restriction enzymes, specifically, for example, AlwI, AlwXI, Alw26I, BbsI, BbvI, BbvI
I, BcefI, BccI, BcgI, BciVI, BinI, BmrI, BpmI, Bsa
I, BseRI, BsgI, BsmAI, BsmBI, BspMI, BsrDI, BstF5
I, EarI, Eco31I, Eco57I, Esp3I, Esp3I, FauI, Fok
I, GsuI, HgaI, HinGUII, HphI, Ksp632I, MboII, Mme
I, Mn1I, NgoVIII, PleI, RleAI, SapI, SfaNI, TaqII,
Tth111II, BsmI, BsrI, BsmFI, BseMII (Szybalski,
W. et al. Gene 100 (1991) 13-26, and New Engla
nd Biolab, Inc. catalog http://www.neb.com)
Etc. The recognition sites and cleavage sites of some restriction enzymes are as follows. BbvI (GCAGC 8/12), HgaI (GAC
GC 5/10), BsmFI (GGGAC 10/14), SfaNI (GCATC 5/9),
BspMI (ACCTGC 4/8) (recognition site and cleavage site are shown in parentheses)

In the preparation method of the present invention, "double-stranded DNA having a homopolymer portion at one or both ends" is used as a starting material,
To prepare "double-stranded DNA in which at least one part or all of the homopolymer part is cut off", a starting material "double-stranded DNA having a homopolymer part at one or both ends"
For example, WO98 / 20122 and Carninci, P. et al. Genomi
cs 37 (1996) 327-336, Carninci, P. et al. DNA Res.
4 (1997) 61-66. However, in the preparation method of the present invention, since the above-mentioned “restriction enzyme having a cleavage site in addition to the recognition site” is used, a double-stranded DNA in which the recognition site of this restriction enzyme has been introduced in advance at the end of the homopolymer portion is used. The double-stranded DNA in which the recognition site of the above restriction enzyme has been introduced in advance at the end of the homopolymer portion is a double-stranded D
It can be prepared by using a primer having a homopolymer and a non-homopolymer containing a sequence of a recognition site as a primer used in the preparation of NA.

The double-stranded DNA treated with the restriction enzyme includes, for example, a double-stranded cDNA. Furthermore, the double-stranded DNA treated with the restriction enzyme may be an artificially modified double-stranded cDNA or a chemically synthesized double-stranded DNA. Furthermore, a double strand treated with the restriction enzyme
As the DNA, DNA having a chemical modification in a part of one strand other than the homopolymer part can be used. The chemical modification is not particularly limited, and examples thereof include modification by methylation. The method of methylation is known to those skilled in the art, and a method using a nucleic acid methylated at the time of the synthesis of the first strand of double-stranded DNA as a substrate can be used. The chemical modification can be performed on any nucleic acid, but methylated cytosine and methylated adenine exist in nature, and methylated cytosine is commercially available and easily available. Can be introduced.

When a double-stranded cDNA is introduced into a plasmid to transform a host in order to amplify the full-length cDNA when preparing a full-length cDNA library, sticky ends are formed on at least one of the double-stranded cDNAs. There is a need to. However, the restriction enzyme cleavage site used to create
, The double-stranded cDNA is cleaved halfway. Therefore, in order to prevent the double-stranded cDNA from being cleaved halfway by the restriction enzyme used to create sticky ends, methylation was introduced into one strand of the double-stranded cDNA, and There is a method using a hemimethylation-sensitive restriction enzyme (Carninci, P. et al. Genomics 37 (1
996) 327-336, Carninci, P. et al. DNARes. 4 (1997)
61-66). In this method, methylation is introduced into one strand of a double-stranded cDNA when a homopolymer portion having a specific restriction enzyme site is introduced into both ends to prepare a full-length cDNA library. However, a primer into which methylation has not been introduced is used for the sequence for creating sticky ends. When a hemimethylation-sensitive restriction enzyme is allowed to act on the double-stranded cDNA in which methylation has been introduced into one strand, the restriction enzyme cleavage site inside the cDNA is not cleaved, and a sticky end is formed. The method of introducing this hemimethylation into cDNA is a method of distinguishing between the primer / linker site and the restriction enzyme sensitivity in cDNA during cDNA synthesis (Huse, WD et al. US Patent (1997)
5681726).

In the preparation method of the present invention, the double-stranded DNA to be treated with a restriction enzyme may be a hemimethylated cDNA in which one strand is methylated. However, while many restriction enzymes sensitive to both-chain methylation are known, hemimethylation is not well known. Susceptibility to both-chain methylation is not necessarily sensitive to hemimethylation (Paroush, Z. et al. Cell 63
(1990) 1229-1237). Therefore, in the present invention, when the double-stranded DNA treated with the restriction enzyme is a hemimethylated cDNA in which one strand is methylated, the DNA is susceptible to hemimethylation as a “restriction enzyme having a cleavage site outside the recognition site”. Use As far as it was examined under the conditions described in the Examples below, at least BbvI (GCA
GC 8/12), HgaI (GACGC 5/10) and GsuI (CTGGAG 16/1
4) (The numbers in parentheses indicate the recognition site and cleavage site)
Are sensitive to hemimethylation.

The method of the present invention for preparing double-stranded DNA excluding the terminal homopolymer portion will be described with reference to the following scheme, taking the case of hemimethylated cDNA as an example.

[0019]

Embedded image

A single strand (1) having a hemimethyl group introduced into a part of one strand other than the homopolymer portion is prepared. This single strand (1) has oligo dG at the 3 ′ end and oligo dT at the 5 ′ end.
Having. This single strand (1) is, for example, Carninci, P. et.
al. Genomics 37 (1996) 327-336, Carninci, P. et a
l. DNA Res. 4 (1997) 61-66. Note that, in the above scheme, the case where oligo dG is present at the 3 ′ end and oligo dT is present at the 5 ′ end is described.
The same applies to main chains.

Next, using the single strand (1) as a template and a homopolymer complementary to the oligo dG that the single strand (1) has at the 3 ′ end as a primer, Synthesize single-stranded DNA (2). However, the primer has a non-homopolymer sequence containing a recognition sequence of a restriction enzyme used for excision of a homopolymer portion, for example, BbvI (see scheme) at the 5 ′ end. The homopolymer portion at one end of the double-stranded DNA synthesized using such a template and primer (the left end of the double-stranded DNA shown by (2)) is
It consists of a homopolymer consisting of oligo dG: dC and a non-homopolymer containing a recognition sequence for the restriction enzyme (for example, BbvI).
The other end of the double-stranded DNA to be synthesized (the right end of the double-stranded DNA shown by (2)) is composed of, for example, a homopolymer composed of oligo dA: dT and a non-homopolymer, and the non-homopolymer recognizes a restriction enzyme. An array can be included. In this case, the restriction enzyme may be any restriction enzyme belonging to class II including class IIS restriction enzyme. For example, the non-homopolymer can include a recognition sequence for a restriction enzyme (eg, BbvI) for cutting the left end of the double-stranded DNA, and in this case, both ends of the double-stranded DNA can be cut at the same time. The double-stranded DNA (2) is treated with a "restriction enzyme having a cleavage site outside the recognition site" (BbvI in the scheme), and part or all of the leftmost homopolymer portion is cut off. As a result, a double-stranded DNA (3) from which at least one end of the homopolymer portion has been cut off can be obtained.

The obtained double-stranded DNA (3) can be amplified by introducing it into a vector and culturing a host transformed with this plasmid. For this purpose, for example, a linker having a protruding end of oligo dGGGG at the 5 ′ end is ligated to the double-stranded DNA (3). Further, this linker has a restriction enzyme site such as EcoRI at the end opposite to the oligo dG so as to be easily introduced into a vector. By ligating such a linker to the double-stranded DNA (3), a double-stranded DN having a protruding end consisting of a restriction enzyme site is obtained.
A (5) is obtained. In this case, the double-stranded DNA (4) in the scheme
Does not go through. Alternatively, the double-stranded DNA (3) can be treated by the following method. Using an enzyme having an exonuclease activity that specifically acts on single-stranded DNA, the remaining single-stranded DNA (double-stranded DN) is treated with the above restriction enzyme.
A (3) is specifically degraded to obtain a double-stranded DNA (4) having blunt ends. Next, a suitable linker, for example, a linker having a restriction enzyme site of EcoRI, is ligated to the blunt end of the double-stranded DNA (4) to form a protruding end so that the vector can be easily introduced into a vector. A double-stranded DNA (5) having protruding ends is obtained. The right end (the end not treated with the restriction enzyme BbvI, the dA: dT homopolymer end in the scheme) of the double-stranded DNA (5) thus obtained is treated with an appropriate restriction enzyme (XhoI in the scheme). . In this case, the restriction enzyme may be any restriction enzyme belonging to class II including the class IIS restriction enzyme as described above. The resulting double-stranded DNA can be introduced into an appropriate vector and amplified.

In addition to the above method, the double-stranded DNA (2) can be amplified, for example, by a PCR method using the double-stranded DNA (2) as a template.

The length of the homopolymer excised by the above method is determined by the type of the "restriction enzyme having a cleavage site in addition to the recognition site". Therefore, the length of the homopolymer contained in the homopolymer portion is taken into consideration. Then, a restriction enzyme is appropriately selected. In addition, the sequence of the non-homopolymer including the recognition site of the restriction enzyme can be appropriately determined depending on the type of the restriction enzyme to be used.

Further, by using a restriction enzyme which does not act on a double-stranded DNA having a chemical modification at its recognition site or cleavage site, the recognition site of the restriction enzyme is internalized in the double-stranded DNA. Even in this case, it is possible to cut off only the homopolymer portion at one end or both ends of the double-stranded DNA. As such a restriction enzyme, a restriction enzyme which does not act on a double-stranded DNA site having a methyl group as a chemical modification can be used. By using such a restriction enzyme, double-stranded DNA other than the homopolymer part
It is possible to introduce a methyl group as a chemical modification into the amino acid to protect it from cleavage. Restriction enzymes that do not act on a double-stranded DNA site having a methyl group as a chemical modification include, for example, BbvI, HgaI, and GsuI.

The nucleotide sequence determination method of the present invention is a method for determining the nucleotide sequence of this double-stranded DNA using one or both of the double-stranded DNAs as a template. It is characterized in that the strand DNA is a double-stranded DNA prepared by the method of the present invention described above.
Specifically, in the method of the present invention, one or both ends of a double-stranded DNA prepared by using the method of the present invention and having one or both ends of the homopolymer portion cut off is used as a template, and the double-stranded DNA is used as a template.
Is determined. However, 2 used as a mold
This strand DNA is used as a template after being appropriately amplified by a microorganism or by PCR. Both amplification methods are well-known techniques. However, double-stranded DNA used as a template is
In the case of amplification by the R method, it is preferable that the homopolymer to be cut off by the prepared double strand is part or all of oligo dG: dC.

As a sequencing method using double-stranded DNA as a template, for example, a dideoxy method using a DNA polymerase using a Sanger method or a transcription sequencing method using an RNA polymerase (for example, disclosed in WO96 / 14434) ) Can be used. In each method, the base sequence is determined from the base at the terminal of the reaction product obtained in the presence of a terminator that terminates the chain elongation by the polymerase and the length of the chain. The nucleotide sequence can be determined, for example, by forming a nucleic acid transcript of double-stranded DNA in the presence of a nucleic acid transcription terminator and analyzing the obtained nucleic acid transcript. An RNA polymerase or the like can be used as the enzyme that catalyzes the nucleic acid transcription. In particular, the transcription sequencing method using RNA polymerase is preferable because the product amplified by PCR can be sequenced without purification, and can be sequenced at high speed with a small amount of sample.

The transcription sequencing method includes, for example, ATP, GTP, and the like in the presence of an RNA polymerase and a DNA fragment containing a promoter sequence for the RNA polymerase.
Ribonucleoside 5 'triphosphates consisting of CTP and UTP or their derivatives and 3' dATP, 3 'dGT
P, 3 ′ dCTP, 3 ′ dUTP and one or more of their derivatives
Reaction of two or more 3 'deoxyribonucleoside 5' triphosphates (3 'dNTPs) to obtain a nucleic acid transcription product, separating the resulting nucleic acid transcription product, and reading the nucleic acid sequence from the resulting separated fraction This is a method for determining the nucleotide sequence of DNA. The DNA fragment (double-stranded DNA) serving as a template contains a promoter sequence for the RNA polymerase. Further, a wild-type RNA polymerase can be used as the RNA polymerase. Alternatively, the ability to incorporate 3'dNTP derivatives
(Compared to the ability of the corresponding wild-type RNA polymerase)
A mutant RNA polymerase consisting of a wild-type RNA polymerase in which at least one amino acid has been modified so as to increase it can also be used.

In the nucleotide sequence determination method of the present invention, a double-stranded DNA from which a part or all of the homopolymer portion which hinders sequence reading is removed is used as a template, so that the accuracy of nucleotide sequence determination is improved. Can be done.

[0030]

The present invention will be further described with reference to the following examples. Example 1 Among class IIS restriction enzymes, BbvI (GCAGC 8/12), HgaI
(GACGC 5/10), BsmFI (GGGAC10 / 14), SfaNI (GCATC 5 /
9), an oligodeoxynucleoside 50mer containing each recognition site of BspMI (ACCTGC 4/8) (in parentheses indicates a recognition site and a cleavage site): 5'-GAGAGAGG
GACGCAGCGACGCGCATCAACCTGCG
AGAGAGAGAGAGAGAGA (oligoI) and its complementary strand (oligoII) are prepared (Espec Oligo). Methylated oligoI (m-oligoI) and methylated oligoII (m-oligoI)
goII) (Espec Oligo). These oligomers are prepared by polyacrylamide gel electrophoresis (Sambro
ok, J. Fritsch, EF and Maniatis, T. MolecularCl
oning. A Laboratory Manual 2nd Ed. 1989, Cold Sprin
g Harbor Laboratory). RI labeling and annealing: DNA 5 'end labeling kit with T4 polynucleotide kinase (Takara MEGALABEL)
Using γ-32P-ATP (Amersham), two types of oligomers are labeled and annealed. Reaction liquid 20μ
10 μg of each of the two kinds of oligomers in the following combination is added to each of them, and reacted at 37 ° C. for 1 hour. 1) o as a combination
ligoI + oligoII, 2) m-oligoI + oligoII, 3) oligoI + m-ol
igoII, 4) m-oligoI + m-oligoII. After the reaction, heat treatment was performed at 65 ° C for 20 minutes to inactivate the kinase.
After 20 minutes at 45 ° C., the mixture was gradually cooled at 37 ° C., and the double-stranded oligomer was recovered by a spin column.

Next, 5 kinds of class IIS restriction enzymes (BbvI, HgaI, BsmFI,
0.5 unit or 5 units of SfaNI and BspMI (both manufactured by New England Biolabs), and added at 37 ° C
Perform restriction enzyme treatment for 1 hour (reaction solution 20 μl, reaction composition other than enzymes and oligomers follows the prescription attached to New England Biolabs), apply 3 μl to polyacrylamide gel electrophoresis, and band using Bio Imaging Analyzer BAS2000. Detected.

As a result, as shown in FIG. 1, for BbvI, the oligomer was not cleaved in lanes 3 to 8,
Sensitive to methylation, including hemimethylation. Regarding HgaI, the oligomer was not cleaved in lane 1, but was cleaved in lane 2 and acted as a restriction enzyme by adjusting the concentration of HgaI, but in lanes 3 to 8, no oligomer was cleaved. It is sensitive to methylation, including hemimethylation. However,
Regarding BspMI, none of the oligomers in lanes 1 to 8 were cleaved, and it was found that the oligomer did not work as a restriction enzyme under the conditions of this example. For BsmFI and SfaNI, the oligomers in lanes 1 and 2 were cleaved, and the hemimethylated oligomer in lane 4 was further cleaved, indicating that they were not completely sensitive to hemimethylation.

Thus, BbvI, BsmFI, HgaI, and SfaNI
The homopolymer existing at the end of at least the double-stranded DNA can be partially or wholly cut off by using the method. However, if the double-stranded DNA contains a class IIS restriction enzyme recognition site, the restriction enzyme may also cut the double-stranded DNA. Need to protect strand DNA. Therefore, double-stranded DNA
When treating the hemimethylated double-stranded DNA to protect the portion from cleavage, the double-stranded DNA is cleaved by using BbvI and HgaI, which were shown to be hemimethylation-sensitive in the above experiment. A part or all of the homopolymer part at the terminal can be cut off without performing.
Although detailed experimental results are not shown, it can be seen that even if GsuI is used instead of BbvI and HgaI, part or all of the homopolymer portion at the end can be cut off without cutting the double-stranded DNA. confirmed.

For example, by preparing a full-length cDNA library as described below, the nucleotide sequence of this cDNA library can be determined more quickly and accurately. That is, as shown in the above scheme, BbvI, HgaI, GsuI
Full-length chain with a restriction enzyme site introduced at the end of the homopolymer
After preparing cDNA and treating it with a restriction enzyme such as BbvI, HgaI or GsuI to remove a homopolymer, a linker required for cloning is connected to prepare a full-length cDNA library. More specifically, after treatment with a restriction enzyme such as BbvI, HgaI, or GsuI,
By ligating a linker with a protruding end such as EcoRI and cloning into an appropriate vector,
A full-length cDNA library can be created. Or BbvI
After treatment with a restriction enzyme such as HgaI or GsuI, the protruding end formed by the restriction enzyme treatment is blunt-ended with S1 nuclease or the like, and then a linker such as EcoRI having a protruding end at the blunt end is ligated to obtain an appropriate By cloning into a vector, a full-length cDNA library can also be prepared.

[0035]

According to the present invention, the base sequence of a cDNA clone can be accurately determined by removing a part or all of a homopolymer existing at a DNA end.

[Brief description of the drawings]

FIG. 1. Double-stranded oligodeoxynucleoside 50mer
Is a gel electrophoresis pattern treated with a restriction enzyme. BbvI, BsmFI, BspMI, HgaI, and SfaNI were used as restriction enzymes. The concentrations used were 0,0 for lanes 1, 3, 5, and 7.
Five units and five units for lanes 2, 4, 6, and 8. As a double-chain oligomer, lane 1,
2 is oligoI + oligoII, lanes 3 and 4 are m-oligoI + oli
In goII, lanes 5 and 6, oligoI + m-oligoII, lane 7,
In Example 8, 100 ng of m-oligoI + m-oligoII was used. A, B,
C and D are double-stranded oligodeoxynucleosides oligoI + oligoII and m-oligoI + oligoI when not treated with restriction enzymes, respectively.
The migration positions of I, oligoI + m-oligoII and m-oligoI + m-oligoII are shown.

Claims (18)

[Claims] (1) having a homopolymer portion at one or both ends;
A method for preparing a double-stranded DNA, comprising: causing a restriction enzyme having a cleavage site in addition to a recognition site to act on the single-stranded DNA to remove at least one part or all of the homopolymer portion. 2. The method according to claim 1, wherein the double-stranded DNA is a double-stranded cDNA. 3. Double-stranded cD in which double-stranded DNA is artificially modified.
The method according to claim 1, which is NA or chemically synthesized double-stranded DNA. 4. The method according to claim 1, wherein the homopolymer portion comprises a homopolymer and a non-homopolymer, and at least a part of the non-homopolymer is a recognition site for the restriction enzyme. 5. The method according to claim 1, wherein the homopolymer contained in the homopolymer portion of the double-stranded DNA is an oligo dG: dC pair or an oligo dA: dT pair. 6. The method according to claim 1, wherein the restriction enzyme is a class IIS restriction enzyme. 7. The class IIS restriction enzyme is AlwI, AlwXI, Alw
26I, BbsI, BbvI, BbvII, BcefI, BccI, BcgI, BciVI,
BinI, BmrI, BpmI, BsaI, BseRI, BsgI, BsmAI, BsmB
I, BspMI, BsrDI, BstF5I, EarI, Eco31I, Eco57I, Esp
3I, FauI, FokI, GsuI, HgaI, HinGUII, HphI, Ksp632
I, MboII, MmeI, Mn1I, NgoVIII, PleI, RleAI, SapI,
SfaNI, TaqII, Tth111II, BsmI, BsrI, BsmFI and BseMI
The method according to claim 6, which is at least one restriction enzyme selected from the group consisting of I. 8. The method according to claim 1, wherein a part of one strand of the double-stranded DNA other than the homopolymer portion has a chemical modification. 9. The method according to claim 8, wherein the chemical modification is a methyl group. 10. The method according to claim 8, wherein the chemical modification is introduced into cytosine or adenine. 11. The method according to claim 8, wherein the restriction enzyme does not act on a double-stranded DNA having a chemical modification at a recognition site or a cleavage site. 12. The method according to claim 11, wherein the restriction enzyme does not act on a double-stranded DNA site having a methyl group as a chemical modification. 13. The method according to claim 12, wherein the restriction enzyme is BbvI, HgaI or GsuI.
13. The method according to claim 12, wherein 14. A method for determining a base sequence of a double-stranded DNA by using one or both of the double-stranded DNAs as a template, wherein the double-stranded DNA serving as the template is any one of the above-described ones. 3. A method for determining a nucleotide sequence, which is a double-stranded DNA prepared by the method according to claim 1. 15. The method according to claim 14, wherein the prepared double strand is amplified by a PCR method or using a microorganism, and then the nucleotide sequence is determined using the amplified double-stranded DNA as a template. 16. The prepared double strand is obtained by removing part or all of oligo dG: dC.
5. The method according to 5. 17. The method according to claim 17, wherein the determination of the base sequence comprises forming a nucleic acid transcript of the double-stranded DNA in the presence of a nucleic acid transcription terminator;
The method according to any one of claims 14 to 16, which is performed by analyzing the obtained nucleic acid transcript. 18. The method according to claim 17, wherein the nucleic acid transcription is performed using an RNA polymerase.